DOCSLIB.ORG

Activation of Hormone-Sensitive Lipase and Phosphorylase Kinase by Purified Cyclic GMP-Dependent Protein Kinase

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Activation of Hormone-Sensitive Lipase and Phosphorylase Kinase by Purified Cyclic GMP-Dependent Protein Kinase Proc. Natl. Acad. Sci. USA Vol. 74, No. 11, pp. 4843-4847, November 1977 Biochemistry Activation of hormone-sensitive lipase and phosphorylase kinase by purified cyclic GMP-dependent protein kinase (cyclic AMP-dependent protein kinase/protein kinase inhibitor/cholesterol esterase) JOHN C. KHOO, PAMELA J. SPERRY, GORDON N. GILL, AND DANIEL STEINBERG Division of Metabolic Disease and Division of Endocrinology, Department of Medicine, University of California, San Diego, La Jolla, California 92093 Communicated by Nathan 0. Kaplan, August 12,1977 ABSTRACT Cyclic GMP-dependent protein kinase, purified The role of cAMP-dependent protein kinase in the activation to homogeneity from bovine lung, was shown to activate hor- of hormone-sensitive lipase from adipose tissue (9) and of mone-sensitive lipase partially purified from chicken adipose phosphorylase kinase from skeletal muscle (10) is well estab- tissue. The degree of activation was the same as that effected by cyclic AMP-dependent protein kinase although higher con- lished. The availability of a highly purified preparation of centrations of the cyclic GMP-dependent enzyme were required cGMP-dependent protein kinase (7) led- us to test the possibility (relative activities expressed in terms of histone H2b phospho- that this kinase might modify the activity of these intercon- rylation units). Activation by cyclic AMP-dependent protein vertible enzymes. kinase was completely blocked by the heat-stable protein kinase inhibitor protein from skeletal muscle but activation by the AND METHODS cyclic GMP enzyme was not inhibited. Lipase fully activated MATERIALS by cyclic AMP-dependent protein kinase showed no further Materials. ['4C]Triolein and cholesterol [1-14CJoleate were change in activity when treated with cyclic GMP-dependent purchased from Dhom Products, Ltd. Phosphorylase b (rabbit protein kinase. Lipase activated by cyclic GMP-dependent protein kinase was reversibly deactivated by purified phos- skeletal muscle), phosphoglucomutase, glucose-6-P dehydro- phorylase phosphatase (from bovine heart); full activity was genase, histone H2b, cAMP, cGMP, and ATP were obtained restored by reincubation with cyclic GMP and cyclic GMP- from Sigma Chemical Co. ['y-32P]ATP was prepared by the dependent protein kinase. Cholesterol esterase activity in the method of Glynn and Chappell (11). cAMP-dependent protein chicken adipose tissue fraction, previously shown to be activated kinase (specific activity, 45 nmol of 32p incorporated per mg along with the triglyceride lipase by cyclic AMP-dependent of histone H2b per mg of protein per min) was purified from protein kinase, was also activated by cyclic GMP-dependent to the method of Wastila et protein kinase. Crude preparations of hormone-sensitive tri- rabbit skeletal muscle according glyceride lipase from human or rat adipose tissue and choles- al. (12) through the first DEAE-cellulose chromatography step. terol esterase from rat adrenal were also activated by cyclic Protein kinase inhibitor was also purified from rabbit skeletal GMP-dependent protein kinase. Purified hosphorylase kinase muscle through the DEAE-cellulose chromatography step by (rabbit skeletal muscle) was also shown to be activated by cyclic the method of Walsh et al. (13). Phosphorylase kinase was pu- GMP-dependent protein kinase. The present results, together rified from rabbit skeletal muscle by the method of Cohen (14). with those of other workers on histone phosphorylation, suggest that the substrate specificities of cyclic GMP-dependent and Phosphorylase phosphatase, a generous gift of E. Y. C. Lee, was cyclic AMP-dependent protein kinase may be similar. This is purified from bovine heart to homogeneity by-the method of discussed in the light of a model recently proposed with regard Brandt et al. (15). The specific