University of Groningen

New insights into the biological role of COMMD1 Bartuzi, Paulina

IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check the document version below. Document Version Publisher's PDF, also known as Version of record

Publication date: 2014

Link to publication in University of Groningen/UMCG research database

Citation for published version (APA): Bartuzi, P. (2014). New insights into the biological role of COMMD1: from inflammation to steatosis and hypercholesterolemia. [S.n.].

Copyright Other than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons).

The publication may also be distributed here under the terms of Article 25fa of the Dutch Copyright Act, indicated by the “Taverne” license. More information can be found on the University of Groningen website: https://www.rug.nl/library/open-access/self-archiving-pure/taverne- amendment.

Take-down policy If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim.

Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons the number of authors shown on this cover page is limited to 10 maximum.

Download date: 06-10-2021 New insights into the biological role of COMMD1 From inflammation to steatosis and hypercholesterolemia

Paulina Anna Bartuzi ISBN: 978-90-367-7405-5

ISBN (ebook): 978-90-367-7404-8

Funding The research described in this thesis was supported by Groningen University Institute for Drug Exploration (GUIDE) and Jan Kornelis de Cock Stichting.

Printing of this thesis was financially supported by University of Groningen, Groningen, the Netherlands; University Medical Center Groningen (UMCG), Groningen, the Netherlands; Groningen University Institute for Drug Exploration (GUIDE), Groningen, the Netherlands Nederlandse Vereniging voor Hepatologie (NVH)

©2014, Paulina Bartuzi No part of this book may be reproduced, stored in retrieval system, or transmitted in any form or by any means without prior permission of the author or, where applicable, the publisher holding the copyright on the published articles.

Cover design: Paulina Bartuzi Book layout: Lovebird design & printing solutions (www.lovebird-design.com) Printed by: EIKON Plus, Kraków, Poland

ISBN: 978-90-367-7405-5 ISBN (ebook): 978-90-367-7404-8 New insights into the biological role of COMMD1 From inflammation to steatosis and hypercholesterolemia

PhD thesis

to obtain the degree of PhD at the University of Groningen on the authority of the Rector Magnificus Prof. E. Sterken and in accordance with the decision by the College of Deans.

This thesis will be defended in public on

Wednesday 10 December 2014 at 09.00 hours

by

Paulina Anna Bartuzi

born on 1 August 1986 in Kraków, Poland Supervisor Prof. M.H. Hofker

Co-supervisor Dr. ing A.J.A. van de Sluis

Assessment committee Prof. K. Willems van Dijk Prof. K.N. Faber Prof. M.P.J. de Winther CONTENTS

PREFACE 7

CHAPTER 1 General introduction 9

CHAPTER 2 Tuning NF-κB: A touch of COMMD proteins 25

CHAPTER 3 Functional understanding of the versatile protein 43 copper metabolism MURR1 domain 1 (COMMD1) in copper homeostasis CHAPTER 4 Copper metabolism domain containing 1 represses genes 59 that promote inflammation and protects mice from colitis and colitis-associated cancer CHAPTER 5 A cell-type-specific role for Commd1 in liver inflammation 91

CHAPTER 6 Loss of hepatocyte COMMD1 results in increased levels 113 of circulating low-density lipoprotein cholesterol CHAPTER 7 Hepatic COMMD1 deficiency is associated with liver 135 microsteatosis and decreased inflammation upon long-term high-fat, high cholesterol feeding CHAPTER 8 Discussion 151

SUMMARIES Summary 171

Podsumowanie 173

Samenvatting 176

Acknowledgements 179

Curriculum Vitae 181

List of publications 182

PREFACE

Our current knowledge of the COMMD family originates mainly from studies on COMMD1, but there is still a lot to learn about the mechanisms and cell-type specific differences governing the function of COMMD1. To date, all the information available on the role of Commd1 in biological pathways other than copper metabolism has come solely from in vitro cell experiments. The studies described in this thesis aim to investigate the role of Commd1 during hepatic steatosis and inflammation in vivo, using conditional Commd1- deficient mice. This thesis gives new insights into the possible functions of COMMD1, as the loss of Commd1 affects hepatic lipid accumulation, clearance of circulating LDL-c, and NF-κB regulation. The thesis consists of eight chapters. Chapter 1 briefly introduces the topic and pathogenesis of non-alcoholic fatty liver disease (NAFLD). It also summarizes low- density lipoprotein (LDL) trafficking through LDL receptor (LDLR) and introduces the aspect of multifunctionality of COMMD1. Chapter 2 provides an overview of the actions of COMMD family with respect to NF-κB pathway. Nevertheless, the main focus of this chapter is COMMD1 as the prototype of the family. In Chapter 3 the role of COMMD1 in vesicular transport, especially its interaction and regulation of hepatic copper export through P-type ATPase transporters Atp7A and Atp7B is described. Chapter 4 provides the first in vivo proof of COMMD1’s role in suppressing the inflammatory response. A mouse model of a conditional myeloid-specific Commd1 knockout (Commd1∆Mye) is described in the context of colitis and sepsis. Further clarification of the role of COMMD1 in hepatocytes is presented in Chapter 5. The focus of this chapter is to dissect cell-type-specific differences in the function of Commd1 in the liver during non-alcoholic fatty liver disease (NAFLD). Two conditional knockouts placed on a high-fat, high-cholesterol (HFC) diet for 12 weeks were investigated: hepatocyte (Commd1∆Hep) and myeloid-specific (Commd1∆Mye). Chapter 5 provides a novel role for Commd1 in steatosis progression and advocates that it has no evident action on hepatic inflammation. On the contrary, myeloid Commd1 suppresses liver inflammation during the progression of NAFLD to NASH. Following on from the role of dyslipidemia feature of NAFLD, Chapter 6 presents a novel link between Commd1 and hypercholesterolemia. Commd1∆Hep mice were shown to have significantly increased levels of plasma LDL-cholesterol and impaired circulating LDLc clearance through hepatocyte LDLR. This chapter reports, for the first time, that Commd1 acts as an adaptor protein to mediate trafficking of the LDLR in hepatocytes and further advocates a more common role of Commd1 in vesicular transport. Chapter 7 provides more insights into Commd1’s actions in the liver. The long-term (20 weeks) effects of HFC-feeding on liver steatosis in Commd1∆Hep mice are described. Finally, Chapter 8 summarizes the findings presented in this thesis and discusses them.

7

CHAPTER 1

General introduction

General introduction General introduction 1 Obesity is a growing problem worldwide. In European countries its prevalence has increased three-fold in the past 30 years, resulting in over 50% of individuals being overweight and over 20% being obese today. Not only does it affect more and more adults, but children are also more frequently being diagnosed with obesity as well. According to the World Health Organization (WHO), in 2011 more than 40 million under five-years-old children were overweight. Moreover, the WHO also reported that the shocking number of approximately 2.8 million adults die every year because of obesity- and overweight-related health problems, and that globally there are more deaths recorded as a results of obesity or overweight than due to the malnutrition. The increased fat accumulation (which is most commonly manifested as an elevation in body mass index (BMI)) is therefore considered one of the major risk factors for developing a number of health problems and/or severe chronic diseases, including diabetes, hypercholesterolemia, cardiovascular diseases (CVD), asthma, arthritis, or even cancer.

NAFLD

A high percentage of the obese population develops non-alcoholic fatty liver disease (NAFLD). This hepatic disorder comprises features ranging from a benign and simple fatty liver disease called steatosis to much more severe stages, such as cirrhosis or even hepatocellular carcinoma (HCC). NAFLD susceptibility originates from a mixture of factors, from genetic to environmental and lifestyle [1]. The initial histological abnormality of NAFLD is hepatic steatosis, as seen by increased liver triglyceride accumulation, a major hallmark of NAFLD [1, 2]. Furthermore, obese steatotic patients also present with increased adipose tissue-derived free fatty acid (FFA) influx into the liver and elevated de novo lipogenesis (DNL) [3, 4]. The hepatic contribution of triglycerides (TGs) originating from DNL in individuals with NAFLD is approximately 26% [3], whereas in the healthy population DNL accounts for less than 5% of hepatic TG formation [5, 6]. Not only are lipid synthesis pathways affected during NAFLD, but the fatty acid oxidation and secretion is also impaired [7, 8]. Since FFA are thought to be toxic, because they increase oxidative stress and activate inflammatory pathways [9], the described defects in lipid metabolism, which are often accompanied by chronic inflammation, can lead to a number of obesity-related co-morbidities, such as diabetes, CVD or atherosclerosis [10, 11]. In many patients, NAFLD develops in association with the metabolic syndrome. Metabolic syndrome, known also as insulin resistance syndrome or syndrome X [12], is recognized as a set of features comprising dyslipidemia, central obesity, insulin resistance (IR), and hypertension [4]. It is also linked with increased mortality and morbidity due to cardiovascular problems [4]. Additionally, there are other parameters (not included in the general definitions of metabolic syndrome nor in the criteria recommended for its

11 CHAPTER 1

diagnosis), which can support the diagnosis, including elevated inflammatory markers, increased alanine transaminase (ALT) or microalbuminuria [12]. The diagnosis of NAFLD comprises tests and analysis to determine the level of liver damage. A blood test is the most simple and considered to be the initial screen. It can reveal, for example, elevation in the liver enzyme ALT. If other liver diseases are ruled out and metabolic syndrome features are present, NAFLD can be confirmed by an ultrasound, computerized tomography (CT), or magnetic resonance imaging (MRI) scan. However, there is currently no imaging system capable of differentiating between steatosis and non-alcoholic steatohepatitis (NASH), so a liver biopsy has to be performed to determine the presence of NASH and the level of fibrosis [13]. NAFLD can often be prevented or reversed (in its early stages) by improving one’s lifestyle through exercising and eating more healthily in order to reduce weight or by limiting the amount of alcohol consumed [8]. Although there are some treatment options other than cholesterol-lowering statins, like vitamin E or metformin, they are either not recommended for all NAFLD patients or may have some significant side-effects. Therefore, despite the growing knowledge about NAFLD, there is still a great need for better and alternative medical treatments.

NASH

Benign steatosis rarely progresses further to the more severe stages and has no inflammatory component; it manifests only as an increased fat accumulation in the liver. However, when elevated lipid storage is also associated with hepatic inflammation, this more complex entity is called nonalcoholic steatohepatitis (NASH). NASH is the less common, yet more severe, form of NAFLD. Although NASH is currently a major focus of research, the mechanisms underlying the pathogenesis of this multifactorial liver disorder are still poorly understood. Since 1998, when Day and James [14] introduced their “two-hit” hypothesis, this has become the commonly accepted theory for steatohepatitis development for the past 15 years [15]. It assumes that the presence of the “first hit”, namely hepatic steatosis, renders the liver sensitive to the ensuing “second hits” of oxidative stress and proinflammatory cytokines. According to this view, the inflammatory reaction initiated in the liver is the main event responsible for progression to cirrhosis or development of CVD. At this stage, the liver-resident macrophages, Kupffer cells, are thought to play a very important role as the source of cytokines, such as tumor necrosis factor-alpha (TNFα) and interleukin-6 (Il-6). Ongoing and constant release of these atherogenic factors results in a low, chronic inflammatory state, not only in the liver itself, but it is also thought to passively contribute to cardiovascular health problems. The levels of circulating inflammatory markers are strongly elevated in NASH patients. Their presence renders arteries more sensitive to damage and therefore accelerates the process of atherosclerosis [16]. However, recently the relevance of the “two-hit” hypothesis has been questioned. There is increasing evidence to suggest that steatosis and NASH should be considered as separate diseases, since simple steatosis is a benign and non-progressive process in most patients [17].

12 General introduction

Therefore, a “multi-parallel hit” is now being considered as an alternative to the “two-hit” hypothesis and it is perhaps a more adequate model of NASH pathogenesis [17]. According 1 to this theory, multiple “hits” can act at the same time, in parallel, eventually leading to liver inflammation. In some cases, the liver develops steatosis but inflammatory and fibrotic changes are never observed. However, in other cases, since the initiation of the disease process, proinflammatory factors interact with accumulating lipids and ultimately result in NASH [15]. An important difference, based on this model, is that steatosis can be preceded by inflammation. It has been suggested that inflammation, causing hepatocyte stress response, can lead to steatosis [17]. This phenomenon has been observed in NASH patients presenting with little or no hepatic lipid accumulation [18]. In support of this concept is the fact that treatment of Ob/Ob mice with an anti-TNF antibody also improves their steatosis [19]. Increased accumulation of lipids in the liver causes endoplasmic reticulum (ER) dysfunction and increases reactive oxygen species (ROS) production. This process results in oxidative stress and subsequent activation of inflammatory pathways, like the NF-κB pathway [20]. This central inflammatory cascade controls expression of TNF-α and Il-6, the two cytokines crucial during NASH [21]. Their elevated production in obese mice is attributed to the lipid accumulation resulting in low-grade inflammatory reaction [21]. TNF-α and Il-6 can be released from adipose tissue as well as liver KCs, in response to hepatocyte cell death [22]. The absence of either TNFα or Il-6 was shown to not only decrease a high fat diet (HFD)-induced infiltration of macrophages and neutrophils, but also to reduce hepatic steatosis in mice [21]. Persistent NF-κB activation is particularly dangerous; it can have severe consequences, including the development of cancers, e.g. hepatocellular carcinoma (HCC). It is known that IL-6 promotes chemically induced HCC [23] and TNF can induce tumors by promoting cell-survival via anti-apoptotic NF-κB activity [24]. Furthermore, depletion of NEMO/IKKγ, a regulatory subunit of the IKK complex upstream of NF-κB, leads to spontaneous liver steatosis, fibrosis and tumor formation [25, 26]. Altogether, several studies support the conclusion that the role of cytokines and inflammatory response, including the NF-κB pathway, is critical during NASH progression and that both steatosis and chronic hepatic inflammation are closely associated. Changes in cholesterol metabolism observed in NAFLD can have severe toxic effects on hepatocytes, Kupffer cells (KCs) and hepatic stellate cells (HSC) leading to liver injury and NASH development [15, 27, 28]. Disturbances in the regulatory events involved in preserving cholesterol homeostasis in hepatocytes are among the mechanisms underlying the pathogenesis of NAFLD. In NAFLD, the liver increases its production of numerous cytokines as well as of low-density lipoprotein (LDL), thus the fatty liver disease is often associated with high LDL and TG levels and decreased levels of HDL [29]. Importantly, both mRNA and protein expression of the LDL receptor (LDLR), the main gateway for hepatic clearance of plasma LDL, was also shown to be diminished in subjects with non-alcoholic fatty liver (NAFL) and NASH [30]. The LDLR trafficking and function is described in the following sections.

13 CHAPTER 1

LA4 LA3 LA5 Ligand-binding domain LA2 LA1 LA6 LA7 NH2

A EGF-like repeats B A and B EGF-homology Extracellular EGF-like domain domain YWTD-rich β-propeller EGF-like repeats C repeat C

O-linked sugar domain

Transmembrane

domain FxNPxY

Cytosolic YxxΦ domain COOH

Figure 1. LDLR structure. The cytosolic domain has two signaling motifs: proximal FxNPxY, important for internalization and recycling of the receptor, and distal sorting sequence YxxΦ. Φ - bulky hydrophobic side-chain; x - any residue. The transmembrane domain links the cytosolic part with the extracellular domain. The latter comprises three parts: (1) ligand-binding domain with 7 LDLR type A (LA) repeats important for LDL-c binding, (2) EGF-homology domain with 3 EGF- like repeats (EGF-like repeat A is important for PCSK9 binding) and β-propeller sequence consisting of 6 YWTD repeats, and (3) O-linked sugar domain.

LDLR PATHWAY AND TRAFFICKING

Nearly 40 years ago, in 1976, Brown and Goldstein [31] made their important discovery of LDLR, a receptor crucial for cellular uptake of cholesterol-rich LDL particles. LDLR belongs to the LDLR family of endocytic receptors. All the other members, namely very low-density lipoprotein receptor (VLDLR), LDLR-related protein (LRP) 1, LRP1B, LRP2 (Megalin), LRP4 (MegF7), LRP5/6, apoE Receptor 2 (apoER2)/LRP8 and sorting protein- related receptor containing LDLR class A repeats (SorLA)/LR11 [32], show structural and functional similarities to the LDLR, which is considered to be the patriarch of the family [33]. Compared with the other larger family members, LDLR has a relatively simple structure (Fig. 1). This glycoprotein receptor is composed of an extracellular domain,

14 General introduction membrane spanning segment and 50 amino acid-long cytoplasmic tail with an FxNPxY motif, crucial for apoB100-mediated uptake of LDL particles [34, 35]. FxNPxY motif 1 plays a role in incorporating LDLR into the clathrin-coated pits. The role of this motif in receptor internalization was discovered when fibroblasts from a patient with familial hypercholesterolemia (FH) who had a point mutation in tyrosine (Y807) in the FxNPxY motif exhibited a defective internalization in vitro [36]. The extracellular domain consists of the O-linked sugar domain, epidermal growth factor (EGF)-like domain [37] (controlling the pH-dependent release of cargo to lysosomes and receptor recycling [38]), and seven LDLR type A ligand-binding repeats necessary for apoE and apoB100 binding. Clearance of LDL, the main carrier of cholesterol in humans, takes place through hepatic LDLR. The endocytosis of receptor-ligand complexes is performed via clathrin-coated pits (Fig. 2). Apolipoprotein B (ApoB) on the LDL particle is recognized by the LDLR [39]. Upon binding of the LDL particle, the autosomal recessive hypercholesterolemia (ARH) protein binds to the FxNPxY motif in the cytoplasmic tail of LDLR. ARH acts as an adaptor protein and enables the internalization of the receptor-ligand complex. In the presence of ARH, clathrin-coated vesicles are formed and directed to endosomes. After sensing the low pH, ligands dissociate from the receptor and are directed to lysosomes for degradation, whereas the LDLR is recycled back to the cell surface [33]. Internalization of LDL-c and its increased concentration in the cell results in the subsequent suppression of LDLR synthesis in order to limit further LDL uptake. This is regulated through sterol response element binding proteins (SREBPs) [40]. At the same time, cholesterol synthesis is inhibited through reduced gene expression of 3-hydroxy-3-methylglutaryl-CoA reductase (HMGCR) [41]. Finally, to prevent free cholesterol toxicity by increasing its esterification to cholesterol esters, acyl-CoA cholesteryl acyl transferase (ACAT) activity is enhanced [42]. However, it is not always the case that, after the cargo release, LDLR is recycled back to the cell surface for new round of ligand internalization. An important regulator involved in this process is proprotein convertase subtilisin-like/kexin type 9 (PCSK9). PCSK9 is synthesized in ER and activated through autocatalytic enzymatic cleavage, before it is secreted out of the cell. PCSK9 is cleaved between its prodomain and catalytic domain, and afterwards the prodomain still remains tightly associated with the catalytic one, possibly inhibiting further proteolytic activity [43-46]. This cleavage step is necessary for the proper folding of PCSK9, its maturation and exit out of ER [43, 47]. Mutations in PCSK9 identified as “gain-of-function” lead to autosomal-dominant hypercholesterolemia [48-50]. In order to lower plasma cholesterol levels, statins, a class of drugs, are widely prescribed. However, statins also act indirectly on PCSK9. They induce SREBP-2 expression which upregulates LDLR to increase LDL clearance, and additionally elevates PCSK9 expression. Consequently, novel therapies aiming to lower PCSK9 are currently undergoing phase III clinical trials [51]; these are awaited as a new approach for rapidly lowering LDL-c and diminishing CVD risks.

15 CHAPTER 1

LDL

clathrin-coated clathrin-coated

pit pit ARH ARH RECYCLING VESICLE

GOLGI COATED COATED VESICLE VESICLE H+ H+ ER LDLR ENDOSOME PCSK9 ENDOSOME pro-PCSK9 LDLR SREBP-2 PCSK9

LYSOSOME LYSOSOME

Figure 2. Overview of the LDLR recycling pathway and effect of PCSK9 on LDLR trafficking. SREBP-2 expression controls and upregulates the synthesis of LDLR and PCSK9. They are synthesized in ER, where PCSK9 undergoes proteolytic cleavage, and both are directed to the Golgi (central part of the scheme). Already here, PCSK9 possibly interacts with LDLR and targets it for lysosomal degradation. From the Golgi, LDLR and PCSK9 are sorted to the cell surface. At the cell surface LDL cholesterol (LDL-c) binds to the LDLR (right part of the scheme) and, upon ARH binding to the receptor’s cytosolic tail, LDLR with its cargo is internalized in clathrin-coated pits. In endosomes, due to the low pH, LDL dissociates from the receptor and is further degraded in lysosomes, whereas LDLR is recycled back to the cell surface. However, in the presence of secreted PCSK9 (left part of the scheme), both LDL-c and PCSK9 bind to the extracellular domain of LDLR. This eventually results in the lysosomal degradation of both LDLR and its ligands.

LDL AND HYPERCHOLESTEROLEMIA, LDL AND LDLR

An increase in circulating LDL is, next to NAFLD, also observed in familial hypercholesterolemia (FH) (OMIM 143890) [52], an autosomal dominant disorder, and its phenocopy, autosomal recessive hypercholesterolemia (ARH) (OMIM 603813) [53]. Patients suffering from FH carry mutations in LDLR leading to problems with its internalization and, in many cases, subsequent accumulation at the cell surface [54]. Patients with ARH display mutations in the gene encoding ARH adaptor protein and, similar to FH patients, present with elevated plasma LDL cholesterol (LDL-c) levels. The FH phenotype is gene- dose dependent and is considered to be generally more severe than the ARH phenotype, as also shown in experiments involving Ldlr/- and Arh-/- mouse models of the diseases.

16 General introduction

Both mouse models are highly sensitive to dietary cholesterol and have significantly impaired in vivo LDL clearance. However, even when fed cholesterol-enriched diet, Arh-/- mice display 1 lower plasma cholesterol levels compared to Ldlr-/- mice. A possible explanation for this is that Ldlr accumulated on the hepatocyte membrane of Arh-/- mice binds VLDL cholesterol, which is subsequently enriched with ApoE and internalized by Lrp, thereby reducing the LDL precursor pool in circulation [55-56]. The reported ARH point and frameshift mutations introduce stop codons and result in the premature termination of translation, the outcome of which is a lack of ARH protein [54]. However, the diversity in LDLR mutations causing FH (described in detail below) and leading to a variable impact on LDLR function is the source of the heterogeneity seen between the clinical phenotypes of FH patients. LDLR mutations can be divided into five classes depending on the step in the LDLR pathway that is affected by the mutation [57]. Class 1 mutations prevent production of a protein. Class 2 affects transport of the receptor from ER to the Golgi for expression at the cell surface either completely (Class 2a), or partially (Class 2b). Class 3 LDLR mutations prevent binding of apoB100 (Class 3a), or apoE (Class 3b) ligands. Class 4 represents mutations leading to impairment of clustering in clathrin-coated pits and therefore impairment of receptor-cargo complex endocytosis, and finally, class 5 affects the release of receptor-bound ligand and recycling of the receptor back to the cell surface for internalization of the next cargo. Overall, impaired clearance of the highly atherogenic LDL-c leads to a significantly increased risk for premature CVD and atherosclerosis [58]. Atherosclerotic lesions contain high amounts of lipoproteins accumulated by foam cells (arising from macrophages and smooth muscle cells) [59]. The decreased rate of circulating LDL-c removal, which is normally taken up by hepatocytes through binding to LDLR and receptor-mediated endocytosis, results in deposition of cholesterol in different tissues, like skin, tendons and coronary arteries [55]. Therefore, patients with either ARH or FH develop, next to xanthomas, premature atherosclerosis more often than the rest of the population, and a significant percentage of these patients show evidence of coronary artery disease.

COMMD1 – A PROTEIN INVOLVED IN VARIOUS CELLULAR PROCESSES

Copper Metabolism Murr1 Domain containing protein 1 (COMMD1) belongs to a family of 10 proteins, which all contain a C-terminal motif called the COMM domain [60]. COMMD proteins have emerged as potential NF-κB inhibitors [60]. Their role in regulating this important inflammatory pathway was shown in a series of in vitro experiments [61, 62]. COMMD1, the family prototype, destabilizes interaction between RelA (p65), an NF-κB subunit, and chromatin. It promotes RelA ubiquitination and its subsequent proteasomal degradation [60, 63]. However, despite a number of follow-up studies clarifying the mechanism by which COMMD1 regulates NF-κB, we still know little about its true role in inflammatory diseases. Details about the role of COMMD1 and other family members in repressing NF-κB activity are discussed in Chapter 2 of this thesis [64].

17 CHAPTER 1

Free radical Copper scavenging transport ATP7A Membrane proteins SOD1 CCS ATP7B CFTR PtdIns Protein aggregation (4,5)P2 mutant SOD1 PARKIN Trafficking LDLR

Ubiquitination

Cullins SOCS1 COMMD1 ENaC NKCC1 Ion transporters

Inflammation & CCDC22 NF-κB signaling ? NF-κB IκBα subunits HIF1 CHK2 DNA Damage Transcription Response regulation

Figure 3. The puzzling pleiotropic functions of COMMD1 – a simplified overview.COMMD1 is associated with multiple cellular processes via interactions with a wide array of proteins (examples are depicted in the scheme above). Many of these functions can be segregated into overlapping categories, such as ion transport, copper transport, inflammation or free radical scavenging. The question mark represents other possible, so far undiscovered, functions of COMMD1.

COMMD proteins owe a part of their name to the fact that COMMD1 was initially discovered to play a role in copper metabolism in dogs [65]. It was found that Bedlington terriers homozygous for a COMMD1 loss-of-function mutation suffer from hepatic copper toxicosis. Several studies have indicated that COMMD1 mediates the biliary export of copper through an interaction with the Wilson disease protein, a P-type ATPase, ATP7B [66-69]. Recently, hepatic copper accumulation was also observed in hepatocyte-specific Commd1-deficient mice upon feeding a copper-rich diet [70]. Altogether, based on our current knowledge, it is tempting to speculate that COMMD1 acts as an adaptor protein to mediate the trafficking of copper-enriched vesicles, either dependent or independent of the copper-transporting protein ATP7B. However, the mechanism of COMMD1’s action in this process is not fully understood. A detailed review of COMMD1’s role in copper metabolism is included in Chapter 3 of this thesis [71]. The possible role of COMMD1 in protein trafficking is supported by several recent studies. COMMD1 associates with membrane phospholipids, especially phosphatidylinositol

4,5-bisphosphate, PtdIns(4,5)P2, which is involved in the process of endocytosis [72]. 18 General introduction

COMMD1 was proven to interact with the epithelial sodium channel (ENaC) [73] and affect the sodium and potassium chloride channel (NKCC1) [74]. Furthermore, 1 COMMD1 regulates the cystic fibrosis transmembrane conductance regulator (CFTR) [75]. The common effect of COMMD1 on the latter membrane proteins is their altered cellular localization at the cell surface. An overview of pathways in which COMMD1 was suggested to play a role is included in Chapter 3 of this thesis. COMMD1 is a multifunctional protein (Fig. 3). To date, its name has been associated with several, apparently distinct, but in many cases overlapping, cellular processes. It regulates transcription factors, like NF-κB and HIF-1, and is involved in facilitating the proteasomal degradation of proteins, either dependent or independent of ubiquitin [60, 63, 76-78]. Furthermore, recent studies have suggested a role for COMMD1 in DNA damage response (DDR) and in mediating the aggregation of proteins associated with neurodegenerative diseases, such as familial Amyotrophic Lateral Sclerosis (ALS) and Parkinson’s disease [79]. However, due to COMMD1’s multifunctional nature, it is very likely that several other proteins/processes will be added to the scheme in the near future.

19 CHAPTER 1 References

[1] A. Naik, R. Košir, and D. Rozman, Genomic aspects of NAFLD pathogenesis, Genomics, 102 (2013) 84-95. [2] Tacer and Rozman, Nonalcoholic fatty liver disease: focus on lipoprotein and lipid deregulation, J Lipids, 2011 Article ID 783976 (2011) 14 pages. [3] K.L. Donnelly, C.I. Smith, S.J. Schwarzenberg, J. Jessurun, M.D. Boldt, and E.J. Parks, Sources of fatty acids stored in liver and secreted via lipoproteins in patients with nonalcoholic fatty liver disease, J Clin Invest, 115 (2005) 1343-1351. [4] J.K. Dowman, J.W. Tomlinson, and P.N. Newsome, Pathogenesis of non-alcoholic fatty liver disease, QJM, 103 (2010) 71-83. [5] L.C. Hudgins, M.K. Hellerstein, C.E. Seidman, R.A. Neese, J.D. Tremaroli, and J. Hirsch, Relationship between carbohydrate-induced hypertriglyceridemia and fatty acid synthesis in lean and obese subjects, J Lipid Res, 41 (2000) 595-604. [6] E.J. Parks, Dietary carbohydrate’s effects on lipogenesis and the relationship of lipogenesis to blood insulin and glucose concentrations, Br J Nutr, 87 Suppl 2 (2002) S247-S253. [7] Kohjima, Enjoji, Higuchi, Kato, Kotoh, Yoshimoto, Fujino, M. Yada, Yada, Harada, Takayanagi, and Nakamuta, Re-evaluation of fatty acid metabolism-related gene expression in nonalcoholic fatty liver disease, Int J Mol Med, 20 3 (2007) 351-8. [8] C. Postic and J. Girard, Contribution of de novo fatty acid synthesis to hepatic steatosis and insulin resistance: lessons from genetically engineered mice, J Clin Invest, 118 (2008) 829-838. [9] A.E. Feldstein, N.W. Werneburg, A. Canbay, M.E. Guicciardi, S.F. Bronk, R. Rydzewski, L.J. Burgart, and G.J. Gores, Free fatty acids promote hepatic lipotoxicity by stimulating TNF-alpha expression via a lysosomal pathway, Hepatology, 40 (2004) 185-194. [10] R.K. Schindhelm, R.J. Heine, and M. Diamant, Prevalence of nonalcoholic fatty liver disease and its association with cardiovascular disease among type 2 diabetic patients: response to Targher et al., Diabetes Care, 30 (2007) e94-e94. [11] P. Loria, A. Lonardo, S. Bellentani, C.P. Day, G. Marchesini, and N. Carulli, Non-alcoholic fatty liver disease (NAFLD) and cardiovascular disease: An open question, Nutr Metab Cardiovasc Dis, 17 (2007) 684-698. [12] R. Olufadi and C.D. Byrne, Clinical and laboratory diagnosis of the metabolic syndrome, J Clin Pathol, 61 (2008) 697-706. [13] L.A. Adams and K.D. Lindor, Nonalcoholic fatty liver disease, Annals of Epidemiology, 17 (2007) 863-869. [14] C.P. Day and O.F. James, Steatohepatitis: A tale of two “hits”?, Gastroenterology, 114 (1998) 842-845. [15] G. Musso, R. Gambino, and M. Cassader, Cholesterol metabolism and the pathogenesis of non-alcoholic steatohepatitis, Prog Lipid Res, 52 (2013) 175-191. [16] G. Carpino, A. Renzi, P. Onori, and E. Gaudio, Role of hepatic progenitor cells in nonalcoholic fatty liver disease development: Cellular cross-talks and molecular networks, Int J Mol Sci, 14 (2013) 20112-20130. [17] H. Tilg and A.R. Moschen, Evolution of inflammation in nonalcoholic fatty liver disease: The multiple parallel hits hypothesis, Hepatology, 52 (2010) 1836-1846. [18] D.G. Tiniakos, M.B. Vos, and E.M. Brunt, Nonalcoholic fatty liver disease: Pathology and pathogenesis, Annu Rev Pathol Mech Dis, 5 (2014) 145-171. [19] Z. Li, S. Yang, H. Lin, J. Huang, P.A. Watkins, A.B. Moser, C. DeSimone, X.-y. Song, and A.M. Diehl, Probiotics and antibodies to TNF inhibit inflammatory activity and improve nonalcoholic fatty liver disease, Hepatology, 37 (2003) 343-350. [20] K. Zhang and R.J. Kaufman, From endoplasmic-reticulum stress to the inflammatory response, Nature, 454 (2008) 455-462. [21] E.J. Park, J.H. Lee, G.-Y. Yu, G. He, S.R. Ali, R.G. Holzer, C.H. Osterreicher, H. Takahashi, and M. Karin, Dietary and genetic obesity promote liver inflammation and tumorigenesis by enhancing IL-6 and TNF expression, Cell, 140 (2010) 197-208.

20 General introduction

[22] T. Sakurai, G. He, A. Matsuzawa, G.-Y. Yu, S. Maeda, G. Hardiman, and M. Karin, Hepatocyte necrosis induced by oxidative stress and IL-1alpha release mediate carcinogen-induced compensatory proliferation and liver tumorigenesis, Cancer Cell, 14 (2008) 156-165. 1 [23] W.E. Naugler, T. Sakurai, S. Kim, S. Maeda, K. Kim, A.M. Elsharkawy, and M. Karin, Gender disparity in liver cancer due to sex differences in MyD88-dependent IL-6 production, Science, 317 (2007) 121-124. [24] S. Toffanin, S.L. Friedman, and J.M. Llovet, Obesity, inflammatory signaling, and hepatocellular carcinoma - an enlarging link, Cancer Cell, 17 (2010) 115-117. [25] D. Cai, M. Yuan, D.F. Frantz, P.A. Melendez, L. Hansen, J. Lee, and S.E. Shoelson, Local and systemic insulin resistance resulting from hepatic activation of IKK-[beta] and NF-[kappa]B, Nat Med, 11 (2005) 183-190. [26] M.C. Arkan, A.L. Hevener, F.R. Greten, S. Maeda, Z.-W. Li, J.M. Long, A. Wynshaw-Boris, G. Poli, J. Olefsky, and M. Karin, IKK-[beta] links inflammation to obesity-induced insulin resistance, Nat Med, 11 (2005) 191-198. [27] V. Bieghs, S.M. Walenbergh, T. Hendrikx, P.J. van Gorp, F. Verheyen, S.W. Olde Damink, A.A. Masclee, G.H. Koek, M.H. Hofker, C.J. Binder, and R. Shiri-Sverdlov, Trapping of oxidized LDL in lysosomes of Kupffer cells is a trigger for hepatic inflammation, Liver Int, 33 (2013) 1056-1061. [28] T. Hendrikx, V. Bieghs, S.M. Walenbergh, P.J. van Gorp, F. Verheyen, M.L. Jeurissen, M.M. Steinbusch, N. Vaes, C.J. Binder, G.H. Koek, R. Stienstra, M.G. Netea, M.H. Hofker, and R. Shiri-Sverdlov, Macrophage specific caspase-1/11 deficiency protects against cholesterol crystallization and hepatic inflammation in hyperlipidemic mice, PLoS One, 8 (2013) e78792. [29] K. Musunuru, Atherogenic dyslipidemia: Cardiovascular risk and dietary intervention, Lipids, 45 (2010) 907-914. [30] H.K. Min, A. Kapoor, M. Fuchs, F. Mirshahi, H. Zhou, J. Maher, J. Kellum, R. Warnick, M.J. Contos, and A.J. Sanyal, Increased hepatic synthesis and dysregulation of cholesterol metabolism is associated with the severity of nonalcoholic fatty liver disease.: Cell Metab, 15 (2012) 665-74. [31] M.S. Brown and J.L. Goldstein, Receptor-mediated control of cholesterol metabolism, Science, 191 (1976) 150-4. [32] M.-P. Marzolo and G. Bu, Lipoprotein receptors and cholesterol in APP trafficking and proteolytic processing, implications for Alzheimer’s disease, Semin Cell Dev Biol, 20 (2009) 191-200. [33] G.-w. Go and A. Mani, Low-density lipoprotein receptor (LDLR) family orchestrates cholesterol homeostasis, Yale J Biol Med, 85 (2012) 19-28. [34] C.G. Davis, I.R. van Driel, D.W. Russell, M.S. Brown, and J.L. Goldstein, The low density lipoprotein receptor. Identification of amino acids in cytoplasmic domain required for rapid endocytosis, J Biol Chem, 262 (1987) 4075-4082. [35] W.J. Chen, J.L. Goldstein, and M.S. Brown, NPXY, a sequence often found in cytoplasmic tails, is required for coated pit-mediated internalization of the low density lipoprotein receptor, J Biol Chem, 265 (1990) 3116-3123. [36] C.G. Davis, M.A. Lehrman, D.W. Russell, R.G. Anderson, M.S. Brown, and J.L. Goldstein, The J. D. mutation in familial hypercholesterolemia: Amino acid substitution in cytoplasmic domain impedes internalization of LDL receptors, Cell, 45 (1986) 15-24. [37] T.A. Springer, An extracellular beta-propeller module predicted in lipoprotein and scavenger receptors, tyrosine kinases, epidermal growth factor precursor, and extracellular matrix components, J Mol Biol, 283 (1998) 837-862. [38] C.G. Davis, J.L. Goldstein, T.C. Sudhof, R.G. Anderson, D.W. Russell, and M.S. Brown, Acid-dependent ligand dissociation and recycling of LDL receptor mediated by growth factor homology region, Nature, 326 (1987) 760-765. [39] O. Wiklund, C.A. Dyer, B.P. Tsao, and L.K. Curtiss, Stoichiometric binding of apolipoprotein B-specific monoclonal antibodies to low density lipoproteins., J Biol Chem, 260 (1985) 10956-10960. [40] I. Shimomura, Y. Bashmakov, H. Shimano, J.D. Horton, J.L. Goldstein, and M.S. Brown, Cholesterol feeding reduces nuclear forms of sterol regulatory element binding proteins in hamster liver, Proc Natl Acad Sci USA, 94 (1997) 12354-12359. [41] J.L. Goldstein and M.S. Brown, Progress in understanding the LDL receptor and HMG-CoA reductase, two membrane proteins that regulate the plasma cholesterol, J Lipid Res, 25 (1984) 1450-1461. [42] M.S. Brown and J.L. Goldstein, A receptor-mediated pathway for cholesterol homeostasis, Science, 232 (1986) 34-47.

21 CHAPTER 1

[43] N.G. Seidah, S. Benjannet, L. Wickham, J. Marcinkiewicz, S.B. Jasmin, S. Stifani, A. Basak, A. Prat, and M. Chretien, The secretory proprotein convertase neural apoptosis-regulated convertase 1 (NARC-1): Liver regeneration and neuronal differentiation, Proc Natl Acad Sci USA, 100 (2003) 928-933. [44] S. Benjannet, D. Rhainds, R. Essalmani, J. Mayne, L. Wickham, W. Jin, M.-C. Asselin, J. Hamelin, M. Varret, D. Allard, M. Trillard, M. Abifadel, A. Tebon, A.D. Attie, D.J. Rader, C. Boileau, L. Brissette, M. Chretien, A. Prat, and N.G. Seidah, NARC-1/PCSK9 and its natural mutants: zymogen cleavage and effects on the low density lipoprotein (LDL) receptor and ldl cholesterol, J Biol Chem, 279 (2004) 48865-48875. [45] T.A. Lagace, D.E. Curtis, R. Garuti, M.C. McNutt, S.W. Park, H.B. Prather, N.N. Anderson, Y.K. Ho, R.E. Hammer, and J.D. Horton, Secreted PCSK9 decreases the number of LDL receptors in hepatocytes and inlivers of parabiotic mice, J Clin Invest, 116 (2006) 2995-3005. [46] D. Cunningham, D.E. Danley, K.F. Geoghegan, M.C. Griffor, J.L. Hawkins, T.A. Subashi, A.H. Varghese, M.J. Ammirati, J.S. Culp, L.R. Hoth, M.N. Mansour, K.M. McGrath, A.P. Seddon, S. Shenolikar, K.J. Stutzman-Engwall, L.C. Warren, D. Xia, and X. Qiu, Structural and biophysical studies of PCSK9 and its mutants linked to familial hypercholesterolemia, Nat Struct Mol Biol, 14 (2007) 413-419. [47] G.D. Norata, G. Tibolla, and A.L. Catapano, Targeting PCSK9 for hypercholesterolemia, Annu Rev Pharmacol Toxicol, 54 (2014) 273-293. [48] J.D. Horton, J.C. Cohen, and H.H. Hobbs, PCSK9: a convertase that coordinates LDL catabolism, J Lipid Res, 50 (2009) S172-S177. [49] M. Abifadel, M. Varret, J.-P. Rabes, D. Allard, K. Ouguerram, M. Devillers, C. Cruaud, S. Benjannet, L. Wickham, D. Erlich, A. Derre, L. Villeger, M. Farnier, I. Beucler, E. Bruckert, J. Chambaz, B. Chanu, J.-M. Lecerf, G. Luc, P. Moulin, J. Weissenbach, A. Prat, M. Krempf, C. Junien, N.G. Seidah, and C. Boileau, Mutations in PCSK9 cause autosomal dominant hypercholesterolemia, Nat Genet, 34 (2003) 154-156. [50] A. Zaid, A. Roubtsova, R. Essalmani, J. Marcinkiewicz, A. Chamberland, J. Hamelin, M. Tremblay, H. Jacques, W. Jin, J. Davignon, N.G. Seidah, and A. Prat, Proprotein convertase subtilisin/kexin type 9 (PCSK9): Hepatocyte-specific low-density lipoprotein receptor degradation and critical role in mouse liver regeneration, Hepatology, 48 (2008) 646-654. [51] Sheridan. (2013, Dec.) Phase 3 data for PCSK9 inhibitor wows. NATURE BIOTECHNOLOGY | NEWS. [Online]. http://www.nature.com/nbt/journal/v31/n12/full/nbt1213-1057.html [52] H.H. Hobbs, D.W. Russell, M.S. Brown, and J.L. Goldstein, The LDL receptor locus in familial hypercholesterolemia: mutational analysis of a membrane protein, Annu Rev Genet, 24 (1990) 133-170. [53] L. Pisciotta, C.P. Oliva, G.M. Pes, L. Di Scala, A. Bellocchio, R. Fresa, A. Cantafora, M. Arca, S. Calandra, and S. Bertolini, Autosomal recessive hypercholesterolemia (ARH) and homozygous familial hypercholesterolemia (FH): A phenotypic comparison, Atherosclerosis, 188 (2006) 398-405. [54] A.K. Soutar, R.P. Naoumova, and L.M. Traub, Genetics, clinical phenotype, and molecular cell biology of autosomal recessive hypercholesterolemia, Arterioscler Thromb Vasc Biol, 23 (2003) 1963-1970. [55] C. Jones, R.E. Hammer, W.-P. Li, J.C. Cohen, H.H. Hobbs, and J. Herz, Normal sorting but defective endocytosis of the low density lipoprotein receptor in mice with autosomal recessive hypercholesterolemia, J Biol Chem, 278 (2003) 29024-29030. [56] C. Jones, R. Garuti, P. Michaely, W.-P. Li, N. Maeda, J.C. Cohen, J. Herz, and H.H. Hobbs, Disruption of LDL but not VLDL clearance in autosomal recessive hypercholesterolemia, J Clin Invest, 117 (2007) 165-174. [57] S. Calandra, P. Tarugi, H.E. Speedy, A.F. Dean, S. Bertolini, and C.C. Shoulders, Mechanisms and genetic determinants regulating sterol absorption, circulating LDL levels, and sterol elimination: implications for classification and disease risk, J Lipid Res, 52 (2011) 1885-1926. [58] M. Arca, G. Zuliani, K. Wilund, F. Campagna, R. Fellin, S. Bertolini, S. Calandra, G. Ricci, N. Glorioso, M. Maioli, P. Pintus, C. Carru, F. Cossu, J. Cohen, and H.H. Hobbs, Autosomal recessive hypercholesterolaemia in Sardinia, Italy, and mutations in ARH: a clinical and molecular genetic analysis, The Lancet, 359 (2002) 841-847. [59] T.P. Hiltunen, J.S. Luoma, T. Nikkari, and S. Yla-Herttuala, Expression of LDL Receptor, VLDL receptor, LDL receptor-related protein, and scavenger receptor in rabbit atherosclerotic lesions: marked induction of scavenger receptor and VLDL receptor expression during lesion development, Circulation, 97 (1998) 1079-1086.

22 General introduction

[60] E. Burstein, J.E. Hoberg, A.S. Wilkinson, J.M. Rumble, R.A. Csomos, C.M. Komarck, G.N. Maine, J.C. Wilkinson, M.W. Mayo, and C.S. Duckett, COMMD proteins, a novel family of structural and functional homologs of MURR1, J Biol Chem, 280 (2005) 22222-32. 1 [61] L. Ganesh, E. Burstein, A. Guha-Niyogi, M.K. Louder, J.R. Mascola, L.W. Klomp, C. Wijmenga, C.S. Duckett, and G.J. Nabel, The gene product Murr1 restricts HIV1 replication in resting CD4+ lymphocytes, Nature, 426 (2003) 853-857. [62] P. de Bie, B. van de Sluis, E. Burstein, and R. Berger, Characterization of COMMD protein-protein interactions in NF-[kappa]B signalling, Biochem J, 398 (2006) 63-71. [63] G.N. Maine, X. Mao, C.M. Komarck, and E. Burstein, COMMD1 promotes the ubiquitination of NF- [kappa]B subunits through a cullin-containing ubiquitin ligase, EMBO J, 26 (2007) 436-447. [64] P. Bartuzi, M.H. Hofker, and B. van de Sluis, Tuning NF-kappaB activity: A touch of COMMD proteins, Biochim Biophys Acta, 1832 (2013) 2315-2321. [65] B. van de Sluis, J. Rothuizen, P.L. Pearson, B.A. van Oost, and C. Wijmenga, Identification of a new copper metabolism gene by positional cloning in a purebred dog population, Hum Mol Genet, 11 (2002) 165-173. [66] P. de Bie, B. van de Sluis, E. Burstein, P.V. van de Berghe, P. Muller, R. Berger, J.D. Gitlin, C. Wijmenga, and L.W. Klomp, Distinct Wilson’s disease mutations in ATP7B are associated with enhanced binding to COMMD1 and reduced stability of ATP7B, Gastroenterology, 133 (2007) 1316-1326. [67] W.M. Vonk, P. Bie, C.K. Wichers, P.E. den Berghe, R. Plaats, R. Berger, C. Wijmenga, L.J. Klomp, and B. Sluis, The copper-transporting capacity of ATP7A mutants associated with Menkes disease is ameliorated by COMMD1 as a result of improved protein expression, Cell Mol Life Sci, 69 (2012) 149-163. [68] T. Miyayama, D. Hiraoka, F. Kawaji, E. Nakamura, N. Suzuki, and Y. Ogra, Roles of COMM-domain- containing 1 in stability and recruitment of the copper-transporting ATPase in a mouse hepatoma cell line, Biochem J, 429 (2010) 53-61. [69] S. Materia, M.A. Cater, L.W. Klomp, J.F. Mercer, and S. La Fontaine, Clusterin and COMMD1 independently regulate degradation of the mammalian copper ATPases ATP7A and ATP7B, J Biol Chem, 287 (2012) 2485-2499. [70] W.I. Vonk, P. Bartuzi, P. de Bie, N. Kloosterhuis, C.G. Wichers, R. Berger, S. Haywood, L.W. Klomp, C. Wijmenga, and B. van de Sluis, Liver-specific Commd1 knockout mice are susceptible to hepatic copper accumulation, PLoS One, 6 (2011) e29183. [71] A. Fedoseienko, P. Bartuzi, and B. van de Sluis, Functional understanding of the versatile protein copper metabolism MURR1 domain 1 (COMMD1) in copper homeostasis, Ann N Y Acad Sci, 1314 (2014) 6-14. [72] J.L. Burkhead, C.T. Morgan, U. Shinde, G. Haddock, and S. Lutsenko, COMMD1 forms oligomeric complexes targeted to the endocytic membranes via specific interactions with phosphatidylinositol 4,5-bisphosphate, J Biol Chem, 284 (2009) 696-707. [73] Y. Ke, A.G. Butt, M. Swart, Y.F. Liu, and F.J. McDonald, COMMD1 downregulates the epithelial sodium channel through Nedd4-2, Am J Physiol Renal Physiol, 298 (2010) F1445-56. [74] L. Smith, P. Litman, and C.M. Liedtke, COMMD1 interacts with the COOH terminus of NKCC1 in Calu-3 airway epithelial cells to modulate NKCC1 ubiquitination, Am J Physiol Cell Physiol, 305 (2013) C133-46. [75] L. Drévillon, G. Tanguy, A. Hinzpeter, N. Arous, A. de de Becdelièvre, A. Aissat, A. Tarze, M. Goossens, and P. Fanen, COMMD1-mediated ubiquitination regulates CFTR trafficking, PLoS One, 6 (2011) e18334. [76] H. Geng, T. Wittwer, O. Dittrich-Breiholz, M. Kracht, and M.L. Schmitz, Phosphorylation of NF-[kappa] B p65 at Ser468 controls its COMMD1-dependent ubiquitination and target gene-specific proteasomal elimination, EMBO Rep, 10 (2009) 381-386. [77] P.A. Muller, B. van de Sluis, A.J. Groot, D. Verbeek, W.I. Vonk, G.N. Maine, E. Burstein, C. Wijmenga, M. Vooijs, E. Reits, and L.W. Klomp, Nuclear-cytosolic transport of COMMD1 regulates NF-[kappa]B and HIF-1 activity, Traffic, 10 (2009) 514-527. [78] B. van de Sluis, A.J. Groot, J. Vermeulen, E. van der Wall, P.J. van Diest, C. Wijmenga, L.W. Klomp, and M. Vooijs, COMMD1 promotes pVHL and O2independent proteolysis of HIF-1 alpha via HSP90/70, PLoS One, 4 (2009) e7332. [79] W.I.M. Vonk, V. Kakkar, P. Bartuzi, Jaarsma, Berger, M.H. Hofker, W.J. Klomp, Wijmenga, H.H. Kampinga, and B. van de Sluis, The copper metabolism MURR1 domain protein 1 (COMMD1) modulates the aggregation of misfolded protein species in a client-specific manner, PLoS One, 9 (2014) e92408.

