Transcriptomic and epigenomics atlas of myotubes reveals insight into the circadian control of metabolism and development Altnta, Ali; Laker, Rhianna C; Garde, Christian; Barrès, Romain; Zierath, Juleen R Published in: Epigenomics DOI: 10.2217/epi-2019-0391 Publication date: 2020 Document version Publisher's PDF, also known as Version of record Document license: CC BY-NC-ND Citation for published version (APA): Altnta, A., Laker, R. C., Garde, C., Barrès, R., & Zierath, J. R. (2020). Transcriptomic and epigenomics atlas of myotubes reveals insight into the circadian control of metabolism and development. Epigenomics, 12(8), 701- 713. https://doi.org/10.2217/epi-2019-0391 Download date: 25. Sep. 2021 Research Article For reprint orders, please contact: [email protected] Transcriptomic and epigenomics atlas of myotubes reveals insight into the circadian control of metabolism and development Ali Altıntas¸‡,1 , Rhianna C Laker‡,1, Christian Garde1, Romain Barres` 1 & Juleen R Zierath*,1,2 1Section for Integrative Physiology, The Novo Nordisk Foundation Center for Basic Metabolic Research, University of Copenhagen, Copenhagen, Denmark 2Section for Integrative Physiology, Department of Molecular Medicine & Surgery, Karolinska Institutet, Stockholm, Sweden *Author for correspondence: [email protected] ‡Authors contributed equally Aim: Innate circadian rhythms are critical for optimal tissue-specific functions, including skeletal muscle, a major insulin-sensitive tissue responsible for glucose homeostasis. We determined whether transcriptional oscillations are associated with CpG methylation changes in skeletal muscle. Materials & methods: We performed rhythmicity analysis on the transcriptome and CpG methylome of circadian synchronized my- otubes. Results: We identified several transcripts and CpG-sites displaying oscillatory behavior, which were enriched with Gene Ontology terms related to metabolism and development. Oscillating CpG methylation was associated with rhythmic expression of 31 transcripts. Conclusion: Although circadian oscillations may be regulated by rhythmic DNA methylation, strong rhythmic associations between transcriptome and CpG methylation were not identified. This resource constitutes a transcriptomic/epigenomic atlas of skeletal muscle and regulation of circadian rhythms. First draft submitted: 17 December 2019; Accepted for publication: 5 February 2020; Published online: 11 March 2020 Keywords: C2C12 • circadian • epigenetics • methylation • muscle • myotube • transcriptomics Circadian rhythms allow organisms to optimize various behavioral and physiological functions throughout the 24 h day–night cycle. Peripheral tissues are under the control of both the central clock, entrained by light signaling through the optical nerve to the suprachiasmatic nucleus and an intrinsic clock, entrained by a variety of environmental and systemic cues, including dietary factors, physical activity, metabolic demand and circulating hormones [1,2]. Mounting evidence indicates that when human behavior becomes out-of-sync with the central and peripheral clocks (e.g., after shift work or jet lag), whole body metabolism is perturbed and the risk for the development of Type 2 diabetes is increased [3–5]. Understanding the genomic mechanisms by which Zeitgebers (time givers) regulate the circadian expression of genes in metabolic tissues may give insight into disease mechanism for insulin resistance and altered metabolic homeostasis in type 2 diabetes. The intrinsic mammalian circadian clock is comprised of the transcription factors ARNTL (also known as BMAL1) and CLOCK [6]. These molecules dimerize and bind the E-box motif in the promoter of Nr1d1 (also known as Rev-Erbα)todriveNr1d1 transcription. In turn, NR1D1 feeds back and binds the DNA response element in the Arntl promoter and blocks transcription. The binding of NR1D1 is balanced by competitive binding of RORα, which has an opposite function to drive the expression of ARNTL. Concomitantly, ARNTL and CLOCK drive the expression of the Period (Per1, Per2 and Per3) and Cryptochrome (Cry1 and Cry2) genes, whose protein products translocate to the nucleus to block Arntl activity. These molecular cycles oscillate with a 24 h period that correspond with the day–night cycle and function as a transcription–translation feedback loop. ARNTL and CLOCK drive the expression of many genes that function in circadian regulation, but also bind to E-box motifs to regulate transcription of genes that are not classically circadian. 