DOCSLIB.ORG

Evolution of the Beta Defensin 2 Gene in Primates

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Evolution of the Beta Defensin 2 Gene in Primates Genes and Immunity (2003) 4, 251–257 & 2003 Nature Publishing Group All rights reserved 1466-4879/03 $25.00 www.nature.com/gene Evolution of the beta defensin 2 gene in primates M Boniotto1, A Tossi2, M DelPero3, S Sgubin1, N Antcheva2, D Santon1, J Masters4 and S Crovella1 1Dipartimento di Scienze della Riproduzione e dello Sviluppo, Universita` di Trieste, Trieste, Italy; 2Dipartimento di Biochimica, Biofisica e Chimica delle Macromolecole, Universita` di Trieste, Trieste, Italy; 3Dipartimento di Biologia Animale e dell’Uomo, Universita` di Torino, Torino, Italy; 4Natal Museum, Pietermaritzburg, South Africa With the aim of further investigating the molecular evolution of beta defensin genes, after having analysed beta defensin 1 (DEFB1) in humans and several nonhuman primate species, we have studied the evolution of the beta defensin 2 gene (DEFB2), which codifies for a peptide with antimicrobial and chemoattractant activity, in humans and 16 primate species. We have found evidence of positive selection during the evolution of orthologous DEFB2 genes at two points on a phylogenetic tree relating these primates: during the divergence of the platyrrhines from the catarrhines and during the divergence of the Cercopithecidae from the Hylobatidae, Great Apes and humans. Furthermore, amino acid variations in Old World Monkeys seem to centre either on residues that are involved in oligomerisation in the human molecule, or that are conserved (40–80%) in beta-defensins in general. It is thus likely that these variations affect the biological function of the molecules and suggest that their synthesis and functional analysis might reveal interesting new information as to their role in innate immunity. Genes and Immunity (2003) 4, 251–257. doi:10.1038/sj.gene.6363958 Keywords: antimicrobial peptides; beta defensins; innate immunity; primates; nucleotide sequences; amino-acid sequences Introduction Results The human beta defensin 2 (hBD2) was originally The alignment of nucleotide sequences of the primate isolated from the skin of psoriatic patients, and was DEFB2 coding region is shown in Table 1. We calculated found to be constitutively expressed in foreskin, lung the number of synonymous nucleotide substitutions per and trachea using the RT-PCR method.1 Moreover, synonymous site (dS) and the number of nonsynon- different authors have demonstrated that the hBD2 gene ymous nucleotide substitutions per nonsynonymous is upregulated upon inflammatory stimuli and its site (dN) by pairwise comparison among the 17 primate expression can subsequently be detected in many other DEFB2 sequences (Table 2). We restricted the analysis tissues.2–5 The peptide has a broad antimicrobial activity by studying only the sequence corresponding to the ranging from Gram negative bacteria to yeasts.1 It antimicrobially active, mature DEFB2. We hypothesised appears that hBD2 kills the pathogens via an electrostatic that only this region has been subject to a positive interaction between the oligomeric form with and a selection caused by direct interaction with pathogens negatively charged microbial surface.6 It has also been and cellular receptors. We found that the dN value was demonstrated that hBD2 shows a chemoattractant higher than dS in several of the nucleotide sequence activity for immature dendritic cells and memory T cells.7 comparisons, indicating that a positive selection pressure Different genes coding for proteins involved, directly acts at the level of this region (see Table 2). or indirectly, in the innate immune response have In order to identify at which node the active portion evolved rapidly by positive selection in response to of the molecule was altered under selection, we have changes in the pathogens to which the host is exposed.8,9 computed the number of synonymous (bS) and non- In this study, we investigate the molecular evolution of synonymous (bN) substitutions for each branch of the beta defensin 2 (DEFB2) gene in humans and 16 primate phylogenetic tree depicting the evolutionary relation species. Comparisons among orthologous DEFB2 genes among the primate species under investigation. For this from several primate species give new insights into the analysis, we used a phylogenetic tree that is widely evolution of the DEFB2 gene and the relation between accepted by primatologists (Figure 1).10 Several branches the structure of the protein and its function. showed greater values of bN than bS, but