23

CHAPTER 2

Tuning NF-κB: A touch of COMMD proteins

Bartuzi P, Hofker MH, van de Sluis B

University of Groningen, University Medical Center Groningen, Molecular Genetics section, Groningen, the Netherlands

Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease 2013; 1832(12): 2315-2321 Abstract

NF-κB is an important regulator of immunity and inflammation, and its activation pathway has been studied extensively. The mechanisms that downregulate the activity of NF-κB have also received a lot of attention, particularly since its activity needs to be terminated to prevent chronic inflammation and subsequent tissue damage. The COMMD family has been identified as a new group of proteins involved in NF-κB termination. All ten COMMD members share the structurally conserved carboxy-terminal motif, the COMM domain, and are ubiquitously expressed. They seem to play distinct and non-redundant roles in various physiological processes, including NF-κB signaling. In this review, we describe the mechanisms and proteins involved in the termination of canonical NF-κB signaling, with a specific focus on the role of the COMMD family in the down-modulation of NF-κB. COMMD proteins and NF-κB termination Introduction

The nuclear factor-κB (NF-κB) family of transcription factors regulates the expression of a wide array of genes involved in various physiological processes, including immunity and inflammation. The central role of NF-κB in these processes is to recruit and activate various immune cells by inducing transcription of proinflammatory mediators like cytokines, chemokines and adhesion molecules. This process aims to protect the host 2 efficiently against different kind of pathogens and injuries. However, it is essential that in the end NF-κB activity is downregulated in order to prevent chronic inflammation. Uncontrolled inflammation can be accompanied by tissue damage (reviewed in [1]) and can have a critical role in the development and pathogenesis of numerous diseases, like inflammatory bowel disease, atherosclerosis, diabetes and cancer [2-7]. Therefore, NF-κB activity during inflammatory responses needs to be tightly spatiotemporally regulated. This review discusses several pathways down-modulating NF-κB activity, and pays special attention to the role of the COMMD family of proteins in NF-κB signaling. The NF-κB family comprises five members: RELA (p65), RELB, c-REL, p50/p105 (NF-κB1), and p52/p100 (NF-κB2), which all share the amino-terminal REL homology domain (RHD). The RHD is essential for various events, such as NF-κB dimerization, interaction with inhibitors of κΒ (IκB), nuclear translocation and binding to DNA. RELA, c-REL and RELB proteins also have a transcriptional activation domain (TAD) at the carboxy-terminus, which is important for the transcription of NF-κB target genes. The TAD is absent in the NF-κB subunits p50 and p52, therefore they can function as transcriptional repressors (reviewed in [8]). Whether NF-κB acts as a transcriptional activator or repressor depends on the dimer combination formed by the NF-κB members. NF-κB dimers which contain at least one member with a TAD activate transcription through displacement of repressors, such as the histone deacetylases 1 and 2 (HDAC1 and HDAC2), and recruitment of co-activators, i.e. HDAC3 [9, 10] and the histone acetylases, CBP/p300 [11-13]. In contrast, p50 and p52 homodimers or p50/p52 heterodimers, which both bind to κB-sites, have been shown to have a transcriptionally repressive function. This function is manifested by recruiting transcriptional repressors, such as HDAC1 [14, 15]. The way that NF-κB is activated can be divided into various signaling pathways, including the canonical (or classical) and the non-canonical (or alternative) pathway. Which of the signaling events occurs depends on the type of stimuli. The canonical pathway is activated by a wide range of stimuli, such as the proinflammatory cytokines, tumor necrosis factor (TNF), interleukin-1 (IL-1) and the bacterial endotoxin, lipopolysaccharide (LPS). These stimuli activate the NF-κB dimer RELA/p50 through the receptors: TNF receptor (TNFR), interleukin 1 receptor (IL-1R) and the toll-like receptor 4 (TLR4), respectively. The non-canonical pathway can be activated by lymphotoxin beta, B cell activating factor, or CD40 ligand. This activation induces the processing of p100 that results in RELB/p52 mediated transcription. Since we will focus mainly on the regulation of the canonical

27 CHAPTER 2

pathway here, we recommend readers to other reviews for further information on the non- canonical and other pathways in NF-κB activation (for example [16-18]). In the canonical NF-κB pathway, the NF-κB dimer RelA/p50 is kept in the cytosol in an inactive state by the IκB proteins. These proteins retain RELA/p50 dimers in the cytosol by masking their nuclear localization signal (NLS) (Fig. 1). This prevents translocation of RELA/p50 to the nucleus. However, it has been indicated that IκB proteins, namely IκBα and IκBε, also have the ability to shuttle NF-κB from the nucleus back to the cytoplasm. This is regulated by the nuclear export signal (NES) within these proteins, which is absent in the other IκB proteins. Upon phosphorylation of the IκB proteins by the IκB kinase (IKK) complex, IκB proteins are ubiquitinated and subsequently degraded by the proteasomes (Fig. 1). This results in nuclear translocation of RELA/p50. Dimeric combinations of RelA subunit (NF-κB) bind to the DNA regions upstream of specific genes to alter their transcription. The IKK complex consists of two catalytic subunits with kinase activity (IKKα/IKK1 and IKKβ/IKK2) and a regulatory subunit (IKKγ, also known as NEMO) [19]. IKK activation is mediated by different protein complexes downstream of various receptors that are responsible for the initial NF-κB activation (reviewed in [20]). This pathway has been studied extensively since NF-κB was first identified in 1986 [21]. However, there is still relatively little known about the mechanisms that terminate its transcriptional activity or the signaling events that are essential to resolve inflammation and prevent autoimmune disease.

Down-modulators of NF-κB

To this day, only a few proteins have been shown to negatively regulate NF-κB signaling [22, 23]. Among them are the IκB proteins (IκBα, IκBβ, and IκBε). Upon NF-κB activation, the expression of both IκBα and IκBε is induced as a negative feedback loop mechanism. Although the expression of IκBε is markedly delayed compared to IκBα, both newly synthesized IκB proteins sequester NF-κB in the cytosol in order to hamper the activity of NF-κB [24] (Fig. 1). On the contrary, it has been shown that hypophosphorylated IκBβ can form a DNA-bound protein complex with RELA, which leads to prolonged expression of NF-κB target genes [25]. Thus IκBβ can regulate NF-κB either negatively or positively. In addition to the IκB proteins, the protein A20/TNFAIP3 similarly serves as a negative feedback loop, with its expression also driven by NF-κB (Fig. 1). The deubiquitinating (DUB) enzymatic activity of A20 is responsible for removal of the K63-linked polyubiquitin chains from the receptor-interacting protein 1 (RIP1). At the same time, the E3 ubiquitin ligase domain of A20 promotes K48-ubiquitin mediated RIP1 protein degradation [26]. In addition to RIP1, A20 also deubiquitinates other IKK regulators, such as NEMO and TRAF6. This event eventually results in downregulation of the canonical NF-κB signaling cascades. The importance of this negative feedback loop mechanism is illustrated in several murine models. Haploinsufficiency for A20 in apolipoprotein E-deficient mice leads to increased atherosclerotic lesion size and conditional depletion of A20 in certain murine

28 COMMD proteins and NF-κB termination

Inflammatory stimuli Figure 1. Simplified overview of NF-κB down-modulation. Inflammatory stimuli reaching the cell through various receptors lead to a number of signaling events and result in activation of the IKK complex. IKKα IKKβ IKK complex phosphorylates NEMO 2 CYLD A20 IκBα, which is ubiquitinated and A20 de novo subsequently degraded by the Ub synthesis Ub P Ub κ α proteasome. COMMD8 enhances Ub I B IκBα de novo IκBα RELA p50 the degradation of IκBα and synthesis hereby stimulates NF-κB activity. The NF-κB dimer, RELA/p50, is proteasome COMMD8 then released from IκBα and RELA p50 relocation translocates into the nucleus to of RELA by IκBα activate the transcription of several genes, including its own inhibitors, A20 and IκBα. transcription: cytosol RELA p50 IκB, A20, etc. Transcribed and newly nucleus κB synthesized A20 inhibits NF-κB by interfering with the IKK complex, whereas IκBα PIAS 1/4 COMMD1 PDLIM2 sequesters NF-κB in the cytosol. interference with NF-κB destabilisation NF-κB binding to DNA and proteasomal degradation CYLD deubiquitinates NEMO, which also results in dampened IKK activity. PIAS1, PIAS4, COMMD1, and PDLIM2 act on NF-κB activity in the nucleus, either interfering with the binding of NF-κB to the DNA or leading to NF-κB ubiquitination and proteasomal degradation. cell types, such as B-cells, dendritic cells (DCs), intestinal epithelial cells or macrophages and granulocytes, leads to hypersensitivity to various inflammatory diseases, such as colitis and nephritis [27, 28]. Furthermore, complete deficiency of A20 results in early death due to uncontrolled inflammation. Of note, human single nucleotide polymorphisms (SNPs) within the A20 gene have been associated with susceptibility to several diseases like rheumatoid arthritis, psoriasis, celiac disease, Crohn’s disease, systemic sclerosis, and type 1 diabetes. Moreover, A20 insufficiency has been shown to play an important role in human B cell lymphoma [27]. Another protein playing a role in dampening the activity of NF-κB is the DUB protease, cylindromatosis (CYLD) [29-31]. CYLD deubiquitinates NEMO and several other upstream proteins like RIP1, TAK1, TRAF2, 6, and 7 [29]. The K63-linked ubiquitin chains removed by CYLD are essential for down-modulation of IKK activity (Fig. 1). Cyld-deficient mice are prone to inflammation and tumor formation in various experimental mouse models [32,33]. In humans, mutations in CYLD are associated with the development of cylindromas (tumors of the skin) [34-36]. In contrast, Cyld-deficient mice do not develop skin tumors

29 CHAPTER 2

spontaneously, but are sensitive to chemically induced skin tumors. Furthermore, reduced expression of CYLD has been observed in colon and liver cancers in humans [37]. Together, these experimental murine models and human genetic studies underline the importance of NF-κB down-modulation in preventing uncontrolled inflammation and the development of diseases associated with inflammation. All the events described above control NF-κB activity by acting upstream of NF-κB. However, little is known about the mechanisms through which NF-κB activity is terminated within the nucleus. In addition to IκBα, which relocates active RELA from nucleus back to the cytosol for proteasomal degradation [38], other proteins that directly inhibit NF-κB at the DNA level have been identified. These include PDZ and LIM domain containing protein 2 (PDLIM2), protein inhibitor of activated STAT (PIAS), and COMMD1 (Fig. 1). PDLIM2 is an ubiquitin E3 ligase [39], which directs RELA from the nucleus into subnuclear domains, also known as promyelocytic leukemia protein (PML) nuclear bodies [40]. Upon polyubiquitination by PDLIM2, RELA is degraded by the proteasomes within the PML nuclear bodies. Pdlim2-deficient mice are more sensitive to LPS-induced sepsis, illustrating the importance of PDLIM2 in restraining inflammation [39]. PIAS1 interferes with the binding of NF-κB to the κB-sites of NF-κB target genes. In a similar fashion to Pdlim2 null mice, loss of Pias1 in mice results in hypersensitivity to endotoxic shock [41]. The latter has also been observed in Pias4-deficient mice, indicating that Pias1 and Pias4 are not redundant in this specific pathway [42]. In addition to the previously discussed proteins, COMMD1, a member of the COMMD family of proteins, has been identified as playing a role in terminating NF-κB at the level of DNA. Similar to PIAS1 and PIAS4, COMMD1 inhibits the expression of a specific subset of NF-κB target genes [43]. The mechanism by which COMMD1 down-modulates NF-κB will be described in the following paragraphs.

The COMMD protein family COMMDs – a family of NF-κB regulators

Using a positional cloning strategy, COMMD1 was first identified to be mutated in Bedlington terriers suffering from copper toxicosis [44]. Copper toxicosis is characterized by copper accumulation in the liver until reaching toxic levels resulting in pathological changes (the role of COMMD1 in copper homeostasis is discussed in paragraph 3.5 of this manuscript). Soon after this discovery, E. Burstein and colleagues demonstrated that COMMD1 belongs to a new family of proteins, called the Copper Metabolism gene MURR1 Domain-containing (COMMD) family [45]. This family consists of ten members and is highly conserved in various multicellular organisms and in some protozoa. The COMMD proteins have a structurally conserved carboxyl-terminal Copper Metabolism gene MURR1 (COMM) domain [45] (Fig. 2). This domain serves as a platform for COMMD interactions with each other and with their interacting partners. The amino-terminal region

30 COMMD proteins and NF-κB termination

variable highly conserved N-terminal region COMM domain NES1 NES2 N HHHH HHHH C COMMD1 - 190 aa (L)

N HHHH HHHH C COMMD2 - 199 aa (U)

N HHHH HHHH C COMMD3 - 195 aa (U) N HHHH HHHH C COMMD4 - 199 aa (U) 2 N HHHH HHHH C COMMD5 - 224 aa (U)

N HHHH HHHH C COMMD6 - 85 aa (L)

N HHHH HHHH C COMMD7 - 200 aa (U)

N HHHH HHHH C COMMD8 - 183 aa (U)

N HHHH HHHH C COMMD9 - 198 aa (L)

N HHHH HHHH C COMMD10 - 202 aa (L)

Figure 2. COMMD family of proteins. The COMMD family consists of 10 members. They all share a structurally conserved C-terminal motif, namely the COMM domain. On the other hand, their N-terminal region shows no homology between the different COMMD proteins, but is highly conserved across species. COMMD1 is designated as the prototype of the family. Within the COMM domain, COMMD1 has two NES sequences (indicated by red boxes). Putative NESs in other

COMMDs are indicated by HHHH and are based on the consensus NES sequence of HX2-3HX2-3HX1-2H (in which H represents the hydrophobic amino acids L, I, V, M or F). Phenotype of a knockout mouse: L= lethal, U= unknown. is unique ineach COMMD protein, but is almost absent in COMMD6, as COMMD6 primarily encodes the COMM domain (Fig. 2). All COMMD proteins, including COMMD1, were shown to interact with COMMD1 [45, 46]. The COMMD proteins are ubiquitously expressed, but the level of mRNA expression of each COMMD varies within and between different tissues [44, 45]. As an example, oligonucleotide microarray data demonstrated that COMMD1 is highly expressed in the testis and heart, but much less so in skin [45]. Nevertheless, there seems to be no direct correlation between mRNA and protein expression, since the highest protein levels of Commd1 in mice are seen in kidney, colon, spleen and liver [47]. Of note, no catalytic activity has been assigned to the COMMD proteins. Although in recent years more insight into the function of COMMD1 has been obtained, very little is known about the function of the other COMMD proteins. Nonetheless, according to Burstein et al. [45], all COMMD proteins are able to interact with different subunits of NF-κB. Additionally, based on a luciferase κB-reporter assay, each COMMD member, when overexpressed, inhibits TNF-induced NF-κB activity [45, 46]. Of note, only COMMD1 is able to interact with all five subunits of NF-κB, whereas the other COMMDs show a selective interaction pattern with NF-κB subunits [45]. Moreover, only an association between COMMD1 and IκBα has been identified so far [46, 48]. It is therefore likely that the mechanism by which each COMMD protein regulates NF-κB is distinct.

31 CHAPTER 2

COMMD1 - a hub in NF-κB termination

Despite the fact that all ten COMMD proteins interact with NF-κB, so far a detailed mechanism has only been described for COMMD1: it inhibits NF-κB by promoting the ubiquitination and subsequent proteasomal degradation of RELA bound to chromatin [43, 45] (Fig. 3). Depletion of COMMD1 results in prolonged nuclear RELA levels upon NF-κB activation, which coincides with increased and sustained expression of a specific group of NF-κB target genes. COMMD1 also downregulates the levels of RELB, p105 and p100. As shown initially for COMMD1 knockdown, the level of polyubiquitinated RELA was also reduced in cells insufficient for either COMMD6, 9 or 10 [43]. These data indicate that other COMMD proteins also mediate NF-κB activity by regulating the turnover of RELA, but more studies are needed to confirm this.

K48 XIAP Ub Ub Ub Ub HSCARG COMMD1 COMMD1 ? proteasome sCLU active export COMMD1 CRM1

passive K63 Ub diffusion? Ub Ub ARF Ub COMMD1 protein cytosol COMMD1 COMMD1 stabilization nucleu

SOCS1 s ECS COMMD1

Ub SOCS1 SOCS1 Ub ECS ECS Ub P P Ub COMMD1 COMMD1 RELA p50 RELA p50 RELA p50 κB κB κB proteasome

Figure 3. Schematic overview of COMMD1 action in p65 (RELA) degradation and functional regulation of COMMD1. COMMD1, a protein of ~ 21kDa enters the nucleus possibly by passive diffusion through the nuclear pores. It associates with ubiquitin E3 ligase complex ECSSOCS1. The interaction of COMMD1-ECSSOCS1 complex with RELA is promoted by phosphorylation of RELA on Ser468 residue. COMMD1 facilitates the interaction between SOCS1 (present in ECSSOCS1 complex) and RELA, which results in ubiquitination and subsequent proteasomal degradation of RELA. ARF promotes poly-K63-linked ubiquitination of COMMD1, which results in increased nuclear COMMD1 levels. COMMD1 can be actively transported out of the nucleus through the CRM1 receptor, utilizing two nuclear export sequences (NES) within its COMM domain. In the cytosol XIAP and HSCARG proteins play a role in COMMD1 K48-linked poly-ubiquitination. This modification leads to degradation of COMMD1 by the proteasomes. sCLU might also affect the level of ubiquitinated COMMD1, as its expression is inversely correlated with COMMD1 levels.

32 COMMD proteins and NF-κB termination

COMMD1 interacts with a multimeric E3 ubiquitin ligase complex of proteins, the ECSSOCS1. This complex containins Elongins B and C, Cullin 2 and SOCS1 (Fig. 3). Within the ECSSOCS1 complex, COMMD1 acts as a hub to facilitate the interaction between RELA and SOCS1, which results in increased polyubiquitination of RELA [43]. The physical association of COMMD1 and RELA depends on the phosphorylation of RelA at serine residue 468 (Ser468). Substitution of Ser468 with an alanine impedes this interaction and almost completely prevents COMMD1-mediated RELA ubiquitination and proteasomal 2 degradation. Upon NF-κB activation, RELA S468A substitution results in prolonged binding of RELA to a selective set of NF-κB target genes [49-51]. Interestingly, after removal of RELA from the promoter site, COMMD1 was detected at the same promoter site [49]. These results suggest that after NF-κB termination, COMMD1 occupies the promoter sites of a specific subset of genes. This indicates that COMMD1 may also reduce the expression of NF-κB target genes by this additional mechanism. The fact that COMMD1 does not contain a DNA-binding motif suggests that it is in a complex with other proteins that occupy these specific promoter sites. However, the composition of this possible protein complex still has to be identified. The importance of Ser468-phosphorylated RELA in NF-κB termination was confirmed by Mao et al. [52]. They showed that this specific post-translational event is important for the interaction of RELA with the histone acetyltransferase GCN5. In complex with COMMD1, GCN5 facilitates the ubiquitin-dependent proteasomal degradation of RELA. Although Mao et al. showed that IKKα and IKKβ are important for this phosphorylation- dependent regulation, Geng et al. indicated that it is particularly IKKε that regulates the phospho-S468 mediated RELA degradation [49, 52]. Of note, an interaction between COMMD10 and GCN5 has also been observed, but the biological relevance of this association is not yet understood.

Functional regulation of COMMD1

Although COMMD1 is predominantly localized in the cytosol, low levels have also been observed in the nucleus [53-58]. Since it is a relatively small protein (21 kDa) and does not contain a nuclear localization signal (NLS), it is likely that COMMD1 enters the nucleus by diffusion through the nuclear pores. However, its transport from the nucleus back to the cytosol seems to be tightly regulated. COMMD1 has two nuclear export signals (NES) (Fig. 2) [55], which are recognized by CRM1 (Exportin 1), a nuclear export receptor present predominantly at the nuclear membrane (Fig. 3). Mutation of the NES or CRM1 inhibition leads to an increase in nuclear COMMD1. COMMD1 NES mutants augment the inhibitory function of COMMD1 on NF-κB. A similar role for NES to regulate the nuclear levels of COMMD1 and hereby its inhibitory effect during hypoxia was demonstrated [55]. NES mutations in COMMD1 reduce hypoxia-driven export of nuclear COMMD1 and coincide with greater inhibition of COMMD1 on hypoxia-inducible factor-1 (HIF-1)

33 CHAPTER 2

activity [55]. The hydrophobic residues forming the NES (NES consensus sequence

of HX2-3HX2-3HX1-2H) are conserved among the COMMD proteins (Fig. 2) [55], but the role of these residues in nuclear localization of the COMMD proteins needs to be investigated. Cytosolic COMMD1 can be polyubiquitinated by either X-linked inhibitor of apoptosis (XIAP) [53] or redox sensor protein HSCARG [58]. Both XIAP and HSCARG add K48-polyubiquitin chains to COMMD1, which direct COMMD1 for proteasomal degradation (Fig. 3). This mechanism likely controls COMMD1 levels and thereby its function on NF-κB. However, at the moment, only a role for XIAP in copper metabolism and COMMD1 regulation has been proposed [53, 61]. Intracellular copper enhances the degradation of XIAP and sensitizes cells to apoptosis [61]. Since COMMD1 was initially identified as a novel modulator of hepatic copper homeostasis, these results might accentuate the link between XIAP and COMMD1 in this specific pathway [44, 61-64]. In addition to K48-linked ubiquitin modification, the tumor suppressor ARF promotes the K63-mediated polyubiquitnation of COMMD1 [65]. K63-polyubiquitination of COMMD1 augments its protein stability and enhances its nuclear levels (Fig. 3). The association between ARF and COMMD1 seems to depend on particular physiological conditions. Upon DNA damage, COMMD1 interacts and colocalizes with ARF. Whether this mechanism is involved in COMMD1-mediated NF-κB inhibition or in other pathways, such as DNA-damage signaling [66], needs to be evaluated. Apart from the ubiquitination, no other protein modifications of COMMD1 have been reported to date. However, several physiological conditions have been described that affect COMMD1 levels. For instance, chronic copper overload reduces the mRNA and protein levels of COMMD1 in the hepatocellular carcinoma cell line HepG2 [67]. In contrast, increased COMMD1 expression was seen in cells subjected to aspirin [68]. This increase is associated with enhanced RELA-COMMD1 interaction and nucleolar distribution of RELA. Downregulation of COMMD1 desensitizes cells for aspirin-induced apoptosis, possibly through increased expression of NF-κB-mediated anti-apoptotic genes, although these particular changes were not examined in the study of Thoms et al. [68]. Interestingly, the stress-induced small heat-shock chaperone secretory clusterin (sCLU) also mediates the protein levels of COMMD1 [54] (Fig. 3). sCLU is negatively correlated with COMMD1 protein levels, but positively correlated with the expression of various NF-κB-target genes linked with cellular survival. Increased sCLU expression is associated with the survival of cancer cells treated with a wide range of anti-cancer treatments, such as chemotherapy or radiation therapy. In line with these results, decreased expression of COMMD1 is observed in several cancers. Lower COMMD1 expression has been correlated with increased invasion of tumor cells and a reduced survival rate of patients with endometrial cancer [69]. However, whether the expression of sCLU and COMMD1 is inversely correlated within various cancers, or whether this correlation is associated with tumor behavior, needs to be investigated.

34 COMMD proteins and NF-κB termination

Altogether, depending on the physiological conditions, COMMD1 function can be modulated through various mechanisms, including regulation of its protein expression, mRNA expression, and nucleocytoplasmic transport. The biological consequences of these alterations on COMMD1’s function in NF-κB signaling or on other COMMD1-mediated processes require further study.

COMMD proteins as binding partners of Cullins 2 As described previously, all members of the COMMD family have the ability to inhibit NF-κB activity. However, except for COMMD1, the exact mechanisms are still unknown. In addition to COMMD1 [43, 45, 48], all the other COMMD proteins physically associate with different Cullins [56]. Cullin proteins act as core scaffold proteins and together with RING box protein (Rbx1 or Rbx2) form the Cullin-RING-ligases (CRLs). CRLs are the largest family of ubiquitin ligases, and they mediate ubiquitination of a wide range of proteins in various physiological processes [70]. Identification of the ability of COMMD proteins to interact with and regulate different CRLs intensifies the complexity and, presumably, also the specificity of this regulatory mechanism. It is therefore likely that, depending on the physiological conditions, each COMMD protein acts as a hub to control several processes, including NF-κB signaling. Indeed, as recently indicated, COMMD8 is in complex with the coiled-coil domain- containing protein (CCDC22) and Cullin1 and mediates the protein degradation of IκBα. Depletion of COMMD8 impairs IκBα degradation and, consequently, reduces NF-κB transcriptional activity [71]. Although CCDC22-COMMD1 and CCDC22-COMMD10 protein complexes were also observed, loss of either COMMD1 or COMMD10 does not affect IκBα degradation. This suggests that COMMD8 is essential for the activation of NF-κB, whereas COMMD1 is important for NF-κB termination. Overall, COMMD proteins interact with specific Cullin-associated complexes and might serve as a hub to regulate the specificity of CRLs.

COMMD1, a multifunctional protein

In addition to its role in NF-κB signaling, COMMD1 is also associated with other physiological processes. As mentioned in paragraph 3.1 of this manuscript, COMMD1 was identified as a protein mediating copper metabolism in the liver [44, 64]. Its role in maintaining hepatic copper homeostasis by promoting copper export to the bile was validated in a hepatic Commd1-deficient mouse model [63]. COMMD1 facilitates copper excretion from the liver into the bile, possibly through the copper transporting protein ATP7B [44, 64, 72, 73]. Interestingly, COMMD1 deficiency in various cell lines also affects the transporting capacity of ATP7A, a copper transporting protein that is highly homologous to ATP7B [73]. However, to date, no polymorphisms or mutations in COMMD1 have been found to be associated with human copper overload diseases. COMMD1 also plays a role in processes like sodium uptake (through regulation of epithelium sodium channel, ENaC, cell surface expression) [74], HIF-1 signaling [59, 60, 69], 35 CHAPTER 2

cystic fibrosis (through interaction with cystic fibrosis transmembrane conductance regulator, CFTR) [57] and maturation of superoxide dismutase 1 (SOD1) [75]. The common mechanism of COMMD1 action in most of these processes seems to be its role in regulating the protein stability and/or in ubiquitination of its targets. It has also been shown that COMMD1 mediates the trafficking of its targets within the cell [57, 76]. Whether ubiquitination is directly involved in all these process is still uncertain. The pleiotropic function of COMMD1 is represented by the lethal phenotype of the Commd1 knockout mouse. In contrast to COMMD1 deficiency in dogs, loss of Commd1 in mice results in early embryonic lethality [59]. These mice die between embryonic stages E9.5 - E10.5. The importance of Commd1 in mouse embryogenesis was confirmed by reintroducing human COMMD1 into the Commd1 knockout mice (B. van de Sluis, unpublished data). Mice deficient in endogenous Commd1, but expressing the human COMMD1 variant are born with the expected Mendelian ratio and do not show any overt phenotype. The exact reason for the discrepancy between dogs and mice is unknown, but it is possible that during embryogenesis in dogs other COMMD proteins can take over the function of COMMD1. Evidence for the lack of non-redundancy of the Commd proteins in mice is illustrated by the fact that genetic deletion of either Commd1, 6, 9 or 10 results in embryonic lethality ([59]; E. Burstein and B. van de Sluis, personal communication). Furthermore, the stage of prenatal death and the morphology of the affected embryos differ between the Commd-deficient embryos, indicating that each Commd protein regulates a specific vital pathway during embryogenesis.

Concluding remarks

Since the discovery of NF-κB, much has been learnt about how it is regulated. In recent years, the termination of NF-κB to down-modulate its response has also attracted a lot of attention. As shown by various experimental mouse models, downregulation of NF-κB plays a crucial role in neutralizing inflammation. In this review we have briefly considered several new regulators of NF-κB, paying special attention to the COMMD family of proteins. Currently, most of what we know about the role of this family in NF-κB signaling comes from in vitro studies. These have focused mainly on the mechanisms by which COMMD1, thought to be the prototype of the COMMD family, terminates NF-κB signaling. Yet recent data on COMMD8 in NF-κB modulation suggest that each COMMD protein regulates NF-κB activity in a different manner. This is supported by the different patterns of each COMMD protein-protein network. There is still much to be learned about how this family acts on NF-κB signaling and about its possible roles in many other pathways. Lack of any catalytic activity suggests that COMMDs act as scaffold proteins to facilitate the assembling of crucial molecular components involved in a number of biological processes, including copper homeostasis, NF-κB and HIF-1 signaling. Nevertheless, the biological relevance of COMMD1 and the other COMMD proteins

36 COMMD proteins and NF-κB termination in NF-κB-mediated inflammation needs to be investigated. It would be of interest to find any polymorphisms or mutations within the COMMD genes associated with the susceptibility to inflammatory diseases, such as inflammatory bowel disease (IBD). Furthermore, to advance this field, we and our collaborator (E. Burstein) are using genetically engineered mice to elucidate the role of various COMMD proteins (i.e. COMMD1, COMMD6 and COMMD9) in the pathogenesis of different diseases associated with inflammation. We are confident that these mouse models will soon provide 2 new insights into the regulatory mechanisms of inflammation and will help us to understand the functions of this protein family.

Acknowledgements

We apologize for omitting relevant papers due to space limitations. We thank Jackie Senior for editing the text and members of the Molecular Genetics laboratory for critically reading the manuscript. This manuscript is supported by the Graduate School for Drug Exploration (GUIDE), University of Groningen, and by the NWO ALW grant 817.02.022.

37 CHAPTER 2 References:

[1] M. Pasparakis, Regulation of tissue homeostasis by NF-[kappa]B signalling: Implications for inflammatory diseases, Nat Rev Immunol, 9 (2009) 778-788. [2] G.K. Hansson, A.-K.L. Robertson, and C. Soderberg-Naucler, Inflammation and atherosclerosis, Annu Rev Pathol Mech Dis, 1 (2013) 297-329. [3] M. von Herrath, S. Sanda, and K. Herold, Type 1 diabetes as a relapsing-remitting disease?, Nat Rev Immunol, 7 (2007) 988-994. [4] A. Mantovani, P. Allavena, A. Sica, and F. Balkwill, Cancer-related inflammation, Nature, 454 (2008) 436-444. [5] A. Kumar, Y. Takada, A. Boriek, and B. Aggarwal, Nuclear factor-[kappa]B: its role in health and disease, J Mol Med (Berl.), 82 (2004) 434-448. [6] R.G. Baker, M.S. Hayden, and S. Ghosh, NF-κB, inflammation, and metabolic disease, Cell Metab., 13 (2011) 11-22. [7] P.P. Tak and G.S. Firestein, NF-κB: A key role in inflammatory diseases, J Clin Invest, 107 (2001) 7-11. [8] S. Ghosh, M.J. May, and E.B. Kopp, NF-[kappa]B and REL proteins: Evolutionarily conserved mediators of immune responses, Annu Rev Immunol, 16 (1998) 225-260. [9] E. Ziesché, D. Kettner-Buhrow, A. Weber, T. Wittwer, L. Jurida, J. Soelch, H. Müller, D. Newel, P. Kronich, H. Schneider, O. Dittrich-Breiholz, S. Bhaskara, S.W. Hiebert, M.O. Hottiger, H. Li, E. Burstein, M.L. Schmitz, and M. Kracht, The coactivator role of histone deacetylase 3 in IL-1-signaling involves deacetylation of p65 NF-κB, Nucl. Acids Res. 41 (2013) 90-109. [10] X. Chen, I. Barozzi, A. Termanini, E. Prosperini, A. Recchiuti, J, Dalli, F. Mietton, G. Matteoli, S. Hiebert, G. Natoli, Requirement for the histone deacetylase Hdac3 for the inflammatory gene expression program in macrophages, Proc Natl Acad Sci USA, 109 (2012) e2865-74. [11] A. Oeckinghaus and S. Ghosh, The NF-κB Family of Transcription Factors and Its Regulation, Cold Spring Harb Perspect Biol., 1 (2009) a000034. [12] S. Ghosh and M.S. Hayden, New regulators of NF-kB in inflammation, Nat Rev Immunol, 8 (2008) 837-848. [13] H. Zhong, M.J. May, E. Jimi, and S. Ghosh, The phosphorylation status of nuclear NF-[kappa]B determines its association with CBP/p300 or HDAC-1, Mol Cell, 9 (2002) 625-636. [14] C.B. Phelps, L.L. Sengchanthalangsy, S. Malek, and G. Ghosh, Mechanism of [kappa]B DNA binding by Rel/NF-[kappa]B dimers, J Biol Chem, 275 (2000) 24392-24399. [15] A.M. Elsharkawy, F. Oakley, F. Lin, G. Packham, D.A. Mann, and J. Mann, The NF-[kappa]B p50:p50:HDAC-1 repressor complex orchestrates transcriptional inhibition of multiple pro-inflammatory genes, J Hepatol, 53 (2010) 519-527. [16] S.-C. Sun, Non-canonical NF-[kappa]B signaling pathway, Cell Res, 21 (2011) 71-85. [17] B. Razani, A.D. Reichardt, and G. Cheng, Non-canonical NF-[kappa]B signaling activation and regulation: principles and perspectives, Immunol Rev, 244 (2011) 44-54. [18] K.W. McCool, S. Miyamoto, DNA damage-dependent NF-κB activation: NEMO turns nuclear signaling inside out, Immunol Rev, 246 (2012) 311-26 [19] A. Israël, The IKK Complex, a central regulator of NF-[kappa]B activation, Cold Spring Harb Perspect Biol, 2 (2010) a000158. [20] F. Liu, Y. Xia, A.S. Parker, and I.M. Verma, IKK biology, Immunol Rev, 246 (2012) 239-253. [21] R. Sen and D. Baltimore, Multiple nuclear factors interact with the immunoglobulin enhancer sequences, Cell, 46 (1986) 705-716. [22] F. Renner, M.L. Schmitz, Autoregulatory feedback loops terminating the NF-[kappa]B response, Trends Biochem Sci, 34 (2009) 128-35 [23] J. Ruland, Return to homeostasis: Downregulation of NF-[kappa]B responses, Nat Immunol, 12 (2011) 709-14 [24] A. Hoffmann, A. Levchenko, M.L. Scott, and D. Baltimore, The I[kappa]B-NF-[kappa]B signaling module: Temporal control and selective gene activation, Science, 298 (2002) 1241-1245.

38 COMMD proteins and NF-κB termination

[25] P. Rao, M.S. Hayden, M. Long, M.L. Scott, A.P. West, D. Zhang, A. Oeckinghaus, C. Lynch, A. Hoffmann, D. Baltimore, S. Ghosh, I[kappa]B[beta] acts to inhibit and activate gene expression during the inflammatory response, Nature, 466 (2010) 1115-9. [26] N. Shembade and E.W. Harhaj, Regulation of NF-[kappa]B signaling by the A20 deubiquitinase, Cell Mol Immunol, 9 (2012) 123-130. [27] A. Ma and B.A. Malynn, A20: linking a complex regulator of ubiquitylation to immunity and human disease, Nat Rev Immunol, 12 (2012) 774-785. [28] S. Wolfrum, D. Teupser, M. Tan, K.Y. Chen, and J.L. Breslow, The protective effect of A20 on atherosclerosis 2 in apolipoprotein E-deficient mice is associated with reduced expression of NF-[kappa]B target genes, Proc Natl Acad Sci USA., 104 (2007) 18601-18606. [29] S.-C. Sun, CYLD: A tumor suppressor deubiquitinase regulating NF-[kappa]B activation and diverse biological processes, Cell Death Differ, 17 (2009) 25-34. [30] G.R. Bignell, W. Warren, S. Seal, M. Takahashi, E. Rapley, R. Barfoot, H. Green, C. Brown, P.J. Biggs, S.R. Lakhani, C. Jones, J. Hansen, E. Blair, B. Hofmann, R. Siebert, G. Turner, D.G. Evans, C. Schrander- Stumpel, F.A. Beemer, A. van den Ouweland, D. Halley, B. Delpech, M.G. Cleveland, I. Leigh, J. Leisti, S. Rasmussen, M.R. Wallace, C. Fenske, P. Banerjee, N. Oiso, R. Chaggar, S. Merrett, N. Leonard, M. Huber, D. Hohl, P. Chapman, J. Burn, S. Swift, A. Smith, A. Ashworth, and M.R. Stratton, Identification of the familial cylindromatosis tumour-suppressor gene, Nat Genet, 25 (2000) 160-165. [31] T.R. Brummelkamp, S.M. Nijman, A.M. Dirac, and R. Bernards, Loss of the cylindromatosis tumour suppressor inhibits apoptosis by activating NF-[kappa]B, Nature, 424 (2003) 797-801. [32] K. Nikolaou, A. Tsagaratou, C. Eftychi, G. Kollias, G. Mosialos, and I. Talianidis, inactivation of the deubiquitinase CYLD in hepatocytes causes apoptosis, inflammation, fibrosis, and cancer, Cancer Cell, 21 (2012) 738-750. [33] J. Zhang, B. Stirling, S.T. Temmerman, C.A. Ma, I.J. Fuss, J.M. Derry, and A. Jain, Impaired regulation of NF-[kappa]B and increased susceptibility to colitis-associated tumorigenesis in CYLD-deficient mice, J Clin Invest, 116 (2006) 3042-3049. [34] P.J. Biggs, R. Wooster, D. Ford, P. Chapman, J. Mangion, Y. Quirk, D.F. Easton, J. Burn, and M.R. Stratton, Familial cylindromatosis (turban tumour syndrome) gene localised to chromosome 16q12-q13: Evidence for its role as a tumour suppressor gene, Nat Genet, 11 (1995) 441-443. [35] S. Saggar, K.A. Chernoff, S. Lodha, L. Horev, S. Kohl, R.S. Honjo, H.R. Brandt, K. Hartmann, and J.T. Celebi, CYLD mutations in familial skin appendage tumours, J Med Genet, 45 (2008) 298-302. [36] R. Massoumi and R. Paus, Cylindromatosis and the CYLD gene: New lessons on the molecular principles of epithelial growth control, Bioessays, 29 (2007) 1203-1214. [37] E.W. Harhaj and V.M. Dixit, Regulation of NF-[kappa]B by deubiquitinases, Immunol Rev, 246 (2012) 107-124. [38] T.T. Huang, N. Kudo, M. Yoshida, and S. Miyamoto, A nuclear export signal in the Nterminal regulatory domain of I[kappa]B[alpha] controls cytoplasmic localization of inactive NF[kappa]B/I[kappa]B[alpha] complexes, Proc Natl Acad Sci USA, 97 (2000) 1014-1019. [39] T. Tanaka, M.J. Grusby, and T. Kaisho, PDLIM2-mediated termination of transcription factor NF[kappa]B activation by intranuclear sequestration and degradation of the p65 subunit, Nat Immunol, 8 (2007) 584-591. [40] A.K. Mankan, M.W. Lawless, S.G. Gray, D. Kelleher, and R. McManus, NF-[kappa]B regulation: The nuclear response, J Cell Mol Med, 13 (2009) 631-643. [41] B. Liu, Y. Yang, V. Chernishof, R.R. Loo, H. Jang, S. Tahk, R. Yang, S. Mink, D. Shultz, C.J. Bellone, J.A. Loo, and K. Shuai, Proinflammatory stimuli induce IKK[alpha]mediated phosphorylation of PIAS1 to restrict inflammation and immunity, Cell, 129 (2007) 903-914. [42] S. Tahk, B. Liu, V. Chernishof, K.A. Wong, H. Wu, and K. Shuai, Control of specificity and magnitude of NF-[kappa]B and STAT1-mediated gene activation through PIASy and PIAS1 cooperation, Proc Natl Acad Sci USA., 104 (2007) 11643-11648. [43] G.N. Maine, X. Mao, C.M. Komarck, and E. Burstein, COMMD1 promotes the ubiquitination of NF[kappa]B subunits through a cullincontaining ubiquitin ligase, EMBO J, 26 (2007) 436-447.

39 CHAPTER 2

[44] B. van de Sluis, J. Rothuizen, P.L. Pearson, B.A. van Oost, and C. Wijmenga, Identification of a new copper metabolism gene by positional cloning in a purebred dog population, Hum Mol Genet, 11 (2002) 165-173. [45] E. Burstein, J.E. Hoberg, A.S. Wilkinson, J.M. Rumble, R.A. Csomos, C.M. Komarck, G.N. Maine, J.C. Wilkinson, M.W. Mayo, and C.S. Duckett, COMMD proteins, a novel family of structural and functional homologs of MURR1, J Biol Chem, 280 (2005) 22222-22232. [46] P. de Bie, B. van de Sluis, E. Burstein, R. Berger, C.S. Duckett, C. Wijmenga, and L.W.J. Klomp, Characterization of COMMD protein-protein interactions in NF-[kappa]B signalling, Biochem J, 398 (2006) 63-71. [47] A.E. Klomp, B. van de Sluis, L.W. Klomp, and C. Wijmenga, The ubiquitously expressed MURR1 protein is absent in canine copper toxicosis, J Hepatol., 39 (2003) 703-709. [48] L. Ganesh, E. Burstein, A. Guha-Niyogi, M.K. Louder, J.R. Mascola, L.W. Klomp, C. Wijmenga, C.S. Duckett, and G.J. Nabel, The gene product Murr1 restricts HIV-1 replication in resting CD4+ lymphocytes, Nature, 426 (2003) 853-857. [49] H. Geng, T. Wittwer, O. Dittrich-Breiholz, M. Kracht, and M.L. Schmitz, Phosphorylation of NF[kappa] B p65 at Ser468 controls its COMMD1dependent ubiquitination and target genespecific proteasomal elimination, EMBO Rep, 10 (2009) 381-386. [50] I. Mattioli, H. Geng, A. Sebald, M. Hodel, C. Bucher, M. Kracht, and M.L. Schmitz, Inducible phosphorylation of NF-[kappa]B p65 at Serine 468 by T cell costimulation is mediated by IKK[epsilon], J Biol Chem, 281 (2006) 6175-6183. [51] H. Buss, A. Dörrie, M.L. Schmitz, R. Frank, M. Livingstone, K. Resch, and M. Kracht, Phosphorylation of serine 468 by GSK-3[beta] negatively regulates basal p65 NF[kappa]B activity, J Biol Chem, 279 (2004) 49571-49574. [52] X. Mao, N. Gluck, D. Li, G.N. Maine, H. Li, I.W. Zaidi, A. Repaka, M.W. Mayo, and E. Burstein, GCN5 is a required cofactor for a ubiquitin ligase that targets NF[kappa]B/RelA, Genes Dev, 23 (2009) 849-861. [53] E. Burstein, L. Ganesh, R.D. Dick, B. van de Sluis, J.C. Wilkinson, L.W. Klomp, C. Wijmenga, G.J. Brewer, G.J. Nabel, and C.S. Duckett, A novel role for XIAP in copper homeostasis through regulation of MURR1, EMBO J, 23 (2004) 244-254. [54] A. Zoubeidi, S. Ettinger, E. Beraldi, B. Hadaschik, A. Zardan, L.W. Klomp, C.C. Nelson, P.S. Rennie, and M.E. Gleave, Clusterin facilitates COMMD1 and I[kappa]B degradation to enhance NF[kappa]B activity in prostate cancer cells, Mol Cancer Res, 8 (2010) 119-130. [55] P.A. Muller, B. van de Sluis, A.J. Groot, D. Verbeek, W.I. Vonk, G.N. Maine, E. Burstein, C. Wijmenga, M. Vooijs, E. Reits, and L.W. Klomp, Nuclearcytosolic transport of COMMD1 regulates NF[kappa]B and HIF-1 activity, Traffic, 10 (2009) 514-527. [56] X. Mao, N. Gluck, B. Chen, P. Starokadomskyy, H. Li, G.N. Maine, and E. Burstein, COMMD1 (copper metabolism MURR1 domain-containing protein 1) regulates cullin RING ligases by preventing CAND1 (cullin-associated Nedd8-dissociated protein 1) binding, J Biol Chem, 286 (2011) 32355-32365. [57] L. Drevillon, G. Tanguy, A. Hinzpeter, N. Arous, A. de Becdelievre, A. Aissat, A. Tarze, M. Goossens, and P. Fanen, COMMD1-mediated ubiquitination regulates CFTR trafficking, PLoS One, 6 (2011) e18334. [58] M. Lian and X. Zheng, HSCARG Regulates NF[kappa]B activation by promoting the ubiquitination of RelA or COMMD1, J Biol Chem, 284 (2009) 17998-18006. [59] B. van de Sluis, P. Muller, K. Duran, A. Chen, A.J. Groot, L.W. Klomp, P.P. Liu, and C. Wijmenga, Increased activity of hypoxiainducible factor 1 is associated with early embryonic lethality in Commd1 null mice, Mol Cell Biol, 27 (2007) 4142-4156. [60] B. van de Sluis, A.J. Groot, J. Vermeulen, E. van der Wall, P.J. van Diest, C. Wijmenga, L.W. Klomp, and M. Vooijs, COMMD1 Promotes pVHL and O2-Independent Proteolysis of HIF-1 alpha via HSP90/70, PLoS One, 4 (2009) e7332. [61] A.R. Mufti, E. Burstein, R.A. Csomos, P.C. Graf, J.C. Wilkinson, R.D. Dick, M. Challa, J.-K. Son, S.B. Bratton, G.L. Su, G.J. Brewer, U. Jakob, and C.S. Duckett, XIAP is a copper binding protein deregulated in Wilson’s disease and other copper toxicosis disorders, Mol Cell, 21 (2006) 775-785.

40 COMMD proteins and NF-κB termination

[62] A.R. Mufti, E. Burstein, and C.S. Duckett, XIAP: Cell death regulation meets copper homeostasis, Arch Biochem Biophys, 463 (2007) 168-174. [63] W.I. Vonk, P. Bartuzi, P. de Bie, N. Kloosterhuis, C.G. Wichers, R. Berger, S. Haywood, L.W. Klomp, C. Wijmenga, and B. van de Sluis, Liver-specific Commd1 knockout mice are susceptible to hepatic copper accumulation, PLoS One, 6 (2011) e29183. [64] T.Y. Tao, F. Liu, L. Klomp, C. Wijmenga, and J.D. Gitlin, The copper toxicosis gene product Murr1 directly interacts with the Wilson disease protein, J Biol Chem, 278 (2003) 41593-41596. [65] Y. Huang, M. Wu, and H.-Y. Li, Tumor suppressor ARF promotes non-classic proteasome-independent 2 polyubiquitination of COMMD1, J Biol Chem, 283 (2008) 11453-11460. [66] N.T. Woods, R.D. Mesquita, M. Sweet, M.A. Carvalho, X. Li, Y. Liu, H. Nguyen, C.E. Thomas, E.S. Iversen, S. Marsillac, R. Karchin, J. Koomen, and A.N. Monteiro, Charting the landscape of tandem BRCT domainmediated protein interactions, Sci. Signal, 5 (2012) rs6. [67] P. Muller, H. Bakel, B. van de Sluis, F. Holstege, C. Wijmenga, and L.J. Klomp, Gene expression profiling of liver cells after copper overload in vivo and in vitro reveals new copper-regulated genes, J Biol Inorg Chem , 12 (2007) 495-507. [68] H.C. Thoms, C.J. Loveridge, J. Simpson, A. Clipson, K. Reinhardt, M.G. Dunlop, and L.A. Stark, Nucleolar targeting of RelA(p65) is regulated by COMMD1-dependent ubiquitination, Cancer Res, 70 (2010) 139-149. [69] B. van de Sluis, X. Mao, Y. Zhai, A.J. Groot, J.F. Vermeulen, E. van der Wall, P.J. van Diest, M.H. Hofker, C. Wijmenga, L.W. Klomp, K.R. Cho, E.R. Fearon, M. Vooijs, and E. Burstein, COMMD1 disrupts HIF- 1[alpha]/[beta] dimerization and inhibits human tumor cell invasion, J Clin Invest, 120 (2010) 2119-2130. [70] M.D. Petroski and R.J. Deshaies, Function and regulation of cullin-RING ubiquitin ligases, Nat Rev Mol Cell Biol, 6 (2005) 9-20. [71] P. Starokadomskyy, N. Gluck, H. Li, B. Chen, M. Wallis, G.N. Maine, X. Mao, I.W. Zaidi, M.Y. Hein, F.J. McDonald, S. Lenzner, A. Zecha, H.-H. Ropers, A.W. Kuss, J. McGaughran, J. Gecz, and E. Burstein, CCDC22 deficiency in humans blunts activation of proinflammatory NF[kappa]B signaling, J Clin Invest, 123 (2013) 2244-2256. [72] O.P. Forman, M.E. Boursnell, B.J. Dunmore, N. Stendall, B. van de Sluis, N. Fretwell, C. Jones, C. Wijmenga, J. Rothuizen, B.A. van Oost, N.G. Holmes, M.M. Binns, and P. Jones, Characterization of the COMMD1 (MURR1) mutation causing copper toxicosis in Bedlington terriers, Anim Genet, 36 (2005) 497-501. [73] W.M. Vonk, P. Bie, C.K. Wichers, P.E. den Berghe, R. Plaats, R. Berger, C. Wijmenga, L.J. Klomp, and B. van de Sluis, The copper-transporting capacity of ATP7A mutants associated with Menkes disease is ameliorated by COMMD1 as a result of improved protein expression, Cell Mol Life Sci., 69 (2012) 149-163. [74] W. Biasio, T. Chang, C.J. McIntosh, and F.J. McDonald, Identification of Murr1 as a regulator of the human delta epithelial sodium channel, J Biol Chem, 279 (2004) 5429-5434. [75] W.I. Vonk, C. Wijmenga, R. Berger, B. van de Sluis, and L.W. Klomp, Cu, Zn superoxide dismutase maturation and activity are regulated by COMMD1, J Biol Chem, 285 (2010) 28991-29000. [76] T. Chang, Y. Ke, K. Ly, and F.J. McDonald, COMMD1 regulates the delta epithelial sodium channel ([delta] ENaC) through trafficking and ubiquitination, Biochem Biophys Res Commun, 411 (2011) 506-511.