activity was 7890 units/mg of to the relationship between the subunit structures of the two protein. kinases. The physiologic significance of the findings remains Preparation of cGMP-Dependent Protein Kinase and to be established. Hormone-Sensitive Lipase. cGMP-dependent protein kinase was purified from bovine lung by affinity chromatography on Changes in intracellular concentrations of cyclic GMP (cGMP) 8-NH2(CH2)2NH-cAMP-Sepharose (7, 16). The homogeneous have been observed in association with a wide variety of met- enzyme prepared by elution with 0.1 mM cGMP in 2% Am- abolic and hormonal perturbations (reviewed in refs. 1 and 2). pholine and 10% glycerol was concentrated to 1 mg/ml. This In many circumstances the cellular levels of cGMP change purified enzyme had a specific activity of 1375 nmol of 32p reciprocally with those of cyclic AMP (cAMP), leading to the incorporated per mg of histone H2b/mg of protein per min. suggestion that these two cyclic nucleotides regulate metabolic Because cGMP-dependent protein kinase was purified by processes in opposite directions-the yin-yang hypothesis (2). competitive elution with cGMP, removal of the nucleotide by Under certain conditions, parallel changes in the concentrations chromatography on Sephadex G-200 or Sephadex G-50 at 300 of the two cyclic nucleotides are observed (3, 4). It has been was required when effects of added cyclic nucleotide were to established in several mammalian systems that cAMP regulates be examined. enzymic activity by phosphorylations catalyzed by cAMP- Hormone-sensitive lipase from chicken adipose tissue was dependent protein kinase (5) and it has been suggested that prepared by the method of Khoo and Steinberg (17) to the pH cGMP may work in an analogous fashion through cGMP- 5.2 precipitate step. The specific activity ranged from 13 to 45 dependent protein kinase (6). The latter enzyme has now been nmol of oleic acid released per mg of protein per hr. Endoge- demonstrated in many tissues (cf. ref. 7) including adipose tissue nous cAMP-dependent protein kinase was inactivated by in- (8). Thus far, however, covalent enzyme modification with cubating the pH 5.2 precipitate fraction (5.2 P fraction) at 500 changes in enzyme activity catalyzed by cGMP-dependent for 20 min in the presence of 10 ,uM cAMP. This heat treatment kinase has not been demonstrated. caused a loss of 40% of the lipase activity. The cAMP was then The costs of publication of this article were defrayed in part by the removed by dialysis and chromatography on Sephadex G-50. payment of page charges. This article must therefore be hereby marked "adertisement" in accordance with 18 U. S. C. §1734 solely to indicate Abbreviations: cGMP, cyclic GMP; cAMP, cyclic AMP; EGTA, eth- this fact. ylene glycol-bis(,B-aminoethyl ether)-N,N'-tetraacetic acid. 4843 Downloaded by guest on October 1, 2021 4844 Biochemistry: Khoo et al. Proc. Nati. Acad. Sci. USA 74 (1977) Table 1. Activation of hormone-sensitive lipase from chicken adipose tissue* Lipase activity, Ratio: act. nmol oleic acid/ with additions/ mg protein act. with Additionst per hr MgATP alone MgATP alone 33 1.0 +cAMP 747 22.6 +cAMP and protein kinase inhibitor 41 1.2 +cGMP 30 0.9 +cGMP-dependent 0 10 20 30 40 50 protein kinase 72 2.2 Protein kinase, units/ml +cGMP and cGMP- FIG. 1. Activation of hormone-sensitive lipase as a function of dependent protein kinase 414 12.5 the concentration of cGMP-dependent protein kinase (0) and +cGMP, cGMP-dependent cAMP-dependent protein kinase (A). The chicken adipose tissue 5.2 protein kinase, and P lipase fraction (75 ,g) was first freed of endogenous cAMP-de- protein kinase inhibitor 515 15.6 pendent protein kinase by heat treatment in the presence of cAMP and then activated at 300 for 10 min under the conditions described * 5.2 P fraction (75 Mg) of chicken adipose tissue hormone-sensitive in Materials and Methods. In some cases, protein kinase inhibitor lipase was incubated with the indicated cofactors for 10 min at 300; (78 Mug/ml) was added to the incubation mixture (@, A). [14C]triolein emulsion was then added and