University of Copenhagen

Total Page:16

File Type:pdf, Size:1020Kb

University of Copenhagen Transcriptomic and epigenomics atlas of myotubes reveals insight into the circadian control of metabolism and development Altnta, Ali; Laker, Rhianna C; Garde, Christian; Barrès, Romain; Zierath, Juleen R Published in: Epigenomics DOI: 10.2217/epi-2019-0391 Publication date: 2020 Document version Publisher's PDF, also known as Version of record Document license: CC BY-NC-ND Citation for published version (APA): Altnta, A., Laker, R. C., Garde, C., Barrès, R., & Zierath, J. R. (2020). Transcriptomic and epigenomics atlas of myotubes reveals insight into the circadian control of metabolism and development. Epigenomics, 12(8), 701- 713. https://doi.org/10.2217/epi-2019-0391 Download date: 25. Sep. 2021 Research Article For reprint orders, please contact: [email protected] Transcriptomic and epigenomics atlas of myotubes reveals insight into the circadian control of metabolism and development Ali Altıntas¸‡,1 , Rhianna C Laker‡,1, Christian Garde1, Romain Barres` 1 & Juleen R Zierath*,1,2 1Section for Integrative Physiology, The Novo Nordisk Foundation Center for Basic Metabolic Research, University of Copenhagen, Copenhagen, Denmark 2Section for Integrative Physiology, Department of Molecular Medicine & Surgery, Karolinska Institutet, Stockholm, Sweden *Author for correspondence: [email protected] ‡Authors contributed equally Aim: Innate circadian rhythms are critical for optimal tissue-specific functions, including skeletal muscle, a major insulin-sensitive tissue responsible for glucose homeostasis. We determined whether transcriptional oscillations are associated with CpG methylation changes in skeletal muscle. Materials & methods: We performed rhythmicity analysis on the transcriptome and CpG methylome of circadian synchronized my- otubes. Results: We identified several transcripts and CpG-sites displaying oscillatory behavior, which were enriched with Gene Ontology terms related to metabolism and development. Oscillating CpG methylation was associated with rhythmic expression of 31 transcripts. Conclusion: Although circadian oscillations may be regulated by rhythmic DNA methylation, strong rhythmic associations between transcriptome and CpG methylation were not identified. This resource constitutes a transcriptomic/epigenomic atlas of skeletal muscle and regulation of circadian rhythms. First draft submitted: 17 December 2019; Accepted for publication: 5 February 2020; Published online: 11 March 2020 Keywords: C2C12 • circadian • epigenetics • methylation • muscle • myotube • transcriptomics Circadian rhythms allow organisms to optimize various behavioral and physiological functions throughout the 24 h day–night cycle. Peripheral tissues are under the control of both the central clock, entrained by light signaling through the optical nerve to the suprachiasmatic nucleus and an intrinsic clock, entrained by a variety of environmental and systemic cues, including dietary factors, physical activity, metabolic demand and circulating hormones [1,2]. Mounting evidence indicates that when human behavior becomes out-of-sync with the central and peripheral clocks (e.g., after shift work or jet lag), whole body metabolism is perturbed and the risk for the development of Type 2 diabetes is increased [3–5]. Understanding the genomic mechanisms by which Zeitgebers (time givers) regulate the circadian expression of genes in metabolic tissues may give insight into disease mechanism for insulin resistance and altered metabolic homeostasis in type 2 diabetes. The intrinsic mammalian circadian clock is comprised of the transcription factors ARNTL (also known as BMAL1) and CLOCK [6]. These molecules dimerize and bind the E-box motif in the promoter of Nr1d1 (also known as Rev-Erbα)todriveNr1d1 transcription. In turn, NR1D1 feeds back and binds the DNA response element in the Arntl promoter and blocks transcription. The binding of NR1D1 is balanced by competitive binding of RORα, which has an opposite function to drive the expression of ARNTL. Concomitantly, ARNTL and CLOCK drive the expression of the Period (Per1, Per2 and Per3) and Cryptochrome (Cry1 and Cry2) genes, whose protein products translocate to the nucleus to block Arntl activity. These molecular cycles oscillate with a 24 h period that correspond with the day–night cycle and function as a transcription–translation feedback loop. ARNTL and CLOCK drive the expression of many genes that function in circadian regulation, but also bind to E-box motifs to regulate transcription of genes that are not classically circadian. 