bN was significantly greater than bS in branch x (Z ¼ 2.56; Po0.05) and in branch y (Z ¼ 2.75; Po 0.05). These results indicate that positive selection has acted in the lineage leading to the clade including the homind and hylobatid families. The deduced amino-acid sequences for the primate Correspondence: Dr S Crovella, Dipartimento di Scienze della Riprodu- zione e dello Sviluppo, Universita` di Trieste, Via dell’Istria, 65/1- 34100 species are reported in Figure 2. Humans and Great Apes Trieste, Italy. E-mail: [email protected] (GA) showed identical amino-acid sequences, with the DEFB2 evolution in primate M Boniotto et al 252 Table 1 Alignment of nucleotide sequences from coding region of orthologous primate DEFB2 genes HSS ATGAGGGTCTTGTATCTCCTCTTCTCGTTCCTCTTCATATTCCTGATGCCTCTTCCAGGTGTTTTTGGTGGTATAGGCGA PTR ...........................................................................A.... PPY ................................................................................ GGO ................................................................................ HMO ........GC.............T..A....C......................................A....A.GA. HCO ......................................................................A....A.GA. HLA .........C................C....C......................................A....A.GA. PME .........C............................................................A....A.GA. PCR ....A....C............................................................A....A.GA. POB ....A....C............................................................A....A.GA. MMU ....A....C..........G.................................................A....A.GA. MFA ....A....C..........G.................................................A....A.GA. PPA ....A....C............................................................A....A.GA. CAE ....A....C...................................................C.C......A....A.GA. CER ....A....C...................................................C........A....A.GA. CPR ....A....C...................................................C........A....C.GA. CJA ....A....C..........G.................................................A..C.A.GA. HSS TCCTGTTACCTGCCTTAAGAGTGGAGCCATATGTCATCCAGTCTTTTGCCCTAGAAGGTATAAACAAATTGGCACCTGTG PTR .........................................................A...................... PPY ................................................................................ GGO ................................................................................ HMO ........................T............................................C.......... HCO ........................T............................................C.......... HLA ........................T............................................C.......... PME ....A...................T................G..........C.............T..C...GT..... PCR ....A...................T................G..........G.............T..C...GT..... POB ....A...................T................G..........C.............T..C...GT..... MMU .............G...G......T..........T.....G........................T......GT..... MFA .............G...G......T..........T.....G........................T......GT..... PPA .............G...G......T..........T.....G........................T......GT..... CAE .................G......T................G........................T..C...GT..... CER .................G......T................G........................T..C...GT..... CPR .................G......T................G........................T..C..TGT..... CJA ..T.T........A..TG......T................G..........G...C.........T..C....T..... HSS GTCTCCCTGGAACAAAATGCTGCAAAAAGCCATGA PTR ................................... PPY ................................... GGO ................................... HMO ................................... HCO .......................CG.......... HLA .......................CG.......... PME ..G..T...C..T...................... PCR ..G..T...C..T...................... POB ..G..T...C..T...................... MMU ..G..T...C..T...................... MFA ..G..T...C..T...................... PPA ..G..T...C..T...................... CAE .CG..T...C..T...................... CER ..G..T...C..T...................... CPR ..G..T...C..T...................... CJA ..G.....CT..T...................... exception of a Gly3-Ser substitution in the N-terminal based on the hBD2 sequence, relating these residues region seen only in P. troglodytes. The hylobatid sequences to the secondary structure elements is also provided show very little variation with respect to the hBD2. in Figure 2. Amino-acid changes found in the gibbon Three amino acid substitutions were observed in the (Hylobatidae) sequences, with respect to the human and N-terminal region of the active peptide, while only one GA sequences, are located exclusively at the N-terminus, conservative substitution was present in the C-terminal preceding the short a-helical stretch. Cercopithecid region. The Old World Monkeys (OWM, Cercopitheci- sequence variations are more extensive and mainly dae) are characterised by very similar amino acid involve the
