DOCSLIB.ORG

Transcriptional Regulation of Cancer Genes in the Xiphophorus

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Transcriptional Regulation of Cancer Genes in the Xiphophorus Transcriptional regulation of cancer genes in the Xiphophorus melanoma system Dissertation zur Erlangung des naturwissenschaftlichen Doktorgrades der Julius-Maximilians-Universität Würzburg vorgelegt von Janine Regneri aus Herdecke Würzburg 2013 Eingereicht am: ....................................................................................................................... Mitglieder der Promotionskommission: Vorsitzender: .......................................................................................................................... Gutachter : .............................................................................................................................. Gutachter: ............................................................................................................................... Tag des Promotionskolloquiums: ............................................................................................. Doktorurkunde ausgehändigt am: ............................................................................................ Eidesstattliche Erklärung Gemäß §4, Abs. 3, Ziff. 3, 5 und 8 der Promotionsordnung der Fakultät für Biologie der Bayerischen Julius-Maximilians-Universität Würzburg Hiermit erkläre ich ehrenwörtlich, dass ich die vorliegende Dissertation selbständig angefertigt und keine anderen als die angegebenen Quellen und Hilfsmittel verwendet habe. Ich erkläre weiterhin, dass die vorliegende Dissertation weder in gleicher, noch in ähnlicher Form bereits in einem anderen Prüfungsverfahren vorgelegen hat. Weiterhin erkläre ich, dass ich außer den mit dem Zulassungsantrag urkundlich vorgelegten Graden keine weiteren akademischen Grade erworben oder zu erwerben versucht habe. Würzburg, Juni 2013 ________________________________________ Janine Regneri Table of contents Abstract ...................................................................................................................................... 1 Zusammenfassung ...................................................................................................................... 3 Introduction ................................................................................................................................ 5 The Xiphophorus melanoma model ........................................................................................ 5 The xmrk oncogene ................................................................................................................. 7 Activating mutations in the Xmrk receptor......................................................................... 7 Oncogenic signaling of Xmrk ............................................................................................. 8 Control of xmrk expression ................................................................................................. 9 Genomic organization of the Tu locus .................................................................................. 11 Different mdl-xmrk allele combinations ........................................................................... 12 The R locus ........................................................................................................................... 14 Aim of the thesis ................................................................................................................... 16 Materials and methods ............................................................................................................. 17 Cell culture ........................................................................................................................... 17 Experimental animals ........................................................................................................... 17 RNA isolation, reverse transcription and expression analysis.............................................. 19 Protein isolation and Western blot analysis .......................................................................... 21 Generation of BAC reporter constructs ................................................................................ 22 Luciferase assay .................................................................................................................... 25 Preparation of gDNA, PCR and sequencing ........................................................................ 25 Phylogenetic analysis ........................................................................................................... 27 Comparative analysis of genomic sequences ....................................................................... 27 Results ...................................................................................................................................... 28 Analysis of the transcriptional regulation of different mdl-xmrk allele combinations ......... 28 Expression of the proto-oncogene egfrb in adult tissues of X. maculatus and X. hellerii 28 Expression of the tumorigenic mdl Sd -xmrk B allele ............................................................ 30 Expression of the proto-oncogene egfrb in xmrk B-expressing tissues of the black pigment cell lineage ........................................................................................................................ 35 Expression of the non-tumorigenic mdl Sr -xmrk A allele ..................................................... 36 Expression of Sr’’ and DrLi (mut) mutant alleles ............................................................ 