10.2217/epi-2019-0391 C 2020 Juleen R Zierath Epigenomics (2020) 12(8), 701–713 ISSN 1750-1911 701 Research Article Altıntas¸, Laker, Garde, Barres` & Zierath Skeletal muscle is responsible for 70–80% of insulin-stimulated glucose uptake, which is severely reduced with metabolic diseases such as Type 2 diabetes [7]. Mammalian skeletal muscle has an intrinsic molecular clock [8–10] and displays rhythmic expression of metabolic genes, such as Pdk4, Ucp3 and Pgc-1β, as well as genes involved in myogenesis, such as Myod1, Atrogin1 and Murf1 [11,12]. Thus, cellular growth and metabolism are partly under the control of the molecular clock machinery. On a functional level, isolated human muscle fibers [13] and mouse myotubes [14] demonstrate rhythmic oxygen consumption, concomitant with clock-dependent myokine secretion as reported for primary human myotubes [15]. Skeletal muscle loss of Arntl impairs whole body glucose homeostasis and insulin sensitivity and reduces the abundance of GLUT4 and various metabolic enzymes [16]. Thus, circadian rhythmicity is critical for metabolism and contractile function of skeletal muscle. The oscillatory nature of the molecular clock is highly dependent on gene transcription and, consequently, epigenetic regulation has been implicated in the fine tuning of this process. Oscillating histone modifications have been described in circadian regulation of the liver metabolism [17–21]. However, the role of DNA methylation of cytosine bases in the transcriptional regulation of the mammalian circadian clock is unclear. Circadian disruption by shortening the length of day from 24 to 22 h alters promoter DNA methylation in the suprachiasmatic nucleus at 1294 regions and many thereby impact downstream processes, including mood, learning and memory [22].Thus, changes in DNA methylation in response to circadian disruption may impact the central control of behavior. At the cellular level in liver, while circadian oscillations in histone modifications in promoters, gene bodies and enhancers have been reported [21], whole-genome bisulfite sequencing at two distinct circadian timepoints revealed promoter DNA methylation levels were relatively stable [21]. Nevertheless, a comprehensive analysis of genome-wide DNA methylation and transcriptional oscillations at multiple time points and in other peripheral tissues has not been reported. The purpose of our study was to delineate the potential link between the circadian CpG methylation and the regulation of circadian gene expression in skeletal muscle. We performed a time-course analysis of the circadian response of gene expression in cultured skeletal muscle and determined parallel epigenetic regulation by assessing changes in DNA methylation at specific promoter regions that correspond to the circadian gene expression profiles. We examined genome-wide methylation across a time course to determine whether transcriptional oscillations are associated with and potentially regulated by rhythmic DNA methylation. A novel aspect of this work is the generation of a comprehensive genomic atlas of temporal epigenetic and transcriptomic variation, which can serve as an important resource for circadian rhythm studies to investigate diurnal changes in skeletal muscle. Materials & methods Material and resources used in this article are summarized in Table 1. C2C12 cell culture Mouse C2C12 myoblasts were grown in DMEM with 10% fetal bovine serum (FBS) and 1% penstrep. Myoblasts were then seeded into 6-well plates with 50,000 cells per well. At approximately 90% confluence, cells were differentiated using DMEM with 2% horse serum and 1% penicillin–streptomycin. The experiment timeline is outlined in Figure 1A. On day 5 of differentiation, when myotubes were fully maturated, cells were circadian synchronized using 50% horse serum shock for 2 h [32], after which media was returned to normal differentiation media. Cells were harvested starting 12 h after serum shock, every 6 h for 60 h in RLT buffer (Qiagen, Hilden, Germany) with β-mercaptoethanol. RNA and DNA were isolated