Load more

Recommended publications
  • LINKING INNATE and ADAPTIVE IMMUNE RESPONSES By
    HUMAN β DEFENSIN 3: LINKING INNATE AND ADAPTIVE IMMUNE RESPONSES By: NICHOLAS FUNDERBURG Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Advisors: Michael Lederman, MD. Scott Sieg, PhD. Department of Molecular Biology and Microbiology CASE WESTERN RESERVE UNIVERSITY January 2008 CASE WESTERN RESERVE UNIVERSITY SCHOOL OF GRADUATE STUDIES We hereby approve the dissertation of ______________Nicholas Funderburg_____________________ candidate for the Ph.D. degree *. (signed)_________David McDonald______________________ (chair of the committee) ______________Michael Lederman__________________ ____ _Scott Sieg________________________ ________Aaron Weinberg___________________ Thomas McCormick___ __________ ________________________________________________ (date) _____7-17-07__________________ *We also certify that written approval has been obtained for any proprietary material contained therein. 2 Table of Contents Table of Contents 3 List of Tables 7 List of Figures 8 Acknowledgements 11 Abstract 12 Chapter 1: Introduction 14 Innate Immunity 17 Antimicrobial Activity of Beta Defensins 19 Human Defensins: Structure and Expression 21 Linking Innate and Adaptive Immune Responses 23 HBDs in HIV Infection 25 Summary of Thesis Work 26 Chapter 2: Human β defensin-3 activates professional antigen-presenting cells via Toll-like Receptors 1 and 2 31 Summary 32 Introduction 33 3 Results 35 HBD-3 induces co-stimulatory molecule expression on APC 35 HBD-3 activation of monocytes occurs through the signaling molecules MyD88 and IRAK-1 36 HBD-3 requires expression of TLR1 and 2 for cellular activation 37 Discussion 40 Materials and Methods 43 Reagents 43 Primary cells and culture conditions 44 HEK293 cell transfectants 44 Flow Cytometry 44 Western Blots 45 TLR Ligand Screening 45 Murine macrophage studies 45 CHO Cell experiments 46 Statistical Methods 46 Acknowledgments 47 Chapter 3: Induction of Surface Molecules and Inflammatory Cytokines by HBD-3 and Pam3CSK4 are regulated differentially by the MAP Kinase Pathways.
    [Show full text]
  • Bacterial Interactions with Cells of the Intestinal Mucosa: Toll- 1182 Like Receptors and Nod2
    Recent advances in basic science BACTERIAL INTERACTIONS WITH CELLS OF THE INTESTINAL MUCOSA: TOLL- 1182 LIKE RECEPTORS AND NOD2 ECario Gut: first published as on 11 July 2005. Downloaded from Gut 2005;54:1182–1193. doi: 10.1136/gut.2004.062794 SUMMARY Toll-like receptors (TLR) and NOD2 are emerging as key mediators of innate host defence in the intestinal mucosa, crucially involved in maintaining mucosal as well as commensal homeostasis. Recent observations suggest new (patho-) physiological mechanisms of how functional versus dysfunctional TLRx/NOD2 pathways may oppose or favour inflammatory bowel disease (IBD). In Published online first 19 April 2005 health, TLRx signalling protects the intestinal epithelial barrier and confers commensal tolerance whereas NOD2 signalling exerts antimicrobial activity and prevents pathogenic invasion. In disease, aberrant TLRx and/or NOD2 signalling may stimulate diverse inflammatory responses leading to acute and chronic intestinal inflammation with many different clinical phenotypes. c INTRODUCTION The intestinal mucosa must rapidly recognise detrimental pathogenic threats to the lumen to initiate controlled immune responses but maintain hyporesponsiveness to omnipresent harmless commensals. Charles Janeway Jr first suggested that so-called pattern recognition receptors (PRRs) may play an essential role in allowing innate immune cells to discriminate between ‘‘self’’ http://gut.bmj.com/ and microbial ‘‘non-self’’ based on the recognition of broadly conserved molecular patterns.1 Toll- like receptors (TLRs) which comprise a class of transmembrane PRRs play a key role in microbial recognition, induction of antimicrobial genes, and the control of adaptive immune responses. NODs (NOD1 and NOD2) are a structurally distinct family of intracellular PRRs which presumably in the context of microbial invasion subserve similar functions (fig 1).