39 Comparison of mdl Sr -xmrk A and mdl Sd -xmrk B expression in gills of X. maculatus and backcross hybrids .............................................................................................................. 41 Structural analysis of the proximal 5’ region of different mdl-xmrk alleles ..................... 42 Comparative structural analysis of the mdl Sr -xmrk A and mdl Sd -xmrk B genomic regions .. 43 Transcriptional activity of mdl Sr -xmrk A and mdl Sd -xmrk B reporter constructs .................. 48 Analysis of a deletion series of the mdl Sd -xmrk B reporter construct ................................. 51 Analysis of candidates for the R locus-encoded gene .......................................................... 54 mtap ................................................................................................................................... 55 pdcd4a ............................................................................................................................... 57 cxxc4 ................................................................................................................................. 58 cdkn2ab ............................................................................................................................. 59 Discussion ................................................................................................................................ 63 Transcriptional regulation of mdl-xmrk allele combinations ................................................ 63 Functional and structural characterization of the putative xmrk promoter region ................ 70 Analysis of R locus candidate genes ..................................................................................... 75 Perspectives .......................................................................................................................... 80 Appendix .................................................................................................................................. 81 Bibliography ............................................................................................................................. 94 Acknowledgments .................................................................................................................. 104 Abstract 1 Abstract The Xiphophorus melanoma system is a useful animal model for the study of the genetic basis of tumor formation. The development of hereditary melanomas in interspecific hybrids of Xiphophorus is connected to pigment cell specific overexpression of the mutationally activated receptor tyrosine kinase Xmrk. In purebred fish the oncogenic function of xmrk is suppressed by the molecularly still unidentified locus R. The xmrk oncogene was generated by a gene duplication event from the Xiphophorus egfrb gene and thereby has acquired a new 5’ regulatory sequence, which has probably altered the transcriptional control of the oncogene. So far, the xmrk promoter region was still poorly characterized and the molecular mechanism by which R controls xmrk -induced melanoma formation in Xiphophorus still remained to be elucidated. To test the hypothesis that R controls melanoma development in Xiphophorus on the transcriptional level, the first aim of the thesis was to gain a deeper insight into the transcriptional regulation of the xmrk oncogene. To this end, a quantitative analysis of xmrk transcript levels in different Xiphophorus genotypes carrying either the highly tumorigenic xmrk B or the non-tumorigenic xmrk A allele was performed. I was able to demonstrate that expression of the tumorigenic xmrk B allele is strongly increased in malignant melanomas of R-free backcross hybrids compared to benign lesions, macromelanophore spots, and healthy skin. The expression level of the non-tumorigenic xmrk A allele, in contrast, is not influenced by the presence or absence of R. These findings strongly indicate that differential transcriptional regulation of
Load more

Recommended publications
  • Strong Reproductive Skew Among Males in the Multiply Mated Swordtail Xiphophorus Multilineatus (Teleostei)
    Journal of Heredity 2005:96(4):346–355 ª The American Genetic Association. 2005. All rights reserved. doi:10.1093/jhered/esi042 For Permissions, please email: [email protected]. Advance Access publication March 2, 2005 Strong Reproductive Skew Among Males in the Multiply Mated Swordtail Xiphophorus multilineatus (Teleostei) J. LUO,M.SANETRA,M.SCHARTL, AND A. MEYER From Fachbereich Biologie, Universita¨t Konstanz, 78457 Konstanz, Germany (Luo, Sanetra, and Meyer); and Physiologische Chemie I, Biozentrum der Universita¨t, Am Hubland, 97074 Wu¨rzburg, Germany (Schartl). Address correspondence to Axel Meyer, Fachbereich Biologie, Universita¨t Konstanz, Fach M617, Universita¨tsstrasse 10, 78457 Konstanz, Germany, or e-mail: [email protected]. Abstract Male swordtails in the genus Xiphophorus display a conspicuous ventral elongation of the caudal fin, the sword, which arose through sexual selection due to female preference. Females mate regularly and are able to store sperm for at least 6 months. If multiple mating is frequent, this would raise the intriguing question about the role of female choice and male-male competition in shaping the mating system of these fishes. Size-dependent alternate mating strategies occur in Xiphophorus; one such strategy is courtship with a sigmoid display by large dominant males, while the other is gonopodial thrusting, in which small subordinate males sneak copulations. Using microsatellite markers, we observed a frequency of multiple paternity in wild-caught Xiphophorus multilineatus in 28% of families analyzed, but the actual frequency of multiple mating suggested by the correction factor PrDM was 33%. The number of fathers contributing genetically to the brood ranged from one to three.