41

CHAPTER 3

Functional understanding of the versatile protein copper metabolism MURR1 domain 1 (COMMD1) in copper homeostasis

Fedoseienko A, Bartuzi P, van de Sluis B

University of Groningen, University Medical Center Groningen, Molecular Genetics section, Groningen, the Netherlands

Annals of the New York Academy of Sciences 2014; 1314: 6-14 Abstract

Copper is an important co-factor in numerous biological processes in all living organisms. However, excessive copper can be extremely toxic, so it is vital that the copper level within a cell is tightly regulated. The damaging effect of copper is seen in several hereditary forms of copper toxicity in man and animals. At present, Wilson disease is the best-described and best-studied copper storage disorder in man; it is caused by mutations in the ATP7B gene. In dogs, a mutation in the COMMD1 gene has been found to be associated with copper toxicosis. Using a liver-specific Commd1 knockout mouse, the biological role of Commd1 in copper homeostasis has been confirmed. Yet, the exact mechanism by which COMMD1 regulates copper homeostasis is still unknown. Here we give an overview of the current knowledge and perspectives on the molecular function of COMMD1 in copper homeostasis. COMMD1 and copper homeostasis Introduction

Hepatic copper toxicity has been described in several mammals, including man, rat, mouse, dog, and sheep. Wilson disease (OMIM 277900), the hereditary copper storage disorder in man, is caused by mutations in the ATP7B gene. ATP7B encodes for the copper transporting P-type ATPase protein, ATP7B. Spontaneous mutations in the Atp7b gene have also been identified in rats (LEC rat) and mice (toxic milk mouse)[1,2]. However, at present, no mutations in the ATP7B gene have been described in dogs or sheep. In dogs, the best-described copper storage disorder is copper toxicosis (CT) in Bedlington terriers [3]. CT in Bedlington terriers is an autosomal recessive disorder characterized by massive lysosomal copper accumulation in the liver of affected dogs. This is due to a defect in the excretion of copper into the bile [4]. A positional cloning approach identified 3 a genomic deletion of 39.7 kb linked with CT, comprising exon 2 of the MURR1 gene [5-7]. The name MURR1 was changed into COpper Metabolism gene MURR1 containing Domain 1 (COMMD1) after Burstein and colleagues identified the COMMD protein family [8], with COMMD1 being the founder of this family. All ten COMMD family members are widely expressed and characterized by a specific domain called the COMM domain, located in the carboxy-terminus of these proteins [8]. The fact that COMMD1 protein was undetectable in liver homogenates of CT-affected Bedlington terriers suggests that the COMMD1 exon 2 deletion results in a loss-of-function protein. In contrast to dogs, a Commd1 loss-of-function mutation in mice results in embryonic lethality [9]. Commd1 knockout mice die in utero between 9.5 and 10.5 days post coitum (dpc). The development of Commd1 knockout embryos is generally delayed, and the placenta vascularization is abnormal. This latter observation has been suggested to be caused by aberrant activity of the transcription factor hypoxia-inducible factor 1 (HIF-1). HIF-1 protein levels and its activity in Commd1 knockout embryos were increased compared to wild-type embryos. The role of COMMD1 in HIF-1 signaling was further supported by various in vitro studies [9-11]. Although the reason for the phenotypic differences between dogs and mice is still unknown, it could be explained by the fact that COMMD1 in dog fetuses may be partially redundant and is compensated by the expression of other COMMD family members. In mice the Commd proteins might have a distinct function or have a different expression pattern compared to dogs and therefore this compensation does not happen. We also speculated that the differences in the placental development between dogs and mice could be an additional explanation for the contradictory phenotypes of these two species [9]. To investigate the contribution of placental Commd1 to the defective embryonic development, we used Commd1 floxed conditional knockout mice [12] and Mox2-cre transgenic mice [13] to generate Commd1-deficient embryos with functionally ‘normal’ placenta. We observed that restoration of Commd1 expression in extra-embryonic lineages was not sufficient to rescue the lethal phenotype of Commd1 knockout embryos (unpublished data). Although this experiment did not prove that Commd1 expression

45 CHAPTER 3

is not important for proper placental development, it certainly indicated that Commd1 expression in the embryonic tissue is essential for normal murine embryogenesis. This is supported by reconstituting COMMD1 expression in Commd1-deficient mice by crossing Commd1 knockout mice with mice expressing human COMMD1 protein. Expression of human COMMD1 in Commd1 knockout mice rescues the lethal phenotype, and these mice are born healthy and do not show any overt phenotype [14]. Using liver-specific Commd1 knockout mice, we provided evidence for a biological role of COMMD1 in hepatic copper homeostasis [12]. Although affected dogs progressively accumulate copper in their liver, mice only show hepatic copper accumulation when being fed a copper-rich diet. However, the mice had no liver pathology nor increased mRNA levels of the metallothioneins Mt-I and Mt-II, both gene transcripts encoding a protein that chelates copper to prevent toxicity. Despite the progressive hepatic copper accumulation in this mouse model (up to a 20-fold increase compared to wild-type littermates), the copper values did not reach the toxic levels seen in CT-affected dogs [12]. Nevertheless, this animal model clearly supports the biological role of COMMD1 in copper homeostasis, although the exact molecular mechanism of how COMMD1 regulates biliary copper excretion still needs to be identified.

Molecular mechanism of COMMD1 in copper homeostasis

The identification of the interaction between COMMD1 and ATP7B [15, 16], strongly suggests that COMMD1 positively regulates the copper-transporting activity of ATP7B and thereby the copper excretion into the bile. Under basal conditions, ATP7B is located within the trans-Golgi network (TGN), where copper can be incorporated in cuproenzymes. In the event of high copper levels, ATP7B is redistributed to cytoplasmic vesicular compartments from which copper can be excreted out of the cell (Fig. 1) [17]. When copper is normalized to physiological levels, ATP7B is recycled back to the TGN. We demonstrated that the subcellular localization of COMMD1 partially overlaps with ATP7B in HEK293T cells [18]. In line with other reports, we showed that COMMD1 localizes in cytoplasmic vesicles with a perinuclear distribution [6, 19-22]. Nevertheless, not all the studies were able to confirm the co-localization of COMMD1 with ATP7B, which may be explained by the different cell systems used, and by the fact that the interaction between ATP7B and COMMD1 might be transient. Although the identity of the cytoplasmic vesicles associated with COMMD1 is still not well defined, the above studies demonstrated that the cellular distribution of COMMD1 partially overlaps with markers of the lysosomal, endosomal pathway (early and recycling endosomes) and multivesicular bodies (Table 1). Despite the fact that these data imply an involvement of COMMD1 in the vesicular trafficking of ATP7B, none of the studies found evidence to show that reduced COMMD1 function affects the copper-induced ATP7B trafficking [18, 19]. Of note, changes in cellular copper levels do not lead to a different subcellular distribution of COMMD1, but can lead to reduced

46 COMMD1 and copper homeostasis

Figure 1. Current overview of the possible mechanisms Trans Golgi Network by which COMMD1 maintains copper homeostasis. ? COMMD1 Under normal conditions ATP7B localizes in the trans-

ATP7B Golgi network (TGN). Upon elevated copper levels Proteolysis ATP7B locates to vesicular compartments at the cell ? periphery from which copper can be excreted out Retrograde of the hepatocytes into the bile. Numerous studies Transport ATP7B ATP7B proposed different mechanism of COMMD1 COMMD1 in regulating copper homeostasis, indicated with COMMD1 question marks. Various studies suggested a role for Translocation ATP7B Cu-dependent Cu COMMD1 in regulating the protein stability of ATP7B. Another study showed that COMMD1 deficiency Cu attenuates the relocation of ATP7B back to TGN when ? copper returns to normal physiological levels. Since COMMD1 ? 3 COMMD1 the incorporation of copper in cuproenzymes is not affected in CT-affected dogs and liver specific Commd1 knockout mice, it is very likely that COMMD1 acts Bile downstream of ATP7B, and is required at this final step canaliculus to excrete copper into the bile canaliculus.

Table 1. Overview of proteins and organelle markers that colocalize with COMMD1 Pathway studied Colocalization Marker Cell type Reference Copper metabolism CD63 Lysosomes HeLa Ref. 6 TFR Early/recycling endosomes

ATP7B/Copper me- ATP7B Trans-Golgi HEK293T Ref. 18 tabolism ATP7B/Copper me- Rab7 Late-endosomes HEK293T Ref. 19 tabolism Rab9 Late-endosomes/TGN Rab11a Recycling endosomes

Biochemical analy- EEA1 Early endosomes Polarized Ref. 20 sis of COMMD1 CHMP2B Late endosomes/ HepG2 and PtdIns(4,5)P2 multi-vesicular bodies Lamp1b Lysosomes Golgin-97b Golgi

Sodium transport δENaC Early/recycling endosomes Cos7 Ref. 21

TFR CFTR trafficking Rab11 Recycling endosomes HeLa Ref. 22 EHD1 Recycling endosomes TFR Early/recycling endosomes a Used in study but shows no COMMD1 colocalization b Minimal COMMD1 colocalization

47 CHAPTER 3

levels of COMMD1 [6, 23]. However, using a mouse hepatoma cell line, Miyayama and colleagues reported that the retrograde transport of ATP7B back to TGN is impaired in Commd1-insufficient cells [24]. This observation indicates that COMMD1 facilitates the relocation of ATP7B back to TGN when the copper returns to normal physiological levels (Fig. 1). It is not known whether ATP7B also continuously cycles between TGN and the cell periphery under basal conditions, similar to the highly homologous Menkes disease protein ATP7A [25], but it would be interesting to investigate the contribution of COMMD1 in this recycling pathway. Nonetheless, if COMMD1 is required for shuttling ATP7B back to the TGN, we would expect the incorporation of copper in cuproenzymes to be affected as well.Since CT-affected Bedlington terriers and the liver-specific Commd1 knockout mouse do not show reduced ceruloplasmin activity [12, 26], this implies that COMMD1 acts downstream of ATP7B, and may be required at the final step of copper excretion into the bile (Fig. 1). This secretory pathway might be facilitated via the interaction

of COMMD1 with the membrane phosphatidylinositol PtdIns(4,5)P2, which has been shown to have a role in vesicular transport, acting as a membrane-anchoring molecule [20]. Another hypothesis, proposed by de Bie and colleagues (2007) [18], suggested that COMMD1 is involved in the quality control of newly synthesized ATP7B protein (Fig. 1). This concept was based on the observation that overexpression of COMMD1 enhanced the proteolysis of newly synthesized ATP7B, and that mutations in the amino-terminal region of ATP7B increased its binding to COMMD1. Several of the described mutations were associated with mislocalization and decreased half-life of ATP7B. Although this study [18] did not provide evidence that COMMD1 directly mediates the proteolysis of ATP7B, other studies support a role for COMMD1 in protein degradation [9, 10, 16, 27-29]. COMMD1 acts as a hub to promote ubiquitination and proteosomal degradation of the NF-κB subunit p65 [27], and of the ubiquitination of the epithelial sodium channel ENaC [28], enhances the proteolysis of hypoxia-inducible factor 1 (HIF1) [9, 10], and is associated with several Cullins [29]. However, there are some discrepancies in the reported effect of COMMD1 on ATP7B protein levels (for overview see Table 2). Miyayama et al. (2010) [24] reported that knockdown of Commd1 in a mouse hepatoma cell line reduced the protein levels and function of Atp7b, resulting in an increase in the intracellular copper concentration and the cytotoxicity to cisplatin. Cisplatin is also a substrate for ATP7B [24], and a recent study supported the association between COMMD1 insufficiency and increased cisplatin sensitivity, but it is not known whether this can be explained by changes in ATP7B function or COMMD1 interaction with the BRCA1 C-terminal (BRCT) domain containing DNA damage response proteins [30]. In line with the observation that COMMD1 is required for proper ATP7B levels, we recently reported that COMMD1 also enhances the protein levels and function of ATP7A [31]. Protein-protein interaction was demonstrated between COMMD1 and ATP7A [16, 31]. This interaction improves the expression, cellular distribution, and copper-exporting activities of transiently expressed wild-type and mutant ATP7A in HEK293T cells [31]. The reduced levels and function of endogenous ATP7A

48 COMMD1 and copper homeostasis ND ND ND ND enriched diet transporting activity transporting activity transporting activity transporting increased upon a copper- upon increased Not changed, but but changed, Not Increased Increased Improved copper- copper- Improved Copper Decreased copper- Decreased copper-

3 mice, 6 weeks old 6 weeks mice, mice, 9-58 weeks old 9-58 weeks mice, Model Liver-specific knockout knockout Liver-specific Liver-specific knockout knockout Liver-specific HEK293T Mouse hepatoma cell line hepatoma Mouse HEK293T HEK293T fibroblasts HEK293T HEK293T HEK293T Mouse embryonic embryonic Mouse ND ND ND protein levels levels protein protein levels protein protein levels protein levels protein protein levels protein Not changedNot Increased proteolysis Increased Increased endogenous endogenous Increased Decreased endogenous Decreased endogenous Decreased endogenous Decreased endogenous Decreased endogenous Decreased endogenous Decreased endogenous ATP7B ND ND ND ND stably overexpressed protein protein overexpressed stably levels overexpressed stably overexpressed protein levels levels protein overexpressed overexpressed protein levels protein overexpressed levels levels levels Increased transiently transiently Increased Increased transiently transiently Increased Increased endogenous protein protein endogenous Increased Decreased endogenous and and Decreased endogenous protein Decreased endogenous and Decreased endogenous ATP7A COMMD1 Knockdown Knockout Knockdown Knockout Knockout Knockdown Overexpression Overexpression Overexpression Reference 24 31 18 12 16 ND = not determined. Table 2. Overview of the literature on the effect of COMMD1 on ATP7A/B levels on of 2. Overview the effect COMMD1 on the literature of Table

49 CHAPTER 3

Table 3. COMMD1 interactome Expression of Pathway/group of Interacting Expression of interacting Method Reference proteins partner COMMD1 partner Copper transport ATP7A o/e o/e PD 31 endog. endog. IP 16 ATP7B o/e endog. IP, PD 15 o/e endog. in vitro interaction o/e o/e IP, PD 18 endog. endog. IF endog. endog. IP 16 Free radical SOD1 endog. endog. IP 33 scavenging o/e o/e PD CCS endog. endog. IP o/e o/e PD COMMD family COMMD1-10 endog. o/e PD 8 COMMD6 o/e o/e Y2H, BFC 38 endog. endog. IP endog. endog. IP 39 Nuclear factor-κB RELA (p65) endog. endog. IP 40 (NF-κB) signaling endog. endog. IP 8 o/e o/e IP 41 o/e o/e PD 42 RELB o/e endog. PD 8 c-REL o/e endog. PD NF-κB2/p100 o/e endog. PD NF-κB2/p100 o/e endog. PD IκBa o/e endog. IP 40 endog. endog. GCN5 o/e o/e IP 43 CCDC22 endog. endog. IP 39 o/e endog. PD Ubiquitin ligase CUL1 endog. endog. IP 40 complex data not shown data not shown ? 27 endog. endog. IP 29 o/e o/e PD CUL2 endog. endog. IP 27 o/e o/e PD o/e endog. PD 39 endog. endog. IP 29 o/e o/e PD CUL3 endog. endog. IP o/e o/e PD CUL4A,4B,7 o/e o/e PD CUL5 o/e o/e PD data not shown data not shown ? 27

50 COMMD1 and copper homeostasis

Expression of Pathway/group of Interacting Expression of interacting Method Reference proteins partner COMMD1 partner Ubiquitin ligase ELONGIN C o/e o/e PD complex SOCS1 o/e o/e PD endog. endog. IP Inhibitor of XIAP endog. endog. IP 35 apoptosis family of o/e o/e IP, PD 44 proteins (IAP) c-IAP1 o/e o/e IP, PD c-IAP2 o/e o/e IP, PD o/e o/e IP, PD 35 NAIP o/e o/e PD Hypoxia adaptation HIF-1a o/e o/e IP, PD 9 3 endog. endog. IP endog. endog. IP 11 o/e o/e PD HIF-1b o/e o/e PD HIF-2a o/e o/e PD Protein folding HSP70 o/e o/e IP 10 Nuclear export CRM1 o/e o/e IP 45 Ion (co) transporters βENaC o/e o/e PD 32 o/e o/e IP 28 δENaC o/e o/e IP, Y2H 32 o/e o/e IP, PD 21 γENaC o/e o/e PD 32 NKCC1 o/e o/e Y2H, 34 in vitro interaction endog. endog. IP AGC kinase family SGK1 o/e endog. IP 28 Akt1/ PKBa o/e o/e IP Cystic fibrosis CFTR o/e o/e Y2H 22 endog. endog. IP COMMD1 ARF o/e o/e IP, Y2H, IF 46 ubiquitination endog. endog. IF HSCARG o/e o/e IP, Y2H 47 endog. endog. IP, IF Secretory clusterin/ sCLU o/e o/e Y2H 48 apoptosis endog. endog. IP, IF endog. o/e endog. endog. IP 16 DNA damage CHK2 o/e o/e Y2H 30 response LIG4 o/e o/e Y2H BRCA1 o/e o/e Y2H, PD BARD1 o/e o/e Y2H, PD endog. = endogenous; o/e = overexpression; BFC = bimolecular fluorescence complementation; IF = immunofluorescence; IP = immunoprecipitation; PD = pull-down, Y2H = yeast two-hybrid. 51 CHAPTER 3

in COMMD1-deficient HEK293T cells and mouse embryonic fibroblasts corroborated the observation shown in cells overexpressing ATP7A and COMMD1 [31]. However, others could not completely confirm these findings. For example, Materia et al. (2012) reported opposite results and they proposed that COMMD1 facilitates degradation of ATP7A and ATP7B [16]. This study could confirm the results described by Vonk et al (2011), but only when both proteins, i.e. COMMD1 and ATP7A, were both transiently overexpressed in HEK293T cells. However, Materia et al (2012) did not investigate the effect of increased ATP7A/B on their copper-transporting activities, subcellular localization, nor copper retention in COMMD1 knockdown cells. Since loss of COMMD1 is related to copper accumulation, the observation of elevated ATP7A/B levels in COMMD1-insufficient cells sounds counter-intuitive, but was explained by an imbalance of copper efflux and copper sequestration, with copper sequestration being the primary function of ATP7B [16, 17]. Despite these contradictory results demonstrated by different cellular models, deletion of Commd1 in murine hepatocytes did not result in significant changes in Atp7b levels, except in the livers of the hepatic Commd1 knockout mice at an age of 6 weeks [12]. Here, a significant reduction in Atp7b levels was observed, which correlated with an increase in the hepatic copper content of the liver-specific Commd1 knockout mice. Thus, by using both cellular and mouse models, the role of COMMD1 in copper homeostasis has been confirmed, although the exact mechanism of its action needs further investigation.

COMMD1 function in other pathways

Since 2002 when we identified the COMMD1 mutation in affected Bedlington terriers, the network of COMMD1-interacting proteins (for overview see Table 3) has increased enormously, implicating pleiotropy of COMMD1. Indeed, besides its role in copper metabolism, COMMD1 has been linked to the regulation of sodium transport via ENaC, enhances the basolateral expression of the sodium-potassium-chloride co-transporter (NKCC1), regulates cystic fibrosis transmembrane conductance regulator (CFTR) trafficking, inhibits Cu,Zn superoxide dismutase (SOD1) activity, and modulates HIF-1 and NF-κB signaling [8, 9, 22, 32-34]. The role of COMMD1 in NF-κB signaling has been discussed in detail by Bartuzi et al [14]. A common theme in these pathways is COMMD1’s role in the ubiquitination and proteolysis of its targets. It enhances the proteolysis of the NF-κB subunit p65 and HIF-1α, and increases the ubiquitination of ENaC and NKCC1, but prevents the ubiquitination of CFTR [10, 21, 22, 27, 34]. These changes in ENaC, NKCC1 and CFTR ubiquitination are not correlated with proteasomal degradation, but with changes in the expression of ENaC, NKCC1 and CFTR at the cell membrane. In these studies, the authors suggested a role for COMMD1 in the trafficking of transmembrane proteins and targeting them to a specific cellular compartment. Altogether, these data advocate a function of COMMD1 in the vesicular transport and recycling of membrane proteins.

52 COMMD1 and copper homeostasis

A better knowledge of the function of COMMD1 in these pathways will be valuable in developing a fuller understanding of its molecular mechanism in copper homeostasis. Several mechanisms have been described as regulating the function of COMMD1 (reviewed by Bartuzi et al.[14]), including cellular copper levels (Muller et al. 2007) [23]. One of the regulators of COMMD1 that is also linked to copper homeostasis is the Xlinked inhibitor of apoptosis (XIAP). Burstein et al. have demonstrated that transformed fibroblasts derived from Xiap-deficient mice have reduced copper and increased COMMD1 levels [35]. Later it was shown that when copper levels are elevated, XIAP levels are markedly decreased both in inherited and acquired copper toxicosis [36]. It has been suggested that XIAP might be involved in regulating the expression of COMMD1 in a copperdependent manner [36, 37]. Other members of the COMMD family also have the ability to interact with copper- transporting ATPases. COMMD2, COMMD8, and COMMD10 can interact with ATP7A 3 and ATP7B, but COMMD3, COMMD4 and COMMD5 interact only with ATP7A (personal communication P. de Bie, C. Wijmenga, and L. Klomp). However, it is still unclear if other COMMDs are also involved in regulating copper homeostasis, and whether they act in concert with COMMD1, since COMMD proteins can interact with themselves or with each other [8, 38].

Concluding remarks

Since COMMD1 exon 2 deletion is linked to the hereditary copper toxicosis in Bedlington terriers, compelling evidence has been provided for a biological role of COMMD1 in copper homeostasis by a mouse model and numerous in vitro studies. One of the most noteworthy findings is the interaction between COMMD1 and the Wilson disease protein ATP7B. This protein-protein interaction was reported by various research groups and points to ATP7B requiring COMMD1 to excrete copper efficiently into the bile. Various studies suggest that COMMD1 insufficiency affects the protein levels of ATP7B, although this is not fully supported by the observation that neither the Atp7b levels, nor the copper transport into the TGN, are affected in the livers of adult hepatic Commd1- deficient mice. This suggests that COMMD1 acts downstream of ATP7B. There is still controversy as to whether ATP7B directly pumps copper into the bile canaliculus or whether ATP7B-containing vesicles are only to be found at the periphery of the hepatocytes, and in close proximity to the biliary canaliculus, when hepatic copper levels are high. Since there is only a partial overlap between COMMD1 and ATP7B localization, and it may be transient, it is tempting to speculate that COMMD1 acts as a hub in this final step to facilitate the fusion of the copper-containing exocytic vesicles with the bile canalicular membrane to release copper into the bile. However, since COMMD1 co-localizes with early and recycling endosomal markers, it cannot be ruled out that it is involved in directing the proteins to the correct vesicular compartment within a cell. Mislocalization of proteins can result in enhanced proteolysis, either proteasomal- or lysosomal-dependent, and this may explain the reduced ATP7B levels, as shown by various studies. The current data

53 CHAPTER 3

on COMMD1 function have been obtained mainly from different kinds of tumor cells, which may not be the appropriate cellular models for studying the hepatic function of COMMD1. With the generation of the conditional Commd1 knockout mouse, an excellent and novel tool has become available to further delineate COMMD1’s exact molecular mechanism in copper homeostasis in hepatocytes and other cell types. In the near future, this mouse model will also allow us to investigate the role of Commd1 in various other biological processes, such as ATP7A-dependent copper transport, sodium, potassium and chloride transport, HIF-1 signaling, and NF-κB mediated inflammation.

Acknowledgements

We thank Jackie Senior for editing the text. This work was supported by the Graduate School for Drug Exploration (GUIDE) of the University of Groningen, and by an NWO- ALW grant (817.02.022).

54 COMMD1 and copper homeostasis

References

[1] Theophilos M.B., Cox D.W., and Mercer J.F. The toxic milk mouse is a murine model of Wilson disease. Hum Mol Genet. 5 (1996) 1619-1624. [2] Wu J., Forbes J., Chen H. et al. The LEC rat has a deletion in the copper transporting ATPase gene homologous to the Wilson disease gene. Nat Genet. 7 (1994) 541-545. [3] Hardy R.M., Stevens J.B., and Stowe C.M. Chronic progressive hepatitis in Bedlington terriers associated with elevated liver copper concentrations. Minnesota Vet. 15 (1975) 13–24. [4] Twedt D.C., Sternlieb I., and Gilbertson S.R. Clinical, morphologic, and chemical studies on copper toxicosis of Bedlington Terriers. J Am Vet Med Assoc. 175 (1979) 269–275. [5] van de Sluis B., Rothuizen J., Pearson P.L. et al. Identification of a new copper metabolism gene by positional cloning in a purebred dog population. Hum Mol Genet. 11 (2002) 165-173. [6] Klomp A.E., van de Sluis B., Klomp L.W. et al. The ubiquitously expressed MURR1 protein is absent in canine copper toxicosis. J Hepatol. 39 (2003) 703-709. 3 [7] Forman O.P., Boursnell M.E., Dunmore B.J. et al. Characterization of the COMMD1 (MURR1) mutation causing copper toxicosis in Bedlington terriers. Anim Genet. 36 (2005) 497-501. [8] Burstein E., Hoberg J.E., Wilkinson A.S. et al. COMMD proteins, a novel family of structural and functional homologs of MURR1. J Biochem. 280 (2005) 22222-22232. [9] van de Sluis B., Muller P., Duran K. et al. Increased activity of hypoxia-inducible factor 1 is associated with early embryonic lethality in Commd1 null mice. Mol Cell Biol. 27 (2007) 4142-4156. [10] van de Sluis B., Groot A.J., van der Wall E. et al. COMMD1 promotes pVHL and O2-independent proteolysis of HIF-1α via HSP90/70. PLoS One 4 (2009) e7332. [11] van de Sluis B., Mao X., Zhai Y. et al. COMMD1 disrupts HIF-1α/β dimerization and inhibits human tumor cell invasion. J Clin Invest. 120 (2010) 2119-2130. [12] Vonk W.I., Bartuzi P., de Bie P. et al. Liver-specific Commd1 knockout mice are susceptible to hepatic copper accumulation. PLoS One 6 (2011) e29183. [13] Tallquist M.D. and Soriano P. Epiblast-restricted Cre expression in MORE mice: A tool to distinguish embryonic vs. extra-embryonic gene function. Genesis 26 (2000) 113-115. [14] Bartuzi P., Hofker M.H., and van de Sluis B. Tuning NF-κB activity: A touch of COMMD proteins. Biochim Biophys Acta. 1832 (2013) 2315-2321. [15] Tao T.Y., Liu F., Klomp L. et al. The copper toxicosis gene product Murr1 directly interacts with the Wilson disease protein. J Biochem. 278 (2003) 41593-41596. [16] Materia S., Cater M.A., Klomp L.W. et al. Clusterin and COMMD1 independently regulate degradation of the mammalian copper ATPases ATP7A and ATP7B. J Biochem. 287 (2012) 2485-2499. [17] Cater M.A., La Fontaine S., Shield K. et al. ATP7B mediates vesicular sequestration of copper: insight into biliary copper excretion. Gastroenterology 130 (2006) 493-506. [18] de Bie P., van de Sluis B., Burstein E. et al. Distinct Wilson-disease mutations in ATP7B are associated with enhanced binding to COMMD1 and reduced stability of ATP7B. Gastroenterology 133 (2007) 1316-1326. [19] Weiss K.H., Carbajo Lozoya J., Tuma S. et al. Copper-induced translocation of the Wilson disease protein ATP7B independent of Murr1/COMMD1 and Rab7. Am J Pathol. 173 (2008) 1783-1794. [20] Burkhead J.L., Morgan C.T., Shinde U. et al. COMMD1 forms oligomeric complexes targeted to the endocytic membranes via specific interactions with phosphatidylinositol 4,5-bisphosphate. J Biochem. 284 (2009) 696-707. [21] Chang T., Ke Y., Ly K. et al. COMMD1 regulates the delta epithelial sodium channel (δENaC) through trafficking and ubiquitination. BBRC. 411 (2011) 506-511. [22] Drévillon L., Tanguy G., Hinzpeter A. et al. COMMD1-mediated ubiquitination regulates CFTR trafficking. PLoS One 6 (2011) e18334.

55 CHAPTER 3

[23] Muller P., Bakel H., Sluis B. et al. Gene expression profiling of liver cells after copper overload in vivo and in vitro reveals new copper-regulated genes. J Biol Inorg Chem. 12 (2007) 495-507. [24] Miyayama T., Hiraoka D., Kawaji F. et al. Roles of COMM-domain-containing 1 in stability and recruitment of the copper-transporting ATPase in a mouse hepatoma cell line. J Biochem. 429 (2010) 53-61. [25] Petris M.J. and Mercer J.F. The Menkes protein (ATP7A; MNK) cycles via the plasma membrane both in basal and elevated extracellular copper using a C-terminal Di-Leucine endocytic signal. Hum Mol Genet. 8 (1999) 2107-2115. [26] Su L.C., Owen C.A., Zollman P.E. et al. A defect of biliary excretion of copper in copper-laden Bedlington terriers. Am J Physiol. (1982) G231–G236. [27] Maine G.N., Mao X., Komarck C.M. et al. COMMD1 promotes the ubiquitination of NF-κB subunits through a cullin-containing ubiquitin ligase. EMBO J. 26 (2007) 436-447. [28] Ke Y., Butt A.G., Swart M. et al. COMMD1 downregulates the epithelial sodium channel through Nedd4-2. Am J Physiol. 298 (2010) F1445-F1456. [29] Mao X., Gluck N., Chen B. et al. COMMD1 (copper metabolism MURR1 domain-containing protein 1) regulates cullin RING ligases by preventing CAND1 (cullin-associated Nedd8-dissociated protein 1) binding. J Biochem. 286 (2011) 32355-32365. [30] Woods N.T., Mesquita R.D., Sweet M. et al. Charting the landscape of tandem BRCT domain–mediated protein interactions. Sci Signal 5 (2012) rs6. [31] Vonk W.M., Bie P., Wichers C.K. et al. The copper-transporting capacity of ATP7A mutants associated with Menkes disease is ameliorated by COMMD1 as a result of improved protein expression. Cell Mol Life Sci. 69 (2012) 149-163. [32] Biasio W., Chang T., McIntosh C.J. et al. Identification of Murr1 as a regulator of the human δ epithelial sodium channel. J Biochem. 279 (2004) 5429-5434. [33] Vonk W.I., Wijmenga C., Berger R. et al. Cu,Zn superoxide dismutase maturation and activity are regulated by COMMD1. J Biochem. 285 (2010) 28991-29000. [34] Smith L., Litman P., and Liedtke C.M. COMMD1 interacts with the COOH terminus of NKCC1 in Calu-3 airway epithelial cells to modulate NKCC1 ubiquitination. Am J Physiol Cell Physiol 305 (2013) C133-C146. [35] Burstein E., Ganesh L., Dick R.D. et al. A novel role for XIAP in copper homeostasis through regulation of MURR1. EMBO J. 23 (2004) 244-254. [36] Mufti A.R., Burstein E., Csomos R.A. et al. XIAP is a copper binding protein deregulated in Wilson’s disease and other copper toxicosis disorders. Mol. Cell 21 (2006) 775-785. [37] Mufti A.R., Burstein E., and Duckett C.S. XIAP: Cell death regulation meets copper homeostasis. Arch Biochem Biophys. 463 (2007) 168-174. [38] de Bie P., van de Sluis B., Burstein E. et al. Characterization of COMMD protein–protein interactions in NF-κB signalling. Biochem J. 398 (2006) 63–71. [39] Starokadomskyy P., Gluck N., Li H. et al. CCDC22 deficiency in humans blunts activation of proinflammatory NF-κB signaling. J Clin Invest 123 (2013) 2244-2256. [40] Ganesh L., Burstein E., Guha-Niyogi A. et al. The gene product Murr1 restricts HIV-1 replication in resting CD4+ lymphocytes. Nature 426 (2003) 853-857. [41] Geng H., Wittwer T., Dittrich-Breiholz O. et al. Phosphorylation of NF-κB p65 at Ser468 controls its COMMD1-dependent ubiquitination and target gene-specific proteasomal elimination. EMBO Rep 10 (2009) 381-386. [42] Thoms H.C., Loveridge C.J., Simpson J. et al. Nucleolar Targeting of RelA(p65) Is Regulated by COMMD1- Dependent Ubiquitination. Cancer Research 70 (2010) 139-149. [43] Mao X., Gluck N., Li D. et al. GCN5 is a required cofactor for a ubiquitin ligase that targets NF-κB/RelA. Genes & Development 23 (2009) 849-861. [44] Maine G.N., Mao X., Muller P.A. et al. COMMD1 expression is controlled by critical residues that determine XIAP binding. Biochem J 417 (2009) 601-609.

56 COMMD1 and copper homeostasis

[45] Muller P.A., van de Sluis B., Groot A.J. et al. Nuclear-cytosolic transport of COMMD1 regulates NF-κB and HIF-1 activity. Traffic 10 (2009) 514-527. [46] Huang Y., Wu M., and Li H.-Y. Tumor Suppressor ARF Promotes Non-classic Proteasome-independent Polyubiquitination of COMMD1. J Biol Chem 283 (2008) 11453-11460. [47] Lian M. and Zheng X. HSCARG regulates NF-κB activation by promoting the ubiquitination of RelA or COMMD1. J Biochem 284 (2009): 17998-18006. [48] Zoubeidi A., Ettinger S., Beraldi E. et al. Clusterin facilitates COMMD1 and I-κB Degradation to enhance NF-κB activity in prostate cancer cells. Mol Cancer Res. 8 (2010) 119-130.

3

57

CHAPTER 4

Copper metabolism domain-containing 1 represses genes that promote inflammation and protects mice from colitis and colitis-associated cancer

Li H1, Chan L1, Bartuzi P2, Melton SD3, Weber A4, Ben–Shlomo S5, Varol C5, Raetz M6, Mao X1, Starokadomskyy P1, van Sommeren S7, Mokadem M1, Schneider H8, Weisberg R1, Westra HJ9, Esko T10, Metspalu A10, Kumar V9, Faubion WA11, Yarovinsky F6, Hofker 2M , Wijmenga C9, Kracht M4, Franke L9,Aguirre V1, Weersma RK7, Gluck N5, van de Sluis B2, and BursteinE1,12

1Department of Internal Medicine, University of Texas Southwestern Medical Center, Dallas, Texas, 2Department of Pediatrics (Section of Molecular Genetics), University of Groningen, University Medical Center Groningen, Groningen, The Netherlands, 3Department of Pathology, Dallas VA Medical Center, Dallas, Texas,4Rudolf Buchheim Institute of Pharmacology, Justus Liebig University, Giessen, Germany, 5Gastroenterology Institute, Tel Aviv Sourasky Medical Center, Tel Aviv, Israel, 6Department of Immunology, University of Texas Southwestern Medical Center, Dallas, Texas, 7Department of Gastroenterology and Hepatology, University of Groningen, University Medical Center Groningen, Groningen, The Netherlands, 8Institute of Physiological Chemistry, Hannover Medical School, Hannover, Germany, 9Department of Genetics, University of Groningen, University Medical Center Groningen, Groningen, The Netherlands, 10Estonian Genome Center, University of Tartu, Tartu, Estonia, 11Division of Gastroenterology and Hepatology, Mayo Clinic, Rochester, Minnesota, 12Department of Molecular Biology, University of Texas Southwestern Medical Center, Dallas, Texas

Gastroenterology 2014; 147(1):184-195 ABSTRACT

BACKGROUND & AIMS: Activation of the transcription factor nuclear factor-κB (NF-κB) has been associated with the development of inflammatory bowel disease (IBD). Copper metabolism MURR1 domain containing 1 (COMMD1), a regulator of various transport pathways, has been shown to limit NF-κB activation. We investigated the roles of COMMD1 in the pathogenesis of colitis in mice and IBD in human beings.

METHODS: We created mice with a specific disruption ofCommd1 in myeloid cells (Mye-knockout [K/O] mice); we analyzed immune cell populations and functions and expression of genes regulated by NF-κB. Sepsis was induced in Mye-K/O and wild-type mice by cecal ligation and puncture or intraperitoneal injection of lipopolysaccharide (LPS), colitis was induced by administration of dextran sodium sulfate, and colitis-associated cancer was induced by administration of dextran sodium sulfate and azoxymethane. We measured levels of COMMD1 messenger RNA in colon biopsy specimens from 29 patients with IBD and 16 patients without (controls), and validated findings in an independent cohort (17 patients with IBD and 22 controls). We searched for polymorphisms in or near COMMD1 that were associated with IBD using data from the International IBD Genetics Consortium and performed quantitative trait locus analysis.

RESULTS: In comparing gene expression patterns between myeloid cells from Mye-K/O and wild-type mice, we found that COMMD1 represses expression of genes induced by LPS. Mye-K/O mice had more intense inflammatory responses to LPS and developed more severe sepsis and colitis, with greater mortality. More Mye-K/O mice with colitis developed colon dysplasia and tumors than wild-type mice. We observed a reduced expression of COMMD1 in colon biopsy specimens and circulating leukocytes from patients with IBD. We associated single-nucleotide variants near COMMD1 with reduced expression of the gene and linked them with increased risk for ulcerative colitis.

CONCLUSIONS: Expression of COMMD1 by myeloid cells has anti-inflammatory effects. Reduced expression or function of COMMD1 could be involved in the pathogenesis of IBD. COMMD1 and colitis INTRODUCTION

Persistent inflammation is a common maladaptive component in the pathogenesis of human diseases. A prime example of this paradigm is inflammatory bowel disease (IBD), a chronic inflammatory process of the intestinal tract that clinically presents as two phenotypic entities: ulcerative colitis (UC) and Crohn’s disease (CD). This disorder involves an interaction between environmental factors and inherited susceptibility, and is associated with an increased risk for colorectal cancer [1]. The regulation of the inflammatory cascade is a complex process in which the transcription factor NF-κB plays a master regulatory role [2]. Consequently, this factor has also been linked to the pathogenesis of several chronic inflammatory conditions in human beings [2], including IBD [3, 4]. Canonical NF-κB activity is mediated primarily by NF-κB complexes containing the RelA subunit (also known as p65) or its paralog c-Rel. Under basal conditions, these complexes are kept in the cytosol through interactions with the inhibitory IκB proteins. Their activation requires IκB degradation, an event triggered by a critical kinase complex known as IκB kinase that sits at the cross-roads of numerous signaling pathways. After signaling inputs abate, homeostatic mechanisms that restore basal 4 NF-κB activity are essential for the physiologic function of this pathway. The induction of IκB gene expression [5], or the expression of IκB kinase inhibitory proteins, such as A20 or CYLD [6, 7], participate in the timely termination of NF-κB activity. The expression of these factors is under the control of NF-κB itself, thus providing negative feedback loops in the pathway. In addition, it has been recognized that ubiquitination and proteasomal degradation of RelA is critical to terminate transcription of a variety of genes [8-13]. One ligase responsible for these effects contains the scaffold protein Cul2 in association with copper metabolism MURR1 domain containing 1 (COMMD1) [10, 12], a prototypical member of the COMMD protein family [14]. In addition to its role in NF-κB regulation [12, 15], COMMD1 has been implicated in a variety of cellular processes, including copper transport [16], electrolyte balance [17- 19], and hypoxia responses [20]. Given these pleotropic functions, it has remained unclear whether this factor plays a physiologically important role in the control of inflammation in vivo and whether it could play a role in chronic inflammatory diseases. Here we report that myeloid- specific deficiency of Commd1 leads to more intense activation of LPS-inducible genes and is associated with more severe inflammation. In addition, we present genetic evidence linking gene variants associated with reduced COMMD1 expression to risk for UC in humans, highlighting the physiologic importance of this gene in immunity and IBD pathogenesis.

61 CHAPTER 4

Figure 1: Commd1 regulates the LPS transcriptional program in myeloid cells. (A) Commd1 does not affect IκB turnover in BMDMs. IκB-α phosphorylation (p-IκB-α) and degradation after LPS treatment were examined by Western blotting. *ns, nonspecific band (arrow points to pIκBα) (B) Commd1 deficiency reduces RelA ubiquitination. Commd1-deficient mouse embryo fibroblasts (K/O) or control cells (WT) were used to detect ubiquitinated RelA by ubiquitin immunoblotting of immunoprecipitated RelA. (C) Gene expression differences resulting from Commd1 deficiency substantially overlap with the LPS response. BMDMs from WT and Mye-K/O mice were utilized in duplicate microarray analysis to ascertain genes regulated by Commd1 or by LPS (100ng/mL)

62 COMMD1 and colitis RESULTS

Commd1 Represses Proinflammatory Gene Expression in Myeloid Cells

To evaluate the potential role of COMMD1 in inflammation, and given the known embryonic lethality that results from complete Commd1 deficiency in mice [23], we generated a tissue- specific mouse model of Commd1 deficiency [24]. First, Commd1 was selectively deleted in myeloid cells (Mye-knockout [K/O]), a critical lineage in innate immunity, leading to the expected loss of Commd1 expression in macrophages (Supplementary Figure 1A). Mye-K/O mice were healthy and B lymphocyte (B220+) and T lymphocyte populations (CD3+ and CD4/CD8) were not significantly different in the spleen or mesenteric lymph nodes (Supplementary Figure 1B and C). Similarly, myeloid populations, including granulocytes (Ly6G+), monocytes and macrophages (CD11b+, Ly6C+ and F4/80), and dendritic cells (CD11chigh, and CD11cintermediate) were not significantly different in Mye-K/O mice (Supplementary Figure 1B-D). In line with previous observations [12, 25, 26], Commd1 deficiency did not alter substantially the phosphorylation or turnover of IκB (Figure 1A), but had a profound effect on RelA ubiquitination (Figure 1B). 4 Next, using bone marrow-derived myeloid cells (BMDMs) from the Mye-K/O mice, we assessed the impact of Commd1 on the LPS transcriptional response at a genome-wide level. High-density microarray experiments indicated that 1008 genes were regulated by LPS at least 3fold in two independent series of experiments (Figure 1C, and Supplementary Tables 1-3). In addition, the expression of 225 genes was found to be regulated by Commd1 (Supplementary Tables 1 and 2). Notably, the vast majority of Commd1-regulated genes (219 of 225) was also regulated by LPS, and only few Commd1 target genes (6 out of 225) were outside the LPS transcriptional response (Supplementary Tables 2 and 3). Hierarchical clustering of these 225 genes was used to visualize the pattern of deregulated expression in Commd1-deficient myeloid cells. Both early and late LPS-inducible genes were affected by Commd1 deficiency (Figure 1D). In most instances, the changes observed consisted of increased gene expression, which often were noted even at basal levels (Figure 1E). To further understand the effect of Commd1 on gene expression in myeloid cells, we performed a functional analysis using the Kyoto encyclopedia of genes and genomes (KEGG) database. This showed that only 51 genes (23%) participate in immune regulation at early (3h) or late (24h) time points. The degree of overlapping genes is presented in Venn diagram form. (D) Hierarchical cluster analysis of Commd1-regulated genes during the LPS response. Expression levels normalized to basal expression in WT samples is shown as color-coded log2-transformed ratios. The gene induction pattern, either early (>3-fold induction at 3h) or late LPS response (>3-fold induction at 24h), is also indicated. The specific effect of Commd1 deficiency is noted by up arrows or down arrows. (E) The genes analyzed in panel D are reanalyzed by calculating ratios between

K/O and WT BMDMs, displayed as color-coded log2-transformed manner. The direction of change is indicated in adjacent columns by up arrows or down arrows. (F) Venn diagram of Commd1- regulated genes, indicating those involved in inflammatory responses or regulated by NF-κB.

63 CHAPTER 4

regulation (as defined by any of a number of KEGG entries) (Supplementary Table 4), indicating that a large number of Commd1 gene targets in myeloid cells are not known inflammatory regulators (Figure 1F). Next, we assessed the contribution of NF-κB regulation to the effects noted inCommd1 -deficient myeloid cells. To that end, NF-κB regulation of genes of interest was ascertained through 2 overlapping approaches: first, using a curated database of published NF-κB gene targets (publicly available at www.NF-kB.org), and second, using chromatin immunoprecipitation (ChIP) for RelA followed by sequencing (ChIP-seq) in LPS-stimulated BMDMs [27]. This indicated that only 66 genes regulated by Commd1 (29%) (Supplementary Table 4) are known NF-κB or RelA targets, suggesting that a substantial proportion of the effects of Commd1 are either secondary or mediated through other transcriptional regulators.

Figure 2: Gene selective effects of Commd1 on NF- κB regulated targets. BMDMs (2 mice per group, with triplicate cultures per mouse) were stimulated with LPS and gene expression was determined by quantitative reverse-transcription polymerase chain reaction. (A) Selected NF-κB target genes are shown, and other (B) LPS-inducible genes that are not NF- κB targets are also shown.

Commd1 Exerts Gene-Selective Effects Among NF-κB-Regulated Targets

Altogether, these findings suggest a substantial repressive role for Commd1 on the LPS response in myeloid cells and confirmed a negative regulatory role for Commd1 on selected NF-κB -regulated genes. Indeed, quantitative reverse- transcription polymerase chain reaction analysis corroborated that certain NF-κB target genes were selectively regulated (for example, Mx1, Cd86 and Sell) (Figure 2A), whereas others were relatively insensitive to Commd1 deficiency (such asIl6 , Tnfaip3 and Mmp13) (Supplementary Figure 2A). These findings are in line with previous reports of gene-specific effects for COMMD1 in cancer cell lines [12]. Enhanced expression of selected genes that are not directly regulated by NF-κB was confirmed as well (Figure 2B). Interestingly, in contrast to these effects, several hypoxia- induced genes were not affected by Commd1 deficiency in BMDMs (Supplementary Figure 2B), despite its reported role in hypoxia-dependent gene expression [20, 23]. In aggregate, the data indicate that Commd1 primarily exerts a gene-selective repressive function on the LPS response. 64 COMMD1 and colitis

Myeloid Deficiency of Commd1 Leads to Exaggerated Inflammatory Responses In Vivo

In view of the effects of Commd1 on LPS-induced gene expression, we used 2 models to contrast the inflammatory response of Mye-K/O mice and wild-type (WT) littermate controls. First, we used the cecal ligation and puncture (CLP) model of polymicrobial sepsis. Animal survival was compromised in Mye-K/O mice compared with WT controls (Figure 3A). In contrast, cultures of peritoneal fluid showed lower bacterial counts in the Mye-K/O mice (Figure 3B), indicating that their increased mortality was not caused by greater bacterial load. Rather, after accounting for bacterial invasion (by examining animals with negative bacterial cultures), we found that Mye-K/O mice had increased cytokine expression (Figure 3C), suggesting that exaggerated proinflammatory gene expression was responsible for their increased susceptibility to sepsis. Next, animals were challenged directly with intraperitoneal LPS injection. Once more, Mye-K/O mice showed greater mortality (Figure 3D) and increased morbidity (Supplementary Figure 3A). Tissue injury, manifested by lactate dehydrogenase (LDH) release in plasma, also was more pronounced in Mye-K/O mice (Supplementary Figure 3B) which also displayed greater plasma increases of interleukin (Il)6 4 and tumor necrosis factor (Tnf) (Figure 3E). In contrast, plasma levels of the anti-inflammatory cytokine Il10 were comparable with WT. Tissue expression of proinflammatory genes was more pronounced in Mye-K/O mice, as exemplified by Tnf, as well as other proinflammatory genes (Figure 3F and Supplementary Figure 4). Altogether, these data indicate that Commd1 deficiency in the myeloid lineage leads to more profound acute inflammatory responses.

Reduced Expression of COMMD1 Is a Common Feature of IBD

Given the findings made in the Mye-K/O mouse model, we decided to explore whether COMMD1 could play a role in the pathophysiology of inflammatory disorders in human beings, choosing IBD as a disease model. To this end, we evaluated the expression of COMMD1 in IBD patients. We found that COMMD1 messenger RNA (mRNA) levels in colonic endoscopic biopsy specimens were reduced in an Israeli cohort of patients with colitis (n=29, 18 with Crohn’s disease and 11 with ulcerative colitis) compared to unaffected controls (n=16; P=0.04) (Figure 4A, left). This finding was replicated in an independent patient cohort in the United States (P= 0.04, 22 normal controls and 17 patients with IBD, 9 of whom had CD and 8 had UC) (Supplementary Figure 5). Similarly, we found that COMMD1 mRNA was reduced in circulating leukocytes from IBD patients with active disease (n=12, 9 with CD and 3 with UC) compared with normal individuals (n=14; P=0.001) (Figure 4A, right). Moreover, in a murine model of colitis induced by dextran sodium sulfate (DSS) administration, we also observed decreased mRNA and protein expression of Commd1 and other Commd genes in the colon (Figure 4B and C). In aggregate, the data indicate that mucosal inflammation is associated with decreased COMMD1 gene expression in clinical and experimental situations.

65 CHAPTER 4

Figure 3: Mye-K/O mice have a more severe sepsis response. (A) Cecal ligation and puncture leads to a higher mortality rate in Mye-K/O mice. Mye-K/O animals (Commd1F/F, LysM-Cre) were compared with wild-type (WT) littermate controls (Commd1F/F). Survival without need for euthanasia was plotted and the Kaplan-Meier estimator was calculated. (B) Peritoneal cultures yield lower bacterial counts in Mye-K/O mice (9 mice in each group). Colony forming units (Cfu) in blood agar were determined by progressive dilution. (C) Induction of proinflammatory gene expression is greater in Mye-K/O mice. Tissue RNA was analyzed by quantitative reverse-transcription polymerase chain reaction (in kidney). To normalize for bacterial load, animals with no detectable bacterial counts were used for this analysis (WT, 4 mice; Mye-K/O, 6 mice). (D) Mye-K/O mice have greater mortality after LPS administration. Survival was analyzed as in panel A. (E) Plasma levels of Il6, Tnf and Il10 were determined in Mye-K/O mice (n=9) and WT controls (n=10) at the time of euthanasia in the LPS model. (F) LPS induction of proinflammatory genes was determined by quantitative reverse-transcription polymerase chain reaction in tissues of Mye-K/O mice (n=10) and WT controls (n=10). * P < 0.05.