simultaneously using the RNA/DNA/miRNA AllPrep kit (Qiagen). RNA sequencing RNA was quality assured using the Bioanalyzer instrument (Agilent Technologies, CA, USA) and subjected to the Illumina TruSeq Stranded Total RNA with Ribo-Zero Gold protocol (Illumina, CA, USA) as described. Libraries (n = 3 for each time point) were subjected to 100-bp single-end sequencing on HiSeq 2500 (Illumina) at the Danish National High-Throughput DNA Sequencing Centre. Approximately 22 million reads/sample were assigned to genes with 11,591 genes surviving the expression threshold. Quantitative reverse transcription polymerase chain reaction (RT-qPCR) RT-qPCR analysis of Arntl, Nr1d1 and 18S (NM 003278) was performed using conventional SYBR green chemistry. Primer sequences (5–3)areArntl forward: TAGGATGTGACCGAGGGAAG; reverse: TCAAA- 702 Epigenomics (2020) 12(8) future science group Oscillating CpG methylation in myotubes Research Article -2 h0 h12 h18 h3024 h h36
Recommended publications
  • Circadian Behavior and Gene Expression in an Estuarine Cnidarian, Nematostella Vectensis
    CIRCADIAN BEHAVIOR AND GENE EXPRESSION IN AN ESTUARINE CNIDARIAN, NEMATOSTELLA VECTENSIS by Whitney B Leach A dissertation submitted to the faculty of The University of North Carolina at Charlotte in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biology Charlotte 2019 Approved by: ______________________________ Dr. Adam Reitzel ______________________________ Dr. Andrew Truman ______________________________ Dr. Stan Schneider ______________________________ Dr. Paola Duarte-Lopez ______________________________ Dr. George Banks ii ©2019 Whitney B Leach ALL RIGHTS RESERVED iii ABSTRACT WHITNEY B LEACH. Circadian behavior and gene expression in a burrowing estuarine cnidarian Nematostella vectensis. (Under the direction of ADAM M. REITZEL) Animals respond to diurnal shifts in their environment with a combination of behavioral, physiological, and molecular changes to synchronize with regularly-timed external cues. The light:dark cycle is regarded as the most important entrainment cue for setting cycles in many bilaterian including mammals, fish, insects and other invertebrates; but the molecular mechanisms that may be responsible for these phenotypes in non-bilaterian phyla remain largely unknown. To improve our understanding of how the photoperiod impacts circadian oscillation in cnidarian organisms (sister group to bilaterians), the sea anemone Nematostella vectensis was used to develop transcriptional and behavioral profiles in response to different light conditions. Nematostella has oscillating patterns
    [Show full text]
  • Circadian Regulation of Gene Expression Systems in the Drosophila Head
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Neuron, Vol. 32, 657–671, November 20, 2001, Copyright 2001 by Cell Press Circadian Regulation of Gene Expression Systems in the Drosophila Head Adam Claridge-Chang,1,5 Herman Wijnen,1,5 PER and TIM proteins physically associate to form a Felix Naef,2 Catharine Boothroyd,1 repressor of CLK/CYC. VRI negatively regulates per and Nikolaus Rajewsky,3 and Michael W. Young1,4 tim expression through a separate autoregulatory path, 1 Laboratories of Genetics, but also determines cycling expression of a key neuro- 2 Mathematical Physics, and peptide, PDF (Blau and Young, 1999). Cycling accumula- 3 Theoretical Condensed Matter Physics tion of this peptide hormone is required for normal pat- The Rockefeller University terns of rhythmic locomotor activity (Helfrich-Forster et 1230 York Avenue al., 2000; Renn et al., 1999). New York, New York 10021 VRI’s contribution to PDF expression and behavioral signaling indicated a potential mechanism for creating extensive pathways of circadian regulation. Since CLK/ Summary CYC activity oscillates, patterns of diverse gene expres- sion might be influenced by the clock through transcrip- Mechanisms composing Drosophila’s clock are con- tional controls using this circadian activator. Evidence served within the animal kingdom. To learn how such for such a strategy has also come from independent clocks influence behavioral and physiological rhythms, studies of the mammalian clock, which is highly homolo- we determined the complement of circadian tran- gous to that of the fly. Vasopressin, a well-known modu- scripts in adult Drosophila heads.