    [Show full text]
  • Endogenous Production of Antimicrobial Peptides in Innate Immunity and Human Disease Richard L
    Endogenous Production of Antimicrobial Peptides in Innate Immunity and Human Disease Richard L. Gallo, MD, PhD, and Victor Nizet, MD Address The definition of an AMP has been loosely applied to Departments of Medicine and Pediatrics, Division of Dermatology, Uni- any peptide with the capacity to inhibit the growth of versity of California San Diego, and VA San Diego Healthcare System, microbes. AMPs might exhibit potent killing or inhibi- San Diego, CA, USA. E-mail: [email protected] tion of a broad range of microorganisms, including gram- positive and -negative bacteria as well as fungi and certain Current Allergy and Asthma Reports 2003, 3:402–409 Current Science Inc. ISSN 1529-7322 viruses. More than 800 such AMPs have been described, Copyright © 2003 by Current Science Inc. and an updated list can be found at the website: http:// www.bbcm.units.it/~tossi/pag1.htm. Some of these AMPs Antimicrobial peptides are diverse and evolutionarily ancient have now been demonstrated to protect diverse organ- molecules produced by all living organisms. Peptides belong- isms, including plants, insects, and mammals, against ing to the cathelicidin and defensin gene families exhibit an infection. AMP sequence analysis has shown that the pep- immune strategy as they defend against infection by inhibiting tide immune system is evolutionarily ancient, and the microbial survival, and modify hosts through triggering tis- conservation of AMP gene families throughout the ani- sue-specific defense and repair events. A variety of processes mal kingdom further supports their biologic significance. have evolved in microbes to evade the action of antimicrobial Antimicrobial peptides function within the conceptual peptides, including the ability to degrade or inactivate antimi- framework of the innate immune system.
    [Show full text]
  • Immuno-Stimulatory Peptides As a Potential Adjunct Therapy Against Intra-Macrophagic Pathogens
    molecules Review Immuno-Stimulatory Peptides as a Potential Adjunct Therapy against Intra-Macrophagic Pathogens Tânia Silva 1,2 and Maria Salomé Gomes 1,2,3,* ID 1 i3S—Instituto de Investigação e Inovação em Saúde, Universidade do Porto, Porto 4200-135, Portugal; [email protected] 2 IBMC—Instituto de Biologia Molecular e Celular, Universidade do Porto, Porto 4200-135, Portugal 3 ICBAS—Instituto de Ciências Biomédicas Abel Salazar, Universidade do Porto, Porto 4050-313, Portugal * Correspondence: [email protected]; Tel.: +35-122-607-4950 Received: 14 July 2017; Accepted: 3 August 2017; Published: 4 August 2017 Abstract: The treatment of infectious diseases is increasingly prone to failure due to the rapid spread of antibiotic-resistant pathogens. Antimicrobial peptides (AMPs) are natural components of the innate immune system of most living organisms. Their capacity to kill microbes through multiple mechanisms makes the development of bacterial resistance less likely. Additionally, AMPs have important immunomodulatory effects, which critically contribute to their role in host defense. In this paper, we review the most recent evidence for the importance of AMPs in host defense against intracellular pathogens, particularly intra-macrophagic pathogens, such as mycobacteria. Cathelicidins and defensins are reviewed in more detail, due to the abundance of studies on these molecules. The cell-intrinsic as well as the systemic immune-related effects of the different AMPs are discussed. In the face of the strong potential emerging from the reviewed studies, the prospects for future use of AMPs as part of the therapeutic armamentarium against infectious diseases are presented. Keywords: antimicrobial peptide; host-defense peptide; infection; Mycobacterium; defensin; cathelicidin; macrophage 1.
    [Show full text]
  • Structure, Function, and Evolution of Gga-Avbd11, the Archetype of the Structural Avian-Double- Β-Defensin Family
    Structure, function, and evolution of Gga-AvBD11, the archetype of the structural avian-double- β-defensin family Nicolas Guyota, Hervé Meudalb, Sascha Trappc, Sophie Iochmannd, Anne Silvestrec, Guillaume Joussetb, Valérie Labase,f, Pascale Reverdiaud, Karine Lothb,g, Virginie Hervéd, Vincent Aucagneb, Agnès F. Delmasb, Sophie Rehault-Godberta,1, and Céline Landonb,1 aBiologie des Oiseaux et Aviculture, Institut National de la Recherche Agronomique, Université de Tours, 37380 Nouzilly, France; bCentre de Biophysique Moléculaire, CNRS, 45071 Orléans, France; cInfectiologie et Santé Publique, Institut National de la Recherche Agronomique, Université de Tours, 37380 Nouzilly, France; dCentre d’Etude des Pathologies Respiratoires, INSERM, Université de Tours, 37032 Tours, France; ePhysiologie de la Reproduction et des Comportements, Institut National de la Recherche Agronomique, CNRS, Institut Français du Cheval et de l’Equitation, Université de Tours 37380 Nouzilly, France; fPôle d’Analyse et d’Imagerie des Biomolécules, Chirurgie et Imagerie pour la Recherche et l’Enseignement, Institut National de la Recherche Agronomique, Centre Hospitalier Régional Universitaire, Université de Tours, 37380 Nouzilly, France; and gUnité de Formation et de Recherche Sciences et Techniques, Université d’Orléans, 45100 Orléans, France Edited by Akiko Iwasaki, Yale University, New Haven, CT, and approved November 26, 2019 (received for review July 26, 2019) Outofthe14avianβ-defensins identified in the Gallus gallus genome, The sequence of Gga-AvBD11 contains 2 predicted β-defensin only 3 are present in the chicken egg, including the egg-specific avian motifs (Fig. 1) (7) and represents the sole double-sized defensin β-defensin 11 (Gga-AvBD11). Given its specific localization and its (9.3 kDa) among all 14 AvBDs reported in the chicken species.