incubation was continued for 30 min at 300. Lipase activity was determined from release of This heat treatment also inactivated endogenous phosphopro- [14C]oleic acid. tein phosphatase. t The concentrations of the cofactors were: Mg(OAc)2, 5 mM; ATP, 0.5 mM; cGMP or cAMP, 10,uM; protein kinase inhibitor, 78 Mug/ml; Enzyme Assay. The conditions for activation, deactivation, and cGMP-dependent protein kinase, 5.3 units/ml. and assay of hormone-sensitive lipase or cholesterol esterase were as described (18, 19). The activation mixture (0.1 ml) contained 5 mM magnesium acetate, 0.5 mM ATP, 10 ,uM alone. Addition of protein kinase inhibitor completely blocked cGMP or cAMP, cGMP- or cAMP-dependent protein kinase this, indicating that the activation was due to endogenous as indicated, 50-150 Mug of 5.2 P fraction, and 20% glycerol/i cAMP-dependent protein kinase. Addition of MgATP and mM EDTA/25 mM Tris, pH 7.4. After incubation at 300 for cGMP alone caused no activation, indicating that the endoge- 10 min, triglyceride lipase activity was assayed by adding 0.7 nous protein kinase of this adipose tissue fraction was not readily ml of an emulsion containing 0.1 mM [14C]triolein, bovine activated by cGMP under these conditions. This is in agreement serum albumin at 5 mg/ml, 2 mM EDTA, and 5 mM sodium with earlier studies in rat adipose tissue showing that, although phosphate (pH 7.0) and incubating for 30 min at 300. Free the Ka for cAMP-stimulated activation of hormone-sensitive [I4C]oleic acid was extracted with chloroform/methanol/ lipase was 1.1 X 10-7 M, significant cGMP-stimulated activa- benzene/water at pH 11.5 (19). Cholesterol esterase was assayed tion was seen only at 1 X 10-4 M (23). by using cholesterol [1-14C]oleate added in ethanol as described Addition of MgATP and cGMP-dependent protein kinase (18). yielded a 2-fold increase in triglyceride lipase activity; with Activation of phosphorylase kinase was carried out in a re- addition of both cGMP-dependent protein kinase and cGMP action mixture of 50 Mul containing 10 mM magnesium acetate, a 12-fold increase was obtained (Table 1).
Load more

Recommended publications
  • (PDE 1 B 1) Correlates with Brain Regions Having Extensive Dopaminergic Innervation
    The Journal of Neuroscience, March 1994, 14(3): 1251-l 261 Expression of a Calmodulin-dependent Phosphodiesterase lsoform (PDE 1 B 1) Correlates with Brain Regions Having Extensive Dopaminergic Innervation Joseph W. Polli and Randall L. Kincaid Section on Immunology, Laboratory of Molecular and Cellular Neurobiology, National Institute on Alcohol Abuse and Alcoholism, Rockville, Maryland 20852 Cyclic nucleotide-dependent protein phosphorylation plays PDE implies an important physiological role for Ca2+-regu- a central role in neuronal signal transduction. Neurotrans- lated attenuation of CAMP-dependent signaling pathways mitter-elicited increases in cAMP/cGMP brought about by following dopaminergic stimulation. activation of adenylyl and guanylyl cyclases are downre- [Key words: CAMP, cyclase, striatum, dopamine, basal gulated by multiple phosphodiesterase (PDE) enzymes. In ganglia, DARPP-321 brain, the calmodulin (CaM)-dependent isozymes are the major degradative activities and represent a unique point of Cyclic nucleotides, acting as “second messengers”or via direct intersection between the cyclic nucleotide- and calcium effects, regulate a diverse array of neuronal functions, from ion (Ca*+)-mediated second messenger systems. Here we de- channel conductance to gene expression. Hydrolysis of 3’,5’- scribe the distribution of the PDEl Bl (63 kDa) CaM-depen- cyclic nucleotidesto 5’-nucleosidemonophosphates is the major dent PDE in mouse brain. An anti-peptide antiserum to this mechanismfor decreasingintracellular cyclic nucleotide levels. isoform immunoprecipitated -3O-40% of cytosolic PDE ac- This reaction is catalyzed by cyclic nucleotide phosphodiester- tivity, whereas antiserum to PDElA2 (61 kDa isoform) re- ase (PDE) enzymes that constitute a large superfamily (Beavo moved 60-70%, demonstrating that these isoforms are the and Reifsynder, 1990).