    [Show full text]
  • Circadian Mechanisms in Medicine
    The new england journal of medicine Review Article Dan L. Longo, M.D., Editor Circadian Mechanisms in Medicine Ravi Allada, M.D., and Joseph Bass, M.D., Ph.D.​​ From the Department of Neurobiology, n addition to the sleep–wake cycle and cognitive functions such Northwestern University, Evanston (R.A.), as learning and memory, intrinsic clocks determine nearly all circadian cycles and the Department of Medicine, Divi- sion of Endocrinology, Metabolism, and in physiology, such as daily variation in blood pressure, heart rate, hormone Molecular Medicine, Feinberg School of I levels, respiratory and exercise capacity, and coagulation. Many pathologic events Medicine, Northwestern University, Chi- occur at specific times of day, indicating that circadian processes contribute to cago (J.B.) — both in Illinois. Address reprint requests to Dr. Bass at the De- disease (Fig. 1). A central function of the clock system is to drive periods of en- partment of Medicine, Northwestern ergy acquisition and use in anticipation of the cycling of day and night. A molecular University, 303 E. Superior St., Lurie understanding of circadian time opens therapeutic insights that can help prevent 7-107, Chicago, IL 60611, or at j-bass@ northwestern . edu. and treat disease. N Engl J Med 2021;384:550-61. DOI: 10.1056/NEJMra1802337 Circadian Organization of Physiology Copyright © 2021 Massachusetts Medical Society. Circadian rhythms persist even in constant conditions with a period that is almost 24 hours (circa diem, about a day). (See the box for a brief summary.) Light entrains the clock to the 24-hour rotation of Earth (Fig. 1). The first forms of life to tell time according to the light–dark cycle were photosynthetic eubacteria.
    [Show full text]
  • Extent and Character of Circadian Gene Expression in Drosophila Melanogaster: Identification of Twenty Oscillating Mrnas in the Fly Head Russell N
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Extent and character of circadian gene expression in Drosophila melanogaster: identification of twenty oscillating mRNAs in the fly head Russell N. Van Gelder* t, Helen Bae*, Michael J.Palazzolo* and Mark A. Krasnow* *Department of Biochemistry, Stanford University School of Medicine, Stanford, California 94305, USA. tBasic Sleep Research Laboratory, Stanford University School of Medicine, Stanford, California 94305, USA. Human Genome Project, Lawrence Berkeley Laboratories, University of California, Berkeley, Berkeley, California 94720, USA. Background: Although mRNAs expressed with a is also maximally expressed (but when the flies are circadian rhythm have been isolated from many species, inactive). Further analysis of the three 'morning' cDNAs the extent and character of circadianly regulated gene showed that each has a unique dependence on the pres- expression is unknown for any animal. In Drosophila ence of a light-dark cycle, on timed feeding, and on the melanogaster, only the period (per) gene, an essential com- function of the per gene for its oscillation. These depen- ponent of the circadian pacemaker, is known to show dencies were different from those determined for per and rhythmic mRNA expression. Recent work suggests that for a novel 'evening' gene. Sequence analysis indicated the encoded Per protein controls its own transcription by that all but one of the 20 cDNAs identified previously an autoregulatory feedback loop. Per might also control uncloned genes. the rhythmic expression of other genes to generate Conclusions: Diurnal control of gene expression is a circadian behavior and physiology.