    [Show full text]
  • Antimicrobial Human Β-Defensins in the Colon and Their Role in Infectious and Non-Infectious Diseases
    Pathogens 2013, 2, 177-192; doi:10.3390/pathogens2010177 OPEN ACCESS pathogens ISSN 2076-0817 www.mdpi.com/journal/pathogens Review Antimicrobial Human β-Defensins in the Colon and Their Role in Infectious and Non-Infectious Diseases Eduardo R. Cobo and Kris Chadee * Department of Microbiology, Immunology and Infectious Diseases, Gastrointestinal Research Group, Snyder Institute for Chronic Diseases, Faculty of Medicine, University of Calgary, 3330 Hospital Drive NW, Calgary, Alberta T2N 4N1, Canada; E-Mail: [email protected] * Author to who correspondence should be addressed; E-Mail: [email protected]; Tel: +1-403-210-3975; Fax: +1-403-270-2772. Received: 11 January 2013; in revised form: 1 March 2013 / Accepted: 10 March 2013 / Published: 19 March 2013 Abstract: β-defensins are small cationic antimicrobial peptides secreted by diverse cell types including colonic epithelial cells. Human β-defensins form an essential component of the intestinal lumen in innate immunity. The defensive mechanisms of β-defensins include binding to negatively charged microbial membranes that cause cell death and chemoattraction of immune cells. The antimicrobial activity of β-defensin is well reported in vitro against several enteric pathogens and in non-infectious processes such as inflammatory bowel diseases, which alters β-defensin production. However, the role of β-defensin in vivo in its interaction with other immune components in host defense against bacteria, viruses and parasites with more complex membranes is still not well known. This review focuses on the latest findings regarding the role of β-defensin in relevant human infectious and non-infectious diseases of the colonic mucosa.
    [Show full text]
  • Expression and Function of Host Defense Peptides at Inflammation
    International Journal of Molecular Sciences Review Expression and Function of Host Defense Peptides at Inflammation Sites Suhanya V. Prasad, Krzysztof Fiedoruk , Tamara Daniluk, Ewelina Piktel and Robert Bucki * Department of Medical Microbiology and Nanobiomedical Engineering, Medical University of Bialystok, Mickiewicza 2c, Bialystok 15-222, Poland; [email protected] (S.V.P.); krzysztof.fi[email protected] (K.F.); [email protected] (T.D.); [email protected] (E.P.) * Correspondence: [email protected]; Tel.: +48-85-7485483 Received: 12 November 2019; Accepted: 19 December 2019; Published: 22 December 2019 Abstract: There is a growing interest in the complex role of host defense peptides (HDPs) in the pathophysiology of several immune-mediated inflammatory diseases. The physicochemical properties and selective interaction of HDPs with various receptors define their immunomodulatory effects. However, it is quite challenging to understand their function because some HDPs play opposing pro-inflammatory and anti-inflammatory roles, depending on their expression level within the site of inflammation. While it is known that HDPs maintain constitutive host protection against invading microorganisms, the inducible nature of HDPs in various cells and tissues is an important aspect of the molecular events of inflammation. This review outlines the biological functions and emerging roles of HDPs in different inflammatory conditions. We further discuss the current data on the clinical relevance of impaired HDPs expression in inflammation and selected diseases. Keywords: host defense peptides; human antimicrobial peptides; defensins; cathelicidins; inflammation; anti-inflammatory; pro-inflammatory 1. Introduction The human body is in a constant state of conflict with the unseen microbial world that threatens to disrupt the host cell function and colonize the body surfaces.