    [Show full text]
  • Serum 5-Nucleotidase by Theodore F
    J Clin Pathol: first published as 10.1136/jcp.7.4.341 on 1 November 1954. Downloaded from J. clin. Path. (1954), 7, 341. SERUM 5-NUCLEOTIDASE BY THEODORE F. DIXON AND MARY PURDOM t0o From the Biochemistry Department, the Institute of Orthopaedics, Stanmore, Middlesex (RECEIVED FOR PUBLICATION DECEMBER 8. 1953) Reis (1934, 1940, 1951) has demonstrated the add the molybdate solution, and dilute with washings to presence of alkaline phosphatase in various tissues 1 litre with water. specifically hydrolysing 5-nucleotidase such as Standard Phosphate Solution.-KH2PO4 0.02195 g., adenosine and inosine-5-phosphoric acids. The and 50 g. trichloracetic acid, made up to 1 litre. This enzyme has its optimum action at pH 7.8 and in all solution contains 0.02 mg. P in 4 ml. human tissues except intestinal mucosa its activity, at the physiological pH range, is much more Methods pronounced than that of the non-specific alkaline Non-specific alkaline phosphatase activity is high at phosphatase. Thus ossifying cartilage, one of the pH 9 towards phenylphosphate adenosine phosphate classical sites of high alkaline phosphatase activity, and glycerophosphate, in this decreasing order (cf. Reis, although very active against say phenyl phosphoric 1951). At pH 7.5, however, the total phosphatase acids at pH 9, is more active against adenosine-5- activity is equally low towards phenyl- or glycero-phos- phosphoric at pH 7.5. This finding suggested to phate -nd the higher activity towards adenosine-5- phosphate at this reaction is reasonably inferred to be Reis that the enzyme might play a part in calcifica- due to the specific 5-nucleotidase.
    [Show full text]
  • Glycogen Synthase Kinase-3 Is Activated in Neuronal Cells by G 12
    The Journal of Neuroscience, August 15, 2002, 22(16):6863–6875 Glycogen Synthase Kinase-3 Is Activated in Neuronal Cells by G␣ ␣ 12 and G 13 by Rho-Independent and Rho-Dependent Mechanisms C. Laura Sayas, Jesu´ s Avila, and Francisco Wandosell Centro de Biologı´a Molecular “Severo Ochoa”, Consejo Superior de Investigaciones Cientı´ficas, Universidad Auto´ noma de Madrid, Cantoblanco, Madrid 28049, Spain ␣ ␣ ␣ ␣ Glycogen synthase kinase-3 (GSK-3) was generally considered tively active G 12 (G 12QL) and G 13 (G 13QL) in Neuro2a cells a constitutively active enzyme, only regulated by inhibition. induces upregulation of GSK-3 activity. Furthermore, overex- Here we describe that GSK-3 is activated by lysophosphatidic pression of constitutively active RhoA (RhoAV14) also activates ␣ acid (LPA) during neurite retraction in rat cerebellar granule GSK-3 However, the activation of GSK-3 by G 13 is blocked by neurons. GSK-3 activation correlates with an increase in GSK-3 coexpression with C3 transferase, whereas C3 does not block ␣ tyrosine phosphorylation. In addition, LPA induces a GSK-3- GSK-3 activation by G 12. Thus, we demonstrate that GSK-3 is ␣ ␣ mediated hyperphosphorylation of the microtubule-associated activated by both G 12 and G 13 in neuronal cells. However, ␣ protein tau. Inhibition of GSK-3 by lithium partially blocks neu- GSK-3 activation by G 13 is Rho-mediated, whereas GSK-3 ␣ rite retraction, indicating that GSK-3 activation is important but activation by G 12 is Rho-independent. The results presented not essential for the neurite retraction progress. GSK-3 activa- here imply the existence of a previously unknown mechanism of ␣ tion by LPA in cerebellar granule neurons is neither downstream GSK-3 activation by G 12/13 subunits.