10.2217/epi-2019-0391 C 2020 Juleen R Zierath Epigenomics (2020) 12(8), 701–713 ISSN 1750-1911 701 Research Article Altıntas¸, Laker, Garde, Barres` & Zierath Skeletal muscle is responsible for 70–80% of insulin-stimulated glucose uptake, which is severely reduced with metabolic diseases such as Type 2 diabetes [7]. Mammalian skeletal muscle has an intrinsic molecular clock [8–10] and displays rhythmic expression of metabolic genes, such as Pdk4, Ucp3 and Pgc-1β, as well as genes involved in myogenesis, such as Myod1, Atrogin1 and Murf1 [11,12]. Thus, cellular growth and metabolism are partly under the control of the molecular clock machinery. On a functional level, isolated human muscle fibers [13] and mouse myotubes [14] demonstrate rhythmic oxygen consumption, concomitant with clock-dependent myokine secretion as reported for primary human myotubes [15]. Skeletal muscle loss of Arntl impairs whole body glucose homeostasis and insulin sensitivity and reduces the abundance of GLUT4 and various metabolic enzymes [16]. Thus, circadian rhythmicity is critical for metabolism and contractile function of skeletal muscle. The oscillatory nature of the molecular clock is highly dependent on gene transcription and, consequently, epigenetic regulation has been implicated in the fine tuning of this process. Oscillating histone modifications have been described in circadian regulation of the liver metabolism [17–21]. However, the role of DNA methylation of cytosine bases in the transcriptional regulation of the mammalian circadian clock is unclear. Circadian disruption by shortening the length of day from 24 to 22 h alters promoter DNA methylation in the suprachiasmatic nucleus at 1294 regions and many thereby impact downstream processes, including mood, learning and memory [22].Thus, changes in DNA methylation in response to circadian disruption may impact the central control of behavior. At the cellular level in liver, while circadian oscillations in histone modifications in promoters, gene bodies and enhancers have been reported [21], whole-genome bisulfite sequencing at two distinct circadian timepoints revealed promoter DNA methylation levels were relatively stable [21]. Nevertheless, a comprehensive analysis of genome-wide DNA methylation and transcriptional oscillations at multiple time points and in other peripheral tissues has not been reported. The purpose of our study was to delineate the potential link between the circadian CpG methylation and the regulation of circadian gene expression in skeletal muscle. We performed a time-course analysis of the circadian response of gene expression in cultured skeletal muscle and determined parallel epigenetic regulation by assessing changes in DNA methylation at specific promoter regions that correspond to the circadian gene expression profiles. We examined genome-wide methylation across a time course to determine whether transcriptional oscillations are associated with and potentially regulated by rhythmic DNA methylation. A novel aspect of this work is the generation of a comprehensive genomic atlas of temporal epigenetic and transcriptomic variation, which can serve as an important resource for circadian rhythm studies to investigate diurnal changes in skeletal muscle. Materials & methods Material and resources used in this article are summarized in Table 1. C2C12 cell culture Mouse C2C12 myoblasts were grown in DMEM with 10% fetal bovine serum (FBS) and 1% penstrep. Myoblasts were then seeded into 6-well plates with 50,000 cells per well. At approximately 90% confluence, cells were differentiated using DMEM with 2% horse serum and 1% penicillin–streptomycin. The experiment timeline is outlined in Figure 1A. On day 5 of differentiation, when myotubes were fully maturated, cells were circadian synchronized using 50% horse serum shock for 2 h [32], after which media was returned to normal differentiation media. Cells were harvested starting 12 h after serum shock, every 6 h for 60 h in RLT buffer (Qiagen, Hilden, Germany) with β-mercaptoethanol. RNA and DNA were isolated simultaneously using the RNA/DNA/miRNA AllPrep kit (Qiagen). RNA sequencing RNA was quality assured using the Bioanalyzer instrument (Agilent Technologies, CA, USA) and subjected to the Illumina TruSeq Stranded Total RNA with Ribo-Zero Gold protocol (Illumina, CA, USA) as described. Libraries (n = 3 for each time point) were subjected to 100-bp single-end sequencing on HiSeq 2500 (Illumina) at the Danish National High-Throughput DNA Sequencing Centre. Approximately 22 million reads/sample were assigned to genes with 11,591 genes surviving the expression threshold. Quantitative reverse transcription polymerase chain reaction (RT-qPCR) RT-qPCR analysis of Arntl, Nr1d1 and 18S (NM 003278) was performed using conventional SYBR green chemistry. Primer sequences (5–3)areArntl forward: TAGGATGTGACCGAGGGAAG; reverse: TCAAA- 702 Epigenomics (2020) 12(8) future science group Oscillating CpG methylation in myotubes Research Article -2 h0 h12 h18 h3024 h h36