    [Show full text]
  • The Evolution of the Placenta Drives a Shift in Sexual Selection in Livebearing Fish
    LETTER doi:10.1038/nature13451 The evolution of the placenta drives a shift in sexual selection in livebearing fish B. J. A. Pollux1,2, R. W. Meredith1,3, M. S. Springer1, T. Garland1 & D. N. Reznick1 The evolution of the placenta from a non-placental ancestor causes a species produce large, ‘costly’ (that is, fully provisioned) eggs5,6, gaining shift of maternal investment from pre- to post-fertilization, creating most reproductive benefits by carefully selecting suitable mates based a venue for parent–offspring conflicts during pregnancy1–4. Theory on phenotype or behaviour2. These females, however, run the risk of mat- predicts that the rise of these conflicts should drive a shift from a ing with genetically inferior (for example, closely related or dishonestly reliance on pre-copulatory female mate choice to polyandry in conjunc- signalling) males, because genetically incompatible males are generally tion with post-zygotic mechanisms of sexual selection2. This hypoth- not discernable at the phenotypic level10. Placental females may reduce esis has not yet been empirically tested. Here we apply comparative these risks by producing tiny, inexpensive eggs and creating large mixed- methods to test a key prediction of this hypothesis, which is that the paternity litters by mating with multiple males. They may then rely on evolution of placentation is associated with reduced pre-copulatory the expression of the paternal genomes to induce differential patterns of female mate choice. We exploit a unique quality of the livebearing fish post-zygotic maternal investment among the embryos and, in extreme family Poeciliidae: placentas have repeatedly evolved or been lost, cases, divert resources from genetically defective (incompatible) to viable creating diversity among closely related lineages in the presence or embryos1–4,6,11.
    [Show full text]
  • Comprehensive Phylogenetic Analysis of All Species of Swordtails and Platies (Pisces: Genus Xiphophorus) Uncovers a Hybrid Origi
    Kang et al. BMC Evolutionary Biology 2013, 13:25 http://www.biomedcentral.com/1471-2148/13/25 RESEARCH ARTICLE Open Access Comprehensive phylogenetic analysis of all species of swordtails and platies (Pisces: Genus Xiphophorus) uncovers a hybrid origin of a swordtail fish, Xiphophorus monticolus, and demonstrates that the sexually selected sword originated in the ancestral lineage of the genus, but was lost again secondarily Ji Hyoun Kang1,2, Manfred Schartl3, Ronald B Walter4 and Axel Meyer1,2* Abstract Background: Males in some species of the genus Xiphophorus, small freshwater fishes from Meso-America, have an extended caudal fin, or sword – hence their common name “swordtails”. Longer swords are preferred by females from both sworded and – surprisingly also, non-sworded (platyfish) species that belong to the same genus. Swordtails have been studied widely as models in research on sexual selection. Specifically, the pre-existing bias hypothesis was interpreted to best explain the observed bias of females in presumed ancestral lineages of swordless species that show a preference for assumed derived males with swords over their conspecific swordless males. However, many of the phylogenetic relationships within this genus still remained unresolved. Here we construct a comprehensive molecular phylogeny of all 26 known Xiphophorus species, including the four recently described species (X. kallmani, X. mayae, X. mixei and X. monticolus). We use two mitochondrial and six new nuclear markers in an effort to increase the understanding of the evolutionary relationships among the species in this genus. Based on the phylogeny, the evolutionary history and character state evolution of the sword was reconstructed and found to have originated in the common ancestral lineage of the genus Xiphophorus and that it was lost again secondarily.