    [Show full text]
  • Regulation of Calmodulin-Stimulated Cyclic Nucleotide Phosphodiesterase (PDE1): Review
    95-105 5/6/06 13:44 Page 95 INTERNATIONAL JOURNAL OF MOLECULAR MEDICINE 18: 95-105, 2006 95 Regulation of calmodulin-stimulated cyclic nucleotide phosphodiesterase (PDE1): Review RAJENDRA K. SHARMA, SHANKAR B. DAS, ASHAKUMARY LAKSHMIKUTTYAMMA, PONNIAH SELVAKUMAR and ANURAAG SHRIVASTAV Department of Pathology and Laboratory Medicine, College of Medicine, University of Saskatchewan, Cancer Research Division, Saskatchewan Cancer Agency, 20 Campus Drive, Saskatoon SK S7N 4H4, Canada Received January 16, 2006; Accepted March 13, 2006 Abstract. The response of living cells to change in cell 6. Differential inhibition of PDE1 isozymes and its environment depends on the action of second messenger therapeutic applications molecules. The two second messenger molecules cAMP and 7. Role of proteolysis in regulating PDE1A2 Ca2+ regulate a large number of eukaryotic cellular events. 8. Role of PDE1A1 in ischemic-reperfused heart Calmodulin-stimulated cyclic nucleotide phosphodiesterase 9. Conclusion (PDE1) is one of the key enzymes involved in the complex interaction between cAMP and Ca2+ second messenger systems. Some PDE1 isozymes have similar kinetic and 1. Introduction immunological properties but are differentially regulated by Ca2+ and calmodulin. Accumulating evidence suggests that the A variety of cellular activities are regulated through mech- activity of PDE1 is selectively regulated by cross-talk between anisms controlling the level of cyclic nucleotides. These Ca2+ and cAMP signalling pathways. These isozymes are mechanisms include synthesis, degradation, efflux and seque- also further distinguished by various pharmacological agents. stration of cyclic adenosine 3':5'-monophosphate (cAMP) and We have demonstrated a potentially novel regulation of PDE1 cyclic guanosine 3':5'- monophosphate (cGMP) within the by calpain.
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • Analyses of PDE-Regulated Phosphoproteomes Reveal Unique and Specific Camp-Signaling Modules in T Cells
    Analyses of PDE-regulated phosphoproteomes reveal unique and specific cAMP-signaling modules in T cells Michael-Claude G. Beltejara, Ho-Tak Laua, Martin G. Golkowskia, Shao-En Onga, and Joseph A. Beavoa,1 aDepartment of Pharmacology, University of Washington, Seattle, WA 98195 Contributed by Joseph A. Beavo, May 28, 2017 (sent for review March 10, 2017; reviewed by Paul M. Epstein, Donald H. Maurice, and Kjetil Tasken) Specific functions for different cyclic nucleotide phosphodiester- to bias T-helper polarization toward Th2, Treg, or Th17 pheno- ases (PDEs) have not yet been identified in most cell types. types (13, 14). In a few cases increased cAMP may even potentiate Conventional approaches to study PDE function typically rely on the T-cell activation signal (15), particularly at early stages of measurements of global cAMP, general increases in cAMP- activation. Recent MS-based proteomic studies have been useful dependent protein kinase (PKA), or the activity of exchange in characterizing changes in the phosphoproteome of T cells under protein activated by cAMP (EPAC). Although newer approaches various stimuli such as T-cell receptor stimulation (16), prosta- using subcellularly targeted FRET reporter sensors have helped glandin signaling (17), and oxidative stress (18), so much of the define more compartmentalized regulation of cAMP, PKA, and total Jurkat phosphoproteome is known. Until now, however, no EPAC, they have limited ability to link this regulation to down- information on the regulation of phosphopeptides by PDEs has stream effector molecules and biological functions. To address this been available in these cells. problem, we have begun to use an unbiased mass spectrometry- Inhibitors of cAMP PDEs are useful tools to study PKA/EPAC- based approach coupled with treatment using PDE isozyme- mediated signaling, and selective inhibitors for each of the 11 PDE – selective inhibitors to characterize the phosphoproteomes of the families have been developed (19 21).