    [Show full text]
  • RNA-Seq Analysis of Drosophila Clock and Non- Clock Neurons Reveals Neuron-Specific Cycling and Novel Candidate Neuropeptides
    RESEARCH ARTICLE RNA-seq analysis of Drosophila clock and non- clock neurons reveals neuron-specific cycling and novel candidate neuropeptides Katharine C. Abruzzi, Abigail Zadina¤a, Weifei Luo, Evelyn Wiyanto¤b, Reazur Rahman, Fang Guo, Orie Shafer¤c, Michael Rosbash* Howard Hughes Medical Institute and National Center for Behavioral Genomics,Department of Biology, Brandeis University, Waltham, United States of America ¤a Current address: Columbia University, Graduate School in Neurobiology and Behavior, New York, New a1111111111 York, United States of America a1111111111 ¤b Current address: Lake Erie College of Osteopathic Medicine, Erie, PA, United States of America a1111111111 ¤c Current address: University of Michigan, Molecular, Cellular, and Developmental Biology, Ann Arbor, MI, a1111111111 Massachusetts, United States of America a1111111111 * [email protected] Abstract OPEN ACCESS Locomotor activity rhythms are controlled by a network of ~150 circadian neurons within the Citation: Abruzzi KC, Zadina A, Luo W, Wiyanto E, adult Drosophila brain. They are subdivided based on their anatomical locations and proper- Rahman R, Guo F, et al. (2017) RNA-seq analysis ties. We profiled transcripts ªaround the clockº from three key groups of circadian neurons of Drosophila clock and non-clock neurons reveals with different functions. We also profiled a non-circadian outgroup, dopaminergic (TH) neu- neuron-specific cycling and novel candidate neuropeptides. PLoS Genet 13(2): e1006613. rons. They have cycling transcripts but fewer than clock neurons as well as low expression doi:10.1371/journal.pgen.1006613 and poor cycling of clock gene transcripts. This suggests that TH neurons do not have a Editor: Achim Kramer, ChariteÂÐ canonical circadian clock and that their gene expression cycling is driven by brain systemic UniversitaÈtsmedizin Berlin, GERMANY cues.
    [Show full text]
  • Circadian Clock Genes in Drosophila: Recent Developments
    In dian Journ al of Experimental Biology Vo l. 41, August 2003, pp. 797-804 Review Article Circadian clock genes in Drosophila: Recent developments P Subramanian', E Balamurugan & G Suthakar Department of Bi ochemi stry. Faculty o f Science, Annamalai University, Annamalain agar 608002, India Circadian rh ythms provide a temporal framcwork to li vin g organi sms and are establi shed in a majority of euk aryotes and in a few prokaryotes. The mo lecul ar mechani sms of c ircadian clock is constantly being investi gated in Drosophila melanogaster. The core of th e clock mechan ism was described by a transcription-translati o n feedback loop mode l involving period (per), timeless (t im ), dc/ock and cycle gcnes. However, recent rescarch has idcntified multiple feedback loops cont rolli ng rh ythm generation and expressio n. Novcl mutations o f timeless throw more li ght on thc functions of per and tilll products. Analysis of pdf neuropcptide gene (expressed in c ircadian pacemaker cell s in Drosophila), indicate that PDF acts as the princ ipal c ircadian transmitter and is in vo lved in output path ways. The product of cryptoci!rollle is known to functi on as a circadian photoreceptor as well as component of the circadian clock. This review focuses on thc recent progress in th c fie ld of molecular rhythm research in the fruit n y. The genc(s) andthc gcne product(s) that are in volved in the transmi ssion of environment al information to the clock, as well as the timing signal s from the clock outward to ccllular functi ons are remai n to be determined.