    [Show full text]
  • The Phylogenetic Distribution of a Female Preference
    University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Faculty Publications in the Biological Sciences Papers in the Biological Sciences 1996 The Phylogenetic Distribution of a Female Preference Alexandra Basolo University of Nebraska - Lincoln, [email protected] Follow this and additional works at: https://digitalcommons.unl.edu/bioscifacpub Part of the Life Sciences Commons Basolo, Alexandra, "The Phylogenetic Distribution of a Female Preference" (1996). Faculty Publications in the Biological Sciences. 45. https://digitalcommons.unl.edu/bioscifacpub/45 This Article is brought to you for free and open access by the Papers in the Biological Sciences at DigitalCommons@University of Nebraska - Lincoln. It has been accepted for inclusion in Faculty Publications in the Biological Sciences by an authorized administrator of DigitalCommons@University of Nebraska - Lincoln. Syst. Biol. 45(3):290-307, 1996 THE PHYLOGENETIC DISTRIBUTION OF A FEMALE PREFERENCE ALEXANDRA L. BASOLO Nebraska Behavioral Biobgy Group, University of Nebraska, Lincoln, Nebraska 68510, USA; E-mail: [email protected] Abstract.—Robust phylogenetic information can be instrumental to the study of the evolution of female mating preferences and preferred male traits. In this paper, the evolution of a preexisting female bias favoring a sword in male swordtail fish and the evolution of the sword, a complex character, are used to demonstrate how the evolution of mating preferences and preferred traits can be examined in a phylogenetic context. Phylogenetic information suggests that a preference for a sword arose prior to the evolution of the sword in the genus Xiphophorus and that the sword was adaptive at its origin. A phylogenetic approach to the study of female preferences and male traits can also be informative when used in conjunction with mate choice theory in making predictions about evolutionary changes in an initial bias, both prior to the appearance of the male trait it favors and subsequent to the appearance of the trait.
    [Show full text]
  • Male Competition in the Evolution of Aggression
    A COMPARATIVE ANALYSIS OF THE ROLE OF MALE – MALE COMPETITION IN THE EVOLUTION OF AGGRESSION, VERTICAL BARS AND MALE BODY SIZE IN THE NORTHERN SWORDTAIL FISHES A dissertation presented to the faculty of the College of Arts and Sciences of Ohio University In partial fulfillment of the requirements for the degree Doctor of Philosophy Jason A. Moretz June 2004 © 2004 Jason A. Moretz All Rights Reserved This dissertation entitled A COMPARATIVE ANALYSIS OF THE ROLE OF MALE – MALE COMPETITION IN THE EVOLUTION OF AGGRESSION, VERTICAL BARS AND MALE BODY SIZE IN THE NORTHERN SWORDTAIL FISHES BY JASON A MORETZ has been approved for the Department of Biological Sciences and the College of Arts and Sciences by Molly R. Morris Associate Professor of Biology Leslie A. Flemming Dean, College of Arts and Sciences MORETZ, JASON A. Ph.D. June 2004. Biological Sciences. A Comparative Analysis of the Role of Male – Male Competition in the Evolution of Aggression, Vertical Bars and Male Body Size in the Northern Swordtail Fishes (154pp.) Director of Dissertation: Molly R. Morris This dissertation examines components of male-male competition in order to determine factors that are important in contest dynamics and outcome, as well as the evolution of particular male traits. Specifically, I use northern swordtail fishes (Pisces: Poecilliidae, genus Xiphophorus) to address the following questions: 1) What role does size play in conflict resolution; 2) How do males use the signal vertical bars in agonistic encounters; 3) What was the role of male - male communication in the evolution of the male trait vertical bars; 4) Are differences in fighting ability and aggression levels between barred and barless X.
    [Show full text]
  • Florida State Museum
    BULLETIN OF THE FLORIDA STATE MUSEUM BIOLOGICAL SCIENCES Volume 5 Number 4 MIDDLE-AMERICAN POECILIID FISHES OF THE GENUS XIPHOPHORUS Donn Eric Rosen fR \/853 UNIVERSITY OF FLORIDA Gainesville 1960 The numbers of THE BULLETIN OF THE FLORIDA STATE MUSEUM, BIOLOGICAL SCIENCES, are published at irregular intervals. Volumes contain about 300 pages and are not necessarily completed in any one calendar year. OLIVER L. AUSTIN, JR., Editor WILLIAM J. RIEMER, Managing Editor All communications concerning purchase or exchange of the publication should be addressed to the Curator of Biological Sciences, Florida State Museum, Seagle Building, Gainesville, Florida. Manuscripts should be sent to the Editor of the B ULLETIN, Flint Hall, University of Florida, Gainesville, Florida. Published 14 June 1960 Price for this issue $2.80 MIDDLE-AMERICAN POECILIID FISHES OF THE GENUS XIPHOPHORUS DONN ERIC ROSEN 1 SYNOPSiS. Drawing upon information from the present studies of the com« parative and functional morphology, distribution, and ecology of the forms of Xiphophorus (Cyprinodontiformes: R6eciliidae) and those made during the last ' quarter of a century on their. genetics, cytology, embryology, endocrinology, and ethology, the species are classified and arranged to indicate their probable phylo- genetic relationships. Their evolution and zoogeography are considered in rela- tion to a proposed center of adaptive radiation -on Mexico's Atlantic coastal plain. Five new forms are, described: X. varidtus evelynae, new subspecies; X, milleri, new specie-s; X. montezumae cortezi, new subspecies; X. pygmaeus 'nigrensis, new ' subspecies; X. heHeri aluarezi, new subspecies. To the memory of MYR6N GORDON, 1899-1959 for his quarter century of contributibns- to the biology of this and other groups of fishes.