66 COMMD1 and colitis

Genetic Variants Associated With Decreased COMMD1 Expression Are Associated With UC Risk

In view of the reduced expression of COMMD1 in IBD patients, we investigated whether genetic polymorphisms of this gene might affect IBD risk in human beings. Interestingly, genome-wide association studies (GWAS) have linked an intergenic region near COMMD1 to the risk for various inflammatory conditions including IBD (Figure 4D) [3, 28-32], but the precise gene responsible for these effects remains unknown. We began by interrogating the most recent meta-analysis of genome-wide association studies (GWAS) for CD and UC [3] by the IIBDGC, which is currently available on the Ricopili server (www.broadinstitute.org/mpg/ricopili/). These data indicated a suggestive association signal with UC for single-nucleotide polymorphisms (SNPs) located just downstream of COMMD1, including rs3943540 (P=7.89 x 10-5) and rs921319 (P=7.47 x 10-5) (Figure 4E). Interestingly, both SNPs are in linkage disequilibrium (LD) with each other (r2=1, D’=1). Additional analysis of the 1000 genomes-imputed IIBDGC UC and CD meta-analyses also showed a suggestive association with UC for a SNP located in the same region, rs6545924 (P=2.27 x 10-5, odds ratio (OR)=1.104, 95% confidence interval of the OR between 1.06-1.15). 4 Epigenetic analysis in myeloid cells performed by the Encyclopedia of DNA Elements (ENCODE) project [33], showed that this genomic locus displays features of a gene regulatory region (Figure 4D and E), such as histone 3 lysine 4 monomethylation (H3K4me1) and lysine 27 acetylation (H3K27Ac), both associated with active enhancers [34]. In agreement with this notion, the SNP and CNV Annotation (SCAN) database [35] indicates that there is a significant eQTL effect of rs921319 on COMMD1 gene expression. To further examine the possibility that these variants have an effect on COMMD1 expression, we conducted cis-eQTL mapping on whole peripheral blood of 2 cohorts (1240 samples previously studied [21] and 891 samples from the Estonian Biobank). Because the SNPs in question were not present in our eQTL data set, we tested rs921320, located in very close proximity to rs921319 and a perfect proxy SNP for rs6545924 (r2=0.9, D’=1). We observed a significant eQTL effect of rs921320 on COMMD1 expression, with the same allelic direction for the Dutch and Estonian cohorts (the P values for individual cohorts were 0.057 and 0.0099, respectively; with a weighted Z-method meta-analysis P=0.0033). The A–allele of rs921320, which is linked to the risk allele for rs6545924, was associated with reduced expression of COMMD1 (Figure 4F). On the other hand, we did not observe any eQTL effects of rs921320 on the 2 other neighboring genes, B3GNT2 or TMEM17. Altogether, these findings suggest that genetic variation in the 3’ region of COMMD1, which has regulatory effects on gene expression, is linked to risk for UC.

Myeloid Cell Deficiency of Commd1 Leads to More Severe Colitis

To further examine the possible involvement of COMMD1 in IBD pathogenesis, we began by assessing the in situ expression of this gene in the colon. Immunofluorescence staining of mouse colon tissue showed staining in the epithelium as well as in mononuclear cells in the lamina propria (Supplementary Figure 6). Furthermore, confocal microscopy images confirmed that 67 CHAPTER 4

Figure 4: Lower COMMD1 expression is linked to IBD. (A) COMMD1 gene expression is suppressed in IBD patients. COMMD1 mRNA expression was determined by quantitative reverse- transcription polymerase chain reaction in endoscopic colonic biopsies from IBD patients with colitis (n=29, 18 with CD and 11 with UC) and normal controls (n=17). Similarly, COMMD1 mRNA levels in white blood cells (WBCs) were determined in IBD patients (n=12, 9 with CD and 3 with UC) and unaffected controls (n=14). (B and C) Commd gene expression at the (B) mRNA level was decreased similarly in colonic tissue after DSS-induced acute colitis (7 mice in the DSS group compared with 8 mice in the water group), and (C) this was shown at the protein level for Commd1 and Commd9 (C). *P < 0.05, ‡P< 0.001, ♦P< 0.0001. (D) Polymorphisms near COMMD1 are associated with UC risk. A map of the 2p15 locus, including SNPs previously implicated in inflammatory diseases, is shown. The region located 3’ of the COMMD1 gene, where SNPs associated to UC were found, is marked by a red box. (E) A closer view of the location of the SNPs of interest downstream of COMMD1 is shown, including chromatin modifications such as histone 3 K4 monomethylation (H3K4m1), trymethylation (H3K4m3) and histone 3 K27 acetylation (H3K27Ac). (F) cis-eQTL analysis for rs921320 in 2 independent cohorts. COMMD1 gene expression (in the y axis) is shown in a box plot for all 3 genotypes for this SNP (CC, CA or AA). The horizontal bar in the box is the median, the top and bottom of the box show the interquartile range (IQR) (Q3 - Q1); the whiskers show the quartile + 1.5x the IQR. The number of individuals in each group is indicated (under the genotype); men and women are denoted by blue and red dots, respectively.

68 COMMD1 and colitis resident lamina propria macrophages (F4/80+) are also COMMD1 positive, in agreement with Western blot analysis of primary myeloid cells (Figure 1A). With this in mind and in view of the known contributions of both epithelial and myeloid cells in the pathogenesis of human and murine colitis [36, 37], we evaluated the role of this gene in this disease process using both epithelial and myeloid cell-specific knockout mice. First, we used the DSS model, which triggers colonocyte injury and an innate immune response to luminal bacteria that results in acute colitis. Mye-K/O mice showed more severe disease that WT animals, with excess mortality, more profound weight loss, and worse disease activity (Figure 5A). In agreement with this, colon shortening (a macroscopic marker of tissue injury) and histologic evaluation of the colonic mucosa both indicated more damage in Mye-K/O mice (Figures 5B and C). In contrast to these results, Commd1 inactivation in the intestinal epithelium did not result in any appreciable alteration of DSS-induced colitis (Supplementary Figure 7). The more severe inflammatory response in Mye-K/O mice was correlated with greater numbers of CD68+ myeloid cells in the colon as seen by immunohistochemistry (Figures 5D, left panel, and E), and a consistent trend was observed at the mRNA level for the macrophage- specific gene Emr1 (F4/80, Figure 5D, right panel). In addition, Mye-K/O mice showed increased 4 expression of proinflammatory genes, such as Il6 and Il1b (Figure 5F). However, myeloid and lymphoid populations in the mesenteric lymph node (MLN) (Supplementary Figure 8) and the spleen (not shown), were not significantly different between the groups.

Myeloid Cell Deficiency of Commd1 Promotes Colitis-Dysplasia Progression

Further analysis indicated that recurrent DSS administration, which mimics the chronic nature of IBD, also resulted in more severe disease in Mye-K/O mice, manifested as greater weight loss (Figure 6A) and more severe anemia (Figure 6B). Colonic tissue from these animals also produced greater amounts of several proinflammatory factors such as Tnf (Figure 6C and S9). In addition, azoxymethane (AOM) followed by recurrent DSS treatments was used to examine progression to dysplasia. In this model, Mye-K/O mice also showed more severe disease, as evidenced by more severe colonic shortening, splenomegaly, and histologic distortion of the mucosal architecture (Figure 6D). Moreover, after 7 weeks of treatment, Mye-K/O mice had a greater propensity to develop dysplasia, high-grade dysplasia (HGD) or multifocal dysplasia (MFD) as assessed histologically (Figure 6D). By 10 weeks, small adenomas could be visualized, but the total number of lesions was not increased in Mye-K/O mice (Figure 6E). Nevertheless, only Mye-K/O mice developed proximal colonic tumors and there was a tendency for the tumor burden to be greater in these animals as a result of greater adenoma volume (Figure 6E). In colonic tissue, Mye-K/O animals showed greater NF-κB activation as evidenced by the ratio of the transcriptionally active form of RelA (phosphorylated at Ser536) to total RelA. However, STAT3 activation, another pathway known to promote cancer in the context of chronic tissue inflammation [38], was not altered in these mice (Figure 6F). Altogether, these data highlight a role for myeloid cell expression of Commd1 in chronic colonic inflammation and progression to dysplasia.

69 CHAPTER 4

Figure 5: Myeloid deficiency of Commd1 predisposes to more severe colitis. (A) Worse survival, weight loss, and disease activity index (DAI) were noted in Mye-K/O mice compared with wild-type littermate controls during acute DSS-induced colitis. *P < 0.05, ‡P< 0.001, ♦P < 0.0001. (B) Colon length was significantly shorter in Mye-K/O mice (n=26) after acute colitis compared to WT controls (n=20). Representative images are shown. (C) Worse tissue injury was also evident histologically. By using a severity score, colonic sections were examined (11 Mye-K/O and 9 WT mice). Representative histologic sections are shown. (D and E) Expansion of macrophage populations in the colonic mucosa of Mye-K/O mice. In the left panel, the number of CD68+ cells present in the mucosa was assessed by immunohistochemistry in a tissue microarray of DSS colitis samples (Mye-K/O, 13 samples; WT, 12 samples). In the right panel, the colonic expression of the macrophage marker gene Emr1 (F4/80) was determined by quantitative reverse-transcription polymerase chain reaction (Mye-K/O, 18 samples; WT, 23 samples). (E) Representative images of the CD68 immunohistochemistry are shown. Scale bar: 20 µm. (F) RNA extracted from colonic tissue was used for quantitative reverse-transcription polymerase chain reaction analysis for the genes indicated (Mye-K/O, 18 samples; WT, 23 samples). au: arbitrary units.

70 COMMD1 and colitis

4

Figure 6: Commd1 deficiency leads to worse chronic colitis and transition to dysplasia. (A) Recurrent administration of DSS caused more weight loss in Mye-K/O mice. (B) Chronic colitis led to more severe anemia in Mye-K/O mice (5 mice per group). (C) Pro-inflammatory cytokine production is increased in colonic tissue of Mye-K/O mice. Colonic full-thickness tissue harvested from colitic mice was cultured overnight and the secretion of cytokines into the growth media was determined. (D) Progression to dysplasia was worse in Mye-K/O animals. Azoxymethane (AOM) was administered before chronic colitis induction and dysplasia was assessed histologically at 7 weeks. Representative images are displayed. (E) Tumor number and volume in mice at 10 weeks of colitis/dysplasia induction is shown. *P < 0.05. (F) Greater NF-κB activation in inflamed colonic tissue of Mye-K/O mice. Activation of NF-κB/RelA and Stat3 was assessed in inflamed colonic tissue of animals treated with AOM / DSS. Western blot analysis was performed with tissue lysates and the active phosphorylated form was quantitated and normalized to expression of the respective target. HGD, high-grade dysplasia; LGD, low-grade dysplasia; MFD, multifocal dysplasia.

71 CHAPTER 4 DISCUSSION

COMMD1 plays an essential role to restrain the activity of NF-κB, a master regulator of inflammation. Specifically, COMMD1 acts to terminate NF-κB transcriptional activation through the ubiquitin-mediated degradation of NF-κB subunits. A detailed molecular mechanism by which COMMD1 restrains NF-κB has been examined and reported previously [8, 10, 12, 13]. The studies presented here confirm the negative regulatory role of this factor on the NF-κB pathway [10, 12, 13, 15], and also underscores the gene-selective nature of these effects. Moreover, the studies in this model corroborate that key aspects of the reported mechanism are evident in the knockout mice, namely normal IκB phosphorylation and turnover, but diminished ability to terminate NF-κB transcriptional activity (ie, reduced RelA/p65 ubiquitination). Importantly, this study investigates the physiological relevance of these events in disease pathogenesis. The data indicate that COMMD1 expression in the myeloid compartment plays an important role in the regulation of inflammatory responses in vivo. Given that diverse functions have been reported for this gene [17, 39-41], this report fills a critical void by underscoring that COMMD1 participates in immune regulation. In addition, the results also suggest that COMMD1 has broader effects on proinflammatory gene expression programs that might extend beyond the NF-κB pathway. Whether these effects are the result of secondary perturbations or are the result of direct regulation of transcription factor(s) other than NF-κB, should be further examined in the future. In the context of intestinal inflammation and progression to cancer, previous studies have underscored the importance of epithelial and myeloid cells in these processes [14, 37, 38]. In particular, epithelial intrinsic NF-κB activation has been shown to be a protective response that promotes cell survival and barrier function [42], and myeloid cell NF-κB activation is important in sustaining the inflammatory response [36]. The increased propensity to inflammation and colitis observed as a result of myeloid cell deficiency of Commd1 is in agreement with this paradigm and suggests that the immune regulatory roles of this gene are physiological. In addition, the increased progression to dysplasia in Mye-K/O mice is in agreement with the role of myeloid cells in promoting tumor growth through various proinflammatory cytokines [43]. In this regard, our model displays increased production of Tnf and greater tissue activation of NF-κB, both of which have been shown to promote cancer progression in the setting of colitis [36, 44]. In addition, we also found no appreciable phenotype of enterocyte-specific deficiency ofCommd1 , which stands in contrast to other models of disrupted NF-κB activity in the epithelium [36, 42]. This may reflect the fact that unlike other models, cell survival genes are not regulated by COMMD1 in the transcriptome analysis presented here. Furthermore, it suggests that other reported roles of Commd1, such as the regulation of various transport mechanisms, may be more relevant in these cells. These observations in the animal model, coupled with the finding that genetic variants linked to lower COMMD1 expression also are associated with an increased risk

72 COMMD1 and colitis for UC, suggest that this gene participates in the pathogenesis of this disorder in humans. In this context, it is important to note a recent report of a risk association for COMMD7, another member of the COMMD gene family [45]. Moreover, COMMD1 acts in concert with Cul2 to promote RelA ubiquitination [10, 12, 13], and the CUL2 gene has been linked to IBD susceptibility [46]. Additional studies, including ongoing resequencing efforts, will be required to validate the genetic association seen here with greater statistical confidence. However, the aggregate of our data and published reports suggest the possibility that homeostatic mechanisms that restore NF-κB to its basal state, when decreased, may enhance the risk for IBD. Our studies also identified that inflammation can lead to suppressed expression of COMMD1, as seen in patients with colitis as well as in animal models. Our data suggest that this is likely the consequence rather than the cause of inflammation in human disease, because this suppression can be induced by inflammation itself in animal studies. The decrease in COMMD1 expression probably plays a physiologic role in the initiation of an appropriate inflammatory response, but in view of the more severe inflammatory responses seen when this gene is deleted in myeloid cells, persistent COMMD1 suppression 4 is probably maladaptive during chronic inflammation. Therefore, this work highlights the need to gain a refined understanding of the molecular events that control COMMD1 gene expression in the setting of inflammation. With this knowledge, we may begin to envision potential interventions that might restore gene expression, which could be tested for their therapeutic potential in chronic inflammatory disorders.

MATERIALS AND METHODS

Human studies: All procedures involving human subjects were reviewed and approved by the respective Institutional Review Boards (at UT Southwestern Medical Center, The Mayo Clinic and Tel-Aviv Sourasky Medical Center). Circulating leukocytes and intestinal biopsies were obtained at the time of endoscopy as part of the patients’ ongoing medical care.

Genome-Wide Association Studies and Quantitative Trait Locus Analysis: Genetic association data were obtained from the 1000 genomes imputed meta-analysis from 15 genome-wide association studies of CD and/or UC conducted by the International IBD Genetic Consortium (IIBDGC) [3]. We conducted cis-expression quantitative trait locus (cis-eQTL) mapping on whole peripheral blood of 2 cohorts: 1240 samples from a previously published study [21] and 891 samples from the Estonian Biobank, both hybridized to Illumina (San Diego, CA) HT12-v3 oligonucleotide arrays using methodology as described in detail elsewhere [22].

Statistical analysis: In all graphs, the mean is presented and the error bars correspond to SEM. Statistical comparisons between mean values were performed using a 1-tailed,

73 CHAPTER 4

heteroscedastic, Student t test. For nonparametric variables, the chi-square test was used. Survival curves were examined using the Kaplan-Meier analysis.

Supplementary materials and methods: All other materials and methods are described in the Supplementary Materials & Methods section.

Note: To access the supplementary material accompanying this article, visit the online version of Gastroenterology at www.gastrojournal.org, and at http://dx.doi.org/10.1053/j.gastro.2014.04.007.

ACKNOWLEDGEMENTS

The authors are grateful to Eric Fearon for kindly providing some reagents used here. The authors are also grateful to John Shelton, Christine Komarck and Baozhi Chen for technical support for this project.

Conflict of interest: The authors disclose no conflicts.

Funding: The work of E.B. was supported by a National Institutes of Health grant (R01 DK073639), a CCFA Senior Research Award (SRA # 2737), a Cancer Prevention & Research Institute of Texas grant (CPRIT RP130409), and the Disease Oriented Clinical Scholars’ Program at UT Southwestern. R.K.W was supported by supported by a VIDI grant (91713308) from the Netherlands Organization for Scientific Research (NWO). The work of N.G. was supported by a start-up grant from the U.S.-Israel Binational Science Foundation (BSF #2009339) and a grant from the German Israeli Foundation. The Estonian Genome Center at the University of Tartu (T.E. and A.P.) received financing from FP7 programs (ENGAGE, OPENGENE), targeted financing from the Estonian Government (SF0180142s08), Estonian Research Roadmap through the Estonian Ministry of Education and Research, Center of Excellence in Genomics (EXCEGEN) and University of Tartu (SP1GVARENG).

Author contributions: HL was responsible for the bulk of the experimental animal data performed here, including experiment execution and data analysis. LC, PB, RW, XM and PS participated in the colitis and colitis-associated cancer mouse models. SDM performed the pathological analysis of the tissue samples. AW, HS and MK performed the microarray experiments and analysis of myeloid cell LPS responses. SB-S, CV, WAF, VK and NG performed the gene expression analysis in human subjects. MM, MR, FY and VA participated in the CLP experiments. SVS and RKW performed the GWAS analysis. H-JW, TE, AM and LF performed the cis-eQTL analysis. MH, CW and BVDS were responsible for generating the mouse model and participated in specific portions of experimental design and interpretation. EB was responsible for the overall study design, data interpretation, and manuscript writing.

74 COMMD1 and colitis REFERENCES

[1] Kaser A, Zeissig S, Blumberg RS. Inflammatory bowel disease. Annu Rev Immunol 2010;28:573-621. [2] Hayden MS, Ghosh S. NF-kB, the first quarter-century: remarkable progress and outstanding questions. Genes Dev 2012;26:203-34. [3] Jostins L, Ripke S, Weersma RK, et al. Host-microbe interactions have shaped the genetic architecture of inflammatory bowel disease. Nature 2012;491:119-24. [4] Lees CW, Barrett JC, Parkes M, et al. New IBD genetics: common pathways with other diseases. Gut 2011;60:1739-1753. [5] Hoffmann A, Levchenko A, Scott ML, et al. The IkB-NF-kB signaling module: temporal control and selective gene activation. Science 2002;298:11241-1245. [6] Kovalenko A, Chable-Bessia C, Cantarella G, et al. The tumour suppressor CYLD negatively regulates NF-kB signalling by deubiquitination. Nature 2003;424:801-805. [7] Wertz IE, O'Rourke KM, Zhou H, et al. De-ubiquitination and ubiquitin ligase domains of A20 downregulate NF-kB signalling. Nature 2004;430:694-699. [8] Natoli G, Chiocca S. Nuclear ubiquitin ligases, NF-kB degradation, and the control of inflammation. Sci Signal 2008;1:pe1. [9] Saccani S, Marazzi I, Beg AA, et al. Degradation of promoter-bound p65/RelA is essential for the prompt termination of the nuclear factor kB response. J Exp Med 2004;200:107-113. [10] Mao X, Gluck N, Li D, et al. GCN5 is a required cofactor for a ubiquitin ligase that targets NF-kB/RelA. 4 Genes Dev 2009;23:849-861. [11] Ryo A, Suizu F, Yoshida Y, et al. Regulation of NF-kB signaling by Pin1-dependent prolyl isomerization and ubiquitin-mediated proteolysis of p65/RelA. Mol Cell 2003;12:1413-1426. [12] Maine GN, Mao X, Komarck CM, et al. COMMD1 promotes the ubiquitination of NF-kB subunits through a Cullin-containing ubiquitin ligase. EMBO Journal 2007;26:436-447. [13] Geng H, Wittwer T, Dittrich-Breiholz O, et al. Phosphorylation of NF-kB p65 at Ser468 controls its COMMD1- dependent ubiquitination and target gene-specific proteasomal elimination. EMBO Rep 2009;10:381-386. [14] Burstein E, Hoberg JE, Wilkinson AS, et al. COMMD proteins: A novel family of structural and functional homologs of MURR1. J Biol Chem 2005;280:22222-22232. [15] Ganesh L, Burstein E, Guha-Niyogi A, et al. The gene product Murr1 restricts HIV-1 replication in resting CD4+ lymphocytes. Nature 2003;426:853-857. [16] van de Sluis B, Rothuizen J, Pearson PL, et al. Identification of a new copper metabolism gene by positional cloning in a purebred dog population. Hum Mol Genet 2002;11:165-173. [17] Biasio W, Chang T, McIntosh CJ, et al. Identification of Murr1 as a regulator of the human d epithelial sodium channel. J Biol Chem 2004;279:5429-5434. [18] Drevillon L, Tanguy G, Hinzpeter A, et al. COMMD1-Mediated Ubiquitination Regulates CFTR Trafficking. PLoS One 2011;6:e18334. [19] Smith L, Litman P, Liedtke CM. COMMD1 interacts with the COOH terminus of NKCC1 in Calu-3 airway epithelial cells to modulate NKCC1 ubiquitination. Am J Physiol Cell Physiol 2013;305:C133-C146. [20] van de Sluis B, Mao X, Zhai Y, et al. COMMD1 disrupts HIF-1a/b dimerization and inhibits human tumor cell invasion. J Clin Invest 2010;120:2119-2130. [21] Fu J, Wolfs MG, Deelen P, et al. Unraveling the regulatorymechanisms underlying tissue-dependent genetic variation of gene expression. PLoS Genet 2012;8:e1002431. [22] Fehrmann RS, Jansen RC, Veldink JH, et al. Trans-eQTLs reveal that independent genetic variants associated with a complex phenotype converge on intermediate genes, with a major role for the HLA. PLoS Genet 2011;7:e1002197. [23] van de Sluis B, Muller P, Duran K, et al. Increased activity of hypoxia-inducible factor 1 is associated with early embryonic lethality in Commd1 null mice. Mol Cell Biol 2007;27:4142-4156.

75 CHAPTER 4

[24] Vonk WI, Bartuzi P, de Bie P, et al. Liver-specific Commd1 knockout mice are susceptible to hepatic copper accumulation. PLoS One 2011;6:e29183. [25] Mao X, Gluck N, Chen B, et al. Copper metabolism MURR1 domain containing 1 (COMMD1) regulates Cullin-RING ligases by preventing Cullin-associated NEDD8-dissociated (CAND1) binding. J Biol Chem 2011;286:32355-32365. [26] Starokadomskyy P, Gluck N, Li H, et al. CCDC22 deficiency in humans blunts activation of proinflammatory NF-kB signaling. J Clin Invest 2013;123:2244-2256. [27] Barish GD, Yu RT, Karunasiri M, et al. Bcl-6 and NF-kB cistromes mediate opposing regulation of the innate immune response. Genes Dev 2010;24:2760-5. [28] Reveille JD, Sims AM, Danoy P, et al. Genome-wide association study of ankylosing spondylitis identifies non-MHC susceptibility loci. Nat Genet 2010;42:123-7. [29] Okada Y, Terao C, Ikari K, Kochi Y, et al. Meta-analysis identifies nine new loci associated with rheumatoid arthritis in the Japanese population. Nat Genet 2012;44:511-6. [30] Kenny EE, Pe'er I, Karban A, et al. A genome-wide scan of Ashkenazi Jewish Crohn's disease suggests novel susceptibility loci. PLoS Genet 2012;8:e1002559. [31] Anderson CA, Boucher G, Lees CW, et al. Meta-analysis identifies 29 additional ulcerative colitis risk loci, increasing the number of confirmed associations to 47. Nat Genet 2011;43:246-252. [32] Franke A, McGovern DP, Barrett JC, et al. Genome-wide meta-analysis increases to 71 the number of confirmed Crohn's disease susceptibility loci. Nat Genet 2010;42:1118-1125. [33] Consortium TEP. A user's guide to the encyclopedia of DNA elements (ENCODE). PLoS Biol 2011;9:e1001046. [34] Kaikkonen MU, Spann NJ, Heinz S, et al. Remodeling of the enhancer landscape during macrophage activation is coupled to enhancer transcription. Mol Cell 2013;51:310-25. [35] Nicolae DL, Gamazon E, Zhang W, et al. Trait-associated SNPs are more likely to be eQTLs: annotation to enhance discovery from GWAS. PLoS Genet 2010;6:e1000888. [36] Greten FR, Eckmann L, Greten TF, et al. IKKb links inflammation and tumorigenesis in a mouse model of colitis-associated cancer. Cell 2004;118:285-296. [37] Bollrath J, Phesse TJ, von Burstin VA, et al. gp130-mediated Stat3 activation in enterocytes regulates cell survival and cell-cycle progression during colitis-associated tumorigenesis. Cancer Cell 2009;15:91-102. [38] Bollrath J, Greten FR. IKK/NF-kB and STAT3 pathways: central signalling hubs in inflammation- mediated tumour promotion and metastasis. EMBO Rep 2009;10:1314-1319. [39] Weiss KH, Lozoya JC, Tuma S, et al. Copper-Induced Translocation of the Wilson Disease Protein ATP7B Independent of Murr1/ COMMD1 and Rab7. Am J Pathol 2008;173:1783-1794. [40] Miyayama T, Hiraoka D, Kawaji F, et al. Roles of COMM-domain-containing 1 in stability and recruitment of the copper-transporting ATPase in a mouse hepatoma cell line. Biochemical Journal 2010;429:53-61. [41] Chang T, Ke Y, Ly K, et al. COMMD1 regulates the delta epithelial sodium channel (dENaC) through trafficking and ubiquitination. Biochem Biophys Res Commun 2011;411:506-511. [42] Nenci A, Becker C, Wullaert A, et al. Epithelial NEMO links innate immunity to chronic intestinal inflammation. Nature 2007;446:557-561. [43] Grivennikov SI, Greten FR, Karin M. Immunity, inflammation, and cancer. Cell 2010;140:883-899. [44] Popivanova BK, Kitamura K, Wu Y, et al. Blocking TNF-a in mice reduces colorectal carcinogenesis associated with chronic colitis. J Clin Invest 2008;118:560-570. [45] Kabakchiev B, Silverberg MS. Expression quantitative trait loci analysis identifies associations between genotype and gene expression in human intestine. Gastroenterology 2013;144:1488-96, 1496 e1-3. [46] Rivas MA, Beaudoin M, Gardet A, et al. Deep resequencing of GWAS loci identifies independent rare variants associated with inflammatory bowel disease. Nat Genet 2011;43:1066-1073.

76 COMMD1 and colitis

SUPPLEMENTARY MATERIALS AND METHODS

Mouse Strains: Mice were housed in barrier facilities and fed irradiated standard diet. All animal procedures were approved by the Care and Use Committee. The conditional Commd1 allele was recently described [1]. LysM-Cre ‘knockin’ mice were obtained from the Jackson laboratory (Bar Harbor, ME). Villin-Cre mice were kindly provided by Dr Eric Fearon.

Sepsis Models: Cecal ligation and puncture was performed as previously described [2]. Overall, the surgical time was kept to fewer than 15-20 minutes. After surgery, the mice were housed individually and monitored in a blinded manner (ie, without knowledge of the specific genotypes). This was performed every hour for the first 4-6 hours, then every 2 hours for the next 6 hours, and, finally, every 4-6 hours until the conclusion of the experiment or the need of euthanasia arose (based on morbidity criteria) (Supplementary Table 5). For the LPS model, LPS (Escherichia coli 055:B5, Sigma, St. Louis, MO) was diluted in water to 0.2 mg/mL and placed in a water bath sonicator (model FS20, Fisher, Waltham, MA) for 15-30 minutes at room temperature before use. After sonication, the LPS was filtered (0.2 μm pore) and injected intraperitoneally (0.1 mg/mouse). 4 After injection, the mice were monitored similarly for morbidity until the conclusion of the experiment (Supplementary Table 5) Bacterial cultures were performed as previously described [3] and tissue RNA was extracted as noted later. Blood also was collected through orbital puncture, and plasma was separated using EDTA (5 mmol/L).

Acute and Chronic DSS-Induced Colitis: For the acute colitis model, DSS (Fisher) was administered in the drinking water at a concentration of 3 g/dL (3%). Freshly prepared DSS drinking solution was replaced every 5 days. Mice were housed in individual cages and evaluated daily for their weight and the presence of diarrhea or bleeding to calculate a disease activity index (Supplementary Table 6), which was based on the scoring system reported by Cooper et al [4]. Evaluation for occult bleeding included Hemoccult testing (Beckman Coulter, Brea, CA). Treatment was given for up to 10 days and animals showing severe distress were euthanized at any point during the experiment. For the chronic colitis and cancer model, the animals were given azoxymethane intraperitoneally (AOM, 10 mg/kg, Sigma). After 7 days, DSS was given in the drinking water over 4 days at a concentration of 2.5% followed by 10 days of regular water. This was repeated for 3 cycles and at the end of 7 or 10 weeks, the animals were euthanized, and the spleen and colon were harvested. The organ length and weight were determined and the colon was opened along the mesenteric side, and tumors were counted using a dissecting microscope (Zeiss Stemi 2000-C, Jena, Germany). Tumor volumes were calculated using the following formula: (width2) x (height /2).

Histology and Immunohistochemistry: At the time of euthanasia, the colon was dissected and opened along the mesenteric side. The open colon was transected longitudinally with

77 CHAPTER 4

one half rolled onto itself as a Swiss roll and fixed in 4% paraformaldehyde (in phosphate- buffered saline). After paraffin embedding and sectioning, the tissue was stained with H&E. The second half was used for RNA extraction as described later. A histologic severity index [4] was used to score colonic sections from mice with acute DSS colitis (Supplementary Table 7). In chronic colitis/dysplasia models (azoxymethane/DSS at 7 weeks), Swiss-roll sections of the colon were assessed for the presence of architectural distortion, dysplasia, multifocal dysplasia, or high-grade dysplasia according to standard clinical pathology criteria. The number of individual foci was not quantitated by this approach. All histopathologic analyses were performed in a blinded fashion by a gastrointestinal pathologist (S.D.M.). For CD68 staining, a tissue microarray was generated using random colonic tissue cores obtained from blocks previously prepared from mice with acute colitis. After constructing the microarrays, 5 μm sections were subjected to CD68 staining (clone F8-11; Biolegend, San Diego, CA). Staining was performed on a Ventana Benchmark XT Automated IHC Stainer with Mild CC1 (Cell Conditioning 1) and 32 minutes of primary antibody incubation at a 1:25 dilution (in Chemmate Ab diluent, Dako, Carpinteria, CA). The detection was performed with an Ultraview Universal DAB detection Kit (cat. 760-500; Ventana, Tucson, AZ). The slides were counterstained with Mayer’s hematoxylin. Images then were analyzed using the ImageJ software (National Institutes of Health, Bethesda, MD) and cell counts were normalized to the surface area using the surface of a microscopic field as a reference. Co-staining for COMMD1 [5] and F4/80 (11-4801; eBioscience, San Diego, CA) was performed using frozen sections of mouse colon tissue embedded in optimum cutting temperature (OCT) using a previously reported protocol.

Multiplex Cytokine Measurements: EDTA-Plasma was separated from blood samples by centrifugation and stored at -80°C. Full-thickness colonic tissue (1 cm of rectum) was harvested form colitic mice and cultured in 12-well cell culture dish with 1mL of complete Dulbecco’s modified Eagle medium culture media. The supernatant was collected 24 hours later, centrifuged and stored at -80°C until measurement. Cytokine measurements were performed using Milliplex MAP beads (Millipore) and run on Luminex Magpix with the Luminex xPONENT software (Luminex, Austin, TX). Data analysis was performed using Milliplex Analyst.

Cell Isolation and Cell Culture: The generation and immortalization of mouse embryo fibroblasts (MEFs) from the Commd1 floxed mouse has been reported previously [6]. These cells were maintained in high-glucose Dulbecco’s modified Eagle medium containing 10% fetal calf serum and treated with MG-132 (20 μmol/L for 3 h) for precipitation of ubiquitinated RelA, as described later. BMDMs were generated by isolation of bone marrow cells from long bones, which were cultured in Roswell Park Memorial Institute (RPMI) media supplemented with 10% fetal calf serum, antibiotics (100 µg/mL penicillin G and 100 µg/mL streptomycin), and Fungizone (Fisher), in the presence of granulocyte-

78 COMMD1 and colitis macrophage colony-stimulating factor (20 ng/mL; Peprotech, Rocky Hill, NJ). Myeloid differentiation was allowed to proceed for 10 days. In specific experiments, cells were treated with LPS (10 ng/mL, E. coli 026:B6, Sigma). Hypoxia conditions (3% oxygen) were established in HeraCell incubators. Splenocytes, thymocytes, or mesenteric lymph node (MLN) cells were isolated according to standard protocols. Briefly, after removing the respective organs and placing them on a sterile dish containing RPMI, the tissue was manually ground and strained through a 40 μm tissue strainer. After centrifugation (300g for 5 minutes at 4ºC), the cell pellet was resuspended in 2 mL of Ammonium- + Chloride-Potassium (ACK) buffer (150mM NH4Cl, 10mM KHCO3, 0.1mM EDTA, pH 7.2) to lyze red blood cells. After 3 minutes at room temperature, the ACK lysis was neutralized by adding 10 mL of fluorescence-activated cell sorter (FACS ) media buffer (0.01% Sodium azide, 2.5% fetal calf serum in phosphate-buffered saline). This cell suspension was strained again through the tissue strainer to obtain a single-cell suspension, which was pelleted by centrifugation. Gastrointestinal epithelial cells were isolated according to a previously described method [7]. Briefly, the entire colon, small bowel, or stomach was harvested and flushed clean with 1 mmol/L dithiothreitol (DTT) in Krebs-Ringer Bicarbonate (KRB) 4 buffer (10 mmol/L D-Glucose, 0.5 mmol/L MgCl2, 4.6 mmol/L KCl, 120 mmol/L NaCl,

0.7 mmol/L Na2HPO4, 1.5 mmol/L NaH2PO4, 15 mmol/L NaHCO3). The lumen was filled with KRB buffer supplemented with 10 mmol/L EDTA and 1 mmol/L DTT, and both ends were ligated. The ligated colon was placed in a 50mL conical tube with 30 mL of KRB buffer and placed at 37°C for 20 minutes with agitation. The sealed intestinal segment was palpated gently to loosen the cells, then cut on one end to drain the contents a 1.7mL microfuge tube. The cells were collected by centrifugation at 300g for 5 minutes and rinsed once with KRB buffer.

Flow Cytometry: Cells were resuspended in 2 mL of FACS media buffer and the cells from the mesenteric lymph node (MLN) were resuspended in 600 µL. For antibody staining, 100 µL of each cell suspension was incubated on ice with the following primary antibodies: anti-B220-PE (BD Pharmingen, San Jose, CA), anti-CD3-PE (BD Pharmingen), anti-CD4-perCP (BD Pharmingen), anti-CD8a-APC (BD Pharmingen), anti-Ly6G-APC (eBioscience), anti-Ly6C- PerCP-Cy5.5 (eBioscience), anti-CD11C-APC (BD Pharmingen), anti-CD11b-PE (eBioscience), anti-F4/80-FITC (eBioscience) and corresponding isotype controls. After 30 minutes, the cells were pelleted by centrifugation (300g for 5 minutes at 4ºC) and washed twice in 500 µL of FACS media buffer. Flow cytometric analysis was performed using FACSCalibur (BD Biosciences, Mountain View, CA) and analyzed using FlowJo software (version 7.6.5, FlowJo, Ashland, OR).

Protein Extraction, Immunoblotting and Immunoprecipitation: Cell lysate preparation, nuclear extract preparation, immunoprecipitation, denatured immunoprecipitation and immunoblotting were performed as previously described [5, 8, 9]. Protein lysates from mouse tissues were prepared after snap freezing the samples in liquid nitrogen. After mincing

79 CHAPTER 4

with a razor blade, tissue pieces were submerged in lysis buffer (50 mmol/L Tris-Hcl pH+ 7.5, 250 mmol/L NaCl, 3 mmol/L EDTA, 3 mmol/L EGTA, 1% Triton X-100, 0.5% NP40, 10% glycerol, 25 mmol/L Na-pyrophosphate) supplemented with protease inhibitor tablets (Roche, San Francisco, CA). Thereafter, tissue homogenization was performed using a 2mL Douncer and a cleared lysate (supernatant after 10,000g centrifugation) was used for further analysis. The following antibodies were used for Western blotting in this study: β-Actin (Sigma, A5441), COMMD1 [5], COMMD9 [10], IκB-α (Upstate Biotechnologies, 06-494), phosphor-IκB-α (Cell signaling, 9246), RelA (Santa Cruz Biotechnology, sc-372 and sc-8008), and ubiquitin (Cell Signaling, 3936).

RNA Extraction and Quantitative Real-Time Reverse-Transcription Polymerase Chain Reaction: In most cases, RNA was extracted using TRIzol (Invitrogen, Grand Island, NY) according to the manufacturer’s instructions. In the case of colonic RNA from colitic mice, we obtained better results by first stabilizing the freshly isolated tissue in RNAlater (Qiagen, Hilden, Germany), followed by RNA extraction using the RNeasy chromatography method (Qiagen), according to the manufacturer’s instructions. RNA (5 μg) was used for complementary DNA synthesis using the Superscript III strand synthesis system (Invitrogen). Real-time polymerase chain reaction was performed in an Eppendorf real-time polymerase chain reaction system. In most cases, SYBR Greenbased detection (Invitrogen) was used using gene specific primers, as noted in Supplementary Table 8. Experiments were performed in triplicate, data were normalized to housekeeping genes, and the relative abundance of transcripts was calculated by the comparative ΔΔCt method.

Microarray Analysis: The primary data for this analysis are available in the Gene Expression Omnibus (GEO) database at National Center for Biotechnology Information (NCBI, Accession GSE53368). The Whole Mouse Genome Oligo Microarray V2 (G4846A, ID 026655, Agilent Technologies; Santa Clara, CA) used in this study contains 44,397 oligonucleotide probes covering the entire murine transcriptome. Synthesis of Cy3-labeled complementary RNA was performed with the Quick Amp Labeling kit, one color (5190-0442, Agilent Technologies) according to the manufacturer’s recommendations. Complementary RNA fragmentation, hybridization, and washing steps also were performed exactly as recommended per the One-Color Microarray- Based Gene Expression Analysis Protocol V5.7. Slides were scanned on the Agilent Micro Array Scanner G2565CA (pixel resolution, 5 µm; bit depth, 20). Data extraction was performed with the Feature Extraction Software V10.7.3.1 by using the recommended default extraction protocol file: GE1_107_Sep09.xml. The singlechannel data generated by the Feature Extraction software were normalized and analyzed in Genespring GX software, version 12.0 (Agilent Technologies). Low expression values were increased to the constant value 15 (defined

as the threshold) to minimize falsepositive ratios. Data were log2transformed and normalized to 75th percentile of each array according to the standard procedure in Genespring GX.

80 COMMD1 and colitis

Only probes referring to transcripts of annotated genes were considered and Agilent probe annotation was used. In cases of multiple probes per gene the value from that probe with the highest arithmetic mean intensity across all 12 hybridizations was selected. Genes were considered as measurable when the arithmetic mean of (antilog2-retransformed) intensity values calculated from all 12 samples was greater than 100 and mean intensity in at least 1 of 6 averaged conditions was greater than 50. Entities showing technical impairments were excluded from analyses. By using these criteria, of 44,397 probes, 18,682 probes corresponding to 11,441 genes were selected for further analysis. Genes were considered as regulated by LPS or by Commd1 KO according to the following criteria: the foldchange of mean values in at least 1 of 3 ratios was greater than 3-fold and regulation was consistent with the same trend in each single (nonaveraged) comparison. The following ratios were calculated: Commd1 KO vs WT, LPS 3 hours WT vs WT, LPS 24 hours WT vs WT. In the resulting gene set Commd1-dependent genes were defined by at least 2-fold differences of the following ratios of mean intensity values: deregulated basal expression (ratio Commd1 KO vs WT), deregulated less than 3 hours LPS treatment (Commd1 KO LPS 3 h vs WT LPS 3 h), deregulated less than 24 hours LPS treatment (Commd1 KO LPS 4 24 h vs WT LPS 24 h). The ratio values of the resulting COMMD1-dependent 225 genes were analyzed by hierarchical cluster analysis using MeV MultiExperimentViewer, version 4.8.1, 2011 (available: www.tm4.org) with cluster settings “average” as linkage method and “Manhattan distance” as distance measure. Gene function analysis was performed using the DAVID (v6.7) software platform (maintained by National Institute of Allergy and Infectious Disease (NIAID) and available at http://david.abcc.ncifcrf.gov/home.jsp). Functional annotation was performed using the KEGG database (KEGG Mapper v1.6, released October 1, 2013). The regulation of genes of interest by NF-κB was ascertained by comparing each gene to 2 partially redundant data sets: a curated database of published NF-κB gene targets (publicly available and maintained at www.NF-kB.org), and, second, a chromatin immunoprecipitation (ChIP) seq data set of RelAregulated genes in LPS-stimulated BMDMs [11].

81 CHAPTER 4 References

[1] Vonk WI, Bartuzi P, de Bie P, et al. Liver-specific Commd1 knockout mice are susceptible to hepatic copper accumulation. PLoS One 2011;6:e29183. [2] Toscano MG, Ganea D, Gamero AM. Cecal ligation puncture procedure. J Vis Exp 2011:pii: 2860. [3] Kirkland D, Benson A, Mirpuri J, et al. B cell-intrinsic MyD88 signaling prevents the lethal dissemination of commensal bacteria during colonic damage. Immunity 2012;36:228-38. [4] Cooper HS, Murthy SN, Shah RS, et al. Clinicopathologic study of dextran sulfate sodium experimental murine colitis. Lab Invest 1993;69:238-249. [5] Burstein E, Hoberg JE, Wilkinson AS, et al. COMMD proteins: A novel family of structural and functional homologs of MURR1. J Biol Chem 2005;280:22222-22232. [6] Vonk WI, de Bie P, Wichers CG, et al. The copper-transporting capacity of ATP7A mutants associated with Menkes disease is ameliorated by COMMD1 as a result of improved protein expression. Cell Mol Life Sci 2012;69:149-63. [7] Ahnen DJ, Reed TA, Bozdech JM. Isolation and characterization of populations of mature and immature rat colonocytes. Am J Physiol 1988;254:G610-G621. [8] Burstein E, Ganesh L, Dick RD, et al. A novel role for XIAP in copper homeostasis through regulation of MURR1. EMBO Journal 2004;23:244-254. [9] Mao X, Gluck N, Li D, et al. GCN5 is a required cofactor for a ubiquitin ligase that targets NF-kB/RelA. Genes Dev 2009;23:849-861. [10] Starokadomskyy P, Gluck N, Li H, et al. CCDC22 deficiency in humans blunts activation of proinflammatory NF-kB signaling. J Clin Invest 2013;123:2244-2256. [11] Barish GD, Yu RT, Karunasiri M, et al. Bcl-6 and NF-kB cistromes mediate opposing regulation of the innate immune response. Genes Dev 2010;24:2760-5. [12] Ramirez-Carrozzi VR, Nazarian AA, Li CC, et al. Selective and antagonistic functions of SWI/SNF and Mi-2b nucleosome remodeling complexes during an inflammatory response. Genes Dev 2006;20:282-296. [13] Zhao A, Urban JF, Jr., Anthony RM, et al. Th2 cytokine-induced alterations in intestinal smooth muscle function depend on alternatively activated macrophages. Gastroenterology 2008;135:217-225 e1. [14] Moreno R, Sobotzik JM, Schultz C, et al. Specification of the NF-kB transcriptional response by p65 phosphorylation and TNF-induced nuclear translocation of IKKe. Nucleic Acids Res 2010;38:6029-6044. [15] Mastrogiannaki M, Matak P, Keith B, et al. HIF-2a, but not HIF-1a, promotes iron absorption in mice. J Clin Invest 2009;119:1159-1166.

82 COMMD1 and colitis Supplementary figures And tables

4

Figure S1 - Baseline characterization of Mye-K/O mice. (A) Commd1 deficiency in myeloid cells of Mye-K/O mice was verified by western blot in myeloid cells derived from bone marrow cells or adherent splenocytes after 10 day culture. Lymphocyte populations (primary thymocytes and non-adherent splenocytes) are shown as controls. (B) and (C) Spleen and MLN populations were not affected in Mye-K/O mice. Various cell populations were determined using flow cytometry for the indicated surface markers (n=3 for each group). (D) Flow cytometry immunophenotypic analysis of splenocytes was performed using markers for granulocytes (Ly6G+), macrophages (CD11b+ and Ly6C+), activated phagocytes (F4/80), dendritic cells (CD11c+) and B lymphocytes (B220+). Representative plots of cells expressing the indicated markers are shown.

83 CHAPTER 4

Figure S2 - Commd1 deficiency did not affect expression of certain NF-kB and hypoxia gene targets. (A) and (B) Bone-marrow derived myeloid cells (2 mice per group, with triplicate cultures each) were stimulated with LPS or exposed to hypoxia conditions and expression of inducible genes were determined by qRT-PCR.

Figure S3 - Mye-K/O mice have a more severe inflammatory response to LPS. (A) After intraperitoneal LPS administration, a morbidity index (Table S5) was calculated at the indicated time points. Mye-K/O mice demonstrated greater morbidity compared to wild-type (WT) littermate controls. (B) Plasma levels of LDH were elevated in Mye-K/O mice (n=8) compared to WT controls (n=6). * p < 0.05 84 COMMD1 and colitis

4

Figure S4 - Pro-inflammatory gene expression Figure S5 - COMMD gene suppression after LPS challenge was more pronounced in Mye- in IBD patients. COMMD1 expression K/O mice. After RNA isolation, gene expression was in the colonic mucosa was reduced evaluated in different organs by qRT-PCR. Highlighted in a cohort of IBD patients in the USA in green are genes that displayed a statistically (22 normal controls and 17 patients with significant difference (p value < 0.05). IBD, 9 of which had CD and 8 with UC). * p =0.04.

Figure S6 – Commd1 is expressed in epithelium and lamina propria macrophages of the colon. Frozen sections of mouse colon tissue were stained with Commd1-specific antibody and counterstained with the macrophage marker F4/80. DAPI staining was used to delineate the nuclei. A negative control not including the primary antibodies is also shown. Magnification bar equals 100 µm.

85 CHAPTER 4

A

Figure S7 - Commd1 deficiency in the intestinal epithelium did not promote affect acute colitis severity. (A) Deletion of Commd1 in intestinal epithelial cells of Commd1F/F, Vilin-Cre mice (IEC- K/O) was demonstrated by western blot analysis using cell lysates from small bowel epithelial cells and colonocytes; splenocytes, and gastric epithelial cells serve as controls. (B) No difference was found between IEC-K/O and WT mice in terms of survival rate, weight loss or disease activity in an acute model of colitis.

Figure S8 - Lymphocyte and macrophage populations during acute colitis. Lymphocyte and myeloid populations were not substantially different in the MLN of Mye-K/O mice compared to controls (n=3 in each group). Flow cytometry was utilized to identify the indicated cell populations as before.

86 COMMD1 and colitis

Figure S9 - Commd1 deficiency leads to greater cytokines secretion from inflamed colonic tissue. Full thickness colonic tissue from mice with chronic DSS colitis were harvested and cultured overnight (WT, n=15; Mye-K/O, n=14). The released of cytokines from these tissues into the culture media was evaluated by a multiplex bead-based assay. Marked 4 in green are statistically significant differences between the groups (p value < 0.05).