    [Show full text]
  • The Circadian Clock, Transcriptional Feedback and the Regulation of Gene Expression
    The Circadian Clock, Transcriptional Feedback and the Regulation of Gene Expression Nobel Prize Lecture Stockholm December 7, 2017 Current Lab Members • Kate Abruzzi • Dylan Ma • Madelen Diaz • Reazur Rahman • Fang Guo • Jenn Sherk • Meghana Holla • Matthias Schlichting • Hua Jin • Patrick Weidner • Qunlong Li • Jason Xi • Weifei Luo • Weijin Xu • Albert Yu Current Lab Members • Kate Abruzzi • Dylan Ma • Madelen Diaz • Reazur Rahman • Fang Guo • Jenn Sherk • Meghana Holla • Matthias Schlichting • Hua Jin • Patrick Weidner • Qunlong Li • Jason Xi • Weifei Luo • Weijin Xu • Albert Yu CIRCADIAN RHYTHMS • Biochemical, physiological, behavioral adaptations to external daily oscillations - rotation of the earth. • Purpose #1: anticipation of daily environmental changes. • Purpose #2: coherence of internal processes. Circadian Rhythms are Ancient and Nearly Ubiquitous Oldest Known Clock is in Cyanobacteria: Oxygenation of the Atmosphere > 2 Billion Years ago Circadian Clocks Exist in Different Kingdoms and Probably Evolved Multiple Times in Evolution Bacteria Plants Animals A Simple Systems View of Circadian Clocks The Beginning (period mutants) Konopka and Benzer (1971) Early Brandeis Cloning Crew Cloning, Identifying and Sequencing period Gene and Protein in the early-mid 80s Rosbash Lab: Pranitha Reddy, Qiang Yu, Xin Liu, Yoav Citri Pioneer Protein! Yu et al., 1987 • PER has an intriguing repeat region, but it is not necessary for circadian function. Cell. 1988 Jan 15;52(1):143-51. The Drosophila single-minded gene encodes a nuclear protein with sequence similarity to the per gene product. Crews ST, Thomas JB, Goodman CS. Two Decades Post- Konopka and Benzer… Nature, 1990 Original Gel -- under Glass (A Recent Gift from Paul Hardin) Cautious Model: No mention of Transcription in the Title or Abstract Four Important Follow-up Papers • 1992: Circadian oscillations in period gene mRNA levels are transcriptionally regulated.
    [Show full text]
  • RNA-Seq Profiling of Small Numbers of Drosophila Neurons
    CHAPTER SEVENTEEN RNA-seq Profiling of Small Numbers of Drosophila Neurons Katharine Abruzzi*, Xiao Chen*, Emi Nagoshi†, Abby Zadina*, Michael Rosbash*,1 *Department of Biology, Howard Hughes Medical Institute and National Center for Behavioral Genomics, Brandeis University, Waltham, Massachusetts, USA †Department of Genetics and Evolution, University of Geneva, Geneva, Switzerland 1Corresponding author: e-mail address: [email protected] Contents 1. Introduction 370 2. Results/Methods 371 2.1 Isolating neurons of interest 371 2.2 Amplification of mRNA 373 2.3 Amplification of miRNA 378 3. Discussion 382 References 385 Abstract Drosophila melanogaster has a robust circadian clock, which drives a rhythmic behavior pattern: locomotor activity increases in the morning shortly before lights on (M peak) and in the evening shortly before lights off (E peak). This pattern is controlled by 75 pairs of circadian neurons in the Drosophila brain. One key group of neurons is + the M-cells (PDF large and small LNvs), which control the M peak. A second key group is the E-cells, consisting of four LNds and the fifth small LNv, which control the E peak. Recent studies show that the M-cells have a second role in addition to controlling the M peak; they communicate with the E-cells (as well as DN1s) to affect their timing, prob- ably as a function of environmental conditions (Guo, Cerullo, Chen, & Rosbash, 2014). To learn about molecules within the M-cells important for their functional roles, we have adapted methods to manually sort fluorescent protein-expressing neurons of interest from dissociated Drosophila brains. We isolated mRNA and miRNA from sorted M-cells and amplified the resulting DNAs to create deep-sequencing libraries.