    [Show full text]
  • GATA2 Regulates Mast Cell Identity and Responsiveness to Antigenic Stimulation by Promoting Chromatin Remodeling at Super- Enhancers
    ARTICLE https://doi.org/10.1038/s41467-020-20766-0 OPEN GATA2 regulates mast cell identity and responsiveness to antigenic stimulation by promoting chromatin remodeling at super- enhancers Yapeng Li1, Junfeng Gao 1, Mohammad Kamran1, Laura Harmacek2, Thomas Danhorn 2, Sonia M. Leach1,2, ✉ Brian P. O’Connor2, James R. Hagman 1,3 & Hua Huang 1,3 1234567890():,; Mast cells are critical effectors of allergic inflammation and protection against parasitic infections. We previously demonstrated that transcription factors GATA2 and MITF are the mast cell lineage-determining factors. However, it is unclear whether these lineage- determining factors regulate chromatin accessibility at mast cell enhancer regions. In this study, we demonstrate that GATA2 promotes chromatin accessibility at the super-enhancers of mast cell identity genes and primes both typical and super-enhancers at genes that respond to antigenic stimulation. We find that the number and densities of GATA2- but not MITF-bound sites at the super-enhancers are several folds higher than that at the typical enhancers. Our studies reveal that GATA2 promotes robust gene transcription to maintain mast cell identity and respond to antigenic stimulation by binding to super-enhancer regions with dense GATA2 binding sites available at key mast cell genes. 1 Department of Immunology and Genomic Medicine, National Jewish Health, Denver, CO 80206, USA. 2 Center for Genes, Environment and Health, National Jewish Health, Denver, CO 80206, USA. 3 Department of Immunology and Microbiology, University of Colorado Anschutz Medical Campus, Aurora, ✉ CO 80045, USA. email: [email protected] NATURE COMMUNICATIONS | (2021) 12:494 | https://doi.org/10.1038/s41467-020-20766-0 | www.nature.com/naturecommunications 1 ARTICLE NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-020-20766-0 ast cells (MCs) are critical effectors in immunity that at key MC genes.
    [Show full text]
  • CLDND1 (NM 001040183) Human Tagged ORF Clone – RC211544
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC211544 CLDND1 (NM_001040183) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: CLDND1 (NM_001040183) Human Tagged ORF Clone Tag: Myc-DDK Symbol: CLDND1 Synonyms: C3orf4; GENX-3745; Z38 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RC211544 ORF sequence Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGATAACCGTTTTGCTACAGCATTTGTAATTGCTTGTGTGCTGAGCCTCATTTCCACCATCTACATGG CAGCCTCCATTGGCACAGACTTCTGGTATGAATATCGAAGTCCAGTTCAAGAAAATTCCAGTGATTTGAA TAAAAGCATCTGGGATGAATTCATTAGTGATGAGGCAGATGAAAAGACTTATAATGATGCACTTTTTCGA TACAATGGCACAGTGGGATTGTGGAGACGGTGTATCACCATACCCAAAAACATGCATTGGTATAGCCCAC CAGAAAGGACAGAGTCATTTGATGTGGTCACAAAATGTGTGAGTTTCACACTAACTGAGCAGTTCATGGA GAAATTTGTTGATCCCGGAAACCACAATAGCGGGATTGATCTCCTTAGGACCTATCTTTGGCGTTGCCAG TTCCTTTTACCTTTTGTGAGTTTAGGTTTGATGTGCTTTGGGGCTTTGATCGGACTTTGTGCTTGCATTT GCCGAAGCTTATATCCCACCATTGCCACGGGCATTCTCCATCTCCTTGCAGGTCTGTGTACACTGGGCTC AGTAAGTTGTTATGTTGCTGGAATTGAACTACTCCACCAGAAACTAGAGCTCCCTGACAATGTATCCGGT GAATTTGGATGGTCCTTCTGCCTGGCTTGTGTCTCTGCTCCCTTACAGTTCATGGCTTCTGCTCTCTTCA TCTGGGCTGCTCACACCAACCGGAAAGAGTACACCTTAATGAAGGCATATCGTGTGGCA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA
    [Show full text]
  • On-Site Sperm Cryopreservation for Aquatic Repository Development