Table S5: Morbidity score for sepsis models

APPEARANCE 0 Normal 1 Lack of grooming 2 Coat rough, possible nasal or ocular discharge 3 Coat very rough, abnormal posture, eyes sunken and glazed

CLINICAL SIGNS 0 Normal 1 Diarrhea, constipation 2 Respiratory rate altered, respiratory depth altered, skin tents 3 Cyanotic extremities, labored breathing

UNPROVOKED BEHAVIOR 0 Normal 1 Minor changes 2 Abnormal behavior, less mobile, less alert, inactive when activity expected 3 Paralysis, inability to remain upright, shivering, convulsion

Total score: Sum of (Domain scores) for each domain in the scoring system

87 CHAPTER 4

Table S6: Disease activity index in the acute DSS colitis model

WEIGHT 0 Unchanged 1 Loss of 1-5% 2 Loss of 6-10% 3 Loss of 11-20% 4 Greater than 20% weight loss

STOOL CONSISTENCY 0 Normal 2 Loose stools (not watery) 4 Diarrhea (liquid stool)

BLEEDING 0 None 2 Hemoccult positive stools 3 Visible blood on stool 4 Gross bleeding per rectum

Total score: Sum of (Domain scores) for each domain in the scoring system

Table S7: Histologic score for the acute DSS colitis model

DOMAIN INVOLVEMENT A) CRYPT LOSS 0 Intact 1 Loss of basal one-third of crypt 2 Loss of basal two-thirds of crypt 3 Loss of entire crypt 4 Erosion (loss of entire crypt and surface epithelium) B) CRYPT DISTORTION 0 None 1 Basal one-third of crypt 2 Basal two-thirds of crypt 3 Entire crypt 1 1-25% of surface 4 Entire crypt and surface epithelium 2 26-50% of surface 3 51-75% of surface C) INFLAMMATION 4 76-100% of surface 0 None 1 Mild 2 Moderate 3 Severe

D) HYPERPLASTIC EPITHELIUM 0 None 1 Basal one-third of crypt 2 Basal two-thirds of crypt 3 Entire crypt 4 Entire crypt and surface epithelium Total score: Sum of (Domain score x involvement score) for each domain in the scoring system

88 COMMD1 and colitis 5 Reference This study This study This Reference PrimerBank ID 6752987b2 PrimerBank PrimerBank ID 6753310a1 PrimerBank PrimerBank ID 6678563a2 PrimerBank PrimerBank ID 6755454a1 PrimerBank PrimerBank ID 161484598c1 PrimerBank PrimerBank ID 19527000a1 PrimerBank 12 12 13 12 14 12 14 15 12 This study This This study This This study This study This study This

4 CCAGTTGGTAACAATGCCATGT GTCCCGTAGGGTAGCTGCT CCCACTTCTTCTCTGGGTTG CGCACAGAGCGATGAAGGT CATCGTTCCATTTCCCAGAGTC GCCAAAATACTACCAGCTCACT CGAGAGTGTTGTGGCAGGTTG GGACTCTGGCTTTGTCTTTC CATGCAGTAGACATGGCAGAA GTGATGCCACCTTGCTTTTT GGAGGGTTTCTCTCCACAC GTGGCTATGACTTCGGTTTGG TGTAGACCATGTAGTTGAGGTCA TGATCGTCTTCAAGGTTTCCTTGT TGGGCTACAGGCTTGTCACT TTGCTCACTCCCAGTTGC GATGGAGTTGAAGGTAGTTTCGTG CAGAATTTGGTTGACTTTGAC TGTTGCTGTAGCCAAATTCGT AGGCCACAGGTATTTTGTCG ACATCTGCAAGTACGTTCGTT AGCAGGTCGGAAGTGGTT ACGAGGAGCACCGTGAAGAT Antisense primer Antisense Antisense primer Antisense Sense primer GCGGGAAATCGTGCGTGACATT GCAAATATGGACAGGAATC CCCACTCCTCCACCTTTGAC Sense primer GGCTGTATTCCCCTCCATCG GTGCCCACGTCAAGGAGTAT GAGTGGGAACTGGTAGTGTTG GCTGAAAGCTCTCCACCTCA CTTGTTCAGAGCGGAGAAAGC CTGTTCAGAAGTTCACGGGAC GGGCATGTGCTTCCAGTATGT CCCCAAAGGGATGAGAAGTT CCTCCTCTGACAACATCAGC TCCGAAAGAAGTGGAATAAGTGG TACATTGCCCAAAAGCCCTTAT TCAATGGGACTGCATATCTGCC TGGATGCTACCAAACTGGAT TCCAACTCCAAGATTTCCCCG TGGCGAAGATGAGAGGACTT TGAGAAGTTCCGCCAGAG TGTCAGTGCCTGCAGACCAT Taqman primer and probe set from Applied Biosystems Applied set from probe and primer Taqman Biosystems Applied set from probe and primer Taqman Biosystems Applied set from probe and primer Taqman Biosystems Applied set from probe and primer Taqman Biosystems Applied set from probe and primer Taqman Biosystems Applied set from probe and primer Taqman Biosystems Applied set from probe and primer Taqman AGGTCGGTGTGAACGGATTTG AAAGACTGGATTCTGGGAAGTTTGG AAACCTGATCCGACTTCACTTCC Human genes Human Gene target Gene target COMMD1 GAPDH ACTB Mouse genes Mouse Gene target Gene target Saa3 Slc2a1 Sell Ccl5 Ccnd2 Cd86 Commd1 Gapdh Commd2 Commd3 Commd4 Commd5 Commd6 Commd7 Commd8 Commd9 Commd10 Cxcl1 Emr1 Il1b Il6 Il33 Mx1 Tnf Veg fa Actb Adm Table S8: Primer sequences used in quantitative PCR analysis sequences used S8: Primer in quantitative Table

89

CHAPTER 5

A cell-type-specific role for Commd1 in liver inflammation

Bartuzi P1, Wijshake T1, Dekker DC1, Fedoseienko A1, Kloosterhuis NJ1, Youssef SA2, Li H3, Shiri-Sverdlov R4, Kuivenhoven JA1, de Bruin A2, Burstein E3, Hofker MH1, van de Sluis B1

1University of Groningen, University Medical Center Groningen, Department of Pediatrics, Molecular Genetics Section, Groningen, the Netherlands, 2Dutch Molecular Pathology Center, Department of Pathology, Faculty of Veterinary Medicine, Utrecht University, Utrecht, the Netherlands, 3University of Texas Southwestern Medical Center, Departments of Internal Medicine and Molecular Biology, Dallas, USA, 4Department of Molecular Genetics, Maastricht University, Maastricht, the Netherlands

Biochimica et Biophysica Acta - Molecular Basis of Disease 2014; 1842(11):2257-2265 Abstract

The transcription factor NF-κB plays a critical role in the inflammatory response and it has been implicated in various diseases, including non-alcoholic fatty liver disease (NAFLD). Although transient NF-κB activation may protect tissues from stress, a prolonged NF- κB activation can have a detrimental effect on tissue homeostasis and therefore accurate termination is crucial. Copper Metabolism MURR1 Domain-containing 1 (COMMD1), a protein with functions in multiple pathways, has been shown to suppress NF-κB activity. However, its action in controlling liver inflammation has not yet been investigated. To determine the cell-type-specific contribution of Commd1 to liver inflammation, we used hepatocyte and myeloid-specific Commd1-deficient mice. We also used a mouse model of NAFLD to study low-grade chronic liver inflammation: we fed the mice a high fat, high cholesterol (HFC) diet, which results in hepatic lipid accumulation accompanied by liver inflammation. Depletion of hepatocyte Commd1 resulted in elevated levels of the NF-κB transactivation subunit p65 (RelA) but, surprisingly, the level of liver inflammation was not aggravated. In contrast, deficiency of myeloid Commd1 exacerbated diet-induced liver inflammation. Unexpectedly we observed that hepatic and myeloid Commd1 deficiency in the mice both augmented hepatic lipid accumulation. The elevated levels of proinflammatory cytokines in myeloid Commd1-deficient mice might be responsible for the increased level of steatosis. This increase was not seen in hepatocyte Commd1- deficient mice, in which increased lipid accumulation appeared to be independent of inflammation. Our mouse models demonstrate a cell-type-specific role for Commd1 in suppressing liver inflammation and in the progression of NAFLD. COMMD1 in liver inflammation and steatosis Introduction

The Copper Metabolism Murr1 Domain-containing protein 1 (COMMD1) is the founder member of a relatively new family of proteins, the COMMD family [1]. This protein family is distinguished by a unique motif called the COMM domain, located at their carboxy- terminus. Recent studies have demonstrated that COMMD1 acts in a wide variety of cellular processes, including hepatic copper transport [2, 3], hypoxia response [4-6], sodium, potassium and chloride transport [7-10], and in nuclear factor kappa B (NF-κB) signaling [11]. We recently confirmed its role in hepatic copper homeostasis in liver-specific Commd1 knockout mice [12]. On depletion of Commd1 in hepatocytes, mice become susceptible to hepatic copper accumulation [12], similar to dogs carrying a homozygous COMMD1 loss-of-function mutation [2]. Notwithstanding its role in copper transport, the biological role of COMMD1 in NF-κB signaling in the liver and in inflammatory liver diseases has not yet been defined. The NF-κB family of transcription factors plays a key role in the inflammatory responses. The family consists of five members, of which p65 (RelA) and p50/p105 (NF-κB1) compose the canonical NF-κB pathway. The p65/p50 heterodimer is sequestered in the cytoplasm by the inhibitory IκB proteins. Activation of the canonical NF-κB pathway via the kinase complex IKK results in translocation of p65/p50 dimer to the nucleus for transcriptional activation of its target genes. COMMD1 has been shown to terminate NF-κB activity by acting as a scaffold protein in the E3 ubiquitin ligase complex (ECSSOCS1) [1, 13]. ECSSOCS1 promotes ubiquitination and subsequent proteasomal degradation of p65 and destabilizes 5 the interaction between p65 and chromatin. Hence, depletion of COMMD1 results in elevated p65 levels and subsequently increased NF-κB activity [1, 13, 14]. The NF-κB signaling pathway has a remarkable physiological function in several liver diseases, including non-alcoholic fatty liver disease (NAFLD) [15]. NAFLD consists of a wide spectrum of pathologies, ranging from simple steatosis to non-alcoholic steatohepatitis (NASH), and can even progress to liver fibrosis and cirrhosis, and in some cases to hepatocellular carcinoma (HCC) [16]. The progression to the severe stages of NAFLD, which are related to a poor prognosis, is thought to be driven by inflammation, including the expression of the NF-κB-mediated cytokines Il-6 and Tnf-α [16-18]. These proinflammatory cytokines are mainly secreted by activated Kupffer cells, the resident liver macrophages, and they promote the progression of NAFLD towards NASH [19, 20]. In addition, the NF-κB signaling pathway in hepatocytes also plays a role in NAFLD progression, as hepatocyte-specific depletion of NEMO, the regulatory subunit of the IKK complex, results in chronic steatohepatitis and eventually leads to the formation of liver tumors [21]. Together these findings underscore the pivotal role of the NF-κB signaling pathway in health and disease, but the contribution of COMMD1 in hepatocyte NF-κB signaling and in inflammatory liver diseases still remains elusive. To determine the cell-type-specific role of COMMD1 in liver inflammation, we used hepatic and myeloid-specific Commd1-deficient mice and a second mouse model of NAFLD for low-grade, chronic liver inflammation. In these different mouse models, we studied the level of diet-induced liver inflammation and the progression of hepatic steatosis.

93 CHAPTER 5 Materials and Methods Animals

Conditional hepatocyte-specific (Commd1∆Hep) [12] and conditional myeloid-specific knockout mice (Commd1∆Mye) were obtained by crossing Commd1loxP/loxP mice (here referred to as wild type (WT) mice) with Albumin-Cre [22] or LysM-Cre [23] transgenic mice, respectively. Both Commd1∆Hep and Commd1∆Mye mice were backcrossed in a C57BL/6J background for more than 8 generations. Commd1loxP/loxP littermate mice (WT) served as controls for Commd1∆Hep and Commd1∆Mye mice. p55∆ns/∆ns ; Commd1∆Hep were obtained by crossing p55∆ns/∆ns [24] with Commd1∆Hep mice. All the experimental mice were males and were housed individually. They were fed ad libitum with either standard rodent chow diet (RMH-B, AB Diets, Woerden, the Netherlands), or, starting at 8-10 weeks of age, a high-fat, high-cholesterol (HFC) diet (45% calories from butter fat) containing 0.2% cholesterol (SAFE Diets) for a period of 12 weeks. p55∆ns/∆ns ; Commd1∆Hep and p55∆ns/∆ns mice were fed only a chow diet and were sacrificed at the age of 20 weeks. All animals were sacrificed following a 4-hour morning fasting period. Body weight and liver weight measurements were recorded. Collected tissues were snap-frozen in liquid nitrogen and blood was collected by means of heart puncture in K3EDTA-coated MiniCollect® tubes (#450476, Greiner Bio-One, Alphen a/d Rijn, the Netherlands). The right hepatic lobe was used for gene expression, immunoblot and histological analysis. Plasma was separated by centrifuging at 3000 rpm for 10 min. at 40C. All animal-related studies were approved by the Institutional Animal Care and Use Committee of the University of Groningen (Groningen, the Netherlands).

Liver nuclear and cytosolic fraction isolation , DNA binding ELISA

Fractionation was performed on fresh, ice-cold, mouse liver samples, using the Nuclear Extract Kit (#40010, Active Motif, La Hulpe, Belgium) according to the manufacturer’s instructions. To study the activity of NF-κB in fresh livers, the DNA binding of p65 was assessed using the TransAM NF-κB p65 ELISA kit (#40096, Active Motif, La Hulpe, Belgium) according to the manufacturer’s instructions.

Isolation of bone marrow cells and peritoneal macrophages

Bone marrow cells isolated from either WT or Commd1∆Mye mice were cultured and differentiated into macrophages, as described previously [25]. Peritoneal macrophages were isolated 3 days after injection of 4% thioglycolate in the peritoneal cavity of either WT or Commd1∆Mye mice.

Immunoblot analysis

Tissues were homogenized in NP40 buffer [0.1% Nonidet P-40 (NP-40), 0.4 M NaCl, 10 mM Tris-HCl (pH 8.0), 1 mM EDTA] supplemented with protease and phosphatase

94 COMMD1 in liver inflammation and steatosis inhibitors and 30 μg of protein was loaded per gel lane. Samples were separated using sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to Amersham™ Hybond™-P PVDF Transfer Membrane (#RPN303F, GE Healthcare, Diegem, Belgium). Bands were visualized using ChemiDoc™ XRS+ System (Bio-Rad Laboratories BV, Veenendaal, the Netherlands).

Liver lipid extraction

15% (w/v) liver homogenates were prepared in 1x PBS and lipid extraction was performed using the Bligh & Dyer method [26]. Samples were analyzed for cholesterol and triglyceride content.

Cholesterol and triglyceride analysis in plasma and liver lipid samples

Total cholesterol (TC) levels were determined using a colorimetric assay (11489232, Roche Molecular Biochemicals) with cholesterol standard FS (DiaSys Diagnostic Systems Gmbh, Holzheim, Germany) as a reference. Triglyceride (TG) levels were determined using Trig/ GB kit (1187771, Roche Molecular Biochemicals) with Roche Precimat Glycerol standard (16658800) as a reference.

Antibodies 5 In these experimental procedures we used the following antibodies: rabbit polyclonal antibody against COMMD1 (11938-1-AP, Proteintech Group, USA), mouse anti-β-Actin (A5441, Sigma-Aldrich Chemie B.V., Zwijndrecht, the Netherlands), rabbit antiTubulin (AB4047, Abcam, Cambridge, UK), rabbit anti-Lamin A/C (2032, Cell Signaling Technology Europe, B.V., Leiden, the Netherlands), rabbit anti-p65 (4764, Cell Signaling Technology, Europe, B.V.), rabbit anti-IκBα (sc-371, Santa Cruz Biotechnology Inc., Heidelberg, Germany), rabbit anti-Cd68 (#137002, Biolegio, Nijmegen, the Netherlands) rabbit anti-F4/80 (#101201, Biolegio, Nijmegen, the Netherlands), goat anti-rabbit IgG (H + L)-HRP Conjugate (170-6515, Bio-Rad Laboratories BV, Veenendaal, the Netherlands), goat anti-mouse IgG (H + L)-HRP Conjugate (170-6516, Bio-Rad Laboratories BV).

Liver histology

Paraffin-embedded liver sections (4 μm) were stained with Hematoxylin & Eosin (H&E). Snap-frozen liver sections (5 μm) were stained using Oil Red O (ORO) or antibodies against Cd68. F4/80 staining was performed on either paraffin-embedded or snap-frozen liver sections. Scoring of steatosis and lobular inflammation was performed in an unbiased manner by an experienced, certified veterinary pathologist using a method described previously [27].

95 CHAPTER 5 Gene expression analysis

Pieces of murine liver of approximately 100 mg were homogenized in 1 ml QIAzol Lysis Reagent (Qiagen, Venlo, the Netherlands). Total RNA was isolated by chloroform extraction. Isopropanol- precipitated and ethanol-washed RNA pellets were dissolved in RNase/DNase free water. 1 μg of RNA was used to prepare cDNA with the Quantitect Reverse Transcription Kit (Qiagen, Venlo, the Netherlands) according to the protocol provided by the manufacturer. 20 ng cDNA was used for subsequent quantitative real-time PCR (qRT-PCR) analysis using iTaq SYBR Green Supermix with ROX (Bio-Rad Laboratories BV,) and 7900HT Fast Real-Time PCR System (Applied Biosystems). The following PCR program was used: 500C/2 min., 950C/10 min., 40 cycles of 950C/15 sec and 600C/1 min. Expression data were analyzed using SDS 2.3 software (Applied Biosystems) and the standard curve method of calculation. Mouse Cyclophilin A was used as an internal control gene. The primer sequences we used are listed in Table S1.

Statistical analysis

All results are expressed as mean ± SEM. Statistical analysis was performed using Prism 5.00 for Windows (GraphPad Software, CA, USA) and the unpaired Student’s t test. Results of P < 0.05 were considered to be statistically significant.

Results Hepatic depletion of Commd1 results in increased levels of NF-κB subunit p65

To elucidate the role of hepatic Commd1 in NF-κB signaling and inflammation in vivo, we depleted Commd1 in hepatocytes (Commd1∆Hep) by crossing Commd1loxP/loxP mice with Alb-Cre transgenic mice, mice expressing Cre-recombinase in adult hepatocytes [12]. Commd1∆Hep mice showed marked reduction in hepatic Commd1 levels, however some residual amount of Commd1 was detected (Fig. 1A), which is likely due to the expression of Commd1 in nonparenchymal cells, as approximately 80% of an adult liver genome exists in hepatocytes, the rest is located in endothelial, stellate or Kupffer cells [28]. Since various cellular models demonstrated that down-regulation of COMMD1 results in elevated p65 levels and subsequently increased NF-κB activity [1, 13], we first assessed the levels of p65 in nuclear and cytosolic fractions of livers from WT (n=6) and Commd1∆Hep mice (n=6-8) (Fig. 1A). We observed that Commd1∆Hep mice showed clearly higher protein levels of p65 in both the cytosolic and nuclear fractions of livers compared with WT mice. Next, we determined whether the rise in protein p65 levels was caused by an increase in p65 mRNA levels (Fig. 1B). We detected no difference in hepaticp65 gene expression between Commd1∆Hep mice and WT littermates, excluding the possibility that the increase in p65 protein levels was due to alterations in transcriptional regulation. In line with previous in vitro studies [1, 13], these data suggest that Commd1 depletion results in an increased protein stability of p65 in hepatocytes. 96 COMMD1 in liver inflammation and steatosis Figure 1.

A. B. WT Commd1 ∆Hep 1.5 WT Commd1 ∆Hep p65 1.0

Cytosol Commd1 0.5 β-Actin

Relative p65 expression 0.0 p65 Nuclear Lamin A/C

Figure 1. Commd1 mediates the levels of cytosolic and nuclear p65 in hepatocytes. (A) Fresh livers from chow-fed WT and Commd1∆Hep mice were used to isolate nuclear and cytosolic fractions, then p65 levels were determined by immunoblot analysis. Three representative mice per group are shown. (B) Relative mRNA expression of p65 in livers of WT and Commd1∆Hep mice, as determined by quantitative RT-PCR. All values per group are shown as mean ± SEM.

Hepatic Commd1 depletion aggravates steatosis, but not inflammation Since NF-κB-mediated inflammation is associated with the progression of NAFLD towards 5 a more severe NASH phenotype [29-31], we investigated the consequences of elevated p65 levels in hepatic Commd1-deficient mice on inflammation in a mouse model of NAFLD nduced by an HFC diet. After 12 weeks of HFC feeding, we saw no differences in body and liver weight between Commd1∆Hep and WT mice (Fig. 2A). In addition, no liver damage was observed, as the plasma levels of the liver enzymes ALT and AST were not markedly increased (data not shown). Surprisingly however, total hepatic cholesterol and triglyceride levels were significantly increased in the Commd1∆Hep mice following 12 weeks of HFC diet (Fig. 2B). This observation was supported by histological analysis: hematoxylin and eosin (H&E) staining demonstrated an increase in lipid deposits in the livers of Commd1∆Hep mice (Fig. 2C, D), as confirmed by ORO staining (Fig. 2C). These differences were not seen in chow-fed animals. Histologically, HFC-feeding markedly increased the level of lobular inflammation in both WT and Commd1∆Hep mice, but no alterations between the genotypes were seen (Fig. 2E). In order to investigate the effect of Commd1 loss in hepatocytes on inflammation in greater detail, we performed immunohistochemical stainings. Immunostaining for the macrophage markers [32] Cd68 (a marker of activated macrophages [33]) and F4/80 (marker of mature macrophages, highly expressed by Kupffer cells [33]) showed increased infiltration of macrophages in the livers on HFC feeding (Fig. 3A), but we saw no differences between Commd1∆Hep and WT mice. Expression analysis of Cd68 and F4/80, together with Cd11b, a migratory marker of blood-derived monocytes [34], confirmed the immunohistochemical results (Fig. 3B).

97 CHAPTERFigure 2. 5

A. B.

WT ] WT 45 6 ∆Hep r ∆Hep ] 25 60 WT Commd1 e WT Commd1 ∆ ∆Hep v Hep W i Commd1 ] Commd1 l ** r

B

e g 20 * / v l % i ] [ l o

30 4

g 40 t [ g m

h 15 / l µ g [ i o W

l e B m o µ

w 10 r [

15 2 r e 20 t e G s v T

i 5 e l L o 0 0 h 0 0 Chow HFC Chow HFC C Chow HFC Chow HFC

C. Chow HFC ∆ ∆ WT Commd1 Hep WT Commd1 Hep

H&E

ORO

D. E. 2.5 WT 5 ∆ WT Commd1 Hep Commd1∆Hep e 2.0 r * 4 o c s n score 1.5 o 3 s i i t s a o t 1.0 m 2 a m e t a l f S 0.5 1 I n N.D. 0.0 0 Chow HFC Chow HFC

Figure 2. Hepatic Commd1 deficiency aggravates lipid accumulation in HFC-fed mice. (A) Body weight (BW) and liver weight, represented as % of the BW, of WT and Commd1∆Hep mice after 12 weeks on HFC diet and of control chow-fed groups. (B) Hepatic total cholesterol and triglyceride levels. Liver lipids were extracted from snap-frozen mouse livers using the Bligh-Dyer method for lipid extraction and analyzed with a colorimetric assay. (C) H&E and ORO staining of hepatic tissue from 4-hour fasted chow- and HFC-fed mice. H&E staining was performed on paraffin-embedded samples and ORO staining on snap-frozen hepatic cryo-sections. Representative images per group are shown. Scale bars represent 100 μm. (D) Histological evaluation of liver steatosis. Steatosis was not present in chow-fed mice (N.D. = not detected). (E) Histological evaluation of inflammation. Inflammation score was based on the number of inflammatory foci per five random fields at 200x. All values per group are shown as mean ± SEM. Statistical significance was determined versus WT control mice: *P<0.05, **P<0.01.

Next, hepatic mRNA levels of a number of NF-κB target genes were determined (Fig. 3C). A significant increase in the expression of the proinflammatory genes: Tnfα, Il-1α, Il-1β and Mcp1, and the NF-κB target genes: Icam, and Tnfaip3 (A20) was detected following 12 weeks of HFC feeding, but we saw no differences betweenCommd1 ∆Hep and WT mice,

98 COMMD1 in liver inflammation and steatosis Figure 3.

A. Chow HFC ∆ ∆ WT Commd1 Hep WT Commd1 Hep

Cd68

F4/80

B. C. 6 6 n WT (Chow) n WT (Chow) o ∆ o

i Hep 5 Commd1 (Chow) i ∆Hep s s 5 Commd1 (Chow) s WT (HFC) s WT (HFC) e ∆Hep e ∆Hep r 4 Commd1 (HFC) r 4 p p Commd1 (HFC) x x E 3 E 3

e e v v i 2 i 2 t t a a l l e 1 e 1 R R 0 0 Cd68 Cd11b F4/80 Tnfα Il- 1 α Il-1β Mcp-1 Icam Iκ Bα A20 (Nfκbia) (Tnfaip3)

Figure 3. Depletion of hepatocyte Commd1 has no effect on HFC-diet-induced liver inflammation. (A) Immunostaining of WT and Commd1∆Hep livers. Snap-frozen samples were stained for the macrophage markers Cd68 and F4/80. Representative images per group are shown. Scale bars represent 5 100 μm. Relative liver mRNA expression of (B) the macrophage and monocyte markers Cd68, Cd11b and F4/80, and (C) proinflammatory cytokines and NF-κB target genes, Tnfα, Il-1α, Il-1β, Mcp-1, Icam, IκBα (NFκBia), and A20 (Tnfaip3). All values per group are shown as mean ± SEM. corroborating the histological analysis. In addition, no substantial difference in the expression of other NF-κB (Fig. S1A) or Commd genes was seen (Fig. S1B). Altogether, hepatic deficiency of Commd1 exacerbated HFC diet-induced steatosis, but not liver inflammation. Since Commd1 is involved in multiple physiological processes [3, 11, 35], it is possible that dietary intervention in combination with Commd1 deficiency affects additional pathways that modulate diet-induced liver inflammation, independent of its role in NF-κB signaling, leading to the observed results. Therefore, we decided to use a genetic approach to further evaluate the role of hepatocyte Commd1 in NF-κB-mediated liver inflammation. We crossed Commd1∆Hep mice on a p55∆ns/∆ns genetic background (p55∆ns/∆ns ; Commd1∆Hep). The p55∆ns/∆ns mice are homozygous for a mutation in the gene encoding the tumor necrosis factor receptor 1 (Tnfr1). This mutation results in impaired shedding of the Tnfr1 from the cell surface, resulting in increased activation of NF-κB and chronic, low- grade inflammation in the liver [24, 36]. The p55∆ns/∆ns ; Commd1∆Hep mice were born without any overt phenotype and in the expected Mendelian ratios. No differences in body and liver weight were observed (Fig. 4A, B). In line with the phenotype of Commd1∆Hep mice, hepatic

99 CHAPTER 5 Figure 4.

A. B. 40 ∆ns/∆ns 8 p55 ∆ns/∆ns p55 ] ∆ ∆ ∆ ∆ns/∆ns ∆Hep p55 ns/ ns ;Commd1 Hep p55 ;Commd1 W B 30 6 % ] [

g t [

h

g 4 W

20 i e B w

r 2 10 e v i L 0 0

p 5 5 ∆ n s / ∆ n s ; p55 ∆ns/∆ns Commd1 ∆ Hep C. D.

n 1.5 ∆ns/∆ns o p65 i p55 s ∆ns/∆ns ∆Hep

s p55 ;Commd1 e r p

Commd1 x 1.0 E

Cytosol e v i t

κ α a I B l 0.5 e R

5

α-Tubulin 6 p 0.0

p65 Nuclear F. Lamin A/C 2.5 p55 ∆ns/∆ns n ∆ns/∆ns ∆Hep o

i p55 ;Commd1

s 2.0 s

e * r

p 1.5 E. ∆ns/∆ns ∆ns/∆ns ∆Hep x

p55 p55 ; Commd1 E

e 1.0 v i t a l 0.5 e R 0.0 TNFα Il-1α Il-1β Mcp-1 Cd68 Ccl5

G. p55 ∆ns/∆ns 1.5 p55 ∆ns/∆ns ;Commd1∆Hep

∆Hep n o

WT Commd1 i s s

e 1.0 r p x E

e v

i 0.5 t a l e R 0.0 Ciap-1 Ciap-2 Bfl-1 Traf-1

Figure 4. Loss of Commd1 function in hepatocytes does not increase Tnf-induced NF-κB activity. (A) Body weight (BW) and (B) liver weight (represented as %BW) of chow-fed p55∆ns/∆ns and p55∆ns/∆ns ; Commd1∆Hep mice. (C) Cytosolic levels of hepatocyte p65 and IκBα (NFκBia) and nuclear levels of hepatocyte p65 of three representative mice per group of p55∆ns/∆ns and p55∆ns/∆ns ; Commd1∆Hep mice determined by immunoblot analysis. (D) Relative gene expression of p65 in liver of p55∆ns/∆ns and p55∆ns/∆ns ; Commd1∆Hep mice, determined by qRT-PCR. (E) H&E staining of hepatic tissue from chow fed mice after 4-hour fasting. Representative images per group are shown. Inflammatory foci are marked with arrows. Scale bars represent 100 μm. (F and G) Relative mRNA expression of (F) proinflammatory cytokines, marcophages markers, and (G) anti-apoptotic genes, as determined by qRT-PCR. All values per group are shown as mean ± SEM. Statistical significance was determined versus control p55∆ns/∆ns group. *P<0.05

Commd1 ablation in p55∆ns/∆ns mice also resulted in elevated levels of p65 (Fig. 4C), with no alteration in p65 mRNA levels (Fig. 4D). Furthermore, similar to what we and others have previously shown [24, 36], p55∆ns/∆ns mice display a significant increase in the number of inflammatory foci within hepatic lobules (Fig. 4E). However, we saw no clear differences

100 COMMD1 in liver inflammation and steatosis in the number of inflammatory foci between p55∆ns/∆ns (n=6) and p55∆ns/∆ns; Commd1∆Hep mice (n=7) (Fig. 4E). This observation was corroborated by the fact that the gene expression of proinflammatory markers and cytokines was not affected by Commd1 deficiency (Fig. 4F). Only Il-1α mRNA levels were significantly increased, but the level of induction was rather mild. In addition to the NF-κB signaling pathway, TNF-α also activates apoptotic pathways [37, 38], and since NF-κB drives the expression of anti-apoptotic genes, we also looked at the mRNA levels of anti-apoptotic genes mediated by NF-κB (Fig. 4G). However, we saw no differences between the two groups (Fig. 4G). Altogether, using two independent but complementary approaches, we showed that depletion of Commd1 in hepatocytes leads to elevated levels of the NF-κB subunit p65, both in the nucleus and cytoplasm, but that it does not affect the level of liver inflammation induced by HFC-feeding nor in Tnf-mediated chronic hepatitis.

Steatosis and inflammation are exacerbated in myeloid-deficient Commd1 mice

In addition to hepatocytes, myeloid cells (in particular macrophages) also play a crucial role in NF-κB-mediated liver inflammation and in the progression of NAFLD [39]. We therefore assessed the role of myeloid Commd1 in liver inflammation during the development of steatohepatitis. We crossed mice carrying floxed conditional Commd1 alleles with LysM-Cre transgenic mice [23] to specifically ablate Commd1 in the myeloid lineage 5 (Fig. S2A,B) [40]. We fed WT (n=6-7) and Commd1∆Mye mice (n=6-7) either chow or HFC diet for 12 weeks. Commd1 deficiency in myeloid cells did not lead to differences in body and liver weight, neither in chow- nor HFC-fed mice (Fig. 5A). The plasma levels of the liver enzymes ALT and AST were also not noticeably elevated (data not shown). However, HFC-fed Commd1∆Mye mice showed a significant increase in liver triglyceride levels compared to WT mice (Fig. 5B). H&E staining of the livers corroborated the exacerbated liver steatosis in Commd1∆Mye mice, and was further confirmed by ORO staining (Fig. 5C, D). In addition to the elevated hepatic fat deposits, histological scoring also revealed an increase in hepatic inflammation (Fig. 5E). The microscopic appearance of the livers showed inflammatory foci widespread in the hepatic tissue. We therefore investigated the effect of myeloid Commd1 depletion on liver inflammation in more detail. We stained liver sections of Commd1∆Mye and WT mice for Cd68 and F4/80 (Fig. 6A). Histological scoring showed an increase in the number of inflammatory foci in Commd1∆Mye mice following 12 weeks of HFC feeding. Moreover, this observation was confirmed by mRNA expression analysis (Fig. 6B). In addition, we analyzed the expression of various proinflammatory cytokines regulated by NF-κB, such as Tnf, Mcp-1, Ccl5 and Icam (Fig. 6C). Dietary intervention markedly induced the expression of proinflammatory markers in both groups. Compared to WT mice, Commd1∆Mye mice showed a significant increase in mRNA expression of most of the proinflammatory markers studied, except for Cd11b and Ccl5, which both showed

101 CHAPTERFigure 5. 5

A. B. ] r

50 WT 8 e 20 WT 80 WT WT v ] ∆Mye i ∆Mye ∆Mye

∆ l Mye Commd1 ]

Commd1 Commd1 r Commd1 W g e

40 / * l 15 v 60 6 i o l % B ]

[

g m g t [

30 /

l µ h [ o g

i l 40 W 4 10 e o m B 20 r w µ [

e

r t e s 5 G 20

v 2 e i 10 T l L o h

0 0 C 0 0 Chow HFC Chow HFC Chow HFC Chow HFC

Chow HFC C. ∆ ∆ WT Commd1 Mye WT Commd1 Mye

H&E

ORO

D. E. WT WT ∆ 2.0 ∆Mye 8 Commd1 Mye Commd1 * * e r

o 1.5 6 c s

n score s i o i s 1.0 t 4 o a t a m e t m a S 0.5 l 2 f N.D. I n 0.0 0 Chow HFC Chow HFC

Figure 5. Myeloid Commd1 deficiency exacerbates HFC-induced lipid accumulation. (A) Body weight (BW) and liver weight, represented as % of BW, of WT and Commd1∆Hep mice after 12 weeks on HFC diet and of control chow-fed groups. (B) Hepatic total cholesterol and triglyceride levels. (C) H&E and ORO staining of hepatic tissue from chow- and HFC-fed mice after 4-hour fasting. Representative images per group are shown. Scale bars represent 100 μm. (D) Histological evaluation of liver steatosis. Steatosis was not present in chow-fed mice (N.D. = not detected). (E) Histological evaluation of inflammation: inflammation score was based on the number of inflammatory foci per five random fields at 200x. All values per group are shown as mean ± SEM. Statistical significance was determined versus WT control group on each diet. *P<0.05.

a trend towards elevated expression (Fig. 6B, C). In conclusion, depletion of Commd1 in myeloid cells leads not only to increased liver inflammation, but also exacerbates the progression of steatosis upon 12 weeks of HFC feeding.

102 Figure 6. COMMD1 in liver inflammation and steatosis

A. Chow HFC ∆ ∆ WT Commd1 Mye WT Commd1 Mye

Cd68

F4/80

B. WT (Chow) C. WT (Chow) Commd1∆Mye (Chow) 8.5 Commd1∆Mye (Chow) 20 WT (HFC) WT (HFC) n n ∆ o ∆Mye 16 Mye i Commd1 (HFC) o Commd1 (HFC) s i 6.5 s s P=0.051 s 12 e ** r e p r * x p 8 P=0.06 x

E 4.5

6 E

** e v e i t v i 4 ** a t

l 2.5 a e l * e 2 R R 0.5 0 Cd68 Cd11b F4/80 Tnfα Mcp-1 Icam Ccl5

Figure 6. HFC diet-induced liver inflammation is increased upon depletion of myeloid Commd1. (A) Immunohistochemistry staining of the macrophage markers Cd68 and F4/80. Representative images 5 per group are shown. Scale bars represent 100 μm. (B and C) Relative mRNA expression of (B) macrophage and monocyte markers, and (C) proinflammatory cytokines. All values per group are shown as mean ± SEM. Statistical significance was determined versus WT control group on each diet. *P<0.05, **P<0.01.

Discussion

NF-κB signaling is an essential pathway in the progression of many inflammatory diseases, including NAFLD [41, 42]. It is therefore crucial to identify the genes and mechanisms regulating the NF-κB pathway, and these might lead to novel therapeutic strategies to treat NAFLD. COMMD1, a pleiotropic protein, is involved in various pathways including NF-κB signaling [1, 11]. Here we evaluated the extent Commd1 deficiency in either hepatocytes or macrophages contributes to liver inflammation and progression of NAFLD in mice. On the one hand we showed that Commd1 has a cell-type-specific role in controlling liver inflammation in NAFLD, since myeloid Commd1 deficiency, but not hepatocyte-specific deletion, augmented the inflammatory tone of the disease. On the other hand, we saw that depletion of Commd1 in either cell type exacerbated diet-induced hepatic lipid accumulation. Ablation of Commd1 in the myeloid lineage caused increased diet-induced steatosis and liver inflammation concomitant with the elevated expression of several inflammatory cytokines, in particular Tnfα. Kupffer cells are the main source of hepatic TNFα, which has been shown to be an essential cytokine in the progression of NAFLD [39]. Blocking the

103 CHAPTER 5

Tnfα signaling pathway by deletion of either the Tnfr1 or Tnfα ameliorates NAFLD in mice [20, 43, 44]. In addition, leptin-deficient (Ob/Ob) mice treated with anti-TNFα antibodies show a reduced level of liver steatosis [45-47]. The increased lipid accumulation observed in HFC-fed Commd1∆Mye mice might therefore be explained by the elevated Tnfα expression in these mice. Our observation of a higher inflammatory tone in the liver of HFC-fed Commd1∆Mye mice is in line with our recent study [40], in which we showed that myeloid depletion of Commd1 exacerbates dextran sodium sulfate (DSS)-induced colitis and increases the susceptibility to sepsis because it invokes a stronger inflammatory response. Furthermore, Commd1 deficiency in bone-marrow derived myeloid cells selectively altered the expression of LPS-mediated genes, including a subset of genes involved in the immune response, and genes directly regulated by NF-κB [40]. However, these expression data also demonstrated that in addition to NF-κB, myeloid Commd1 also mediates other pathways activated by LPS, either directly or indirectly [40]. In addition, the intestinal epithelial- deficient Commd1 mice do not show increased inflammation or any sensitivity difference in DSS-induced colitis, resembling some aspects of the hepatic-specific deficiency that we present here. Despite the elevated levels of cytosolic and nuclear p65 (Fig. 1A), Commd1 deficiency in hepatocytes did not affect the level of liver inflammation in either NAFLD (Fig. 3) or in mice with low-grade liver inflammation due to a mutation in Tnfr1 [24, 36]. Nonetheless, the increase in p65 levels is in line with previous in vitro studies [1, 13], which demonstrated that COMMD1 promotes the ubiquitin-mediated proteolysis of p65. Insufficiency of COMMD1 in U2OS cells [13] or loss of p65-COMMD1 interaction [14] increased the steady-state and the protein stability of p65, respectively. Together with the unchanged mRNA levels of p65 (Fig. 1B), these data suggest that the elevated p65 levels in Commd1-deficient hepatocytes may result from an increased protein stability of p65 caused by reduced p65 ubiquitination. Nevertheless, independent of the level of hepatocyte p65, the activity of NF-κB is not changed upon depletion of Commd1 (Fig. 3C). A DNA-binding ELISA assay to assess the activity of NF-κB supported this observation. Although LPS injection itself significantly increased the activity of NF-κB in the livers of WT and Commd1∆Hep mice, Commd1 deficiency did not affect the level of NF-κB binding to DNA neither after PBS nor LPS (Fig. S3). The level of NF-κB activity is tightly titrated through various mechanisms [48-53] and numerous proteins controlling NF-κB signaling have been identified [11]; we therefore speculate that the effect of Commd1 loss is compensated by another mechanism to restore a basal NF-κB activity. We excluded the contribution of the well-known NF-κB inhibitors, IκBα (Nfkbia) and A20 (Tnfaip3) [11]. NF-κB drives the expression of both genes, but the mRNA levels of IκBα (Nfkbia) and A20 (Tnfaip3) in Commd1∆Hep livers of chow- and HFC-fed mice were not altered compared to WT mice (Fig. 3C). In line with this observation, we saw no difference in IκBα (Nfkbia) protein levels in p55∆ns/∆ns ; Commd1∆Hep mice (Fig. 4C). In addition, we saw no marked differences in the expression of other COMMD genes, a family of proteins, which have the ability to inhibit NF-κB activity [1, 11]. This suggests that there is another homeostatic mechanism that prevents uncontrolled NF-κB activity in Commd1-

104 COMMD1 in liver inflammation and steatosis deficient hepatocytes, which requires further studies to identify the mechanism and understand what is happening. Despite the lack of a higher inflammatory response, Commd1∆Hep mice fed a HFC-diet surprisingly showed elevated levels of liver cholesterol and triglycerides (TG) compared to WT littermates (Fig. 2B). Supported by histological analysis, these data indicate that hepatic Commd1 deficiency aggravates steatosis. Although COMMD1 has been linked to the regulation of biliary copper excretion and may regulate trafficking of various transporters [2, 9, 54], including ATP7B, a P-type ATPase which mediates copper excretion into the bile [55], we could not observe any marked changes in the biliary cholesterol excretion determined by the in vivo Transintestinal Cholesterol Excretion (TICE) experiment [56] (data not shown). Because we did not observe any marked changes in the mRNA levels of various genes involved in lipid uptake, synthesis and excretion (data not shown), a clear explanation for this observation is still missing. However, as COMMD1 is associated with the intracellular trafficking of various proteins and is localized to vesicles (reviewed in [3]), we speculate that COMMD1 acts as an adaptor protein in sorting/fusion of vesicles, a process that is also involved in autophagy. Recent studies demonstrated that inhibition of macroautophagy is associated with accumulation of TG and cholesterol in lipid droplets [57, 58]. It would therefore be of interest to further investigate the hepatic function of COMMD1, and to determine which kind of vesicles COMMD1 is localized to. Although COMMD1 partially co-localizes to endosomal and lysomal markers (reviewed in [3]), COMMD1-associated vesicles are still not fully characterized. Based on its pleiotropic function, it is highly possible that COMMD1 5 is not only involved in biliary copper excretion, but requires further substantial investigation. In conclusion, in this study we demonstrate that Commd1 represses the level of inflammation in NAFLD in a cell-type-dependent manner. Although hepatocyte Commd1 does not play a major role in liver inflammation, our data indicate that it does have a protective role in slowing the progression of steatosis in mice. Furthermore, our current knowledge advocates that its repressive action on inflammation is restricted to myeloid cells and this seems to be a general phenomenon in various disease models [40]. The mechanism by which myeloid COMMD1 restrains inflammation might therefore be an interesting target for developing new treatment strategies for inflammatory diseases.

Acknowledgements

We thank Jackie Senior for editing the text. This work described here was supported by the Graduate School for Drug Exploration (GUIDE), University of Groningen, an ALW (NWO) grant 817.02.022 awarded to BS, and partly by grants from NIH (R01 DK 073639) and CCFA (SRA 3727) awarded to EB.

105 CHAPTER 5 References

[1] E. Burstein, J.E. Hoberg, A.S. Wilkinson, J.M. Rumble, R.A. Csomos, C.M. Komarck, G.N. Maine, J.C. Wilkinson, M.W. Mayo, and C.S. Duckett, COMMD proteins, a novel family of structural and functional homologs of MURR1, J Biol Chem, 280 (2005) 22222-32. [2] B. van de Sluis, J. Rothuizen, P.L. Pearson, B.A. van Oost, and C. Wijmenga, Identification of a new copper metabolism gene by positional cloning in a purebred dog population, Hum Mol Genet, 11 (2002) 165-173. [3] A. Fedoseienko, P. Bartuzi, and B. van de Sluis, Functional understanding of the versatile protein copper metabolism MURR1 domain 1 (COMMD1) in copper homeostasis, Ann. N.Y. Acad. Sci. (2014) DOI: 10.1111/nyas.12353. [4] B. van de Sluis, P. Muller, K. Duran, A. Chen, A.J. Groot, L.W. Klomp, P.P. Liu, and C. Wijmenga, Increased activity of hypoxia-inducible factor 1 is associated with early embryonic lethality in Commd1 null mice, Mol Cell Biol, 27 (2007) 4142-4156. [5] B. van de Sluis, A.J. Groot, J. Vermeulen, E. van der Wall, P.J. van Diest, C. Wijmenga, L.W. Klomp, and M. Vooijs, COMMD1 promotes pVHL and O2-independent proteolysis of HIF-1 alpha via HSP90/70, PLoS One, 4 (2009) e7332. [6] B. van de Sluis, X. Mao, Y. Zhai, A.J. Groot, J.F. Vermeulen, E. van der Wall, P.J. van Diest, M.H. Hofker, C. Wijmenga, L.W. Klomp, K.R. Cho, E.R. Fearon, M. Vooijs, and E. Burstein, COMMD1 disrupts HIF- alpha/beta dimerization and inhibits human tumor cell invasion, J Clin Invest, 120 (2010) 2119-2130. [7] W. Biasio, T. Chang, C.J. McIntosh, and F.J. McDonald, Identification of Murr1 as a regulator of the human delta epithelial sodium channel, J Biol Chem, 279 (2004) 5429-5434. [8] Y. Ke, A.G. Butt, M. Swart, Y.F. Liu, and F.J. McDonald, COMMD1 downregulates the epithelial sodium channel through Nedd4-2, Am J Physiol Renal Physiol, 298 (2010) F1445-56. [9] T. Chang, Y. Ke, K. Ly, and F.J. McDonald, COMMD1 regulates the delta epithelial sodium channel (δENaC) through trafficking and ubiquitination, Biochem Biophys Res Commun, 411 (2011) 506-511. [10] L. Smith, P. Litman, and C.M. Liedtke, COMMD1 interacts with the COOH terminus of NKCC1 in Calu-3 airway epithelial cells to modulate NKCC1 ubiquitination, Am J Physiol Cell Physiol, 305 (2013) C133-46. [11] P. Bartuzi, M.H. Hofker, and B. van de Sluis, Tuning NF-kappaB activity: A touch of COMMD proteins, Biochim Biophys Acta, 1832 (2013) 2315-2321. [12] W.I. Vonk, P. Bartuzi, P. de Bie, N. Kloosterhuis, C.G. Wichers, R. Berger, S. Haywood, L.W. Klomp, C. Wijmenga, and B. van de Sluis, Liver-specific Commd1 knockout mice are susceptible to hepatic copper accumulation, PLoS One, 6 (2011) e29183. [13] G.N. Maine, X. Mao, C.M. Komarck, and E. Burstein, COMMD1 promotes the ubiquitination of NF-[kappa]B subunits through a cullin-containing ubiquitin ligase, EMBO J, 26 (2007) 436-447. [14] H. Geng, T. Wittwer, O. Dittrich-Breiholz, M. Kracht, and M.L. Schmitz, Phosphorylation of NF-[kappa] B p65 at Ser468 controls its COMMD1-dependent ubiquitination and target gene-specific proteasomal elimination, EMBO Rep, 10 (2009) 381-386. [15] T. Luedde and R.F. Schwabe, NF-[kappa]B in the liver - linking injury, fibrosis and hepatocellular carcinoma, Nat Rev Gastroenterol Hepatol, 8 (2011) 108-118. [16] J.K. Dowman, J.W. Tomlinson, and P.N. Newsome, Pathogenesis of non-alcoholic fatty liver disease, QJM, 103 (2010) 71-83. [17] P. Angulo, Nonalcoholic Fatty Liver Disease, N Engl J Med, 346 (2002) 1221-1231. [18] H. Tilg and A.R. Moschen, Insulin resistance, inflammation, and non-alcoholic fatty liver disease, Trends Endocrinol Metab, 19 (2008) 371-379. [19] D. Cai, M. Yuan, D.F. Frantz, P.A. Melendez, L. Hansen, J. Lee, and S.E. Shoelson, Local and systemic insulin resistance resulting from hepatic activation of IKK-[beta] and NF-[kappa]B, Nat Med, 11 (2005) 183-190. [20] E.J. Park, J.H. Lee, G.-Y. Yu, G. He, S.R. Ali, R.G. Holzer, C.H. Osterreicher, H. Takahashi, and M. Karin, Dietary and genetic obesity promote liver inflammation and tumorigenesis by enhancing IL-6 and TNF expression, Cell, 140 (2010) 197-208.

106 COMMD1 in liver inflammation and steatosis

[21] T. Luedde, N. Beraza, V. Kotsikoris, G. van Loo, A. Nenci, R. De Vos, T. Roskams, C. Trautwein, and M. Pasparakis, Deletion of NEMO/IKK[gamma] in liver parenchymal cells causes steatohepatitis and hepatocellular carcinoma, Cancer Cell, 11 (2007) 119-132. [22] C. Postic, M. Shiota, K.D. Niswender, T.L. Jetton, Y. Chen, J.M. Moates, K.D. Shelton, J. Lindner, A.D. Cherrington, and M.A. Magnuson, Dual roles for glucokinase in glucose homeostasis as determined by liver and pancreatic beta cell-specific gene knock-outs using Cre recombinase, J Biol Chem, 274 (1999) 305-315. [23] B.E. Clausen, C. Burkhardt, W. Reith, R. Renkawitz, and I. Förster, Conditional gene targeting in macrophages and granulocytes using LysMcre mice, Transgenic Res, 8 (1999) 265-277. [24] M. Aparicio-Vergara, P.P. Hommelberg, M. Schreurs, N. Gruben, R. Stienstra, R. Shiri-Sverdlov, N.J. Kloosterhuis, A. de Bruin, B. van de Sluis, D.P. Koonen, and M.H. Hofker, Tumor necrosis factor receptor 1 gain-of-function mutation aggravates nonalcoholic fatty liver disease but does not cause insulin resistance in a murine model, Hepatology, 57 (2013) 566-576. [25] M. Groeneweg, E. Kanters, M.N. Vergouwe, H. Duerink, G. Kraal, M.H. Hofker, and M.P. de Winther, Lipopolysaccharide-induced gene expression in murine macrophages is enhanced by prior exposure to oxLDL, J Lipid Res, 47 (2006) 2259-2267. [26] E.G. Bligh and W.J. Dyer, A rapid method of total lipid extraction and purification, Can J Biochem Physiol, 37 (1959) 911-7. [27] D.E. Kleiner, E.M. Brunt, M. Van Natta, C. Behling, M.J. Contos, O.W. Cummings, L.D. Ferrell, Y.-C. Liu, M.S. Torbenson, A. Unalp-Arida, M. Yeh, A.J. McCullough, and A.J. Sanyal, Design and validation of a histological scoring system for nonalcoholic fatty liver disease, Hepatology, 41 (2005) 1313-1321. [28] C.M. Weisend, J.A. Kundert, E.S. Suvorova, J.R. Prigge, and E.E. Schmidt, Cre activity in fetal albCre mouse hepatocytes: Utility for developmental studies, Genesis, 47 (2009) 789-792. [29] F. Marra, Nuclear factor-kappaB inhibition and non-alcoholic steatohepatitis: inflammation as a target for therapy, Gut, 57 (2008) 570-572. [30] N. Beraza, Y. Malato, S. Vander Borght, C. Liedtke, H.E. Wasmuth, M. Dreano, R. de Vos, T. Roskams, and C. Trautwein, Pharmacological IKK2 inhibition blocks liver steatosis and initiation of non-alcoholic 5 steatohepatitis, Gut, 57 (2008) 655-663. [31] P.S. Ribeiro, H. Cortez-Pinto, S. Sola, R.E. Castro, R.M. Ramalho, A. Baptista, M.C. Moura, M.E. Camilo, and C.M. Rodrigues, Hepatocyte apoptosis, expression of death receptors, and activation of NF-[kappa]B in the liver of nonalcoholic and alcoholic steatohepatitis patients, Am J Gastroenterol, 99 (2004) 1708-1717. [32] C.M. Lloyd, A.R. Phillips, G.J. Cooper, and P.R. Dunbar, Three-colour fluorescence immunohistochemistry reveals the diversity of cells staining for macrophage markers in murine spleen and liver, J Immunol Methods, 334 (2008) 70-81. [33] D.M. Dambach, L.M. Watson, K.R. Gray, S.K. Durham, and D.L. Laskin, Role of CCR2 in macrophage migration into the liver during acetaminophen-induced hepatotoxicity in the mouse, Hepatology, 35 (2002) 1093-1103. [34] D.A. Lepay, R.M. Steinman, C.F. Nathan, H.W. Murray, and Z.A. Cohn, Liver macrophages in murine listeriosis. Cell-mediated immunity is correlated with an influx of macrophages capable of generating reactive oxygen intermediates., J Exp Med, 161 (1985) 1503-1512. [35] P. de Bie, B. van de Sluis, L. Klomp, and C. Wijmenga, The Many Faces of the Copper Metabolism Protein MURR1/COMMD1, J Hered, 96 (2005) 803-811. [36] S. Xanthoulea, M. Pasparakis, S. Kousteni, C. Brakebusch, D. Wallach, J. Bauer, H. Lassmann, and G. Kollias, Tumor necrosis factor (TNF) receptor shedding controls thresholds of innate immune activation that balance opposing TNF functions in infectious and inflammatory diseases, J Exp Med, 200 (2004) 367-376. [37] B. Robaye, M. Mosselmans, W. Fiers, J.E. Dumont, and P. Galand, Tumor necrosis factor induces apoptosis (programmed cell death) in normal endothelial cells in vitro, Am J Pathol, 138 (1991) 447-453. [38] O. Micheau and J. Tschopp, Induction of TNF receptor I-mediated apoptosis via two sequential signaling complexes, Cell, 114 (2003) 181-190.