    [Show full text]
  • Protein Kinases Phosphorylation/Dephosphorylation Protein Phosphorylation Is One of the Most Important Mechanisms of Cellular Re
    Protein Kinases Phosphorylation/dephosphorylation Protein phosphorylation is one of the most important mechanisms of cellular responses to growth, stress metabolic and hormonal environmental changes. Most mammalian protein kinases have highly a homologous 30 to 32 kDa catalytic domain. • Most common method of reversible modification - activation and localization • Up to 1/3 of cellular proteins can be phosphorylated • Leads to a very fast response to cellular stress, hormonal changes, learning processes, transcription regulation .... • Different than allosteric or Michealis Menten regulation Protein Kinome To date – 518 human kinases known • 50 kinase families between yeast, invertebrate and mammaliane kinomes • 518 human PKs, most (478) belong to single super family whose catalytic domain are homologous. • Kinase dendrogram displays relative similarities based on catalytic domains. • AGC (PKA, PKG, PKC) • CAMK (Casein kinase 1) • CMGC (CDC, MAPK, GSK3, CLK) • STE (Sterile 7, 11 & 20 kinases) • TK (Tryosine kinases memb and cyto) • TKL (Tyrosine kinase-like) • Phosphorylation stabilized thermodynamically - only half available energy used in adding phosphoryl to protein - change in free energy forces phosphorylation reaction in one direction • Phosphatases reverse direction • The rate of reaction of most phosphatases are 1000 times faster • Phosphorylation occurs on Ser/The or Tyr • What differences occur due to the addition of a phosphoryl group? • Regulation of protein phosphorylation varies depending on protein - some turned on or off
    [Show full text]
  • Protein Kinase C As a Paradigm Alexandra C
    Biochem. J. (2003) 370, 361–371 (Printed in Great Britain) 361 REVIEW ARTICLE Regulation of the ABC kinases by phosphorylation: protein kinase C as a paradigm Alexandra C. NEWTON1 Department of Pharmacology, University of California at San Diego, La Jolla, CA 92093-0640, U.S.A. Phosphorylation plays a central role in regulating the activation down-regulation of PKC as a paradigm for how these sites and signalling lifetime of protein kinases A, B (also known as control the function of the ABC kinases. Akt) and C. These kinases share three conserved phosphorylation motifs: the activation loop segment, the turn motif and the Key words: phosphoinositide 3-kinase, phosphoinositide-depen- hydrophobic motif. This review focuses on how phosphorylation dent kinase-1 (PDK-1), phosphorylation motif, protein kinase A at each of these sites regulates the maturation, signalling and (PKA), protein kinase B (PKB)\Akt, protein kinase C (PKC). INTRODUCTION by phosphorylation as a paradigm for control of ABC kinase function by phosphorylation. Almost half a century ago Krebs, Graves and Fischer reported b that the first discovered protein kinase, phosphorylase kinase, ARCHITECTURE OF ABC KINASES was, itself, activated by phosphorylation [1]. Two decades later, Fischer and colleagues showed that the kinase that phosphory- Protein kinases A, B\Akt and C have in common a conserved lates phosphorylase kinase, later named protein kinase A (PKA), kinase core whose function is regulated allosterically by a was also phosphorylated [2]. Reversible control by phosphory- corresponding regulatory moiety (Figure 1). In the case of PKA, lation\dephosphorylation is now firmly established as a fun- the regulatory moiety is a separate polypeptide, whereas the damental mechanism for regulating the function of most of the regulatory determinants are on the same polypeptide as the 500 or so members of the mammalian protein kinase superfamily.