    [Show full text]
  • Human B-Defensin 3 Has Immunosuppressive Activity in Vitro and in Vivo
    Eur. J. Immunol. 2010. 40: 1073–1078 DOI 10.1002/eji.200940041 Immunomodulation 1073 SHORT COMMUNICATION Human b-defensin 3 has immunosuppressive activity in vitro and in vivo Fiona Semple1, Sheila Webb1, Hsin-Ni Li2, Hetal B. Patel3, Mauro Perretti3, Ian J. Jackson1, Mohini Gray2, Donald J. Davidson2 and Julia R. Dorin1 1 MRC Human Genetics Unit, Institute of Genetics and Molecular Medicine, Edinburgh EH4 2XU, Scotland, UK 2 Centre for Inflammation Research, QMRI University of Edinburgh UK 3 William Harvey Research Institute, Barts and The London School of Medicine, Queen Mary University of London UK b-defensins are antimicrobial peptides with an essential role in the innate immune response. In addition b-defensins can also chemoattract cells involved in adaptive immunity. Until now, based on evidence from dendritic cell stimulation, human b defen- sin-3 (hBD3) was considered pro-inflammatory. We present evidence here that hBD3 lacks pro-inflammatory activity in human and mouse primary M/. In addition, in the presence of LPS, hBD3 and the murine orthologue Defb14 (but not hBD2), effectively inhibit TNF-a and IL-6 accumulation implying an anti-inflammatory function. hBD3 also inhibits CD40/ IFN-c stimulation of M/ and in vivo, hBD3 significantly reduces the LPS-induced TNF-a level in serum. Recent work has revealed that hBD3 binds melanocortin receptors but we provide evidence that these are not involved in hBD3 immunomodulatory activity. This implies a dual role for hBD3 in antimicrobial activity and resolution of inflammation. Key words: Anti-inflammatory . cAMP . Defensin . TNF-a Supporting Information available online Introduction insensitive, antimicrobial activity [5].
    [Show full text]
  • Downregulation of Defensin Genes in SARS-Cov-2 Infection
    medRxiv preprint doi: https://doi.org/10.1101/2020.09.21.20195537; this version posted September 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. Downregulation of Defensin genes in SARS-CoV-2 infection Mohammed M Idris*, Sarena Banu, Archana B Siva, Ramakrishnan Nagaraj* CSIR-Centre for Cellular and Molecular Biology, Hyderabad 500007, India *Corresponding Authors: Mohammed M Idris Email: [email protected] Ramakrishnan Nagaraj Email: [email protected] NOTE: This preprint reports new research that has not been certified by peer review and should not be used to guide clinical practice. medRxiv preprint doi: https://doi.org/10.1101/2020.09.21.20195537; this version posted September 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. Abstract: Defensins, crucial components of the innate immune system, play a vital role against infection as part of frontline immunity. Association of SARS-CoV-2 infection with defensins has not been investigated till date. In this study, we have investigated the expression of defensin genes in the buccal cavity during COVID-19 infection. Nasopharyngeal/Oropharyngeal swab samples collected for screening SARS-CoV-2 infection were analyzed for the expression of major defensin genes by the quantitative real-time reverse transcription polymerase chain reaction, qRT-PCR.
    [Show full text]
  • Β-Defensin Expression in the Canine Nasal Cavity by Michelle Satomi
    β-defensin expression in the canine nasal cavity by Michelle Satomi Aono A thesis submitted to the Graduate Faculty of Auburn University in partial fulfillment of the requirements for the Degree of Masters of Science Auburn, Alabama May 6th, 2013 Keywords: defensin, innate immunity, canine nasal cavity Copyright 2013 by Michelle S. Aono Approved by Edward E. Morrison, Professor and Head of Anatomy, Physiology and Pharmacology Robert Kemppainen, Associate Professor of Anatomy, Physiology and Pharmacology John C. Dennis, Research Fellow IV of Anatomy, Physiology and Pharmacology Abstract Defensins are a family of endogenous antibiotics that are important in mucosal innate immunity, but little is currently known about defensin expression in the nasal cavity. Herein expression of canine β-defensin (cBD)1, cBD103, cBD108 and cBD123 RNA in the respiratory epithelium (RE), cBD1 and 108 RNA in the olfactory epithelium (OE), and cBD1, cBD108, cBD119 and cBD123 RNA in the olfactory bulb (OB) is reported. cBD1 and 103 were also expressed in the canine nares and tongue. cBD102, cBD120, and cBD122 RNA expression was undetectable in the tissues examined. cBD103 transcript abundance in canine nares showed a 90 fold range of inter-individual variation. Murine β-defensin 14 expression mirrors that of cBD103 in the dog, with high expression in the nares and tongue, but has little to no expression in the RE, OE or OB. High expression of cBD103 in the nares may provide indirect protection to the OE by eliminating pathogens in the rostral portion of the nasal cavity, whereas cBD1 and 108 may provide direct protection to the RE and OE.