107 CHAPTER 5

[39] G. Baffy, Kupffer cells in non-alcoholic fatty liver disease: The emerging view, J Hepatol, 51 (2009) 212-223. [40] H. Li, Chan, P. Bartuzi, S.D. Melton, Weber, Ben-Shlomo, Raetz, Mao, Starokadomskyy, van Sommeren, Mokadem, Weisberg, H.-J. Westra, Esko, Metspalu, W.A. Faubion, Yarovinsky, M.H. Hofker, Wijmenga, Kracht, Franke, Aguirre, R.K. Weersma, Gluck, van de Sluis, and Burstein, Copper metabolism domain- containing 1 represses genes that promote inflammation and protects mice from colitis and colitis- associated cancer, Gastroenterology, 147 (2014) 184-195.e3. [41] R.G. Baker, M.S. Hayden, and S. Ghosh, NF-kappaB, inflammation, and metabolic disease, Cell Metab, 13 (2011) 11-22. [42] I. Locatelli, S. Sutti, M. Vacchiano, C. Bozzola, and E. Albano, NF-kappaB1 deficiency stimulates the progression of non-alcoholic steatohepatitis (NASH) in mice by promoting NKT-cell-mediated responses, Clin Sci (Lond), 124 (2013) 279-287. [43] G. Kanuri, A. Spruss, S. Wagnerberger, S.C. Bischoff, and I. Bergheim, Role of tumor necrosis factor alpha (TNFalpha) in the onset of fructose-induced nonalcoholic fatty liver disease in mice, J Nutr Biochem, 22 (2011) 527-534. [44] K.T. Uysal, S.M. Wiesbrock, M.W. Marino, and G.S. Hotamisligil, Protection from obesity-induced insulin resistance in mice lacking TNF-[alpha] function, Nature, 389 (1997) 610-614. [45] B.M. De Taeye, T. Novitskaya, O.P. McGuinness, L. Gleaves, M. Medda, J.W. Covington, and D.E. Vaughan, Macrophage TNF-alpha contributes to insulin resistance and hepatic steatosis in diet-induced obesity, Am J Physiol Endocrinol Metab, 293 (2007) E713-25. [46] Z. Li, S. Yang, H. Lin, J. Huang, P.A. Watkins, A.B. Moser, C. DeSimone, X.-y. Song, and A.M. Diehl, Probiotics and antibodies to TNF inhibit inflammatory activity and improve nonalcoholic fatty liver disease, Hepatology, 37 (2003) 343-350. [47] K. Tomita, G. Tamiya, S. Ando, K. Ohsumi, T. Chiyo, A. Mizutani, N. Kitamura, K. Toda, T. Kaneko, Y. Horie, J.-Y. Han, S. Kato, M. Shimoda, Y. Oike, M. Tomizawa, S. Makino, T. Ohkura, H. Saito, N. Kumagai, H. Nagata, H. Ishii, and T. Hibi, Tumour necrosis factor alpha signalling through activation of Kupffer cells plays an essential role in liver fibrosis of non-alcoholic steatohepatitis in mice, Gut, 55 (2006) 415-424. [48] S. Saccani, I. Marazzi, A.A. Beg, and G. Natoli, Degradation of promoter-bound p65/RelA is essential for the prompt termination of the nuclear factor [kappa]B response, J Exp Med, 200 (2004) 107-113. [49] L.-F. Chen, W. Fischle, E. Verdin, and W.C. Greene, Duration of nuclear NF-kappaB action regulated by reversible acetylation, Science, 293 (2001) 1653-1657. [50] A. Ryo, F. Suizu, Y. Yoshida, K. Perrem, Y.-C. Liou, G. Wulf, R. Rottapel, S. Yamaoka, and K.P. Lu, Regulation of NF-kappaB signaling by Pin1-dependent prolyl isomerization and ubiquitin-mediated proteolysis of p65/RelA, Mol Cell, 12 (2003) 1413-26. [51] C.-K. Ea and D. Baltimore, Regulation of NF-kappaB activity through lysine monomethylation of p65, Proc Natl Acad Sci USA, 106 (2009) 18972-18977. [52] M. Kracklauer and C. Schmidt, At the crossroads of SUMO and NF-kappaB, Mol Cancer, 2 (2003) 39. [53] M. Naumann and C. Scheidereit, Activation of NF-kappa B in vivo is regulated by multiple phosphorylations, EMBO J, 13 (1994) 4597-4607. [54] L. Drévillon, G. Tanguy, A. Hinzpeter, N. Arous, A. de de Becdelièvre, A. Aissat, A. Tarze, M. Goossens, and P. Fanen, COMMD1-mediated ubiquitination regulates CFTR trafficking, PLoS One, 6 (2011) e18334. [55] T.Y. Tao, F. Liu, L. Klomp, C. Wijmenga, and J.D. Gitlin, The copper toxicosis gene product Murr1 directly interacts with the Wilson disease protein, J Biol Chem, 278 (2003) 41593-96. [56] U.J. Tietge and A.K. Groen, Role the TICE?: Advancing the concept of transintestinal cholesterol excretion, Arterioscler Thromb Vasc Biol, 33 (2013) 1452-1453. [57] M. Amir and M.J. Czaja, Autophagy in nonalcoholic steatohepatitis, Expert Review of Gastroenterology & Hepatology, 5 (2014) 159-166. [58] R. Singh, S. Kaushik, Y. Wang, Y. Xiang, I. Novak, M. Komatsu, K. Tanaka, A.M. Cuervo, and M.J. Czaja, Autophagy regulates lipid metabolism, Nature, 458 (2009) 1131-1135.

108 COMMD1 in liver inflammation and steatosis

SUPPLEMENTARY TABLES

Table S1. qRT-PCR primer sequences.

Gene Forward 5’→3’ Reverse 5’→3’

p65 ACCGCTGCATCCACAGTT GGATGCGCTGACTGATAGC Il-1a AACCAAACTATATATCAGGATGTG ACGGGCTGGTCTTCTCCTTG Il-1b TGCAGCTGGAGAGTGTGG TGCTTGTGAGGTGCTGATG Mcp-1 GCTGGAGAGCTACAAGAGGATCA ACAGACCTCTCTCTTGAGCTTGGT Tnfa GTAGCCCACGTCGTAGCAAAC AGTTGGTTGTCTTTGAGATCCATG Icam ACTGCACGTGCTGTATGGTC CTGCAGGTCATCTTAGGAGATG Cd68 TGACCTGCTCTCTCTAAGGCTACA TCACGGTTGCAAGAGAAACATG Cd11b TCAGAGAATGTCCTCAGCAG TGAGACAAACTCCTTCATCTTC A20 (Tnfaip3) GCTCTGAAAACCAATGGTGATG CCGAGTGTCTGTCTCCTTAAG Ikbα (Nfkbia) TGGAAGTCATTGGTCAGGTGAA CAGAAGTGCCTCAGCAATTCCT Ccl5 GTGCCCACGTCAAGGAGTAT CCCACTTCTTCTCTGGGTTG Ciap-1 GACCGTCAATGATATTGTCTCAG TGGCCTCAAGAAGATTATCCAG Ciap-2 AGGAGGAGGAGTCAGATGATC CTGAATGAGGTTGCTGCAGTG Bfl-1 AGATTGCCCTGGATGTATGTG CTCTCTGGTCCGTAGTGTTAC Traf-1 TGCGACTCATGGAGGAGGCATC TGAGCCATCCCCGTTCAGGTAC 5 Cyclophilin A TTCCTCCTTTCACAGAATTATTCCA CCGCCAGTGCCATTATGG Commd1 CGCAGAACGCCTTTCACGG ATGCAATAGACTTGAGAAGTCC Commd2 GCGGCTAGATGTACAGCTTG GGTCTGTCTGCAAGAAATGAG Commd3 GACCAACCAACTTCATAAGATG CCCACCAAGTCCTGTAACTG Commd4 AGCCTGTGCCGCTGTTACG GGCTCCTCCACAGAATGAAG Commd5 AGCTTCCTCCAGGCTACTGTG GCTGTGACTGTCAGTTGGATG Commd6 GGTCACGGGCCAGCTTATAG GAGTGATCTGCCACCTTCAG Commd7 TCCTACTGGTTCCAAATGGTG TTTCTCCTCGCTAAGACCTAG Commd8 AGGAGTTACAGAGTCTGATCAG ACGGTGCAGCACTGAAATCTG Commd9 CCTCCTCTGACAACATCAGC GGAGGGTTTCTCTCCACAC Commd10 TGCAACTGGGAGTGAGCAAG AGTCCAGCTGCGCTTGTATG p50 CATGGCAGACGATGATCCCTACG ATTTGAAGGTATGGGCCATCTGTTGA p100 AGCAGTGTTCAGAGTTGGGAGTGT GGATCATAATCTCCATCATGTTCTTCTT RelB GCCGAATCAACAAGGAGAGCG CATCAGCTTGAGAGAAGTCGGCA cRel GAGCCATGGCCTCGAGTGGA GTCTGTGCTGCGCTCCCCTG

109 CHAPTER 5

FigureSupp S1.lementary Figures

A. 3 WT (Chow) Commd1 ∆Hep (Chow)

n WT (12wks HFC)

o ∆Hep i Commd1 (12wks HFC) s

s 2 e

r ** p x E

e v i

t 1 a l e R

0 p50 p100 RelB cRel

B. WT (Chow) Commd1 ∆Hep (Chow) 2.0 WT (12wks HFC) Commd1∆Hep (12wks HFC) n o i

s 1.5 s e r p x E 1.0 e v i t a l e

R 0.5

0.0 Commd1 Commd2 Commd3 Commd4 Commd5 Commd6 Commd7 Commd8 Commd9 Commd10

Figure S1. Hepatic Commd1 deficiency does not affect the gene expression of the NF-κB subunits or Commd family members. Relative mRNA expression of (A) NF-κB subunits and (B) Commd family members in livers of WT and Commd1∆Hep mice, as determined by quantitative RT-PCR. All values per group are shown as mean ± SEM. Statistical significance was determined versus WT control mice on each diet: **P<0.01.

Figure S2.

A. 1.5 B. 1.5 WT WT ∆Mye ∆Mye Commd1 n n Commd1 o o i i s s s s e e 1.0 1.0 r r p p x x E E

e e v v i i t t 0.5 0.5 a a l l e e *** *** R R

0.0 0.0

Figure S2. Commd1∆Mye mice show efficient depletion of Commd1 in macrophages. Relative mRNA expression of Commd1 in (A) peritoneal and (B) bone marrow-derived macrophages of WT (n=3) and Commd1∆Mye (n=3) mice. Statistical significance was determined versus WT control mice: **P<0.01, ***P<0.001

110 COMMD1 in liver inflammation and steatosis Figure S3.

5 WT ∆Hep Commd1 4 D O

3 e v i t a

l 2 e R 1

0 PBS LPS

Figure S3. Depletion of hepatic Commd1 does not effect NF-κB activity. Binding of nuclear NF-κB to the DNA was assessed in livers of WT (n=4) and Commd1∆Hep (n=4) mice after 6 h of LPS (10 mg/kg) administration. Statistical significance was determined versus WT mice in either control (PBS) or LPS-stimulated group: *P<0.05.

5

111

CHAPTER 6

Loss of hepatocyte COMMD1 results in increased levels of circulating low-density lipoprotein cholesterol

Bartuzi P1, Dekker DC1, Favier RP4, Li H6, Fieten H4, Brufau G2, Huijkman N1, Levels JH5, van Ijzendoorn SCD3, Groen AK2, Kuiven- hoven JA1, Horton JD7, Burstein E6, Hofker MH1, van de Sluis B1

1Molecular Genetics section and 2Department of Pediatrics, Center for Liver Digestive and Metabolic Diseases, and 3Department of Cell Biology, Membrane Cell Biology section, Uni- versity Medical Center Groningen, University of Groningen, Groningen, the Netherlands, 4Department of Clinical Sciences of Companion Animals, Faculty of Veterinary Medicine, Utrecht University, Utrecht, the Netherlands, 5Department of Experimental Vascular Medi- cine, Academic Medical Center, University of Amsterdam, Amsterdam, the Netherlands, 6Department of Internal Medicine and 7Department of Molecular Genetics, University of Texas Southwestern Medical Center, Dallas, Texas, U.S.A.

In preparation Abstract

An elevated level of circulating low-density lipoprotein (LDL) is a key risk factor for various cardiovascular diseases, and levels of LDL are tightly controlled by the hepatic LDL receptor (LDLR). Although the general concept by which plasma LDL levels are kept in control is known, the exact mechanism regulating the LDLR function is still poorly understood. Here we identified COMMD1 as a new gene regulating cholesterol homeostasis. Absence of hepatic COMMD1 increases the plasma levels of the atherogenic LDL lipoprotein in mice and dogs. COMMD1 physically associates with the LDLR and facilitates the cellular uptake of LDL. Depletion of Commd1 markedly impairs the proprotein convertase subtilisin/kexin type 9-mediated LDLR proteolysis, suggesting that COMMD1 coordinates the intracellular sorting of the LDLR. Since COMMD1 was initially reported to mediate biliary copper excretion, our data point to COMMD1 as a general adaptor protein in the intracellular sorting of various cargos, including the LDLR. COMMD1 and LDLR trafficking Introduction

The low-density lipoprotein receptor (LDLR) in the liver plays a pivotal role in controlling the level of circulating low-density lipoprotein (LDL) [1, 2]. A high level of LDL is a major risk factor for the development of atherosclerosis, and most of the knowledge about the mechanism regulating LDL levels has been obtained from patients suffering from familial hypercholesterolemia (FH). FH is a genetic disorder characterized by elevated plasma levels of LDL [3, 4]. It is frequently caused by mutations in LDLR leading to impaired clearance of LDL from the bloodstream. Most common are heterozygous, mild mutations occurring with an estimated frequency of 1/500 in the general population [2, 4, 5]. The prevalence of FH patients with homozygous LDLR mutations is much lower (1 in a million), and these patients generally have a more severe phenotype [5]. The variations in LDLR are categorized depending on their outcome. The outcomes include no LDLR synthesis or production of a receptor defective in either LDL-cholesterol (LDL-c) binding, receptor internalization or recycling, or failing to move the receptor from the endoplasmic reticulum (ER) to the Golgi apparatus [4, 5]. In normal conditions, upon maturation, LDLR is transported to the cell surface where it binds to LDL-c. The LDLR-LDL-c complex is internalized via clathrin-coated pits, and directed to the early and then to the late endosomal compartments, where acidic pH triggers dissociation of LDL-c from its receptor. LDL-c is subsequently targeted to the lysosomes for degradation; the LDL receptor is either recycled back to the membrane or degraded by the lysosomes [6]. The lysosomal degradation of LDLR is mediated by proprotein convertase subtilisin/ kexin type 9 (PCSK9) [7-10]. Gain-of-function mutations in PCSK9 are associated with hypercholesterolemia [11] caused by increased LDLR proteolysis mediated by PCSK9 [7, 12]. Apart from PCSK9, the autosomal recessive hypercholesterolemia protein (ARH) was also shown to be involved in the control of LDLR signaling and trafficking. Patients with ARH 6 mutations show many clinical similarities with FH patients. ARH binds to the cytosolic domain of LDLR and acts as an adaptor protein to regulate the endocytosis of LDLR, which is markedly impaired in ARH patients [13-15]. Although additional proteins, such as Idol and β-Arrestin2, have been identified in the LDLR pathway [16, 17], the exact mechanism by which the intracellular trafficking of the LDLR is regulated is still not completely understood. In this study, we identified COMMD1 as a novel gene reducing the plasma LDL-c levels in mice and dogs. COMMD1 belongs to the COMMD family of proteins [18], and loss of COMMD1 has initially been associated with progressive hepatic copper accumulation in dogs, which we recently reproduced in mice [19-21]. Several studies indicate that COMMD1 regulates biliary copper excretion via the copper-transporting protein ATP7B [21-24]. Although the exact mechanism is still unclear, it has been postulated that COMMD1 might be involved in the retrograde trafficking or the proteasomal degradation of ATP7B [23, 25]. Here, we show that COMMD1 interacts with LDLR to mediate the cellular uptake of LDL, and that COMMD1 deficiency elevates the levels of plasma LDL-c in mice and dogs.

115 CHAPTER 6 RESULTS Hepatic Commd1 knockout mice and Commd1-deficient dogs are hypercholesterolemic

In order to better understand the biological role of Commd1 in the liver, we identified the characteristics of the liver-specific Commd1 knockout mice (Commd1∆Hep) [21] with regard to their hepatic and plasma cholesterol and triglyceride concentrations. We investigated both chow-fed (Supplementary Table 1) and high-fat high-cholesterol (HFC, cholesterol 0.2%)-fed (Supplementary Table 2) groups of mice (n=6-8). As shown previously [21], body weight and hepatic copper levels were not altered between Commd1∆Hep mice and littermate Commd1loxP/loxP mice, which from now on are referred to as wild-type (WT) mice. Hepatic cholesterol and triglyceride (TG) concentrations were also unaffected. Remarkably, however, the plasma cholesterol levels in chow-fed Commd1∆Hep mice were approximately 35% higher and in HFC-fed Commd1∆Hep mice approximately 39% higher than those of WT mice (Fig. 1a). The plasma triglyceride levels remained unchanged (Fig. 1b). A significant increase in plasma cholesterol was also seen in Commd1∆Hep mice at ten weeks of age (Supplementary Fig. 1a). Of note, we observed no differences in cholesterol levels between WT and transgenic mice expressing the Cre recombinase in hepatocytes (Alb-Cre), which excludes the possibility that exotic expression of Cre recombinase in the liver affects cholesterol metabolism (Supplementary Fig. 1b). Next, we evaluated whether COMMD1 deficiency in dogs [19] also affects the level of circulating cholesterol. We measured the plasma total cholesterol levels in COMMD1-/- dogs and in COMMD1+/- littermates (aged approximately 3-3.5 yrs) [20] (Fig. 1c). COMMD1-/- dogs showed a 50% increase in plasma total cholesterol compared to control littermates, but their plasma TG levels remained unaffected (Fig. 1d). Figure 1.

a b c d e

WT ∆ WT 10 Commd1 Hep 0.6 Commd1∆Hep 8 1.5 6

] ] l

*** o M ] M r

8 ] * e m m

6 M t [ [ M s

l l 1.0

0.4 ] m 4 e [ m l o o

6 [ r r M

o s e e

4 h t t m G G [ s s

*** C 4 T T

e e l l l 0.2 0.5 2 a o o t

h 2 h 2 o C C T 0 0.0 0 0.0 0 Chow HFC Chow HFC COMMD1 +/- -/- COMMD1 +/- -/- Labrador unaff. aff.

Figure 1. Hepatic Commd1 knockout mice and Commd1-/- dogs are hypercholesterolemic. (a) Plasma total cholesterol and (b) triglyceride (TG) levels of hepatic Commd1 knockout mice fed chow or a high-fat high-cholesterol (HFC) diet for 20 weeks. (c) Plasma total cholesterol and (d) TG levels of dogs heterozygous (+/-) or homozygous (-/-) for a loss-of-function mutation in COMMD1. (e) Plasma total cholesterol in two groups of Labrador retrievers: copper toxicosis-unaffected (unaff.) and affected (aff.). Group averages are plotted with SEM error. Significance in (a) and (b) was tested against a wild-type control group on each diet. Significance in (c) and (d) was tested against COMMD1+/- control group. Significance in (e) was tested against the unaffected group. *P<0.05, **P<0.01, ***P<0.001.

116 COMMD1 and LDLR trafficking

Despite the fact that high copper is linked to reduced levels of circulating cholesterol, possibly due to a decrease in Vldl synthesis and secretion [26], we evaluated the effect of progressive copper accumulation in the liver on plasma cholesterol levels in dogs. As a model we studied Labrador retrievers affected with copper toxicosis (Supplementary Fig. 2b). Similar to Bedlington terriers (Supplementary Fig. 2a), severe hepatic copper accumulation has been described in Labrador retrievers and although the mutation underlying copper toxicosis in Labrador retrievers is unknown, COMMD1 has been excluded as the causal gene [27-29]. Plasma total cholesterol in affected Labrador retrievers was similar to unaffected Labrador retrievers (aged ~4.5 yrs.) (Fig. 1e), excluding the possible causality between hepatic copper accumulation and elevated circulating cholesterol.

Circulating LDL-c levels are mediated by COMMD1

We then determined the lipoprotein profiles in pooled plasma samples of WT and Commd1∆Hep mice (n=6-8) fed either a chow (Fig. 2a) or HFC diet (Fig. 2b) for 20 weeks. Lipoproteins from plasma were separated by means of fast-performance liquid chromatography (FPLC). In Commd1∆Hep mice we found increased levels of Ldl-c (Fig. 2a,b), a lipoprotein that is normally present in mouse plasma in very low concentrations, whereas the high-density lipoprotein cholesterol (Hdl-c) is the most prevalent circulating cholesterol in mice. Detailed quantification of the different cholesterol forms demonstrated that the increase in the total cholesterol levels was mainly due to increase in Ldl-c (Supplementary Fig. 3a,b). To confirm that the isolated fractions correspond to Ldl and Hdl, we performed an immunoblot analysis to detect the apolipoproteins ApoB100 and ApoA1 (Fig. 2c,d), the apolipoproteins associated with Ldl and Hdl, respectively, and we also determined the triglyceride content in each fraction (Supplementary Fig. 3c,d). 6 The distribution of cholesterol across the lipoprotein fractions of COMMD1-/- and COMMD1+/- dogs (Fig. 3a) as well as of the unaffected and affected Labrador Retrievers (Fig. 3b) was also determined. Cholesterol was mainly present in VLDL and LDL particles in COMMD1-/- dogs, whereas cholesterol in their littermates (COMMD1+/- dogs) and Labrador retrievers (unaffected and affected dogs) was predominately detected in the HDL fraction. Similar to mice, due to the lack of cholesteryl ester transfer protein (CETP) activity, the most prevalent circulating cholesterol in dogs is HDL [30]. Together, these data indicate that hepatic Commd1 is essential to control plasma Ldl-c levels in mammals.

Vldl-TG production is unaffected by ablation of Commd1 in hepatocytes

To evaluate whether the elevated plasma Ldl-c levels in Commd1∆Hep mice result from an increased very low-density lipoprotein (Vldl) production and secretion, we assessed the changes in plasma Vldl-TG after intraperitoneal injection of Poloxamer-407. The production of Vldl-TG was not altered between Commd1∆Hep and WT mice (Fig. 4a, b).

117 CHAPTER 6 Figure 2.

a b 0.5 0.5 WT WT ∆ ∆Hep Commd1 Hep Commd1 ] 0.4 ]

M 0.4 M m m [ [

l l o o r 0.3 r 0.3 e e t t s s e e l l o o h 0.2 h 0.2 C C

0.1 0.1

0.0 0.0 5 10 15 20 25 30 35fraction 5 10 15 20 25 30 35fraction VLDL LDL HDL VLDL LDL HDL

c d

fraction 13 14 15 16 17 18 19 20 21 22 23 24 25 26 fraction 13 14 15 16 17 18 19 20 21 22 23 24 25 26 ApoB100 ApoB100 WT WT ApoA1 ApoA1

ApoB100 ApoB100 ∆ Commd1 Hep Commd1 ∆Hep ApoA1 ApoA1

Figure 2. Lipoprotein composition is altered in hepatic Commd1-deficient mice. Pooled plasma samples of each experimental group of mice fed either (a) chow or (b) HFC diet were separated using FPLC gel filtration. 50 fractions were collected from each separation. Total cholesterol content was determined and lipoprotein profile was plotted. (c) Fractions #13-26 containing cholesterol were collected through FPLC from each experimental group, loaded on an SDS polyacrylamide gel andFigure blotted 3. against ApoA1 and ApoB100 lipoproteins. The chow group and (d) HFC group are shown.

a 0.3 Commd1 +/- Commd1 -/- ] M m [

l 0.2 o r e t s e l o h

C 0.1 Figure 3. COMMD1 deficiency in dogs results in aberrant distribution 0.0 5 10 15 20 25 30 35 fraction of cholesterol among the different VLDL LDL HDL lipoproteins. Pooled plasma samples b of each experimental group of dogs 0.3 Labrador unaff. were separated using FPLC gel filtration. Labrador aff.

] 50 fractions were collected from each M

m separation. Total cholesterol content [

l 0.2 o

r was determined and lipoprotein profile e t s

e was plotted. (a) FPLC lipoprotein l o

h profile of dogs heterozygous (+/-)

C 0.1 or homozygous (-/-) for a loss-of-function mutation in COMMD1. (b) FPLC 0.0 cholesterol profile of copper toxicosis 5 10 15 20 25 30 35 fraction in unaffected (unaff.) and affected (aff.) VLDL LDL HDL Labrador retrievers.

118 COMMD1 and LDLR trafficking

Since Ldl-c is mainly cleared from the bloodstream via Ldlr-mediated endocytosis in the liver, we investigated whether hepatic Commd1 deficiency affects the Ldlr levels. No clear differences in hepatic Ldlr mRNA or protein levels were observed. In addition, no changes were found in Arh or Lrp (a member of the LDLR family) levels (Fig. 4c). Furthermore, hepatic mRNA expression of genes involved in cholesterol uptake, synthesis or efflux were unaltered (Fig. 4d). Together, these results exclude the possibility that the increased plasma Ldl-c levels in hepatic Commd1-deficient mice are caused by differences in Vldl synthesis andFigure secretion, 4. or by an aberrant expression of genes/proteins involved in LDL homeostasis.

a b c WT Commd1 ∆Hep 30 300 WT WT Ldlr e ∆ Hep t ∆Hep 25 Commd1 a Commd1 r ]

] n W o

M Lrp-1 i B t

20 200 m c [ g

u k d G Arh / o

T 15 r

h p a

/ l m G o s 10 100 Tubulin T a m - l L µ P [ 5 D L V 0 0 0 30 60 120 240 Time [min.]

d

1.8 WT n Commd1 ∆Hep

s i o 1.4 p r e

e E x 1.0 G e n 0.6 t i v e

R e l a 0.2 Ldlr Srb-1 Lrp1 Hmgcr Srebp2 Abca1 Abcg5 Abcg8 6 uptake synthesis efflux

Figure 4. VLDL-TG production and hepatic expression of Ldlr and other lipid-related genes are not affected by the loss of hepatic Commd1. (a) After intraperitoneal injection of poloxamer 407, blood was taken via orbita puncture at time points 0, 30, 60, 120 and 240 min. TG concentration was determined and plotted against time. (b) VLDL-TG production rate was calculated based on the TG concentration curve and corrected for the total time of experiment (4 h) and body weight of mice. (c) Livers of chow-fed mice were homogenized and 30 μg of protein was subjected to immunoblot analysis. Levels of Ldlr, Lrp-1, Arh and Tubulin were determined. Three representative samples from WT and Commd1∆Hep mice are shown. (d) Hepatic mRNA levels were analyzed in chow fed WT and Commd1∆Hep mice and presented relative to the WT control group. Group average values are presented with SEM. *P<0.05.

Plasma levels of LDL-c are determined by an accurate intracellular trafficking of the LDLR, and since COMMD1 mediates the trafficking of various transmembrane proteins, we determined the relative subcellular distribution of Commd1 in relation to Ldlr, Arh

119 CHAPTER 6

and endocytic markers by performing a continuous sucrose gradient fractionation. The presence of Commd1, Ldlr, Arh and the endocytic proteins in fractions of WT mouse liver was determined by immunoblot analysis. Ldlr appeared in the middle and high- density fractions, whereas Commd1 was present in the low and middle density fractions (Fig. 5a). Commd1 and Ldlr were both detected in the same middle-density fractions. Furthermore, Commd1 co-sedimented with Arh, and the early endosomal marker, Eea-1. As demonstrated previously [14], only limited co-sedimentation with Ldlr and Arh was seen. A high percentage of Commd1 was also detected in the same fractions as the Rab11, a marker for the recycling endosomes [31]. Figure 5.

a b Flag-LDLR + + COMMD1-GST - + 10% 40% Sucrose * * * GST + - Ldlr PD:GSH Flag-LDLR

Commd1 Flag-LDLR

Rab11 COMMD1-GST

Eea-1 Input

Arh GST

c d e Y807A GST GST-LDLRct GST COMMD1-GST 1-118-GST 119-190-GST GST-LDLRct Flag-LDLR - + Flag-LDLR + + + + Ha-COMMD1 + + +

IP:Flag COMMD1 PD:GSH Flag-LDLR PD:GSH

Flag-LDLR Flag-LDLR Input

COMMD1 Input Input GST

Figure 5. COMMD1 is associated with LDLR. (a) Liver of WT chow fed mouse was homogenized and loaded on a continuous 10-40% sucrose gradient. Fractions were separated by ultracentrifugation and immunoblotted against Commd1, together with different endosomal and LDLR trafficking markers: Ldlr, Arh, Eea-1, Rab11. The figure represents the results of four independent experiments. * Commd1 and Ldlr were both detected in the same middle-density fractions (b) HEK293T cells were transfected with constructs expressing Flag-LDLR with either COMMD1-GST or GST alone. Interaction with COMMD1 was detected via pull-down using glutathione sepharose beads. (c) HEK293T cells were transfected with Flag-LDLR vector and interaction with endogenous COMMD1 was detected using immunoprecipitation with rabbit anti-Flag antibody. (d) HEK293T cells were transfected with Flag-LDLR vector together with either GST alone, COMDM1-GST, 1-118-GST (GST-tagged COMMD domain) or 119-190-GST (GST-tagged N-terminal region of COMMD1). Interaction with LDLR was detected by pull-down using glutathione sepharose beads. (e) HEK293T cells were transfected with Ha-COMMD1 construct together with GST alone, GST-LDLRct ( GST-tagged cytosolic domain of LDLR) or GST-LDLRct Y807A (GST-tagged mutated cytosolic domain of LDLR). Interaction with COMMD1 was detected through pull-down with glutathione sepharose beads.

120 COMMD1 and LDLR trafficking

Commd1 is physically associated with the LDLR

Since Commd1 co-sediments with the Ldlr, we determined whether COMMD1 associates with the LDLR. HEK293T cells were transiently transfected with constructs expressing LDLR-Flag together with either COMMD1 fused with glutathione S-transferase (GST) or GST alone (Fig. 5b). Cell lysates were incubated with glutathione (GSH) sepharose beads, and the presence of co-precipitated LDLR was detected by immunoblot analysis. A clear association between COMMD1 and LDLR was observed. This interaction was confirmed by using cell lysates of LDLR-Flag-transfected HEK293T cells, where endogenous COMMD1 was evidently present in the LDLR-Flag precipitates (Fig. 5c). To identify which region of COMMD1 is necessary for the formation of the COMMD1-LDLR protein complex, we transfected HEK293T cells with vectors co-expressing LDLR-Flag either with full length COMMD1, its N-terminal region outside of the COMMD domain (1-118-GST), or its C-terminal COMM domain (119-190-GST) (Fig. 5d). The interaction was only observed with the full-length COMMD1 protein or with the fragment encoding the COMM domain. Intracellular transport of LDLR depends on various signals in its cytoplasmic tail, including the NPXY motif. Mutation of tyrosine (Y807) in the NPXY motif affects the binding of ARH, β-arrestin and clathrin, all of which are involved in LDLR trafficking. To determine whether the NPXY motif is also important for LDLR-COMMD1 association, we performed a GST-pull down assay with cell lysates expressing either the wild-type LDLR cytoplasmic tail fused with GST (GST-LDLRct) or mutant LDLRct Y807A (Fig. 5e). Substitution of tyrosine with alanine (Y807A) markedly abrogated the binding between LDLRct and COMMD1. Together, these results suggest that COMMD1 associates with the LDLR and that its binding with the LDLR depends on the NPXY motif in the cytoplasmic tail of the LDLR. In line with previous studies (reviewed by Fedoseienko et al. [32]), the above data suggest that COMMD1 is associated with endocytic compartments. 6

Commd1 deficiency in mouse embryonic fibroblasts moderates LDL uptake

Next, we investigated the role of Commd1 in the cellular uptake of LDL using Commd1 knockout (KO) mouse embryonic fibroblasts (MEFs) [24] (Fig. 6a). Fluorescently-labeled LDL (Dil LDL) was added to the medium, and cells were incubated at 40 C for 1 h in order to increase the binding of Dil LDL to the LDL receptor. Next, we induced endocytosis by placing the cells at 370 C for 5 min. Despite the increased mRNA (Fig. 6b) and protein expression of Ldlr (Fig. 6a) in Commd1 KO MEFs, we observed an approximately 40% decrease in LDL uptake in Commd1 KO MEFs compared to WT cells (Fig. 6c). To assess whether Commd1 deficiency specifically affects LDL uptake, we also measured the uptake of labeled transferrin (Tf) by the Tf receptor (TfR). The intracellular trafficking of TfR shows many similarities to LDLR regulation mechanistically; both receptor cargos are internalized

121 CHAPTER 6

by clathrin-mediated endocytosis [33]. No differences in transferrin uptake were observed betweenFigure 6. Commd1 KO and WT cells (Fig. 6c), suggesting that Commd1 mediates specifically the uptake of LDL in MEFs.

a b c

WT KO n 20 150 WT o s i l

* l KO s e s Ldlr c

15 e T *** r e 100 v p W i

t x i o s E 10 t

Ldlr o

Commd1 . e f p

e v

f 50 i r t 5 o

a l %

Tubulin e

R 0 0 WT KO DilLDL Transferrin - Alexa633 d e WT KO PCSK9 0h 4h 8h 0h 4h 8h 100 ]

h 2

0 80 R = 0.96

Ldlr y =

r Slope = -1.51 t T

e t

a 60 m

o T β t

-actin i s W

40 n f e o 2 D R = 0.93

% 20 WT [ Slope = -9.37 KO 0 0 4 8 Time [h]

Figure 6. LDL uptake and LDLR degradation by PCSK9 is impaired in COMMD1-deficient MEFs. (a) Ldlr and Commd1 levels in WT and Commd1-knockout (KO) MEFs. (b) Gene expression of Ldlr in KO MEFs relative to WT cells. (c) In vitro uptake assay. Dil-labeled LDL [5 μg/ml] or Alexa-633-labeled Transferrin [5 μg/ml] was added to the serum-depleted medium and incubated with MEFs at 4°C for 1h and subsequently at 37°C for 5 min.. Dil-labeled LDL uptake was measured by FACS analysis. The percentage of positive KO cells was plotted against values from WT cells. Data represent results of four independent uptake experiments. (d) MEFs were incubated with human recombinant PCSK9 [5 μg/ml] in a serum depleted medium for 0, 4, 8 h. Cells were lysed and subjected to immunoblot analysis. The presented blots are representative of four independent experiments. (e) Quantification of Ldlr protein optical density corrected for optical density of β-actin in PCSK9 assay. Values plotted are calculated as a percentage of density at T = 0. All group averages are presented with SEM. *P<0.05, **P<0.01, ***P<0.001.

PCSK9-mediated LDLR degradation is impaired by Commd1 deficiency

Degradation of the LDLR induced by extracellular PCSK9 depends on LDLR internalization and its subsequent routing to the lysosomes. To gain more insight into the mechanism of how COMMD1 mediates the LDLR function, we assessed the consequences of Commd1 deficiency on PCSK9-mediated LDLR proteolysis [7, 8]. For this, we incubated WT and Commd1 KO MEFs with recombinant PCSK9 for 4 h and 8 h and determined the total Ldlr levels by immunoblot analysis. Recombinant PCSK9 clearly induced the degradation of Ldlr in WT cells. However, upon depletion of Commd1, the PCSK9-mediated

122 COMMD1 and LDLR trafficking proteolysis was markedly decreased (Fig. 6 d,e). These data suggest that COMMD1 participates in the intracellular sorting of LDLR.

DISCUSSION

An elevated level of circulating LDL cholesterol is a high risk factor for the development of cardiovascular diseases, including atherosclerosis. Despite broad knowledge about the regulation of cholesterol homeostasis, there are still many patients with high plasma cholesterol levels with unknown etiology, suggesting the presence of additional, unknown modulators of cholesterol homeostasis. Here we identifiedCOMMD1 as a novel gene regulating the levels of circulating LDL cholesterol. Hepatic Commd1 knockout mice and Commd1-deficient dogs are both hypercholesterolemic. Although in both species the main circulating lipoprotein is HDL, it was either Ldl, or VLDL/LDL that was primarily increased in these animal models, respectively. Our data suggest that COMMD1 modulates the plasma LDL levels via the LDLR; this is supported by several observations. First, we excluded the possibility that elevated plasma LDL-c level was caused by increased VLDL synthesis and secretion. Second, COMMD1 physically associates with the LDLR, which is consistent with a subset of Commd1 being co-sedimented with Ldlr. Third, ablation of Commd1 in MEFs reduces the uptake of labeled LDL, and finally, absence of Commd1 impairs PCSK9-mediated proteolysis of the Ldlr. Thus, it appears that COMMD1 mediates the intracellular trafficking of the LDLR, although the mechanism remains elusive. These results are in line with previous findings on the biological function of COMMD1, which show that it modulates the biliary copper excretion via the copper transporting protein ATP7B [19, 21, 23, 34, 35]. COMMD1 physically associates with ATP7B. 6 Under basal conditions, ATP7B is localized in the trans-Golgi network (TGN), but it redistributes to cytoplasmic vesicles when cells are exposed to high copper levels, and cycles back to the TGN when copper returns to normal physiological levels. Miyayama and colleagues [25] demonstrated that the loss of COMMD1 affects the retrograde transport of ATP7B back to the TGN in mouse hepatoma cells. However, another study suggested that COMMD1 promotes the proteolysis of misfolded ATP7B protein [23], but the latter observation could not be confirmed in vivo [21]. COMMD1 also coordinates the subcellular localization of several other transmembrane proteins, such as the epithelial sodium channel ENaC, Na-K-2Cl cotransporter NKCC1, and the cystic fibrosis transmembrane conductance regulator CFTR [36-40]. COMMD1 promotes the expression of CFTR and NKCC1 at the plasma membrane, but it reduces the level of δENaC at the cell surface, and targets δENaC to recycling endosomes. In all pathways a correlation between COMMD1 and the level of ubiquitination of its clients, suggesting that COMMD1 might be involved in a ubiquitin-dependent protein sorting.

123 CHAPTER 6

In line with our results, COMMD1 colocalizes with various cellular compartments of the sorting machinery, such as early, late and recycling endosomes, and lysosomes [39-41]. Moreover, COMMD1 interacts with phosphorylated phosphatidylinositols,

in particular with the phosphatidylinositol 4,5-bisphosphate (PtdIns(4,5)P2) [41]. PtdIns(4,5)P2 is a membrane-anchoring molecule for vesicular transport, which interacts with clathrin, ARH, and Dab2. All proteins bind to LDLR, and facilitate the internalization of LDLR [42-44]. Therefore, it is tempting to speculate that COMMD1 is an adaptor protein and participates in a dynamic network of proteins to sort the LDLR to the correct vesicular cellular compartment. Together, our study has identified COMMD1 as a novel player in LDL cholesterol homeostasis. Our results and existing data on the biological role of Commd1 in vesicular trafficking indicate that COMMD1 facilitates the intracellular transport of LDLR. This discovery can lead to a better understanding of the molecular mechanism by which the LDLR is regulated, and possibly help with the development of new therapies to lower circulating cholesterol and reduce atherosclerosis. Furthermore, the regulatory function of COMMD1 in intracellular trafficking of transmembrane proteins appears to hold true for several pathways. Our findings are therefore relevant to discovering the general mechanistic details of how COMMD1 sorts its clients.

METHODS Animals

Hepatocyte-specific Commd1 knockout mice (Commd1∆Hep) [21] were backcrossed for more than 8 generations in a C57BL/6J background. Ldl receptor-deficient mice (Ldlr-/-) were purchased from The Jackson Laboratory (Bar Harbor, USA, stock number 002207). All mice were individually housed males, fed ad libitum with either standard rodent chow diet (RMH-B, AB Diets, the Netherlands) or, starting at 8-9 weeks of age, a high-fat, high- cholesterol (HFC) diet (45% calories from butter fat) containing 0.2% cholesterol (SAFE Diets), n=6-8. HFC feeding lasted for 20 weeks. Mice were sacrificed following a 4-hour morning fasting period. Tissues for mRNA and protein expression analysis were snap- frozen in liquid nitrogen and stored at -800 C until further analysis. Blood was drawn by means of heart puncture, and plasma was isolated by centrifugation at 3000 rpm for 10 min. at 40 C. All animal studies were approved by either the Institutional Animal Care and Use Committee of the University of Groningen (Groningen, the Netherlands) or the Care and Use Committee of the University of Texas Southwestern Medical Center (Texas, USA). All canine samples originated from an earlier study [29].

Plasma clearance of [125I]LDL

Mouse LDL was prepared and radiolabeled with sodium 125I, Clearance of 125I-labeled apoB (apoB48 plus apoB100) from plasma of WT and Commd1∆Hep mice was measured at the indicated time. All procedures were performed as described before [45].

124 COMMD1 and LDLR trafficking

In vivo VLDL-TG production

The experiment was performed on 10-13 week old chow-fed mice. After a 4 h morning fast, animals were intraperitonealy injected with poloxamer 407 (BASF, Ludwigshaven, Germany) solution in saline (1 g/kg body weight). Blood was drawn by retro-orbital puncture at the following time points: 0, 30, 60, 120, 240 min. Collected samples were used for TG determination and calculation of VLDL-TG production rate.

Hepatic lipid extraction

Liver homogenates prepared as 15% (w/v) solutions in PBS were subjected to lipid extraction according to the Bligh & Dyer method [46]. Obtained samples were used for further determination of cholesterol and TG content.

Cholesterol and triglyceride analysis in plasma and liver homogenates

Total cholesterol (TC) levels were determined using colorimetric assay (11489232, Roche Molecular Biochemicals, Almere, the Netherlands) with cholesterol standard FS (DiaSys Diagnostic Systems Gmbh, Holzheim, Germany) as a reference. Triglyceride (TG) levels were determined using Trig/GB kit (1187771, Roche Molecular Biochemicals) with Roche Precimat Glycerol standard (16658800) as a reference.

Antibodies

In the experimental procedures described, the following antibodies were used: rabbit polyclonal antibody against COMMD1 (11938-1-AP, Proteintech Group, USA), rabbit polyclonal antibody against LDLR (PAB8804, Abnova Gmbh, Heidelberg, Germany), rabbit 6 polyclonal antibody against GST (Z-5) (sc-459, Santa Cruz Biotechnology, Inc., Heidelberg, Germany), goat anti-rabbit IgG (H + L)-HRP Conjugate (170-6515, Bio-Rad Laboratories BV, Veenendaal, the Netherlands), goat anti-mouse IgG (H + L)-HRP Conjugate (170-6516, Bio-Rad Laboratories BV), mouse antiβ-Actin (A5441, Sigma-Aldrich Chemie B.V., Zwijndrecht, the Netherlands), rabbit antiTubulin (AB4047, Abcam, Cambridge, UK), rabbit anti-Rab11 (700184, Invitrogen, Leek, the Netherlands), rabbit antiEEA1 (AB2900, Abcam). Rabbit anti-ApoB100 and rabbit anti-ApoA1 antibodies were a gift from Prof. A.K. Groen. Rabbit polyclonal antibody against ARH was a gift from Prof. H.H. Hobbs. Density analysis of Western blot images was performed using Image Lab 3.0.1 Software (Bio-Rad Laboratories).

Expression constructs

The following vectors were used in the experiments described: peBB-COMMD1-Flag [18, 47], peBB-GST, peBB-COMMD1-GST, peBB-1118-GST, peBB-119190-GST [48],

125 CHAPTER 6

pcDNA3.1-Flag-LDLR, and pcDNA3.1-PCSK9. Full-length Flag-tagged LDLR receptor was obtained from Dr. N. Freedman [17] and subcloned into pDNA3.1. pcDNA3.1-PCSK9 was kindly provided by Dr. P. Costet [49].

Gene expression analysis

Pieces of murine liver of approximately 100 mg were homogenized in 1 ml QIAzol Lysis Reagent (Qiagen). Total RNA was isolated by chloroform extraction. Isopropanol- precipitated and ethanol-washed RNA pellets were dissolved in RNase/DNase free water. 1 µg of RNA was used to prepare cDNA with the Quantitect Reverse Transcription Kit (Qiagen, Venlo, the Netherlands) according to the manufacturer’s protocol. 20 ng cDNA was used for subsequent quantitative real-time PCR (qRT-PCR) analysis using iTaq SYBR Green Supermix with ROX (Bio-Rad Laboratories BV) and 7900HT Fast Real-Time PCR Systems (Applied Biosystems). The following temperature program was used: 500 C/2 min., 950 C/10 min., 40 cycles with 950 C/15 sec and 600 C/1 min. Expression data was analyzed using SDS 2.3 software (Applied Biosystems) and the standard curve method of calculation. Mouse cyclophilin A was used as an internal control gene. Primers used for the expression studies are listed in Table S3.

Fast-Performance Liquid Chromatography (FPLC)

Plasma samples within each murine or canine experimental group were pooled together and fractionated using the fast performance liquid chromatography (FPLC) method. All 50 collected fractions were analyzed to determine TC and TG content. Fractions containing LDL and HDL were further analyzed by means of immunoblot using anti- ApoA1 and anti-ApoB100 antibodies. The total cholesterol distribution among the main lipoprotein classes of the individual plasma samples was measured using FPLC analysis as described previously but with some minor modifications [50]. In brief, the system contained a PU-980 ternary pump with an LG-980-02 linear degasser and an UV-975 UV/VIS detector (Jasco, Tokyo, Japan). An extra PU 2080i-plus pump (Jasco) was used for in-line cholesterol RTU enzymatic reagent (Biomerieux, Marcy l’Etoile, France) addition at a flow rate of 0.1 mL/min. EDTA plasma was diluted 1:1 with Tris buffered saline and 30 μL sample/buffer mixture was loaded on a Superose 6 HR 10/30 column (GE Health care, Life sciences division, Diegem, Belgium) for lipoprotein separation at a flow rate of 0.31 mL/min. Chromatographic profiles of commercially available plasma lipid standards (SKZL, Nijmegen, the Netherlands) served as a reference.

Cell lines and cell culture

Human embryonic kidney 293T cells (HEK293T) (obtained from ATCC, Manassas, VA, USA) and mouse embryonic fibroblasts (MEFs) [24] were cultured using Dubbelcco’s

126 COMMD1 and LDLR trafficking

Modified Eagles Medium – DMEM with Glutamax (GIBCO), supplemented with 10% FBS (Invitrogen) and antibiotics.

Sucrose gradients

Sucrose gradient separation of fractions obtained from fresh liver tissue was performed as described before by Jones et al. [14] with the following modifications: chow-fed mice were fasted for 4 hours before sacrificing, liver homogenates were spun for 16 h using a Beckman Coulter ultracentrifuge equipped with a swinging bucket rotor SW55 Ti at 40,000 rpm, and fractions of 285 µl were collected from the top of the tube. 1/10 of each fraction was mixed with SDS sample buffer and used for further immunoblot analysis.

Immunoprecipitation analysis

The immunoprecipitation experiments were performed as described before [51].

Dil LDL uptake assay

Culture medium was replaced with empty DMEM culture medium supplemented with Dil LDL [5 µg/ml] (Molecular Probes, Invitrogen). Cells were kept for 1 h at 40 C, then for 5 min. at 370C. Then they were immediately placed on ice, washed with cold PBS and scraped. As a control for the specificity of the investigated uptake pathway, cells were incubated with Alexa633-Transferrin [5 µg/ml]. Cells were centrifuged at 300 g for 5 min. at 40C and resuspended in 50 µl of FACS buffer (PBS with 2% FCS and 5 mM EDTA) supplemented with additional 5% FBS. Cell pellets were vortexed, 2 ml of FACS buffer was added, samples were centrifuged as before and resuspended in 200 µl of the FACS buffer. Cells were kept on ice at all times and subjected to immediate FACS analysis. The number of positive cells 6 was counted and recorded as a percentage of the whole population. Data of four independent experiments were presented relative to uptake results of the control WT population (set as 100%).

PCSK9 assay

Cells were grown in 12-well plates and incubated for 0, 4 h and 8 h with 5 µg/ml recombinant PCSK9 (#PC9-H5223 ACRO Biosystems, Greater London, UK) in an empty medium. Cells were lysed in sample buffer and analyzed by Western Blot.

Statistical analysis

All results are expressed as a mean ± SEM. Statistical analysis was performed using Prism 5.00 for Windows (GraphPad Software, CA, USA) and the unpaired Student’s t test. Results of P<0.05 were considered statistically significant: *P<0.05, **P<0.001, ***P<0.0001.

127 CHAPTER 6 Acknowledgements

We would like to thank Niels Kloosterhuis and Henk van der Molen for technical assistance with mouse experiments, Prof. Uwe Tietge for providing us with P407, Tineke Jager for help with plasma lipid analysis, Karin Klappe for help with setting-up the sucrose gradient experiments. We thank A.K. Groen for rabbit anti-ApoB100 and anti-ApoA1 antibodies and H.H. Hobbs for rabbit polyclonal antibody against ARH. We thank Jackie Senior for critically reading the manuscript. The work was partly funded by the Groningen University Institute for Drug Exploration (GUIDE) and TransCard FP7-603091–2.