    [Show full text]
  • Properties of an Acid Phosphatase in Pulmonary Surfactant (Lung Surfactant/Phosphatidate Phosphatase/Phosphatidylglycerol Phosphate) BRADLEY J
    Proc. Natl. Acad. Sci. USA Vol. 77, No. 2, pp. 808-811, February 1980 Biochemistry Properties of an acid phosphatase in pulmonary surfactant (lung surfactant/phosphatidate phosphatase/phosphatidylglycerol phosphate) BRADLEY J. BENSON Cardiovascular Research Institute, and the Department of Biochemistry, University of California, San Francisco, California 94143 Communicated by John A. Clements, November 5, 1979 ABSTRACT Lung surfactant, a lipid-protein complex pu- phatase (phosphatidate phosphohydrolase, EC 3.1.3.4) in in- rified from dog lungs, contains a highly active phosphomo- tracellular lamellar bodies. Spitzer et al. (13) also found the noesterase associated with it. This phosphatase is quite specific enzyme in their preparations of isolated lamellar bodies, for the hydrolysis of phosphatidic acid and 1-acyl-2-lysophos- phatidic acid. The enzyme possesses many of the characteristics whereas Garcia et al. (14) found no phosphatidate phosphatase of the microsomal enzyme, phosphatidate phosphohydrolase in their lamellar body preparations that they could not attribute (EC 3.1.3.4). In addition, we have shown that this enzyme will to microsomal contamination. Recently, however, Spitzer and also convert phosphatidylglycerol phosphate [1(3-sn-phospha- Johnston (15) demonstrated convincingly that the phosphatidate tidyl)sn-glycerol-1-PJ to phosphatidylglycerol [1{3-sn-phos- phosphatase in their lamellar body preparations was not con- phatidyl)sn-glycerolj and Pi. The phosphatidylglycerol phos- tamination from microsomes. Baranska and van Golde (16) phate was made available to the surfactant enzyme in a coupled assay by hydrolysis of cardiolipin [1(3-sn-phosphatidyl)3(3- reported that their preparations of lamellar bodies contained sn-phosphatidyl)sn-glycerolJ by stereospecific cleavage with no phospholipid biosynthetic enzymes that could not be at- phospholipase C (phosphatidylcholine cholinephosphohydro- tributed to microsomal contamination, although their studies lase, EC 3.1.4.3) from Bacillus cereus.
    [Show full text]
  • Some Ultrastructural and Enzymatic Effects of Water Stress in Cotton (Gossypium Hirsutum L.) Leaves (Acid Phosphatase/Acid Lipase/Alkaline Lipase)
    Proc. Nat. Acad. Sci. USA Vol. 71, No. 8, pp. 3243-3247, August 1974 Some Ultrastructural and Enzymatic Effects of Water Stress in Cotton (Gossypium hirsutum L.) Leaves (acid phosphatase/acid lipase/alkaline lipase) JORGE VIEIRA DA SILVA*, AUBREY W. NAYLOR, AND PAUL J. KRAMER Department of Botany, Duke University, Durham, North Carolina 27706 Contributed by Paul J. Kramer, May 30, 1974 ABSTRACT Water stress induced by floating discs cut boxylation of glycine occurs after lipase treatment of mito- from cotton leaves (Gossypium hirsutum L. cultivar chondria Stoneville) on a polyethylene glycol solution (water poten- (23). tial, -10 bars) was associated with marked alteration of Results, thus far obtained by indirect means, support the ultrastructural organization of both chloroplasts and hypothesis that water stress in drought sensitive species leads mitochondria. Ultrastructural organization of chloro- to hydrolytic activity that degrades not only storage products plasts was sometimes almost completely destroyed; per- but the structural framework of organelles such as ribosomes, oxisomes seemed not to be affected; and chloroplast ribosomes disappeared. Also accompanying water stress chloroplasts, and mitochondria. Ultrastructural and micro- was a sharp increase in activity of acid phosphatase chemical evidence is reported here that such deterioration [orthoplhosphoric-monoester phosplhohydrolase (acid opti- occurs in cotton (Gossypium hirsutum L. cv. Stoneville) during mum), EC 3.1.3.2], and acid and alkaline lipase [glycerol water stress. ester hydrolase EC 3.1.1.3] within chloroplasts. Only acid lipase activity was detected inside mitochondria of stressed MATERIALS AND METHODS discs. These alterations in cell organization and enzy- mology may account for at least part of the previously Cotton plants (Gossypium hirsutum L.