    Louisiana State University LSU Digital Commons LSU Master's Theses Graduate School 2017 On-site Sperm Cryopreservation for Aquatic Repository Development and User Group Linkage William Martin Childress Louisiana State University and Agricultural and Mechanical College Follow this and additional works at: https://digitalcommons.lsu.edu/gradschool_theses Part of the Environmental Sciences Commons Recommended Citation Childress, William Martin, "On-site Sperm Cryopreservation for Aquatic Repository Development and User Group Linkage" (2017). LSU Master's Theses. 4577. https://digitalcommons.lsu.edu/gradschool_theses/4577 This Thesis is brought to you for free and open access by the Graduate School at LSU Digital Commons. It has been accepted for inclusion in LSU Master's Theses by an authorized graduate school editor of LSU Digital Commons. For more information, please contact [email protected]. ON-SITE SPERM CRYOPRESERVATION FOR AQUATIC REPOSITORY DEVELOPMENT AND USER GROUP LINKAGE A Thesis Submitted to the Graduate Faculty of the Louisiana State University and Agricultural and Mechanical College in partial fulfillment of the requirements for the degree of Master of Science in The School of Renewable Natural Resources by William M. Childress B.S., University of Southern Mississippi, 2011 August 2017 Acknowledgements There are many people that have guided me and provided support along the way during this thesis. I would like to thank my major professor, Dr. Terrence Tiersch, for his guidance, mentorship, and the many opportunities to travel, conduct research, and grow both professionally and personally. I thank Dr. Edward Chesney for serving on my graduate committee and providing me with my foundation in aquaculture and research.
    [Show full text]
  • Gene Expression in Blood Reflects Smoking Exposure Among Cancer
    www.nature.com/scientificreports OPEN Gene expression in blood refects smoking exposure among cancer‑free women in the Norwegian Women and Cancer (NOWAC) postgenome cohort Nikita Baiju1*, Torkjel M. Sandanger1, Pål Sætrom2,3,4,5 & Therese H. Nøst1,5 Active smoking has been linked to modulated gene expression in blood. However, there is a need for a more thorough understanding of how quantitative measures of smoking exposure relate to diferentially expressed genes (DEGs) in whole‑blood among ever smokers. This study analysed microarray‑based gene expression profles from whole‑blood samples according to smoking status and quantitative measures of smoking exposure among cancer‑free women (n = 1708) in the Norwegian Women and Cancer postgenome cohort. When compared with never smokers and former smokers, current smokers had 911 and 1082 DEGs, respectively and their biological functions could indicate systemic impacts of smoking. LRRN3 was associated with smoking status with the lowest FDR‑adjusted p‑value. When never smokers and all former smokers were compared, no DEGs were observed, but LRRN3 was diferentially expressed when never smokers were compared with former smokers who quit smoking ≤ 10 years ago. Further, LRRN3 was positively associated with smoking intensity, pack‑years, and comprehensive smoking index score among current smokers; and negatively associated with time since cessation among former smokers. Consequently, LRRN3 expression in whole‑blood is a molecular signal of smoking exposure that could supplant self‑reported smoking data in further research targeting blood‑based markers related to the health efects of smoking. Tobacco smoking is one of the major threats to public health, and it is currently responsible for more than 8 million deaths worldwide each year 1.