128 COMMD1 and LDLR trafficking References

[1] Y. Osono, L.A. Woollett, J. Herz, and J.M. Dietschy, Role of the low density lipoprotein receptor in the flux of cholesterol through the plasma and across the tissues of the mouse, J Clin Invest, 95 (1995) 1124-1132. [2] J.L. Goldstein, H.H. Hobbs, and M.S. Brown , Familial hypercholesterolemia., in The Metabolic and Molecular Bases of Inherited Disease, 8th ed. New York: McGraw Hill [3] A. Raper, D. Kolansky, and M. Cuchel, Treatment of familial hypercholesterolemia: Is there a need beyond statin therapy?, Curr Atheroscler Rep, 14 (2012) 11-16. [4] S. Silva, A. Alves, D. Patel, R. Malhó, A. Soutar, and M. Bourbon, In vitro functional characterization of missense mutations in the LDLR gene, Atherosclerosis, 225 (2012) 128-134. [5] A. Fahed and G. Nemer, Familial hypercholesterolemia: The lipids or the genes?, Nutrition & Metabolism, 8 (2011) 23. [6] A.K. Soutar and R.P. Naoumova, Mechanisms of Disease: genetic causes of familial hypercholesterolemia, Nat Clin Pract Cardiovasc Med, 4 (2007) 214-225. [7] T.A. Lagace, D.E. Curtis, R. Garuti, M.C. McNutt, S.W. Park, H.B. Prather, N.N. Anderson, Y.K. Ho, R.E. Hammer, and J.D. Horton, Secreted PCSK9 decreases the number of LDL receptors in hepatocytes and in livers of parabiotic mice, J Clin Invest, 116 (2006) 2995-3005. [8] Y.-W. Qian, R.J. Schmidt, Y. Zhang, S. Chu, A. Lin, H. Wang, X. Wang, T.P. Beyer, W.R. Bensch, W. Li, M.E. Ehsani, D. Lu, R.J. Konrad, P.I. Eacho, D.E. Moller, S.K. Karathanasis, and G. Cao, Secreted PCSK9 downregulates low density lipoprotein receptor through receptor-mediated endocytosis, J Lipid Res, 48 (2007) 1488-1498. [9] D.-W. Zhang, T.A. Lagace, R. Garuti, Z. Zhao, M. McDonald, J.D. Horton, J.C. Cohen, and H.H. Hobbs, Binding of proprotein convertase subtilisin/kexin type 9 to epidermal growth factor-like repeat A of low density lipoprotein receptor decreases receptor recycling and increases degradation, J Biol Chem, 282 (2007) 18602-18612. [10] Y. Wang, Y. Huang, H.H. Hobbs, and J.C. Cohen, Molecular characterization of proprotein convertase subtilisin/kexin type 9-mediated degradation of the LDLR, J Lipid Res, 53 (2012) 1932-1943. [11] M. Abifadel, M. Varret, J.-P. Rabes, D. Allard, K. Ouguerram, M. Devillers, C. Cruaud, S. Benjannet, L. Wickham, D. Erlich, A. Derre, L. Villeger, M. Farnier, I. Beucler, E. Bruckert, J. Chambaz, B. Chanu, J.-M. Lecerf, G. Luc, P. Moulin, J. Weissenbach, A. Prat, M. Krempf, C. Junien, N.G. Seidah, and C. Boileau, Mutations in PCSK9 cause autosomal dominant hypercholesterolemia, Nat Genet, 34 (2003). 6 [12] K.N. Maxwell and J.L. Breslow, Adenoviral-mediated expression of Pcsk9 in mice results in a low-density lipoprotein receptor knockout phenotype, Proc Natl Acad Sci USA, 101 (2004) 7100-7105. [13] G. Zuliani, M. Arca, A. Signore, G. Bader, S. Fazio, M. Chianelli, S. Bellosta, F. Campagna, A. Montali, M. Maioli, A. Pacifico, G. Ricci, and R. Fellin, Characterization of a new form of inherited hypercholesterolemia: familial recessive hypercholesterolemia, Arterioscler Thromb Vasc Biol, 19 (1999) 802-809. [14] C. Jones, R.E. Hammer, W.-P. Li, J.C. Cohen, H.H. Hobbs, and J. Herz, Normal sorting but defective endocytosis of the low density lipoprotein receptor in mice with autosomal recessive hypercholesterolemia, J Biol Chem, 278 (2003) 29024-29030. [15] M.I. Sirinian, F. Belleudi, F. Campagna, M. Ceridono, T. Garofalo, F. Quagliarini, R. Verna, S. Calandra, S. Bertolini, M. Sorice, M.R. Torrisi, and M. Arca, Adaptor protein ARH is recruited to the plasma membrane by low density lipoprotein (LDL) binding and modulates endocytosis of the LDL/LDL receptor complex in hepatocytes, J Biol Chem, 280 (2005) 38416-38423. [16] N. Zelcer, C. Hong, R. Boyadjian, and P. Tontonoz, LXR regulates cholesterol uptake through Idol-dependent ubiquitination of the LDL receptor, Science, 325 (2009) 100-104. [17] J.-H. Wu, K. Peppel, C.D. Nelson, F.-T. Lin, T.A. Kohout, W.E. Miller, S.T. Exum, and N.J. Freedman, The adaptor protein beta-arrestin2 enhances endocytosis of the low density lipoprotein receptor, J Biol Chem, 278 (2003) 44238-44245.

129 CHAPTER 6

[18] E. Burstein, J.E. Hoberg, A.S. Wilkinson, J.M. Rumble, R.A. Csomos, C.M. Komarck, G.N. Maine, J.C. Wilkinson, M.W. Mayo, and C.S. Duckett, COMMD proteins, a novel family of structural and functional homologs of MURR1, J Biol Chem, 280 (2005) 22222-22232. [19] B. van de Sluis, J. Rothuizen, P.L. Pearson, B.A. van Oost, and C. Wijmenga, Identification of a new copper metabolism gene by positional cloning in a purebred dog population, Human Molecular Genetics, 11 (2002) 165-173. [20] R.P. Favier, B. Spee, B.A. Schotanus, T.S. van den Ingh, H. Fieten, B. Brinkhof, C.S. Viebahn, L.C. Penning, and J. Rothuizen, COMMD1-deficient dogs accumulate copper in hepatocytes and provide a good model for chronic hepatitis and fibrosis, PLoS One, 7 (2012) e42158. [21] W.I. Vonk, P. Bartuzi, P. de Bie, N. Kloosterhuis, C.G. Wichers, R. Berger, S. Haywood, L.W. Klomp, C. Wijmenga, and B. van de Sluis, Liver-specific Commd1 knockout mice are susceptible to hepatic copper accumulation, PLoS One, 6 (2011) e29183. [22] S. Materia, M.A. Cater, L.W. Klomp, J.F. Mercer, and S. La Fontaine, Clusterin and COMMD1 independently regulate degradation of the mammalian copper ATPases ATP7A and ATP7B, J Biol Chem, 287 (2012) 2485-2499. [23] P. de Bie, B. van de Sluis, E. Burstein, P.V. van de Berghe, P. Muller, R. Berger, J.D. Gitlin, C. Wijmenga, and L.W. Klomp, Distinct Wilson’s disease mutations in ATP7B are associated with enhanced binding to COMMD1 and reduced stability of ATP7B, Gastroenterology, 133 (2007) 1316-1326. [24] W.M. Vonk, P. Bie, C.K. Wichers, P.E. den Berghe, R. Plaats, R. Berger, C. Wijmenga, L.J. Klomp, and B. Sluis, The copper-transporting capacity of ATP7A mutants associated with Menkes disease is ameliorated by COMMD1 as a result of improved protein expression, Cell Mol Life Sci, 69 (2012) 149-163. [25] T. Miyayama, D. Hiraoka, F. Kawaji, E. Nakamura, N. Suzuki, and Y. Ogra, Roles of COMM-domain- containing 1 in stability and recruitment of the copper-transporting ATPase in a mouse hepatoma cell line, Biochem J, 429 (2010) 53-61. [26] D. Huster and S. Lutsenko, Wilson disease: not just a copper disorder. Analysis of a Wilson disease model demonstrates the link between copper and lipid metabolism, Mol Biosyst, 3 (2007) 816-824. [27] G. Hoffmann, T.S. van den Ingh, P. Bode, and J. Rothuizen, Copper-associated chronic hepatitis in Labrador retrievers, J Vet Intern Med, 20 (2006) 856-861. [28] H. Fieten, P.J. Leegwater, A. Watson, and J. Rothuizen, Canine models of copper toxicosis for understanding mammalian copper metabolism, Mamm Genome, 23 (2012) 62-75. [29] H. Fieten, S. Hugen, T.S. van den Ingh, W.H. Hendriks, J.C. Vernooij, P. Bode, A.L. Watson, P.A. Leegwater, and J. Rothuizen, Urinary excretion of copper, zinc and iron with and without D-penicillamine administration in relation to hepatic copper concentration in dogs, Vet J, 197 (2013) 468-473. [30] E. Bailhache, F. Briand, P. Nguyen, M. Krempf, T. Magot, and K. Ouguerram, Metabolism of cholesterol ester of apolipoprotein B100-containing lipoproteins in dogs: evidence for disregarding cholesterol ester transfer, Eur J Clin Invest, 34 (2004) 527-534. [31] S. Takahashi, K. Kubo, S. Waguri, A. Yabashi, H.-W. Shin, Y. Katoh, and K. Nakayama, Rab11 regulates exocytosis of recycling vesicles at the plasma membrane, J Cell Sci, 125 (2012) 4049-4057. [32] A. Fedoseienko, P. Bartuzi, and B. van de Sluis, Functional understanding of the versatile protein copper metabolism MURR1 domain 1 (COMMD1) in copper homeostasis, Ann. N.Y. Acad. Sci. (2014) 12353. [33] L. Du and S.R. Post, Macrophage colony-stimulating factor differentially regulates low density lipoprotein and transferrin receptors, J Lipid Res, 45 (2004) 1733-1740. [34] A.E. Klomp, B. van de Sluis, L.W. Klomp, and C. Wijmenga, The ubiquitously expressed MURR1 protein is absent in canine copper toxicosis, J Hepatol, 39 (2003) 703-709. [35] T.Y. Tao, F. Liu, L. Klomp, C. Wijmenga, and J.D. Gitlin, The copper toxicosis gene product Murr1 directly interacts with the Wilson disease protein, J Biol Chem, 278 (2003) 41593-96. [36] L. Smith, P. Litman, and C.M. Liedtke, COMMD1 interacts with the COOH terminus of NKCC1 in Calu-3 airway epithelial cells to modulate NKCC1 ubiquitination, Am J Physiol Cell Physiol, 305 (2013) C133-C146.

130 COMMD1 and LDLR trafficking

[37] Y. Ke, A.G. Butt, M. Swart, Y.F. Liu, and F.J. McDonald, COMMD1 downregulates the epithelial sodium channel through Nedd4-2, Am J Physiol Renal Physiol, 298 6 (2010) F1445-F1456. [38] W. Biasio, T. Chang, C.J. McIntosh, and F.J. McDonald, Identification of Murr1 as a regulator of the human [delta]epithelial sodium channel, J Biol Chem, 279 (2004) 5429-5434. [39] T. Chang, Y. Ke, K. Ly, and F.J. McDonald, COMMD1 regulates the delta epithelial sodium channel (deltaENaC) through trafficking and ubiquitination, Biochem Biophys Res Commun, 411 (2011) 506-511. [40] L. Drévillon, G. Tanguy, A. Hinzpeter, N. Arous, A. de de Becdelièvre, A. Aissat, A. Tarze, M. Goossens, and P. Fanen, COMMD1-mediated ubiquitination regulates CFTR trafficking, PLoS ONE, 6 (2011) e18334. [41] J.L. Burkhead, C.T. Morgan, U. Shinde, G. Haddock, and S. Lutsenko, COMMD1 forms oligomeric complexes targeted to the endocytic membranes via specific interactions with phosphatidylinositol 4,5-bisphosphate, J Biol Chem, 284 (2009) 696-707. [42] L.M. Traub, Sorting it out: AP-2 and alternate clathrin adaptors in endocytic cargo selection, J Cell Biol, 163 (2003) 203-208. [43] P.S. McPherson, B. Ritter, and B. Wendland, Clathrin-mediated endocytosis, in Trafficking Inside Cells: Pathways, Mechanisms and Regulation, N. Segev et al., Eds.: Landes Bioscience and Springer Science+Business Media [44] M.E. Maurer and J.A. Cooper, The adaptor protein Dab2 sorts LDL receptors into coated pits independently of AP-2 and ARH, J Cell Sci, 119 (2006) 4235-4246. [45] S. Rashid, D.E. Curtis, R. Garuti, N.N. Anderson, Y. Bashmakov, Y.K. Ho, R.E. Hammer, Y.-A. Moon, and J.D. Horton, Decreased plasma cholesterol and hypersensitivity to statins in mice lacking Pcsk9, Proc Natl Acad Sci USA, 102 (2005) 5374-5379. [46] E.G. Bligh and W.J. Dyer, A rapid method of total lipid extraction and purification, Can J Biochem Physiol, 37 (1959) 911-7. [47] G.N. Maine, X. Mao, C.M. Komarck, and E. Burstein, COMMD1 promotes the ubiquitination of NF-[kappa]B subunits through a cullin-containing ubiquitin ligase, EMBO J, 26 (2007) 436-447. [48] X. Mao, N. Gluck, D. Li, G.N. Maine, H. Li, I.W. Zaidi, A. Repaka, M.W. Mayo, and E. Burstein, GCN5 is a required cofactor for a ubiquitin ligase that targets NF-kappaB/RelA, Genes Dev, 23 (2009) 849-861. [49] F. Lalanne, G. Lambert, M.J. Amar, M. Chetiveaux, Y. Zair, A.-L. Jarnoux, K. Ouguerram, J. Friburg, N.G. Seidah, H.B. Brewer, M. Krempf, and P. Costet, Wild-type PCSK9 inhibits LDL clearance but does not affect apoB-containing lipoprotein production in mouse and cultured cells, J Lipid Res, 46 (2005) 1312-19. 6 [50] J.H. Levels, L.C. Lemaire, A.E. van den Ende, S.J. van Deventer, and J.J. van Lanschot, Lipid composition and lipopolysaccharide binding capacity of lipoproteins in plasma and lymph of patients with systemic inflammatory response syndrome and multiple organ failure, Critical Care Medicine, 31 (2003) 1647-53. [51] B. van de Sluis, P. Muller, K. Duran, A. Chen, A.J. Groot, L.W. Klomp, P.P. Liu, and C. Wijmenga, Increased activity of hypoxia-inducible factor 1 is associated with early embryonic lethality in Commd1 null mice, Mol Cell Biol, 27 (2007) 4142-4156.

131 CHAPTER 6 SuppFigurel S1.ementary Figures Figure S2. a b a b 7 12000 3000 ]

4 ] M 6 Figure S1. Total plasma cholesterol ] M] m m

** [ ∆Hep m m p 5 [ l p levels in WT, Commd1 , and Alb- p l 3 8000 2000 o [ p r o [ 4

r r e r

t Cre mice. Plasma total cholesterol levels e e t e 2 s 3 p s p e l p e of (a) 10-week old chow-fed wild-type p l o 4000 1000 o 2 o o h C C h 1 C and hepatic Commd1 knockout mice

C 1 ND 0 0 and (b) 20-week long0 HFC-fed Alb-Cre 0 WT WT control mice.C GroupOMMD 1averages+/- -/- are plottedL abrador unaff. aff. ∆Hep Commd1 Alb-Cre with SEM error. Significance in (a) and (b) Figure S1. Figure S2. was tested against the WT mice. **P<0.01 a b a b Figure S1. Figure S2. 7 12000 3000 ]

4 ] M 6 ] M] m m

** [ m m

b p a 5 b [ a l p

p l 3 80Figure00 S2. Hepatic copper2000 concentrations. o [ p r o [ 4

r 7 r e

Figure S3.12 000 3000 r t e ] e t e 2 s Hepatic copper levels in (a) dogs 3 p s p e 4 ] M 6 l p e p ] l o M] 4000 1000 o o

m 2 m o h

** [ heterozygous (+/-) or homozygous (-/-) C m C m h 1 p

5 C [ l p

C 1 p l 3 a 8000 2000 b o [ p

r ND o [ 4 for loss-of-function mutation of COMMD1

r 5 0 r 0 0 10 0 e WT

r WT t e e t WT WT e COMMD1 +/- -/- Labrador unaff. aff. 2 s ∆Hep and (b) copper toxicosis in unaffected ∆Hep 3 p ** s ∆ p e Hep Commd1 Commd1

l Commd1 Alb-Cre ] p ] e p l o 4000 * 1000 o 4 o 8 2 M o M h (unaff.) and affected (aff.) Labrador C C h 1 C m m [ [

C 1

l

retrievers. Groupl averages are plotted with o 3 ND o

r 6 0 0 0 0 r e SEM error. Significancee in (b) was tested t WT Labrador unaff. aff. t WT COMMs D1 +/- -/- s

∆ e Hep e l Commd1 Alb-Cre 2 against the unaffectedl 4 dogs. *P<0.05

Figure S3. o o ** C h ** C h a 1 b 2 5 WT 10 WT Commd1 ∆Hep ** Commd1 ∆Hep

] 0 ] 0 4 * 8 M TC VLDL LDL HDL M TC VLDL LDL HDL m m [ [

l l o 3 o

r 6 Figure S3. c r d e e t t s s e e l 2 l 4 o 0.06 WT o 0.**06 WT ∆

C h ∆ Hep a b Hep C h 1 Com**md1 Commd1 5 WT 10 WT 2 ∆Hep ∆Hep Commd1 0 ** Commd1 0 ] 4 * ] TC VLDL LDL HDL TC VLDL LDL HDL ] 8 ] M M 0.04 0.04 M M m m [

c [ d

l m m l [ [

o 3 o r 6 r s 0.06 0.06 s

e WT

e WT t t G ∆Hep ∆Hep G s

s Commd1 Commd1 T T e e l 2 l 4 o o 0.02 ** 0.02 ] ] C h 0.04 C h 0.04 M 1 ** 2 M m m [ [

s s G G T 0 0.00 T 0.00 TC VLDL LDL HDL 0.02 0.02 T5C 1V0LDL 15 LDL 20 HDL25 30 35 fraction 5 10 15 20 25 30 35 fraction c d VLDL LDL HDL VLDL LDL HDL

0.06 0.00 0.06 0.00 WT 5 10 WT15 20 25 30 35 fraction 5 10 15 20 25 30 35 fraction ∆Hep Commd1 ∆Hep Commd1 VLDL LDL HDL VLDL LDL HDL ] 0.04 Figure ] S3.0.04 Cholesterol distribution among the lipoprotein particles. (a) and (b) Pooled plasma M M ∆Hep m samplesm from (a) chow-fed and (b) 20-week long HFC-fed WT and Commd1 mice were size- [ [

s fractionateds by FPLC. Total cholesterol (TC) and cholesterol content of each fraction was determined. G G T T 0.02 (c) Triglyceride0.02 (TG) levels in FPLC-fractionated plasma samples from chow-fed and (d) 20-week long HFC-fed WT and Commd1∆Hep mice. Group averages are plotted with SEM error. Significance in (a) and (b) was tested against the WT control group. *P<0.05, **P<0.01

0.00 132 0.00 5 10 15 20 25 30 35 fraction 5 10 15 20 25 30 35 fraction VLDL LDL HDL VLDL LDL HDL COMMD1 and LDLR trafficking supplementary Tables

Table S1. Parameters of WT and Commd1∆Hep mice fed chow diet. Values ±SEM.

Age 28 weeks 28 weeks Significance Genotype Commd1loxP/loxP Commd1∆Hep - n 6 7 - BW [g] 32.73 ± 1.41 33.24 ± 1.13 NS Liver TC [μmol/g liver] 2.41 ± 0.43 2.353 ± 0.21 NS Liver TG [μmol/g liver] 12.12 ± 2.09 13.00 ± 2.34 NS Liver Copper [μg/g dry liver] 84.63 ± 8.93 74.99 ± 8.30 NS

Table S2. Parameters of WT and Commd1∆Hep mice fed HFC diet. Values ±SEM.

Age 28 weeks 28 weeks Significance Genotype Commd1loxP/loxP Commd1∆Hep - n 8 7 - BW [g] 39.65 ± 1.40 37.13 ± 1.36 NS Liver TC [μmol/g liver] 9.04 ± 1.05 10.85 ± 0.82 NS Liver TG [μmol/g liver] 22.52 ± 2.36 22.10 ± 2.73 NS Liver Copper [μg/g dry liver] 17.52 ± 2.11 23.51 ± 2.21 NS

Table S3. qRT-PCR primer sequences. 6

Gene Forward 5’→3’ Reverse 5’→3’ Ldlr CATATGCATCCCCAGTCTTTG GCAGTGCTCCTCATCTGACTTG Srb-1 TTGGCCTGTTTGTTGGGATG GGATTCGGGTGTCATGAAGG Lrp TCAGACGAGCCTCCAGACTGT ACAGATGAAGGCAGGGTTGGT Cd36 GATCGGAACTGTGGGCTCAT GGTTCCTTCTTCAAGGACAACTTC Hmgcr AGCTTGCCCGAATTGTATGTG TCTGTTGTGAACCATGTGACTTC Srebp2 CGACGAGATGCTACAGTTTG GGTAGGAGAGACTTTGACCTG Abaca1 GGGAAGGACATTCGCTCGG TTGCTTTTCAGCTTGCTCGG Abcg5 CTGCATGTGTCCTACAGCGTCA AGATGCACATAATCTGGCCACTCTC Abcg8 TCAGTCCAACACTCTGGAGGTCA ATTTCGGATGCCCAGCTCAC Cyclophilin A TTCCTCCTTTCACAGAATTATTCCA CCGCCAGTGCCATTATGG

133

CHAPTER 7

Hepatic COMMD1 deficiency is associated with liver microvesicular steatosis and decreased inflammation upon long-term high-fat, high-cholesterol feeding

Bartuzi P1, Dekker DC1, Kloosterhuis NJ1, de Bruin A2, Hofker MH1, van de Sluis B1

1University of Groningen, University Medical Center Groningen, Department of Pediatrics, Section Molecular Genetics, Groningen, the Netherlands, 2Faculty of Veterinary Medicine, Utrecht, the Netherlands

In preparation Abstract

Hepatic steatosis is considered a benign stage of non-alcoholic fatty liver disease (NAFLD), but can progress to non-alcoholic steatohepatitis (NASH), a more advanced form of NAFLD. NAFLD is a multifactorial disease, and because of its complexity the underlying mechanism of the development and progression of NASH is still not well understood. Our recent data suggest a protective role for Commd1 in the progression of diet-induced NAFLD, however its true contribution to NAFLD is not well defined yet. To further assess its role in the pathogenesis of NAFLD, wild type (WT) and hepatocyte Commd1-deficient knockout mice were fed a high fat high cholesterol (0,2%) diet for 20 weeks. Both groups developed steatosis, however hepatic Commd1-deficient mice accumulated lipids predominantly in the form of microvesicles, whereas WT mice displayed mainly macrovesicular steatosis. Microvesicular steatosis in hepatocyte Commd1 deficient mice was associated with decreased gene expression of proinflammatory cytokines, such as Tnf-α, Il-1α and Il-1β. In addition, transcriptional induction of various genes involved in cholesterol homeostasis, e.g. Srebp-1c and Abc transporters, was diminished by Commd1 deficiency. Most of these genes are regulated by Lxrα, a nuclear receptor that protects cells from cholesterol overload. Although mitochondrial dysfunction is associated with microvesicular steatosis, no evidence was found that loss of Commd1 results in mitochondrial impairment. Altogether, this study substantiates the role of Commd1 in pathogenesis of NAFLD, but further studies are needed to fully understand its mechanistic action in NAFLD. COMMD1 and steatosis progression Introduction

Non-alcoholic fatty liver disease (NAFLD) is the most common liver disease in developed countries, and its prevalence is rapidly rising together with the dramatic increase in obesity and diabetes [1]. NAFLD covers a spectrum of hepatic pathologies, ranging from benign steatosis to non-alcoholic steatohepatitis (NASH). Later stages of NASH are characterized by presence of liver fibrosis, and can lead to cirrhosis and hepatocellular carcinoma (HCC) [2, 3]. Etiology of this disease is considered to be multifactorial and due to its complexity the mechanisms leading to development of NASH are still not fully understood. Inflammation is an important factor in the progression of NAFLD. During hepatic inflammation, the resident liver macrophages, Kupffer cells, release proinflammatory cytokines, like TNF-α and Il-6 [4]. The expression of these cytokines is under the control of NF-κB, a family of transcription factors, which is involved in the inflammatory response. Excessive production of proinflammatory cytokines is associated with increased lipid accumulation [4], promotes fibrogenesis as well as hepatocyte injury and death [5], which can eventually lead to cancer development [6]. In a previous study [7], we identified copper metabolism gene MURR1 domain-containing protein 1 (COMMD1) as a possible player in NAFLD progression. We demonstrated that hepatocyte specific depletion of Commd1 exacerbates hepatic cholesterol and lipid accumulation upon feeding a high fat, high cholesterol diet (HFC) for 12 weeks. Although Commd1 can suppress the activity of NF-κB [8-10], this increase in lipid accumulation was independent of the level of inflammation, as hepatocyte Commd1 deficiency did not result in aberrant NF-κB activation. However, since COMMD1 is a multifunctional protein, playing a role in copper metabolism [11, 12], ion transport [13], protein trafficking [14] and protein aggregation [15], one cannot rule out the possibility that Commd1 also mediates other factors which might be involved in NAFLD progression. Hence, in this study we further evaluated the consequences of hepatic Commd1 deficiency on the progression of NAFLD.

Results Commd1∆Hep mice show altered lipid accumulation pattern in the liver 7 Previously we demonstrated that murine Commd1 ameliorates lipid and cholesterol accumulation in a model of NAFLD by feeding mice a HFC-diet for 12 weeks [7]. To further assess the role of Commd1 on the progression of NAFLD in mice, we fed hepatic Commd1 deficient (Commd1∆Hep), and wild type (WT) littermates a HFC diet for 20 weeks. In parallel, mice of both genotypes were fed a control chow diet. HFC feeding increased the body weight of both groups, however we did not observe marked differences between Commd1∆Hep and WT mice (Fig. 1A). In contrast, HFC-fed Commd1∆Hep mice had significantly lower liver weights compared to their controls (Fig. 1B). No differences in triglyceride (TG) levels were detected in the liver (Fig. 1C) or in the plasma (Fig. 1D). However, similar to what was previously shown [16], plasma cholesterol levels were significantly elevated in both

137 CHAPTERFigure 1. 7

A. WT C. E. WT G. 45 ∆Hep 30 WT 10 ∆Hep Commd1 ∆Hep Commd1 0.3 WT ] ∆Hep ] Commd1 l Commd1 r o 25 M *** e r 8 ] r v m e i [ t e l

] l

s 30 20 v i g

o 0.2 g l [ e r /

6 l

l e g o t o /

W 15 l s h m o e B l 4 *** µ [ o m 15 10

h 0.1 µ G [ C

T 2

5 Total C

0 0 0 0.0 Chow HFC Chow HFC Chow HFC Chow HFC B. WT D. WT F. H. 10 ∆ 0.6 ∆Hep 500 7 ] Hep WT WT Commd1 Commd1 ∆Hep ∆Hep l

W Commd1 Commd1

o 6 * ] r B

8 400 r

] e ] e t 5 % v M

0.4 s [ i l

e

t m 6 µ M 300 l [ g

h 4

o / g l i h G o

e 3 4 T 200 m FFA [ w 0.2

µ r

[ 2

e 2 100 Free C v i 1 L 0 0.0 0 0 Chow HFC Chow HFC Chow HFC Chow HFC

Figure 1. Hepatic and plasma lipid content in mice fed a HFC diet for 20 weeks. (A) Body weight and (B) liver weight of WT and Commd1∆Hep mice fed a regular chow diet and a HFC diet for 20 weeks (C) Hepatic triglycerides, (D) plasma triglycerides, (E) plasma total cholesterol, (F) plasma free fatty acid level, (G) hepatic total cholesterol, and (H) hepatic free cholesterol of WT and Commd1∆Hep mice fed a regular chow diet and a HFC diet for 20 weeks. All values per group are shown as mean ± SEM. Statistical significance was determined versus control WT group on each diet. *P<0.05, **P<0.01, *** P<0.001.

Commd1∆Hep groups fed chow or HFC diet (Fig. 1E), but no changes in plasma free fatty acid levels were observed (Fig. 1F). In addition, although it did not reach statistical significance (P=0.1), the hepatic cholesterol concentrations in hepatocyte Commd1 deficient mice showed trend towards an increase compared to WT mice (Fig. 1G,H). To study the pathological changes induced by long-term HFC-feeding, we performed histological analysis of chow and HFC-fed mice. Liver sections were stained with hematoxylin and eosin (H&E), which showed an increase in fat deposits after prolonged cholesterol feeding in both WT and Commd1∆Hep mice (Fig. 2A, B). However, we did not observe a clear difference in the grade of steatosis (Fig. 2B,C), which was supported by TG content analysis (Fig. 1C). Nonetheless, H&E staining revealed that there is a clear difference in the morphology of the lipid-containing vesicles between the two groups (Fig. 2D) As expected, long-term HFC feeding of WT mice resulted predominantly in accumulation of triglycerides in large vesicles (high-grade macrovesicular steatosis), accompanied by a few percentage of cells showing multiple smaller fat droplets within hepatocytes (microvesicular steatosis) (Fig. 2D). Commd1∆Hep mice, however, showed mainly hepatic microvesicular steatosis, and the presence of macrovesicular steatosis was relatively low (low-grade macrovesicular steatosis) (Fig. 2E,F). Altogether, these data suggest that Commd1 might regulate processes resulting in altered pattern of fat accumulation in hepatocytes.

Depletion of Commd1 in hepatocytes attenuates diet-induced hepatic inflammation

Long-term HFC-feeding induces liver inflammation and can even result in liver fibrosis, both features of a more severe form of NAFLD. Therefore, we decided to investigate 138 Figure 2. COMMD1 and steatosis progression

A. Chow HFC

WT B. 3 WT Commd1∆Hep e d a

r 2 g

s i s o t a

∆ Hep 1 e t S N.D. 0 Chow HFC Commd1

E. 1.5 WT Commd1∆Hep C. Chow HFC D. H&E - magnification 1.0

0.5 WT WT N.D. Microvesicular Steatosis 0.0 Chow HFC

F. 1.5 WT Commd1∆Hep

1.0 ∆ Hep ∆ Hep

0.5 Commd1 Commd1 N.D. Macrovesicular Steatosis 0.0 Chow HFC

Figure 2. Loss of hepatic Commd1 is associated with microvesicular steatosis in advanced stages of NAFLD. (A) H&E and (C) ORO staining of hepatic tissue from 4-hour fasted WT and Commd1∆Hep mice following 20 weeks of regular chow diet or a HFC diet. Representative images per group are shown. Scale bars represent 100mm. (D) Magnification of H&E staining from HFC-fed representative mouse samples. Scale bars represent 50 µm. Example macrovesicular (WT) and microvesicular (Commd1∆Hep) fat droplets are marked with arrows and arrowheads, respectively. Histological evaluation of liver steatosis (B) grade and (E,F) type. Presence of either (E) micro- or (F) macrosteatosis was scored (0 - not detected, 1 - present). Steatosis was not observed in chow-fed mice (N.D. = not detected). the level of hepatic inflammation in both mouse groups upon HFC feeding and to evaluate the consequences of macro-/ microvesicular steatosis on the progression of NAFLD. 7 Following 20 weeks of HFC-diet, histological scoring (number of inflammatory foci per field) did not identify significant difference in lobular inflammation between WT and Commd1∆Hep mice (Fig. 3C). Immunostaining for a marker of activated macrophages, Cd68, [17] (Fig. 3A, B) and the mRNA levels of Cd68 supported this observation, as no alterations were observed (Fig. 4A). However, despite the absence of marked differences in the number of inflammatory foci, the gene expression of various proinflammatory (Mcp-1, Cd11b, Tnf-α, Il-1α, Il-1β) and NF-κB target genes (A20, Icam1) (Fig. 4A) was significantly reduced in livers of Commd1∆Hep mice compared to WT mice. Nevertheless, no difference was seen between the chow-fed animals. To investigate whether long-term

139 CHAPTER 7 Figure 3. B.

A. ∆Hep WT WT Commd1 0.020 Commd1∆Hep

0.015

0.010

Chow morphometry 8

6 0.005 D C 0.000 Chow HFC

C. 2.0 WT Commd1∆Hep 1.5 HFC

1.0

0.5 Lobular inflammation 0.0 Chow HFC Figure 3. Hepatic Commd1 deficiency does not affect HFC diet-induced inflammatory infiltrations. (A) Representative images of the immunohistochemical staining of the macrophage marker Cd68. Scale bars represent 100µm. (B) Computer-based analysis of Cd68 positive signal in histological slides. (C) Histological evaluation of inflammation. Inflammation score was based on a number of inflammatory foci per five random fields at 200x. All values per group are shown as mean ± SEM. Statistical significance was determined versus control WT group on each diet.

HFC also results in liver fibrosis, we determined the expression of several fibrotic markers in the livers of WT and hepatic Commd1 knockouts (Fig. 4B). Although histological analysis of liver fibrosis revealed no detectable collagen staining (data not shown) in HFC-fed groups of mice, the gene expression of the fibrotic markers Col1a1, Tgfβ, and Timp-1 was significantly induced in both groups upon HFC-feeding. However, in HFC-fed Commd1∆Hep mice the expression of these markers showed a trend towards reduction, except for Tgfβ, which was significantly decreased. Taken together, although the number of inflammatory foci was not clearly affected by hepatic depletion of Commd1, proinflammatory cytokine expression was markedly reduced in HFC-fed Commd1∆Hep mice compared to WT mice.

Mitochondrial function is not affected by the loss of Commd1 in hepatocytes

Previous studies demonstrated that mitochondrial dysfunction is associated with microvesicular steatosis [18]. Furthermore, two co-expression databases (http://coexpresdb.jp/ and http://genenetwork.nl/) predict that COMMD1 is co-expressed with genes involved in various pathways, particularly in oxidative phosphorylation and mitochondrial function [19]. Therefore, we determined whether depletion of hepatocyte Commd1 affects the mitochondrial function by analyzing the expression of the mitochondrial

140 COMMD1 and steatosis progression Figure 4.

A. WT (Chow) 16 12 14 ∆ WT (Chow) WT (Chow) Hep ∆Hep ∆Hep Commd1 (Chow) Commd1 (Chow) Commd1 (Chow) 14 12 WT (HFC) WT (HFC) n 10 ∆Hep WT (HFC) ∆Hep o Commd1 (HFC) i Commd1∆Hep (HFC) 12 Commd1 (HFC) s 10 s **

e 8 ** r * 10 p 8 x

E 8

6

e ** 6 v

i 6 t *

a 4 l 4 *

e 4 R 2 2 2

0 0 0 Mcp-1 Cd68 Cd11b T n f α Il- 1 α Il-1β A20 Icam1 B. 16 WT (Chow) Commd1∆Hep (Chow)

n 14 WT (HFC) o i Commd1∆Hep (HFC) s

s 12 e r

p 10 x E

e 8 v i t a

l 6 e

R 4 * 2 0 αSMA Col1α 1 T g f β Timp-1

Figure 4. Expression of proinflammatory cytokines is attenuated in HFC-fed Commd1∆Hep mice. (A and B) Relative hepatic mRNA expression of (A) inflammatory cytokines, monocyte and macrophage markers, and (B) fibrotic markers, as determined by qRT-PCR. All values per group are shown as mean ± SEM. Statistical significance was determined versus control WT group on each diet. *P<0.05, **P<0.01. complex proteins in the liver of mice following 20 weeks of HFC diet. Immunoblot analysis using an antibody cocktail against the subunits of mitochondrial respiratory chain did not detect a clear difference in the levels of any of the five mitochondrial subunits (Fig. 5A). In addition, it is known that dysfunction of the mitochondria is correlated with increased production of reactive oxygen species (ROS), which activates the stress kinases, JNK and p38 MAPK and increases the expression of heme oxygenase-1 (HO-1) [20, 21]. No differences in total 7 level of HO-1 or phosphorylation status of JNK and p38 MAPK were observed between the two groups, indicating that the production of ROS is not changed by depletion of hepatocyte Commd1. Altogether, these data suggest that microvesicular steatosis in hepatocyte Commd1-deficient mice is not correlated with alteration in the mitochondrial function.

Hepatic loss of Commd1 affects the expression of genes involved in cholesterol homeostasis upon HFC-feeding

The considerable difference in the form of HFC-induced steatosis and the trend towards higher liver cholesterol levels in hepatocyte Commd1-deficient mice prompted us

141 CHAPTERFigure 5. 7

A. B. WT Commd1∆Hep WT Commd1∆Hep

P-Jnk (p54) CV - ATP5A CIII - UQCRC2 P-Jnk (p46) CIV - MTCO1 Jnk (p54)

CII - SDHB Jnk (p46) P-p38

CI - NDUFB8 p38

HO-1 β-Actin β-actin

Figure 5. Microvesicular steatosis in Commd1∆Hep mice is not associated with mitochondrial dysfunction. (A ) Mitochondrial complex I-V protein levels in WT and Commd1∆Hep livers following 20 weeks of HFC diet were determined by Western blot analysis. (B) Western blot analysis of HO-1 levels and phosphorylation status of JNK, p38 MAPK in liver tissue of WT and Commd1∆Hep mice following 20 weeks of HFC diet. Three representative mice per group are shown.

to analyze the expression of genes involved in cholesterol homeostasis and lipid metabolism. The major cholesterol uptake genes Ldlr and Srb-1 were both decreased, but no differences in the expression of the long chain fatty acid translocase gene Cd36 was seen (Fig. 6A). Most of the genes involved in cholesterol synthesis (HmgCoAR, Scd, Fas) were unchanged, but Acc1, Srebp-1c and Srebp-2 mRNA levels were significantly reduced (Fig. 6B). In addition, the majority of the cholesterol efflux genes (Abca1, Abcg1, Abcg8) were significantly reduced (Fig. 6C). The decreased expression of the cholesterol efflux genes was in line with a reduced Lxrα expression, a transcription factor regulating the expression of these efflux genes. The expression of the transcription factors Pparα and Pparγ, regulating genes involved in fatty acid metabolism and storage, was not changed (Fig. 6D). Additionally, no marked differences in genes coding apolipoproteins A1 and A5 (Fig. 6E), or in genes involved in fatty acid esterification (Dgat1, Dgat2), or in conversion of cholesterol to bile acids (Cyp7A1, Cyp27A1) (Fig. 6F) were detected. Altogether, the high-grade microvesicular steatosis in Commd1∆Hep mice was associated with aberrant expression of various Lxrα target genes, involved in either cholesterol efflux or synthesis, but not with genes involved in lipid metabolism.

Discussion

Liver steatosis (NAFLD) has been described as the hepatic manifestation of the metabolic syndrome [22] and two patterns of hepatic steatosis are recognized, namely the macro- and microvesicular steatosis. In macrovesicular steatosis, fat is accumulated in large vesicles, which displace the nucleus to the hepatocyte periphery, whereas in microvesicular steatosis fat is accumulated in a number of small vesicles, and the cytoplasm of the hepatocytes has

142 COMMD1 and steatosis progression

Figure 6.

A. B. E.

WT (Chow) 14 3.5 ∆Hep 6 WT (Chow) WT (Chow) Commd1 (Chow) ∆ ** Commd1∆Hep (Chow) Commd1 Hep (Chow) WT (HFC) 12 3.0 ∆Hep WT (HFC) Commd1 (HFC)

n WT (HFC) ∆Hep o ∆Hep i Commd1 (HFC) 10 Commd1 (HFC) s 8 2.5 ** s 4

e **

r 6

p 2.0 x * E

4

e 1.5 v i ** t 2 3 a l 1.0 e 2 * R 1 0.5 0 0 0.0 Ldlr Srb-1 Cd36 HmgCoAR Scd-1 Fas Acc-1 Srebp-1c Srebp-2 ApoA1 ApoA5 uptake synthesis apolipoproteins

C. D. F.

WT (Chow) WT (Chow) ∆ 2.5 25 4 Commd1 Hep (Chow) WT (Chow) Commd1∆Hep (Chow) * WT (HFC) Commd1∆Hep (Chow) WT (HFC) ∆Hep 15 Commd1 (HFC) WT (HFC) Commd1∆Hep (HFC) 2.0 n 8 Commd1∆Hep (HFC) o

i 3

s ** s

e 1.5 r 6 ** p x 2 * E

e 4 1.0 v i t a l

e 1 0.5

R 2

0 0 0.0 Abca1 Abcg1 Abcg5 Abcg8 Pparα Pparγ Lxrα Dgat1 Dgat2 Cyp7A1 Cyp27A1 efflux transcription factors esterification hydroxylation

Figure 6. Commd1 deficiency is associated with decreased transcriptional activation of Lxrα target genes. (A - F) Relative hepatic mRNA levels of genes involved in cholesterol homeostasis and lipid metabolism, as determined by qRT-PCR. All values per group are shown as mean ± SEM. Statistical significance was determined versus control WT group on each diet. *P<0.05, **P<0.01. a foamy appearance [18]. However, the exact mechanism leading to any of the two forms of steatosis and their biological significance is not fully understood yet. In this study we demonstrate that in an advanced stage of NAFLD, loss of hepatocyte Commd1 is associated with microvesicular steatosis, whereas wild type mice show predominantly macrovesicular steatosis. Furthermore, our results suggest that microvesicular steatosis is associated with decreased diet-induced proinflammatory cytokine expression, and aberrant Lxrα activation. In our previous study we observed that feeding WT and hepatic Commd1 deficient mice 7 HFC diet for 12 weeks results mainly in microvesicular form of liver steatosis, without any difference in the level of hepatic inflammation between the two groups. However, prolonged HFC feeding of WT mice resulted predominantly in macrovesicular steatosis, suggesting that the presence of larger fat droplets can be recognized as the advanced stage of diet-induced NAFLD in mice. Although it is not clear if microvesicular steatosis always precedes macrovesicular steatosis, our data suggest that hepatic Commd1 depletion delays the development of larger fat droplets in advanced stage of NAFLD. A clear explanation for this observation is lacking, but it is tempting to hypothesize that Commd1 could play a role in the formation of these larger fat droplets. This is in line with our current knowledge about the function of COMMD1.

143 CHAPTER 7

COMMD1 seems to be involved in the sorting and delivery of various cargos, including copper and LDL [16, 23]. COMMD1 deficiency causes progressive accumulation of copper in the liver of dogs and mice. The accumulation of copper is seen as electron-dense granules in lysosomes [24, 25], due to defects in the release of copper into the bile. Furthermore our recent data demonstrate that the clearance of circulating Ldl is also impaired by the loss-of-Commd1. Altogether, based on these data we can speculate that COMMD1 may act as an adaptor protein in sorting/fusion of vesicles, a process that might also be involved in the transformation of microvesicular into macrovesicular steatosis. It would therefore be relevant to further investigate the hepatic function of COMMD1, and to determine which kind of vesicles COMMD1 is localized to. Although COMMD1 partially co-localizes to endosomal and lysosomal markers (reviewed in [23]), COMMD1-associated vesicles are still not fully characterized, and based on its pleiotropic function it is highly possible that COMMD1 does not transport only copper and LDL. Our data indicate that microvesicular steatosis is associated with decreased transcriptional activation of various cytokines, such as Tnfα, Il-1α or Mcp-1. Most of these cytokines are expressed by Kupffer cells, the resident liver macrophages. Their activation can be caused by elevated levels of reactive oxygen species (ROS). However, the reduced inflammatory gene expression found in HFC-fed Commd1∆Hep mice could not be explained by differences in ROS production, since neither JNK nor p38 MAPK activation status was changed. Additionally, we also observed reduced expression of Lxrα target genes, which is in agreement with lowered Lxrα mRNA levels. These included genes involved in cholesterol synthesis, like Srebp-1c or Srebp-2. Srebp-2 activates the transcription of Ldlr, which was also reduced in HFC-fed Commd1∆Hep mice. In addition, the expression of the genes encoding proteins involved in cholesterol export, like Abca1, g1 and g5/g8 was markedly decreased. All these genes are transcriptionally activated by Lxrα. These data indicate that microvesicular steatosis is associated with reduced Lxrα transactivation, which might suggest that the level of oxysterols, oxidized derivatives of cholesterol and Lxrα ligands, is reduced. On the other hand, the total cholesterol levels were not changed. Therefore, further studies are needed to explain these differences in Lxrα activity. Taken together, our data indicate that Commd1 is involved in the progression of microvesicular to macrovesicular form of steatosis. To date, it is not clear which proteins govern this process, but the described mouse model might help us better understand how the transition in type of lipid droplet size is regulated, and elucidate the biological relevance of micro- and macrovesicular steatosis in NAFLD pathology.

Materials and Methods Animals

Conditional hepatocyte-specific male mice (Commd1∆Hep) [12] were backcrossed in a C57BL/6J background for more than 8 generations. Animals were housed individually and fed ad libitum with either standard rodent chow diet (RMH-B, AB Diets, 144 COMMD1 and steatosis progression the Netherlands) or, starting at 8 weeks of age, high-fat, high-cholesterol (HFC) diet (45% calories from butter fat) containing 0.2% cholesterol (SAFE Diets) for a period of 20 weeks. Prior to sacrifice, all animals were fasted for 4 hours. Tissues were snap-frozen in liquid nitrogen and blood was collected by means of heart puncture. Plasma was separated by centrifugation at 3000 rpm for 10 min. at 40 C. All animal-related studies were conducted with the approval of Institutional Animal Care and Use Committee of the University of Groningen (Groningen, the Netherlands).

Liver Lipid Extraction

15% (w/v) liver homogenates were prepared in PBS and lipid extraction was performed using the Bligh & Dyer method [26]. Samples were analyzed for cholesterol and triglyceride content.

Cholesterol and Triglyceride Analysis in Plasma and Liver Lipid Samples

Colorimetric assays were used to determine total (TC) (11489232, Roche Molecular Biochemicals) and free cholesterol (FC) (113609910930, DiaSys Diagnostic Systems Gmbh, Holzheim, Germany) levels in plasma and liver lipid samples. Cholesterol Standard FS (DiaSys Diagnostic Systems Gmbh, Holzheim, Germany) was used as a reference. Triglyceride (TG) levels were determined using Trig/GB kit (1187771, Roche Molecular Biochemicals) with Roche Precimat Glycerol standard (16658800) as a reference.

Antibodies

In the described studies the following antibodies were used: mouse antiβ-Actin (A5441, Sigma-Aldrich Chemie B.V., Zwijndrecht, the Netherlands), MitoProfile® Total OXPHOS Rodent WB Antibody Cocktail (#ab110413; Abcam, Cambridge, UK), mouse anti-P-Jnk (#9255, Cell Signaling Technology, BIOKÉ-Leiden, the Netherlands), rabbit anti-Jnk (#9258, Cell Signaling Technology), rabbit anti-P-p38 (#9215, Cell Signaling Technology), rabbit anti-p38 (#9212, Cell Signaling Technology), rabbit anti-HO-1 (#SPA-896, Stressgen), rabbit anti-Cd68 (#137002, Biolegio, Nijmegen, the Netherlands), goat anti-rabbit IgG (H + L)- HRP Conjugate (170-6515, Bio-Rad Laboratories BV, Veenendaal, the Netherlands), goat 7 anti-mouse IgG (H + L)-HRP Conjugate (170-6516, Bio-Rad Laboratories BV, Veenendaal, the Netherlands).

Histology

Liver histological analysis was performed as described before [27]. Briefly, paraffin- embedded or snap-frozen liver sections were stained (H&E, ORO and Cd68 staining) and scored blindly by an experienced pathologist using an established scoring system for determining level and type of steatosis, as well as grade of lobular inflammation [28].

145 CHAPTER 7

Gene Expression Analysis

Total RNA isolation and subsequent cDNA preparation with following quantitive real-time PCR (qRT-PCR) were performed as described before (Chapter 6, this thesis). List of primer sequences is provided in Table S1.

Immunoblot analysis

Liver samples of approximately 100 mg were homogenized and their concentration was measured using Bradford assay for protein determination. 30 µg of protein was loaded per lane of a sodium dodecyl sulfate-polyacrylamide electrophoresis gel (SDS-PAGE). Detection of bands was performed using ChemiDoc™ XRS+ System (Bio-Rad Laboratories BV, Veenendaal, the Netherlands).

Statistical Analysis

All results are expressed as mean ± SEM. Statistical analysis was performed using Prism 5.00 for Windows (GraphPad Software, CA, USA) and unpaired Student’s t test. Results of P<0.05 were considered statistically significant: * P<0.05, **P<0.001, ***P<0.0001.