    [Show full text]
  • The MAP Kinase P38 Is Part of Drosophila Melanogaster's
    The MAP Kinase p38 Is Part of Drosophila melanogaster’s Circadian Clock Verena Dusik1, Pingkalai R. Senthilan1, Benjamin Mentzel2, Heiko Hartlieb1, Corinna Wu¨ lbeck3, Taishi Yoshii4, Thomas Raabe2, Charlotte Helfrich-Fo¨ rster1* 1 Neurobiology and Genetics, Biocenter, University of Wu¨rzburg, Wu¨rzburg, Germany, 2 Institute of Medical Radiation and Cell Research, University of Wu¨rzburg, Wu¨rzburg, Germany, 3 Institute of Zoology, University of Regensburg, Regensburg, Germany, 4 Graduate School of Natural Science and Technology, Okayama University, Okayama, Japan Abstract All organisms have to adapt to acute as well as to regularly occurring changes in the environment. To deal with these major challenges organisms evolved two fundamental mechanisms: the p38 mitogen-activated protein kinase (MAPK) pathway, a major stress pathway for signaling stressful events, and circadian clocks to prepare for the daily environmental changes. Both systems respond sensitively to light. Recent studies in vertebrates and fungi indicate that p38 is involved in light- signaling to the circadian clock providing an interesting link between stress-induced and regularly rhythmic adaptations of animals to the environment, but the molecular and cellular mechanisms remained largely unknown. Here, we demonstrate by immunocytochemical means that p38 is expressed in Drosophila melanogaster’s clock neurons and that it is activated in a clock-dependent manner. Surprisingly, we found that p38 is most active under darkness and, besides its circadian activation, additionally gets inactivated by light. Moreover, locomotor activity recordings revealed that p38 is essential for a wild-type timing of evening activity and for maintaining ,24 h behavioral rhythms under constant darkness: flies with reduced p38 activity in clock neurons, delayed evening activity and lengthened the period of their free-running rhythms.
    [Show full text]
  • Characterization of Basal Gene Expression Trends Over a Diurnal Cycle in Xiphophorus Maculatus Skin, Brain and Liver
    HHS Public Access Author manuscript Author ManuscriptAuthor Manuscript Author Comp Biochem Manuscript Author Physiol Manuscript Author C Toxicol Pharmacol. Author manuscript; available in PMC 2019 June 01. Published in final edited form as: Comp Biochem Physiol C Toxicol Pharmacol. 2018 June ; 208: 2–11. doi:10.1016/j.cbpc.2017.11.013. Characterization of Basal Gene Expression Trends Over a Diurnal Cycle in Xiphophorus maculatus Skin, Brain and Liver Yuan Lu, Jose Reyes, Sean Walter, Trevor Gonzalez, Geraldo Medrano, Mikki Boswell, William Boswell, Markita Savage, and Ronald Walter* The Xiphophorus Genetic Stock Center, Department of Chemistry and Biochemistry, 419 Centennial Hall, Texas State University, San Marcos, TX Abstract Evolutionarily conserved diurnal circadian mechanisms maintain oscillating patterns of gene expression based on the day-night cycle. Xiphophorus fish have been used to evaluate transcriptional responses after exposure to various light sources and it was determined that each source incites distinct genetic responses in skin tissue. However, basal expression levels of genes that show oscillating expression patterns in day-night cycle, may affect the outcomes of such experiments, since basal gene expression levels at each point in the circadian path may influence the profile of identified light responsive genes. Lack of knowledge regarding diurnal fluctuations in basal gene expression patterns may confound the understanding of genetic responses to external stimuli (e.g., light) since the dynamic nature of gene expression implies animals subjected to stimuli at different times may be at very different stages within the continuum of genetic homeostasis. We assessed basal gene expression changes over a 24-hour period in 200 select Xiphophorus gene targets known to transcriptionally respond to various types of light exposure.