    [Show full text]
  • Cldnd1 (NM 171826) Mouse Tagged ORF Clone – MR203231 | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MR203231 Cldnd1 (NM_171826) Mouse Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Cldnd1 (NM_171826) Mouse Tagged ORF Clone Tag: Myc-DDK Symbol: Cldnd1 Synonyms: 1110019C08Rik; AA407103; AI849195; AW489850; Cldn25 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin ORF Nucleotide >MR203231 ORF sequence Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGATAACCGTTTTGCTACTGCGTTTGTGATTGCTTGTGTGCTTAGTCTGATTTCCACCATCTACATGG CGGCCTCCATAGGCACGGACTTCTGGTATGAGTATCGAAGTCCCATTCAAGAGAATTCAAGTGACTCGAA TAAAATCGCCTGGGAAGATTTCCTCGGTGACGAGGCGGATGAGAAGACTTACAACGATGTTCTGTTCCGA TACAACGGCAGCTTGGGGCTGTGGAGACGGTGCATCACCATACCCAAAAACACTCACTGGTATGCGCCAC CGGAAAGGACAGAGTCATTTGATGTGGTTACCAAATGCATGAGTTTCACACTAAACGAGCAGTTCATGGA GAAGTATGTGGACCCCGGCAACCACAATAGCGGCATCGACCTGCTTCGCACCTACCTGTGGCGCTGCCAG TTCCTTTTACCCTTCGTCAGCTTGGGCTTGATGTGCTTTGGGGCGTTGATTGGCCTCTGTGCCTGTATCT GCCGCAGCCTGTATCCCACCCTCGCCACTGGCATTCTCCATCTCCTTGCAGGTCTGTGCACACTGGGCTC CGTGAGTTGCTATGTTGCCGGCATTGAACTCTTACATCAGAAAGTAGAGCTGCCCAAGGATGTATCTGGA GAATTTGGATGGTCCTTCTGCCTGGCCTGCGTCTCGGCTCCCTTACAGTTCATGGCGGCCGCTCTCTTCA TCTGGGCTGCCCACACCAACCGGAAAGAGTACACCTTAATGAAGGCTTATCGTGTGGCA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
    [Show full text]
  • Molecular Targeting and Enhancing Anticancer Efficacy of Oncolytic HSV-1 to Midkine Expressing Tumors
    University of Cincinnati Date: 12/20/2010 I, Arturo R Maldonado , hereby submit this original work as part of the requirements for the degree of Doctor of Philosophy in Developmental Biology. It is entitled: Molecular Targeting and Enhancing Anticancer Efficacy of Oncolytic HSV-1 to Midkine Expressing Tumors Student's name: Arturo R Maldonado This work and its defense approved by: Committee chair: Jeffrey Whitsett Committee member: Timothy Crombleholme, MD Committee member: Dan Wiginton, PhD Committee member: Rhonda Cardin, PhD Committee member: Tim Cripe 1297 Last Printed:1/11/2011 Document Of Defense Form Molecular Targeting and Enhancing Anticancer Efficacy of Oncolytic HSV-1 to Midkine Expressing Tumors A dissertation submitted to the Graduate School of the University of Cincinnati College of Medicine in partial fulfillment of the requirements for the degree of DOCTORATE OF PHILOSOPHY (PH.D.) in the Division of Molecular & Developmental Biology 2010 By Arturo Rafael Maldonado B.A., University of Miami, Coral Gables, Florida June 1993 M.D., New Jersey Medical School, Newark, New Jersey June 1999 Committee Chair: Jeffrey A. Whitsett, M.D. Advisor: Timothy M. Crombleholme, M.D. Timothy P. Cripe, M.D. Ph.D. Dan Wiginton, Ph.D. Rhonda D. Cardin, Ph.D. ABSTRACT Since 1999, cancer has surpassed heart disease as the number one cause of death in the US for people under the age of 85. Malignant Peripheral Nerve Sheath Tumor (MPNST), a common malignancy in patients with Neurofibromatosis, and colorectal cancer are midkine- producing tumors with high mortality rates. In vitro and preclinical xenograft models of MPNST were utilized in this dissertation to study the role of midkine (MDK), a tumor-specific gene over- expressed in these tumors and to test the efficacy of a MDK-transcriptionally targeted oncolytic HSV-1 (oHSV).
    [Show full text]