    [Show full text]
  • Aggressive Mature Natural Killer Cell Neoplasms
    isord D ers od & lo T r B f a n o s l f a u n s r Journal of i o u n o Lima, J Blood Disorders Transf 2013, 5:1 J ISSN: 2155-9864 Blood Disorders & Transfusion DOI: 10.4172/2155-9864.1000182 Review Article OpenOpen Access Access Aggressive Mature Natural Killer Cell Neoplasms: from Disease Biology to Disease Manifestations Margarida Lima* Department of Hematology, Laboratory of Cytometry, Hospital de Santo António, Centro Hospitalar do Porto, Multidisciplinary Unit for Biomedical Investigation, Portugal Abstract Nature killer (NK)/T cell lymphoma, nasal type, and aggressive NK-cell leukemia are rare tumors with higher prevalence in Asia, Central and South America, which are etiologically related to the Epstein Barr virus (EBV). Proteins encoded by EBV genes and non-coding viral RNAs expressed on the infected cells are involved in immune deregulation and cell transformation and lymphomagenesis occur as a consequence of multiple oncogenic events. Complex chromosomal abnormalities are frequent and loss of chromosomes 6q, 11q, 13q, and 17p are recurrent aberrations. In accordance, many genes are differentially expressed, often due to gene deletion, mutation or methylation. These include, among others, tumor suppressor genes and oncogenes, as wells as genes involved in cell signal transducer pathways, cell survival and apoptosis, cell cycle, cell motility and cell adhesion, as well as in cell communication through cytokine networks. Consequently many biochemical pathways are affected in NK-cell neoplasms, which could contribute to cancer development and progression, as well as to disease manifestations. This review focuses on the molecular and biochemical mechanisms by which EBV induces NK-cell lymphomagenesis, disrupting genes and molecules involved in crucial biological processes.
    [Show full text]
  • Department of Physics, Chemistry and Biology Bachelor Thesis, 16 Hp | Biology Programme: Physics, Chemistry and Biology Spring Term 2019 | LITH-IFM-X-EX--19/3696--SE
    Linköping University | Department of Physics, Chemistry and Biology Bachelor thesis, 16 hp | Biology programme: Physics, Chemistry and Biology Spring term 2019 | LITH-IFM-x-EX--19/3696--SE A Versatile Group of Molecules, Can Defensins Make an Impact in Medicine? Filip Fors Examinator, Matthias Laska, IFM Biologi, Linköpings universitet Tutor, Jordi Altimiras, IFM Biologi, Linköpings universitet Avdelning, institution Datum Division, Department Date 6/6-19 Department of Physics, Chemistry and Biology Linköping University Språk Rapporttypi ISBN Language Report category Svenska/Swedish Licentiatavhandling ISRN: LITH-IFM-x-EX--19/3696--SE Engelska/English Examensarbete _________________________________________________________________ C-uppsats D-uppsats Serietitel och serienummer ISSN ________________ Övrig rapport Title of series, numbering ______________________________ _____________ URL för elektronisk version Titel Title A Versatile Group of Molecules, Can Defensins Make an Impact in Medicine? Författare Author Filip Fors Sammanfattning Abstract Antimicrobial peptides are an ancient form of innate defense and is present in all ways of life. In humans they are present as cathelicidins and defensins. Both are important for the immune system and they exhibit activity against viruses, bacteria and fungi. Defensins exhibit less cytotoxicity and are better characterized and are thus more easily developed as therapeutic tools. Defensins are apt at doing a multitude of things, from inhibiting Herpes simplex virus replication and preventing anthrax’ lethality to helping with wound closure and acting as biomarkers for a variety of ailments. Defensins have consistently shown good results in a laboratory setting but have less than exemplary in vivo results. Defensins’ multifunctionality as well as the complex environment in living organisms makes characterizing why defensins are not performing as well in vivo difficult.
    [Show full text]