    [Show full text]
  • The BLMP-1 Transcription Factor Promotes Oscillatory Gene Expression to Achieve Timely Molting
    bioRxiv preprint doi: https://doi.org/10.1101/2021.07.05.450828; this version posted July 5, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. The BLMP-1 transcription factor promotes oscillatory gene expression to achieve timely molting Yannick P. Hauser1,2, Milou W.M. Meeuse1,2, Dimos Gaidatzis1,3, Helge Großhans1,2,4 5 1 Friedrich Miescher Institute for Biomedical Research (FMI), Maulbeerstrasse 66, CH-4058 Basel. 2 University of Basel, Petersplatz 1, CH-4001 Basel. 3 Swiss Institute of Bioinformatics, Basel, Switzerland. 4 Correspondence to: [email protected] 10 Abstract Gene expression oscillators can coordinate developmental events in space and time. In C. elegans, a gene expression oscillator directs rhythmic accumulation of ~25% of the transcriptome, and thus thousands of transcripts, presumably to control molting, a process of 15 rhythmic skin regeneration. The mechanism and organization of the oscillator are not known. Here, we report that rhythmic RNA polymerase II recruitment to promoters produces transcript level oscillations. We identify BLMP-1, orthologous to the mammalian transcription repressor PRDM1, as a rhythmically accumulating transcription factor that is required for timely molting, and oscillatory gene expression. We propose a dual function for 20 BLMP-1 in shaping oscillatory gene expression and coupling it to a set of direct targets, which ensures cuticular integrity. With mammalian PRDM1/BLIMP1 promoting regular cycles of postnatal hair follicle regeneration, our findings point to the possible existence of a fundamentally conserved clock mechanism in control of rhythmic skin regeneration.
    [Show full text]
  • Bioinformatic Analysis of Circadian Reprogramming Events
    UNIVERSITY OF CALIFORNIA, IRVINE Bioinformatic Analysis of Circadian Reprogramming Events DISSERTATION submitted in partial satisfaction of the requirements for the degree of DOCTOR OF PHILOSOPHY in Computer Science by Nicholas Joseph Ceglia Dissertation Committee: Professor Pierre Baldi, Chair Professor Paolo Sassone-Corsi Assistant Professor Marco Levorato 2018 c 2018 Nicholas Joseph Ceglia DEDICATION To my mom and dad. ii TABLE OF CONTENTS Page LIST OF FIGURES vi ACKNOWLEDGMENTS ix CURRICULUM VITAE x ABSTRACT OF THE DISSERTATION xii 1 Data Analysis of Circadian Rhythms 1 1.1 Introduction.................................... 1 1.2 ToolsandMethods ................................ 3 1.3 ExperimentalResults. .. 3 1.4 LargeScaleAnalysis ............................... 4 2 Software 5 2.1 BIO CYCLE ................................... 5 2.1.1 Motivation................................. 5 2.1.2 DatasetCuration ............................. 8 2.1.3 PeriodicandAperiodicSignals. .. 13 2.1.4 Statistics.................................. 14 2.2 CircadiOmics ................................... 15 2.2.1 Goals.................................... 15 2.2.2 WebServerArchitecture . 16 2.2.3 DataRepository ............................. 16 2.2.4 DataDiscovery .............................. 18 2.2.5 Visualization ............................... 19 2.2.6 MetabolomicAtlas ............................ 20 2.2.7 Impact................................... 20 3 CircadianReprogrammingbyNutritionalChallenge 23 3.1 HighFatDiet-InducedReprogramming . .... 23 3.1.1 Reorganization
    [Show full text]