    [Show full text]
  • AMP-Activated Protein Kinase: the Current Landscape for Drug Development
    REVIEWS AMP-activated protein kinase: the current landscape for drug development Gregory R. Steinberg 1* and David Carling2 Abstract | Since the discovery of AMP-activated protein kinase (AMPK) as a central regulator of energy homeostasis, many exciting insights into its structure, regulation and physiological roles have been revealed. While exercise, caloric restriction, metformin and many natural products increase AMPK activity and exert a multitude of health benefits, developing direct activators of AMPK to elicit beneficial effects has been challenging. However, in recent years, direct AMPK activators have been identified and tested in preclinical models, and a small number have entered clinical trials. Despite these advances, which disease(s) represent the best indications for therapeutic AMPK activation and the long-term safety of such approaches remain to be established. Cardiovascular disease Dramatic improvements in health care coupled with identifying a unifying mechanism that could link these (CVD). A term encompassing an increased standard of living, including better nutri- changes to multiple branches of metabolism followed diseases affecting the heart tion and education, have led to a remarkable increase in the discovery that the AMP-activated protein kinase or circulatory system. human lifespan1. Importantly, the number of years spent (AMPK) provided a common regulatory mechanism in good health is also increasing2. Despite these positive for inhibiting both cholesterol (through phosphoryla- Non-alcoholic fatty liver disease developments, there are substantial risks that challenge tion of HMG-CoA reductase (HMGR)) and fatty acid (NAFLD). A very common continued improvements in human health. Perhaps the (through phosphorylation of acetyl-CoA carboxylase disease in humans in which greatest threat to future health is a chronic energy imbal- (ACC)) synthesis8 (BOx 1).
    [Show full text]
  • The Characterization of Oligonucleotides and Nucleic Acids Using Ribonuclease H and Mass Spectrometry
    Louisiana State University LSU Digital Commons LSU Historical Dissertations and Theses Graduate School 1999 The hC aracterization of Oligonucleotides and Nucleic Acids Using Ribonuclease H and Mass Spectrometry. Lenore Marie Polo Louisiana State University and Agricultural & Mechanical College Follow this and additional works at: https://digitalcommons.lsu.edu/gradschool_disstheses Recommended Citation Polo, Lenore Marie, "The hC aracterization of Oligonucleotides and Nucleic Acids Using Ribonuclease H and Mass Spectrometry." (1999). LSU Historical Dissertations and Theses. 6923. https://digitalcommons.lsu.edu/gradschool_disstheses/6923 This Dissertation is brought to you for free and open access by the Graduate School at LSU Digital Commons. It has been accepted for inclusion in LSU Historical Dissertations and Theses by an authorized administrator of LSU Digital Commons. For more information, please contact [email protected]. INFORMATION TO USERS This manuscript has been reproduced from the microfilm master. UMI films the text directly from the original or copy submitted. Thus, some thesis and dissertation copies are in typewriter free, while others may be from any type of computer printer. The quality of this reproduction is dependent upon the quality of the copy submitted. Broken or indistinct print, colored or poor quality illustrations and photographs, print bleedthrough, substandard margins, and improper alignment can adversely affect reproduction. In the unlikely event that the author did not send UMI a complete manuscript and there are missing pages, these will be noted. Also, if unauthorized copyright material had to be removed, a note will indicate the deletion. Oversize materials (e.g., maps, drawings, charts) are reproduced by sectioning the original, beginning at the upper left-hand corner and continuing from left to right in equal sections with small overlaps.
    [Show full text]