146 COMMD1 and steatosis progression References

[1] G.C. Farrell and C.Z. Larter, Nonalcoholic fatty liver disease: From steatosis to cirrhosis, Hepatology, 43 (2006) S99-S112. [2] C.A. Matteoni, Z.M. Younossi, T. Gramlich, N. Boparai, Y.C. Liu, and A.J. McCullough, Nonalcoholic fatty liver disease: A spectrum of clinical and pathological severity, Gastroenterology, 116 (1999) 1413-1419. [3] C.H. Kim and Z.M. Younossi, Nonalcoholic fatty liver disease: A manifestation of the metabolic syndrome, Cleve Clin J Med, 75 (2008) 721-728. [4] E.J. Park, J.H. Lee, G.-Y. Yu, G. He, S.R. Ali, R.G. Holzer, C.H. Osterreicher, H. Takahashi, and M. Karin, Dietary and Genetic Obesity Promote Liver Inflammation and Tumorigenesis by Enhancing IL-6 and TNF Expression, Cell, 140 (2010) 197-208. [5] P. Paschos and K. Paletas, Non alcoholic fatty liver disease and metabolic syndrome, Hippokratia, vol. 13, no. 1, 9-19, 01-03 2009. [6] T. Luedde and R.F. Schwabe, NF-[kappa]B in the liver - linking injury, fibrosis and hepatocellular carcinoma, Nat Rev Gastroenterol Hepatol, 8 (2011) 108-118. [7] P. Bartuzi, Wijshake, D.C. Dekker, A. Fedoseienko, N.J. Kloosterhuis, S.A. Youssef, H. Li, Shiri-Sverdlov, J.-A. Kuivenhoven, de Bruin, E. Burstein, M.H. Hofker, and B. van de Sluis, A cell type-specific role for murine Commd1 in liver inflammation, Biochim Biophys Acta, 1842 (2014) 2257-2265. [8] P. de Bie, B. van de Sluis, E. Burstein, and R. Berger, Characterization of COMMD protein-protein interactions in NF-kappaB signalling, Biochem J, 398 (2006) 63-71. [9] E. Burstein, J.E. Hoberg, A.S. Wilkinson, J.M. Rumble, R.A. Csomos, C.M. Komarck, G.N. Maine, J.C. Wilkinson, M.W. Mayo, and C.S. Duckett, COMMD proteins, a novel family of structural and functional homologs of MURR1, J Biol Chem, 280 (2005) 22222-32. [10] L. Ganesh, E. Burstein, A. Guha-Niyogi, M.K. Louder, J.R. Mascola, L.W. Klomp, C. Wijmenga, C.S. Duckett, and G.J. Nabel, The gene product Murr1 restricts HIV-1 replication in resting CD4+ lymphocytes, Nature, 426 (2003) 853-857. [11] B. van de Sluis, J. Rothuizen, P.L. Pearson, B.A. van Oost, and C. Wijmenga, Identification of a new copper metabolism gene by positional cloning in a purebred dog population, Hum Mol Genet, 11 (2002) 165-173. [12] W.I. Vonk, P. Bartuzi, P. de Bie, N. Kloosterhuis, C.G. Wichers, R. Berger, S. Haywood, L.W. Klomp, C. Wijmenga, and B. van de Sluis, Liver-specific Commd1 knockout mice are susceptible to hepatic copper accumulation, PLoS One, 6 (2011) e29183. [13] Y. Ke, A.G. Butt, M. Swart, Y.F. Liu, and F.J. McDonald, COMMD1 downregulates the epithelial sodium channel through Nedd4-2, Am J Physiol Renal Physiol, 298 (2010) F1445-56. [14] L. Drévillon, G. Tanguy, A. Hinzpeter, N. Arous, A. de de Becdelièvre, A. Aissat, A. Tarze, M. Goossens, and P. Fanen, COMMD1-mediated ubiquitination regulates CFTR trafficking, PLoS One, 6 (2011) e18334. [15] W.I.M. Vonk, V. Kakkar, P. Bartuzi, D. Jaarsma, R. Berger, M.H. Hfker, L.W.J. Klomp, C. Wijmenga, 7 H.H. Kampinga, and B. van de Sluis, The copper metabolism MURR1 domain protein 1 (COMMD1) modulates the aggregation of misfolded protein species in a client-specific manner, PLoS One, 9 (2014) e92408. [16] P. Bartuzi, D.C. Dekker, R.P. Favier, H. Fieten, G. Brufau, N. Huijkman, J.H. Levels, C.D. van Ijzendoorn, A.K. Groen, E. Burstein, J.D. Horton, M.H. Hofker, J.-A. Kuivenhoven, and B. van de Sluis, Hepatic COMMD1 deficiency increases plasma low-density lipoprotein levels due to impaired intracellular trafficking of the low-density lipoprotein receptor in mice and dogs, in preparation. [17] D.M. Dambach, L.M. Watson, K.R. Gray, S.K. Durham, and D.L. Laskin, Role of CCR2 in macrophage migration into the liver during acetaminophen-induced hepatotoxicity in the mouse, Hepatology, 35 (2002) 1093-1103. [18] S. Tandra, M.M. Yeh, E.M. Brunt, R. Vuppalanchi, O.W. Cummings, A. Ãœnalp-Arida, L.A. Wilson, and N. Chalasani, Presence and significance of microvesicular steatosis in nonalcoholic fatty liver disease, J Hepatol, 55 (2011) 654-659.

147 CHAPTER 7

[19] K. Begriche, J. Massart, M.-A. Robin, F. Bonnet, and B. Fromenty, Mitochondrial adaptations and dysfunctions in nonalcoholic fatty liver disease, Hepatology, 58 (2013) 1497-1507. [20] Son, Y.-K. Cheong, N.-H. Kim, H.-T. Chung,. Kang, and H.-O. Pae, Mitogen-activated protein kinases and reactive oxygen species: How can ROS activate MAPK pathways?, J Signal Transduct, 2011 (2011) 792639. [21] S.W. Ryter, J. Alam, and A.M. Choi, Heme oxygenase-1/carbon monoxide: From basic science to therapeutic applications, Physiol Rev, 86 (2006) 583-650. [22] G. Marchesini, M. Brizi, G. Bianchi, S. Tomassetti, E. Bugianesi, M. Lenzi, A.J. McCullough, S. Natale, G. Forlani, and N. Melchionda, Nonalcoholic fatty liver disease: A feature of the metabolic syndrome, Diabetes, 50 (2001) 1844-1850. [23] A. Fedoseienko, P. Bartuzi, and B. van de Sluis, Functional understanding of the versatile protein copper metabolism MURR1 domain 1 (COMMD1) in copper homeostasis, Ann N Y Acad Sci, 1314 (2014) 6-14. [24] C.A.J. Owen and J. Ludwig, Inherited copper toxicosis in Bedlington terriers: Wilson’s disease (hepatolenticular degeneration), Am J Pathol, 106 (1982) 432-4. [25] H. Nederbragt, T.S. van den Ingh, and P. Wensvoort, Pathobiology of copper toxicity, Vet Q, 6 (1984) 179-235. [26] E.G. Bligh and W.J. Dyer, A rapid method of total lipid extraction and purification, Can J Biochem Physiol, 37 (1959) 911-7. [27] M. Aparicio-Vergara, P.P. Hommelberg, M. Schreurs, N. Gruben, R. Stienstra, R. Shiri-Sverdlov, N.J. Kloosterhuis, A. de Bruin, B. van de Sluis, D.P. Koonen, and M.H. Hofker, Tumor necrosis factor receptor 1 gain-of-function mutation aggravates nonalcoholic fatty liver disease but does not cause insulin resistance in a murine model, Hepatology, 57 (2013) 566-576. [28] D.E. Kleiner, E.M. Brunt, M. Van Natta, C. Behling, M.J. Contos, O.W. Cummings, L.D. Ferrell, Y.-C. Liu, M.S. Torbenson, A. Unalp-Arida, M. Yeh, A.J. McCullough, and A.J. Sanyal, Design and validation of a histological scoring system for nonalcoholic fatty liver disease, Hepatology, 41 (2005) 1313-1321.

148 COMMD1 and steatosis progression Supplementary TABLES

Table S1. qRT-PCR primer sequences.

Locus FOR 5’ → 3’ REV 5’ → 3’ A20 GCTCTGAAAACCAATGGTGATG CCGAGTGTCTGTCTCCTTAAG Abca1 GGGAAGGACATTCGCTCGG TTGCTTTTCAGCTTGCTCGG Abcg1 GTTCAGGAGGCCATGATGGT CCGTCTGCCTTCATCCTTCTC Abcg5 CTGCATGTGTCCTACAGCGTCA AGATGCACATAATCTGGCCACTCTC Abcg8 TCAGTCCAACACTCTGGAGGTCA ATTTCGGATGCCCAGCTCAC Acc-1 TCTCTGGCTTACAGGATGGTTTG GAGTCTATTTTCTTTCTGTCTCGACCTT Apoa1 CCCAGTCCCAATGGGACA CAGGAGATTCAGGTTCAGCTGTT Apoa5 GACTACTTCAGCCAAAACAGTTGGA AAGCTGCCTTTCAGGTTCTCCT aSma ACGAACGCTTCCGCTGC GATGCCCGCTGACTCCAT Cd11b TCAGAGAATGTCCTCAGCAG TGAGACAAACTCCTTCATCTTC Cd36 GATCGGAACTGTGGGCTCAT GGTTCCTTCTTCAAGGACAACTTC Cd68 TGACCTGCTCTCTCTAAGGCTACA TCACGGTTGCAAGAGAAACATG Col1a1 AACCCTGCCCGCACATG CAGACGGCTGAGTAGGGAACA Cyclophilin A TTCCTCCTTTCACAGAATTATTCCA CCGCCAGTGCCATTATGG Cyp27a1 GCCTCACCTATGGGATCTTCA TCAAAGCCTGACGCAGATG Cyp7a1 AGCAACTAAACAACCTGCCAGTACTA GTCCGGATATTCAAGGATGCA Dgat1 GTGCACAAGTGGTGCATCAG CAGTGGGACCTGAGCCATCA Dgat2 TTCCGAGACTACTTTCCCATCCAG ACCAGCCAACGTAGCCAAATAGG Fas AGATCCTGGAACGAGAACACGAT GAGACGTGTCACTCCTGGACTTG HmgCoAR AGCTTGCCCGAATTGTATGTG TCTGTTGTGAACCATGTGACTTC Icam ACTGCACGTGCTGTATGGTC CTGCAGGTCATCTTAGGAGATG Il-1a AACCAAACTATATATCAGGATGTG ACGGGCTGGTCTTCTCCTTG Il-1b TGCAGCTGGAGAGTGTGG TGCTTGTGAGGTGCTGATG Ldlr CATATGCATCCCCAGTCTTTG GCAGTGCTCCTCATCTGACTTG Lxra TGGTAATGTCCAGGGCTCCAG TCCACAACTCCGTTGCAGAA Mcp-1 GCTGGAGAGCTACAAGAGGATCA ACAGACCTCTCTCTTGAGCTTGGT 7 Ppara TTCCCTGTTTGTGGCTGCTAT TGCAACTTCTCAATGTAGCCTATGTT Pparg GCCCTTTGGTGACTTTATGG CTCGATGGGCTTCACGTT Scd-1 ATGCTCCAAGAGATCTCCAGTTCT CTTCACCTTCTCTCGTTCATTTCC Srb-1 TTGGCCTGTTTGTTGGGATG GGATTCGGGTGTCATGAAGG Srebp-1c TTACTCGAGCCTGCCTTCAG TAGATGGTGGCTGCTGAGTG Srebp-2 CGACGAGATGCTACAGTTTG GGTAGGAGAGACTTTGACCTG Tgfb GCCCTTCCTGCTCCTCATG CCGCACACAGCAGTTCTTCTC Timp-1 CGCCTAAGGAACGGAAATTTG AGGGATAGATAAACAGGGAAACACTGT Tnfa GTAGCCCACGTCGTAGCAAAC AGTTGGTTGTCTTTGAGATCCATG

149

CHAPTER 8

Discussion

Discussion

COMMD1 has been associated with a number of cellular processes since its discovery in 2002 as a modifier in copper homeostasis [1] and a potential NF-κB suppressor [2] [3]. This thesis provides new insights into the biological role of COMMD1 in NF-κB signaling and the inflammatory response, steatosis, and intracellular trafficking of low- density lipoprotein receptor (LDLR). In this chapter we attempt to place the new findings in the context of the current understanding of COMMD1 function.

COMMD1 – A PUZZLING PLEIOTROPIC PROTEIN

COMMD1, previously known as MURR1, was initially identified as a gene regulating copper homeostasis [1]. The COMMD1 mutation in Bedlington terriers affects the gene function and impairs hepatic copper excretion into the bile, which results in an excessive copper accumulation in livers of COMMD1-deficient dogs [4]. This hepatic defect leads in time to copper toxicosis (CT) [5]. Hepatic copper toxicity has also been described in humans as well as other mammals, such as rats, mice, and sheep [5]. In humans, the hereditary copper storage disorder is known as Wilson’s disease and is caused by mutations in ATP7B, a gene encoding a copper-transporting P-type ATPase. To date, mutations in ATP7B have only been described in humans, rats and mice, but not in dogs [6,7]. However, given that COMMD1 is able to interact with ATP7B, it has been suggested that COMMD1 regulates the function of ATP7B and thereby mediates the biliary copper excretion. In addition to its role in copper homeostasis, it has emerged that COMMD1 plays a role in inflammatory signaling, which will be discussed in detail in the next section. Following the discovery of COMMD1 as a copper toxicity gene, numerous proteins have been identified as physically associated with COMMD1[8-14], making the biological function of this relatively small protein (21 kDa) truly puzzling to understand. These discoveries linked COMMD1 to a number of pathways and cellular processes, like inflammation [3], hypoxia adaption [15], ion transporter regulation [12, 16], cystic fibrosis [17], DNA damage response [11], and the activation and maturation of superoxide dismutase (SOD1), as well as to a role in mediating the aggregation properties of misfolded proteins [18]. Although the exact mechanism by which COMMD1 regulates these processes is still unclear, recent studies suggested that COMMD1 acts as a scaffold/adaptor protein to mediate ubiquitination, maturation and trafficking of its client proteins. In order to uncover the true biological role of COMMD1, a whole body Commd1 -knockout mouse was generated. Surprisingly, it was found that, in contrast to COMMD1- deficient dogs, Commd1-knockout mice are embryonically lethal [15]. There is no exact 8 explanation for the phenotypic differences between mice and dogs, but the embryonically lethal phenotype in mice supports the idea that COMMD1 is a multifunctional protein and that it modulates various important biological processes. In order to overcome the lethal phenotype and to evaluate the function of Commd1 in vivo, a conditional Commd1- knockout mouse model was generated, with a genetic depletion of Commd1 specifically

153 CHAPTER 8

in hepatocytes; this confirmed its role in hepatic copper homeostasis [19]. Furthermore, in order to study in vivo the role of Commd1 in inflammatory processes, a myeloid Commd1-deficient mouse model was used. The studies presented in this thesis describe both the hepatic, as well as the myeloid model of Commd1 deficiency, demonstrating novel cell-type specific effects of Commd1 in mice during inflammation, steatosis, and in hepatic protein trafficking.

COMMD1 AND INFLAMMATION

Inflammation plays a crucial role in the pathogenesis of various diseases, and a key signaling pathway in the inflammatory response is the NF-κB pathway. NF-κB is known as a cellular responder to a vast spectrum of stress-inducing stimuli. This results in rapid activation of the NF-κB pathway, which assures proper detection and response to potential threats. NF-κB activation results in the recruitment and activation of immune cells through transcriptional control of cytokines, chemokines and adhesion molecules. In addition to its role in immunity and the inflammatory response, NF-κB also has a protective role by regulating the expression of anti-apoptotic genes. However, prolonged NF-κB activity is very dangerous and has been associated with the progression and behavior of many different types of cancer, such as lung, ovarian, breast and liver cancer [20]. Moreover, sustained inflammation has a detrimental effect on the progression of various other diseases, like asthma [21], colitis [22], neurodegenerative disorders [23] and skin diseases [24]. Additionally, it is know that chronic inflammation is a pathological component of the metabolic syndrome. Metabolic syndrome is a group of risk factors, such as obesity, dyslipidemia or hypertension, which can lead to the development of various disorders including atherosclerosis, diabetes, and fatty liver diseases, such as non-alcoholic fatty liver disease (NAFLD). NAFLD can further progress to the more severe non-alcoholic steatohepatitis (NASH), liver fibrosis, and eventually liver cancer [25]. It is therefore crucial for the inflammatory signaling to be terminated efficiently. However, despite the fact that the NF-κB pathway has been studied extensively, there is still much to be learned, especially about the mechanisms governing its timely termination and how to protect cells from the harmful effects of chronic inflammation. To date, several inhibitors have been described as playing a role in NF-κB suppression [26], including COMMD1. COMMD1 is a prototype member of the COMMD family of proteins, and it was described as inhibiting NF-κB in vitro [3]. The molecular mechanism by which COMMD1 inhibits NF-κB has been studied extensively (reviewed in [26]). COMMD1 interacts with the NF-κB subunit p65 (RelA), and thereby promotes p65 proteasomal degradation [3, 27]. COMMD1 associates with the E3 ubiquitin ligase complex (ECSSOCS1), facilitating the interaction between ECSSOCS1 and p65. As a result, COMMD1 destabilizes the interaction of p65 with chromatin, leading to subsequent proteasomal degradation of the ubiquitinated p65. Nevertheless, despite this knowledge, the true biological role of COMMD1 in inflammation is still unknown. We therefore studied

154 Discussion the consequence of COMMD1 deficiency on the inflammatory response in various diseases associated with inflammation, such as sepsis, colitis, cancer, liver inflammation, and NAFLD [28] (Chapters 4, 5 and 7). The conditional Commd1-knockout mouse allowed us to investigate the role of COMMD1 in NF-κB mediated inflammation in a cell-type-specific manner. We focused on the myeloid cell lineage and hepatocytes. Macrophages have an indispensable role in the progression of the diseases we studied and their chronic activation can lead to detrimental physiological effects, including tissue degradation and fibrosis. In addition, NF-κB signaling in hepatocytes has a crucial role in cellular survival and in the development of inflammation-associated metabolic diseases, such as diabetes and NAFLD/NASH. In this thesis we show, for the first time, that myeloid Commd1 can suppress inflammation in vivo. Myeloid Commd1-deficient mice showed lower survival in endotoxin-induced sepsis and in a dextran sodium sulfate (DSS)-induced experimental model of colitis (Chapter 4). These observations were associated with a significantly higher inflammatory reaction than in the wild-type (WT) littermates, thus supporting the role of COMMD1 as an inflammatory suppressor. Consistently, myeloid Commd1 attenuates diet-induced inflammation. Using a mouse model of NAFLD (by feeding mice a high-fat, high-cholesterol diet (HFC) for 12 weeks), we observed that the level of liver inflammation was increased in myeloid Commd1-deficient mice (Chapter 5). In conclusion, depletion of Commd1 in myeloid cells renders mice more sensitive to various inflammatory disorders, which suggests a general role of myeloid Commd1 in restraining inflammation, and is in line with the importance of myeloid NF-κB activation in sustaining the inflammatory response in various diseases [29]. Surprisingly, despite the elevated cytoplasmic and nuclear levels of p65 in Commd1- deficient hepatocytes, we saw no effect on the diet-induced inflammation in the hepatocyte- specific Commd1-knockout mice (Chapters 5 and 7), and this mouse model even showed decreased inflammation after a long period (20 weeks) of HFC feeding (Chapter 7). We have no good explanation for this latter observation, but we believe that the reduced inflammation is probably an indirect effect of long-term HFC feeding in hepatocyte Commd1-deficient mice. These results will be discussed further in the following section. As also shown in Chapter 7, feeding mice a HFC diet results in a myriad of alterations affecting the cascade of metabolic processes [30] and could therefore affect the results of our study regarding the diet-induced liver inflammation in hepatocyte-specific Commd1-deficient mice. We therefore went on to confirm our findings by crossing liver- specific Commd1-knockout mice with a transgenic mouse model for low-grade chronic liver inflammation (p55Δns/Δns) [31, 32] (Chapter 5). The p55Δns/Δns mice are homozygous 8 for a mutation in TNFR1, which leads to impaired shedding of the receptor, and this in turn results in a low-grade chronic liver inflammation. However, depletion of hepatic Commd1 on this genetic background did not exacerbate the liver inflammation. The same results were obtained when hepatocyte-specific Commd1-deficient mice were crossed with transgenic mice expressing a constitutively active form of the NF-κB activator, IKK2, in hepatocytes

155 CHAPTER 8

(unpublished data) [33]. Altogether, the depletion of hepatocyte Commd1 did not alter the hepatic inflammatory response, independent of whether the genetic alteration leading to an elevated hepatic inflammation was introduced via TNFR1 or more downstream via the NF-κB activator, IKK2. In addition, Commd1 depletion in intestinal epithelial cells also did not affect the pathophysiology of DSS-induced colitis (Chapter 4), although increased NF-κB activity in intestinal epithelial cells (IECs) aggravates the progression of colitis and creates a tumor-promoting environment [33, 34]. Together, the fact that only myeloid Commd1 seems to play a crucial role in inflammatory responses suggests that Commd1 restrains inflammation in a cell-type specific manner. In line with in vitro studies [3, 27], we observed that hepatocyte Commd1 depletion increased the stability of p65 (RelA). However, despite the fact that depletion of Commd1 in hepatocytes led to a clear increase in hepatic cytosolic and nuclear p65 levels, this did not result in an increase in NF-κB activity [35]. Since the NF-κB is tightly controlled by different mechanisms [36-38], it is possible that compensatory pathways are activated to suppress NF-κB activity in Commd1-deficient hepatocytes. However, we excluded the possibility that the expression of the NF-κB inhibitors, like A20 or IκBα, which are directly regulated by NF-κB [39, 40], are increased as a negative-feed loop mechanism. It is highly possible that other molecular mechanisms are involved in preventing uncontrolled NF-κB activity in Commd1-deficient hepatocytes. For example, it has been shown that post-transcriptional modifications (PTM) of p65, like phosphorylation, have a pivotal role in fine-tuning the level of NF-κB activity [41]. Phosphorylation at a residue serine 468 (S468) within the transactivation domain 2 (TAD2) of p65 can down-regulate the basal activity of NF-κB. Phosphorylation of S468 can be mediated by GSK3β [42] and IKKβ [43] and has been shown to be essential for the interaction of COMMD1 with p65 [44]. Furthermore, diminished p65 phosphorylation at sites like Ser276 or Ser536 is also known to result in suppressed NF-κB-dependent gene expression [45-47]. Whether PTM or other molecular events (e.g. epigenetic events) compensate for the increased p65 levels in Commd1- deficient hepatocytes needs to be investigated, since it would be of great interest to gain a better insight into the molecular mechanism which controls the NF-κB activity so stringently.

COMMD1 AND HEPATIC STEATOSIS

Loss of myeloid Commd1 was found to increase diet-induced hepatic inflammation. However, in addition to this, we observed that depletion of myeloid Commd1 also leads to elevated steatosis after 12 weeks of HFC feeding (Chapter 5). Hepatic steatosis, if present without an additional inflammatory or fibrotic component, is considered a benign, initial stage of non-alcoholic fatty liver disease (NAFLD) [48], but its progression to non-alcoholic steatohepatitis (NASH) is associated with a more severe phenotype. Steatosis is commonly thought of as the “first hit” that increases liver vulnerability to the effect of factors like oxidative stress and inflammatory cytokines [49]. Since myeloid Commd1 depletion also

156 Discussion leads to elevated fat accumulation after 12 weeks of HFC diet, we speculate that this increase is caused by the higher expression of inflammatory cytokines such as TNFα. Overeating is known to result in excessive hepatic fatty acid (FA) levels and can lead to increased β-oxidation together with a high production of reactive oxygen species (ROS) [50]. The outcome of these events is an increase in peroxidation of lipids and an elevated - O2 production, which activates the hepatic resident macrophages (Kupffer cells (KC)) to produce inflammatory factors. These include Tnfα, which was found to be upregulated in myeloid Commd1-deficient mice. On the one hand, KC play an important role in hepatic dyslipidemia development. There are studies reporting that the diet-induced steatosis can be reduced through KC depletion, and that both Il-6 and Tnfα play a significant role in this process [51, 52]. On the other hand, however, this effect is contradicted by another study which reported TNFα signaling was uncoupled from steatosis development [32]. Despite the increased expression of the pro-inflammatory cytokines Il-6 and Tnfα in this mouse model, hepatic lipid accumulation was not elevated. The reason for these contradictory results is not yet known, but it is important to consider the experimental approach when interpreting such data. For instance, using injections with a human recombinant TNFα [53, 54] in order to study the role of TNFα in hepatic lipogenesis might lead to beyond- physiological-concentrations of this cytokine. Furthermore, differences in the content of the diets used in different experiments might influence the results significantly. Finally, the true difficulty is to make a direct comparison between different genetic models, such as a gain-of-function TNFR1 knockin mouse model with a loss-of-function TNFR1 mouse model. Drawing simple conclusions based on some types of studies can often be difficult. Additionally, it is known that the inflammatory response has different characteristics depending on the time point when it is investigated; some genes are activated in response to an inflammatory stimulus very early, whereas other genes fall into the category of late- responders [55]. This makes the set-up of either acute or chronic inflammatory signaling of particular importance when discussing the physiological relevance of experimental findings. Furthermore, our current knowledge on NAFLD progression in humans suggests that the pathogenesis of NAFLD might also differ between individuals. This view is reflected in three observations: some patients never progress from benign steatosis to NASH, while in some patients the hepatic fat accumulation leads in time to severe NASH development, and finally, in others NASH is observed to develop without the preceding hepatic steatosis [56]. It is therefore possible that in the particular experimental settings of myeloid Commd1- deficient mice fed a HFC-diet, an excessive TNFα signaling could result in elevated hepatic steatosis. To confirm this, myeloid Commd1-deficient mice could be crossed with TNFR1 8 knockout mice to evaluate the role of TNFα in the progression of steatosis in myeloid Commd1-deficient mice. It is interesting that we also observed an elevated hepatic lipid accumulation in HFC-diet-fed liver-specific Commd1 knockout mice, although genetic ablation of hepatic Commd1 did not affect the level of diet-induced inflammation. The exact mechanism is not

157 CHAPTER 8

yet fully understood, but one can speculate that it might be a similar mechanism to the one involved in regulating the function of the copper-transporting ATPase ATP7B. One could further speculate that COMMD1 also mediates other transporters such as ATP-binding cassette (ABC) transporters like ABCG5 and 8, which are involved in biliary cholesterol secretion. As a result, the possible effects on biliary lipid excretion would lead to higher hepatic cholesterol levels. However, this was ruled out by our trans-intestinal cholesterol efflux (TICE) experiment (unpublished data discussed in Chapter 5), in which no significant alterations in biliary lipid content were detected. Alternatively, it is possible that Commd1 actions are related to lipid trafficking between cellular compartments and that Commd1 works as an adaptor protein involved in cargo delivery between different vesicles. In line with this way of thinking, in the event of the absence of Commd1, there would be a greater accumulation of lipids. This could further be attributed to the possible problems with the sorting and fusion of vesicles resulting in cholesterol retention within the cells. The process of sorting and fusion of vesicles is known to play a role in autophagy [57], and its inhibition has been recently associated with decreased lipid breakdown resulting in a greater accumulation of triglycerides and cholesterol in the lipid droplets [58, 59]. Considering the above facts, the lack of a scaffold protein like Commd1 might result in impaired cellular lipid trafficking and subsequent lipid accumulation within the cells. Remarkably, depletion of hepatocyte-specific Commd1 in concert with prolonged HFC feeding led to alterations in hepatic lipid accumulation pattern (Chapter 7). Steatosis is described as either macro- or microvesicular type and although the significance of each type is not yet clear, they seem to be very important. Histologically, macrovesicular steatosis results in nucleus displacement to the cell periphery, whereas microvesicular steatosis leads to a foamy appearance of cytoplasm [60]. Twelve weeks of HFC dietary intervention in mice led to the development of steatosis, however both WT and Commd1∆Hep mice showed only hepatic microvesicular steatosis. After an additional 8 weeks of HFC-feeding, we observed that WT mice displayed a mixture of both micro- and macrovesicular steatosis. Though little is known about this process, our results point to the conclusion that microvesicular steatosis is possibly the first observed entity, which in time evolves into macrovesicular steatosis. Our hypothesis is supported by reports on rodents in which microvesicular steatosis was found to precede the macrovesicular type [61]. In accordance with this progression, and similar to what we observed in Commd1∆Hep mice after long-term HFC feeding, a lower hepatic inflammatory tone was noted along with the microvesicular type of fat accumulation. Despite a mixture of micro- and macrovesicular steatosis in WT mice, the steatotic phenotype of mice with hepatocyte Commd1 depletion remained mainly microvesicular after nearly 5 months of HFC feeding. We therefore speculate that knocking out Commd1 in hepatocytes delays the progression from micro- to macrovesicular steatosis. Although the correlation between the presence and degree of micro- or macrovesicular steatosis and the severity of NAFLD/NASH is not yet clear, if present in a significant percentage, macrovesicular steatosis is associated with the primary graft non-function

158 Discussion and delayed postoperative function [62]. Thus, people with a particularly high percentage of hepatic macrovesicular steatosis are often rejected as liver donors. This could be associated with a more advanced NAFLD stage and likely higher hepatic inflammation in these patients. On the other hand, the role and contribution of microsteatosis to the transplant rejection is not clear. Nevertheless, some studies argue that this risk should not be attributed solely to the levels of macrovesicular steatosis, but to a combination of macro- and severe microvesicular steatosis that ultimately results in an increased potential for liver rejection [62]. Altogether, this suggests that the importance of the presence and level of microvesicular steatosis should not be underestimated. The latter finding is in line with an observation that macrovesicular steatosis rarely progresses to fibrosis or cirrhosis [60]. Although no clear mechanism explaining these phenotypes has been discovered so far, microvesicular steatosis is often thought to be associated with an impaired mitochondrial β-oxidation function. We could not confirm this in our model, since neither protein levels of mitochondrial subunits, nor activation status of ROS-induced stress kinases JNK and p38 were found to be altered. Therefore, given the data obtained, we could hypothesize that Commd1 seems to affect not only the level of steatosis at the initial stage of NAFLD but, as the disease progresses, also the way in which excess fat is stored in hepatic tissue. However, further research is needed to determine precisely which mechanisms are involved in this process.

COMMD1 AND PROTEIN TRAFFICKING

During the work for this thesis we made an unexpected observation that suggests Commd1 may play a role in regulating the clearance of LDL via the LDLR. We found that hepatocyte- specific Commd1 depletion in mice, as well as the whole body Commd1 deficiency in dogs, leads to significantly increased plasma LDL-c levels (Chapter 6). LDL cholesterol (LDL-c) is considered to be the atherogenic form of cholesterol and is cleared from the circulation through LDLR, the main hepatic LDL-c receptor. LDL-c binds to LDLR and is internalized in clathrin-coated pits. It eventually reaches lysosomes, where cholesterol cargo is unloaded and LDLR is recycled back to the plasma membrane for a new round of ligand endocytosis [63]. Mutations found so far in LDLR affect the process of receptor synthesis, maturation or endocytosis at different steps, leading mostly to impaired LDLR function resulting in elevated LDL-c concentrations in the bloodstream [64]. The significance of our finding is underlined by the fact that mice and dogs both have mainly an HDL cholesterol profile, and the effect observed in Commd1∆Hep mice was already present upon regular chow feeding, without introducing any additional environmental 8 stressor, such as a cholesterol-rich diet. Moreover, the fact that this effect is detected in mice and dogs indicates that the observed phenotype is not restricted to a specific species. One could hypothesize that Commd1, as a proposed scaffold protein, binds to the cytosolic tail of LDLR receptor (Chapter 6) to mediate the internalization of the LDLR upon binding of LDLc. Through phosphatidylinositol 4,5-bisphosphate (PtdIns(4,5)P2) [65],

159 CHAPTER 8

LDL

clathrin- coatedpit COMMD1 ? ARH (1) (2) RECYCLING ? COMMD1 VESICLE

GOLGI COATED COMMD1? VESICLE (4)

H+ ER LDLR ENDOSOME COMMD1 (3) ?

SREBP-2 LDLR

LYSOSOME

Figure 1. Hypothetical sites of Commd1 action in LDLR trafficking. Commd1 could possibly: (1) interact with LDLR in Golgi, affecting its maturation and/or trafficking towards the cell membrane, (2) associate with LDLR at the membrane, (3) affect fusion/sorting of vesicle from endosomes to lysosomes or (4) to recycling endosomes.

an important signaling lipid, COMMD1 is recruited to the plasma membrane to facilitate the endocytosis of the LDLR (Fig. 1). Recruitment of Commd1 to the membrane via

an interaction with PtdIns(4,5)P2 could serve as a platform for the binding between receptor and other adaptor proteins such as ARH, facilitating the internalization of the LDLR upon LDL binding. Another possibility is that Commd1 governs the fusion and sorting of vesicles

160 Discussion from endosomes to lysosomes or recycling endosomes, and back to the cell membrane. In the case of Commd1 deficiency it would result in LDLR retention in endosomes. In our study (Chapter 6) we established an interaction between Commd1 and LDLR. Furthermore, based on our in vitro studies, we have shown that in mouse embryonic fibroblasts (MEFs) knockout for Commd1, the uptake of labeled LDL was impaired. Altogether this suggests a plausible and important role for Commd1 in LDLR functioning. Moreover, our own data and that from others [9, 17, 65-67] suggest that Commd1 co-localizes with protein markers for endosomal compartments, like early and recycling endosomes or lysosomes. To further confirm this, we used mouse liver tissue and showed that Commd1 co-precipitates in the sucrose density gradient in the same fractions as not only LDLR, but also ARH, EEA-1 (early endosomal marker), and Rab11 (recycling endosome marker). Additionally, PCSK9-induced LDLR degradation was reduced in knockout MEFs, suggesting that deficiency of Commd1 affects LDLR accessibility for PCSK9-directed lysosomal targeting. This hypothesis is in line with our preliminary biotinylation data, in which we observed that depletion of Commd1 in primary hepatocytes resulted in decreased LDLR levels at the plasma membrane (unpublished results), suggesting that, in the event of Commd1 deficiency, LDLR likely remains trapped in one of the endocytic compartments. If Commd1 regulates LDLR internalization, one would expect the level of LDLR at the plasma membrane to be increased [68, 69]. This, together with the facts that Commd1 was shown to co-localize with markers of endocytic compartments and that Commd1 deficiency limits PCSK9-induced receptor degradation, suggests that Commd1 is not involved in LDLR internalization. This conclusion is further supported by our observation that the relative rise (approximately 35%) of LDLc plasma levels in Commd1∆Hep mice compared to WT mice is independent of the mouse diet. COMMD1-mediated LDLR trafficking does not therefore seem to be controlled by cholesterol as shown by ARH [68] and β-arrestin2 [70]. ARH and β-arrestin2 both mediate the internalization of the LDLR upon LDL-c binding; this indicates that COMMD1 participates in other part of the “life cycle of the LDLR” as demonstrated for ARH and β-arrestin2. It is very likely that the arrest could happen at the point of the recycling of the LDLR back to the plasma membrane. Commd1 has been shown to co-localize with early and recycling endosomal markers, like Rab11, EHD1 and transferrin receptor (TfR) [17]. Thus, involvement of Commd1 in receptor recycling pathways could be a general function of Commd1. If this is true, the LDLR would be trapped within the recycling endosomes and, consequently, LDLR would not be accessible for extracellular PCSK9 to drive the lysosomal LDLR-degradation (Chapter 6). 8 Finally, Commd1 could interact with LDLR already in the Golgi apparatus, where LDLR maturation takes place and lack of Commd1 would then result in LDLR trapped in Golgi. Though this possibility cannot be ruled out completely, it seems rather unlikely, given that several studies found Commd1 to co-localize with the trans-Golgi to a much more limited extent than it co-localized with endosomal compartments [65, 66].

161 CHAPTER 8

Endosomes are the intersection of proteins, which are internalized and need to be recycled back to the plasma membrane or sorted to the other cellular compartments, such as lysosomes or the Golgi apparatus. Additionally, endosomes also sort newly biosynthesized proteins from the Golgi to the membrane. Thus, the increased LDL-c level in circulation can generally result from a problem with receptor recycling or sorting of newly synthesized protein to the plasma membrane. The role of COMMD1 in recycling or sorting proteins is in line with previous findings. It has been reported that Commd1 insufficiency impairs the retrograde transport of Atp7b from the cell periphery back to the trans-Golgi network (TGN) [71]. In addition, COMMD1 sustains the expression of the cystic fibrosis transmembrane conductance regulator (CFTR) at the membrane [17], and promotes the localization of δENaC to a recycling compartment in the cell [9]. Together, the previous findings along with our own data advocate Commd1 being involved in LDLR trafficking, possibly at the step of sorting internalized and/or newly synthesized LDLR to the plasma membrane. However, these possible scenarios require further detailed studies to determine how likely they are. Importantly, the effect of Commd1 on LDL-c levels regulation that we discovered might be of significant therapeutic interest and could lead to the development of new, cholesterol-lowering therapies.

THE ROLE OF COMMD1 – SUBTLE EFFECTS BUT INDISPENSABLE PRESENCE

Given all the studies published to date on the role of COMMD1 and the new data described in this thesis, it is becoming clear that COMMD1 is definitely not a one-pathway player. It is involved in many essential processes within the cell, which is supported by the lethal phenotype of the Commd1-knockout mouse. As COMMD1 does not have any catalytic properties, we hypothesize that it acts either as a scaffold or hub to bring proteins together, and/or acts as an adaptor protein targeting its clients for ubiquitination in different cellular processes. For example, COMMD1 is involved in the formation of the E3 ubiquitin ligase complex, which mediates the proteasomal degradation of p65 (RelA) [27]. Furthermore, COMMD1 plays a role in CFTR ubiquitination, affecting its protein stability [17]. COMMD1 insufficiency could, similar to its effect on CFTR, also affect LDLR ubiquitination status, thus altering the recycling of this receptor. The conditional knockout mice gave us an excellent opportunity to study the biological function of COMMD1 and to investigate the mechanism by which COMMD1 regulates different cellular processes. In this thesis we have described a cell-type-specific role for COMMD1. We show that myeloid Commd1, but not hepatocyte- or intestinal epithelial Commd1, restrains the inflammatory response. Furthermore, we show that hepatocyte- specific Commd1 depletion affects the progression of NAFLD and we demonstrated for the first time that COMMD1 plays a significant role in clearing plasma LDL in mice and dogs. Although in the current stage of work we can really only speculate about the mechanisms behind the observed effects, it is certain that the mouse studies we have presented in this

162 Discussion thesis are a good starting point towards unraveling how Commd1 works in different cellular, tissue and disease contexts. Although a genetic variation in the 3’ region of the human COMMD1 gene is linked to a risk for ulcerative colitis (Chapter 4), no mutations in COMMD1 in inflammatory bowel disease patients have been identified so far. In addition, no correlation between COMMD1 variant and copper toxicity in humans has been reported. Despite this, it would be of interest to investigate whether genetic variations in COMMD1 result in aberrant plasma cholesterol levels in patients with hypercholesterolemia, and whether these patients are also susceptible to hepatic copper accumulation. Knowledge about the possible regulators and players involved in progression of diseases like NAFLD and hypercholesterolemia is of great scientific importance, given the high prevalence of these disorders worldwide and their economic impact on societies. Identifying the proteins regulating disease progression and understanding how they work is the key to designing more effective therapies. Thus, the identification of COMMD1 as a possible regulator of LDLR trafficking makes it a potential target for treating hypercholesterolemia in the future. However, despite a well-established role of Commd1 in copper homeostasis, a clear mechanism for how it regulates copper transporters is still missing. It is very likely that COMMD1 mediates the trafficking of ATP7B in a similar fashion to how it regulates the LDLR trafficking. Therefore, identifying the mechanism responsible for LDLR regulation by COMMD1 might indirectly advance our knowledge on copper homeostasis, and patients with a copper storage disorder might benefit from the research initiated and described in this thesis. The puzzling nature of COMMD1 makes it clear that as we proceed with the research we are likely to discover many other functions of this protein. This thesis provides more insight into the biological role of Commd1, especially in the liver, and although some questions have been answered, many more have been raised during our investigations. Further studies will be essential to help unravel all the functions and mechanisms behind the cellular role of COMMD1 and will likely help in designing treatment strategies against diseases like NAFLD, hypercholesterolemia, and copper toxicity.

8

163 CHAPTER 8 References

[1] B. van de Sluis, J. Rothuizen, P.L. Pearson, B.A. van Oost, and C. Wijmenga, Identification of a new copper metabolism gene by positional cloning in a purebred dog population, Hum Mol Genet, 11 (2002) 165-173. [2] L. Ganesh, E. Burstein, A. Guha-Niyogi, M.K. Louder, J.R. Mascola, L.W. Klomp, C. Wijmenga, C.S. Duckett, and G.J. Nabel, The gene product Murr1 restricts HIV-1 replication in resting CD4+ lymphocytes, Nature, 426 (2003) 853-857. [3] E. Burstein, J.E. Hoberg, A.S. Wilkinson, J.M. Rumble, R.A. Csomos, C.M. Komarck, G.N. Maine, J.C. Wilkinson, M.W. Mayo, and C.S. Duckett, COMMD proteins, a novel family of structural and functional homologs of MURR1, J Biol Chem, 280 (2005) 22222-32. [4] R.P. Favier, B. Spee, B.A. Schotanus, T.S. van den Ingh, H. Fieten, B. Brinkhof, C.S. Viebahn, L.C. Penning, and J. Rothuizen, COMMD1-deficient dogs accumulate copper in hepatocytes and provide a good model for chronic hepatitis and fibrosis, PLoS One, 7 (2012) e42158. [5] A. Fedoseienko, P. Bartuzi, and B. van de Sluis, Functional understanding of the versatile protein copper metabolism MURR1 domain 1 (COMMD1) in copper homeostasis, Ann. N.Y. Acad. Sci., 1314 (2014) 6-14. [6] M.B. Theophilos, D.W. Cox, and J.F. Mercer, The toxic milk mouse is a murine model of Wilson disease, Hum Mol Genet, 5 (1996) 1619-1624. [7] J. Wu, J.R. Forbes, H.S. Chen, and D.W. Cox, The LEC rat has a deletion in the copper transporting ATPase gene homologous to the Wilson disease gene, Nat Genet, 7 (1994) 541-545. [8] W. Biasio, T. Chang, C.J. McIntosh, and F.J. McDonald, Identification of Murr1 as a regulator of the human delta epithelial sodium channel, J Biol Chem, 279 (2004) 5429-5434. [9] T. Chang, Y. Ke, K. Ly, and F.J. McDonald, COMMD1 regulates the delta epithelial sodium channel (δENaC) through trafficking and ubiquitination, Biochem Biophys Res Commun, 411 (2011) 506-511. [10] M. Lian and X. Zheng, HSCARG regulates NF-kappaB activation by promoting the ubiquitination of RelA or COMMD1, J Biol Chem, 284 (2009) 17998-18006. [11] N.T. Woods, R.D. Mesquita, M. Sweet, M.A. Carvalho, X. Li, Y. Liu, H. Nguyen, C.E. Thomas, E.S. Iversen, S. Marsillac, R. Karchin, J. Koomen, and A.N. Monteiro, Charting the landscape of tandem BRCT domain- mediated protein interactions, Sci Signal, 5 (2012) rs6. [12] L. Smith, P. Litman, and C.M. Liedtke, COMMD1 interacts with the COOH terminus of NKCC1 in Calu-3 airway epithelial cells to modulate NKCC1 ubiquitination, Am J Physiol Cell Physiol, 305 (2013) C133-46. [13] A. Zoubeidi, S. Ettinger, E. Beraldi, B. Hadaschik, A. Zardan, L.W. Klomp, C.C. Nelson, P.S. Rennie, and M.E. Gleave, Clusterin facilitates COMMD1 and I-kappaB degradation to enhance NF-kappaB activity in prostate cancer cells, Mol Cancer Res, 8 (2010) 119-130. [14] Y. Huang, M. Wu, and H.-Y. Li, Tumor suppressor ARF promotes non-classic proteasome-independent polyubiquitination of COMMD1, J Biol Chem, 283 (2008) 11453-11460. [15] B. van de Sluis, P. Muller, K. Duran, A. Chen, A.J. Groot, L.W. Klomp, P.P. Liu, and C. Wijmenga, Increased activity of hypoxia-inducible factor 1 is associated with early embryonic lethality in Commd1 null mice, Mol Cell Biol, 27 (2007) 4142-4156. [16] Y. Ke, A.G. Butt, M. Swart, Y.F. Liu, and F.J. McDonald, COMMD1 downregulates the epithelial sodium channel through Nedd4-2, Am J Physiol Renal Physiol, 298 (2010) F1445-56. [17] L. Drévillon, G. Tanguy, A. Hinzpeter, N. Arous, A. de de Becdelièvre, A. Aissat, A. Tarze, M. Goossens, and P. Fanen, COMMD1-mediated ubiquitination regulates CFTR trafficking, PLoS One, 6 (2011) e18334. [18] W.I. Vonk, V. Kakkar, P. Bartuzi, D. Jaarsma, R. Berger, M.H. Hofker, L.W. Klomp, C. Wijmenga, H.H. Kampinga, and B. van de Sluis, The copper metabolism MURR1 domain protein 1 (COMMD1) modulates the aggregation of misfolded protein species in a client-specific manner, PLoS One, 9 (2014) e92408. [19] W.I. Vonk, P. Bartuzi, P. de Bie, N. Kloosterhuis, C.G. Wichers, R. Berger, S. Haywood, L.W. Klomp, C. Wijmenga, and B. van de Sluis, Liver-specific Commd1 knockout mice are susceptible to hepatic copper accumulation, PLoS One, 6 (2011) e29183.

164 Discussion

[20] B. Hoesel and J.A. Schmid, The complexity of NF-κB signaling in inflammation and cancer, Mol Cancer, 12 (2013) 86. [21] A. Pahl and I. Szelenyi, Asthma therapy in the new millennium, Inflamm Res, 51 (2002) 273-82. [22] K. Chen, Y.M. Long, H. Wang, L. Lan, and Z.H. Lin, Activation of nuclear factor-kappa B and effects of pyrrolidine dithiocarbamate on TNBS-induced rat colitis, World J Gastroenterol, 11 (2005) 1508-14. [23] M.P. Mattson and S. Camandola, NF-kappaB in neuronal plasticity and neurodegenerative disorders, J Clin Invest, 107 (2001) 247-254. [24] S. Bell, K. Degitz, M. Quirling, N. Jilg, S. Page, and K. Brand, Involvement of NF-kappaB signalling in skin physiology and disease, Cell Signal, 15 (2003) 1-7. [25] T. Luedde and R.F. Schwabe, NF-[kappa]B in the liver - linking injury, fibrosis and hepatocellular carcinoma, Nat Rev Gastroenterol Hepatol, 8 (2011) 108-118. [26] P. Bartuzi, M.H. Hofker, and B. van de Sluis, Tuning NF-kappaB activity: A touch of COMMD proteins, Biochim Biophys Acta, 1832 (2013) 2315-2321. [27] G.N. Maine, X. Mao, C.M. Komarck, and E. Burstein, COMMD1 promotes the ubiquitination of NF-[kappa]B subunits through a cullin-containing ubiquitin ligase, EMBO J, 26 (2007) 436-447. [28] H. Li, Chan, P. Bartuzi, S.D. Melton, A.Weber, S. Ben-Shlomo, M. Raetz, X. Mao, P. Starokadomskyy, S. van Sommeren, M. Mokadem, H. Schneider, R. Weisberg, H.-J. Westra, T. Esko, A. Metspalu, V. Kumar, W.A. Faubion, F. Yarovinsky, M. Hofker, C. Wijmenga, M Kracht, L. Franke, V. Aguirre, R.K. Weersma, N. Gluck, B. van de Sluis, and E. Burstein, Copper metabolism domain-containing 1 represses genes that promote inflammation and protects mice from colitis and colitis-associated cancer, Gastroenterology, 147 (2014) 184-195.e.3. [29] F.R. Greten, L. Eckmann, T.F. Greten, J.M. Park, Z.-W. Li, L.J. Egan, M.F. Kagnoff, and M. Karin, IKKbeta links inflammation and tumorigenesis in a mouse model of colitis-associated cancer, Cell, 118 (2004) 285-296. [30] R. Buettner, J. Scholmerich, and L.C. Bollheimer, High-fat diets: modeling the metabolic disorders of human obesity in rodents, Obesity, 15 (2007) 798-808. [31] S. Xanthoulea, M. Pasparakis, S. Kousteni, C. Brakebusch, D. Wallach, J. Bauer, H. Lassmann, and G. Kollias, Tumor necrosis factor (TNF) receptor shedding controls thresholds of innate immune activation that balance opposing TNF functions in infectious and inflammatory diseases, J Exp Med, 200 (2004) 367-376. [32] M. Aparicio-Vergara, P.P. Hommelberg, M. Schreurs, N. Gruben, R. Stienstra, R. Shiri-Sverdlov, N.J. Kloosterhuis, A. de Bruin, B. van de Sluis, D.P. Koonen, and M.H. Hofker, Tumor necrosis factor receptor 1 gain-of-function mutation aggravates nonalcoholic fatty liver disease but does not cause insulin resistance in a murine model, Hepatology, 57 (2013) 566-576. [33] K. Vlantis, A. Wullaert, Y. Sasaki, M. Schmidt-Supprian, K. Rajewsky, T. Roskams, and M. Pasparakis, Constitutive IKK2 activation in intestinal epithelial cells induces intestinal tumors in mice, J Clin Invest, 121 (2011) 2781-2793. [34] Y. Sunami, F. Leithhauser, S. Gul, K. Fiedler, N. Guldiken, S. Espenlaub, K.-H. Holzmann, N. Hipp, A. Sindrilaru, T. Luedde, B. Baumann, S. Wissel, F. Kreppel, M. Schneider, K. Scharffetter-Kochanek, S. Kochanek, P. Strnad, and T. Wirth, Hepatic activation of IKK/NFkappaB signaling induces liver fibrosis via macrophage-mediated chronic inflammation, Hepatology, 56(2012) 1117-1128. [35] P. Bartuzi, Wijshake, D.C. Dekker, A. Fedoseienko, N.J. Kloosterhuis, S.A. Youssef, H. Li, Shiri-Sverdlov, J.-A. Kuivenhoven, de Bruin, E. Burstein, M.H. Hofker, and B. van de Sluis, A cell type-specific role for murine Commd1 in liver inflammation, Biochim Biophys Acta 1842 (2014) 2257-2265. 8 [36] M. Karin and Y. Ben-Neriah, Phosphorylation meets ubiquitination: The control of NF-kappaB activity, Annu Rev Immunol, 18 (2000) 621-663. [37] A. Oeckinghaus and S. Ghosh, The NF-kappaB Family of Transcription Factors and Its Regulation, Cold Spring Harb Perspect Biol, 1 (2009) a000034. [38] G. van Loo and R. Beyaert, Negative regulation of NF-kappaB and its involvement in rheumatoid arthritis, Arthritis Res Ther, 13 (2011) 221.

165 CHAPTER 8

[39] L. Verstrepen, K. Verhelst, G. van Loo, I. Carpentier, S.C. Ley, and R. Beyaert, Expression, biological activities and mechanisms of action of A20 (TNFAIP3), Biochem Pharmacol, 80 (2010) 2009-2020. [40] Y. Yamamoto and R.B. Gaynor, IkappaB kinases: key regulators of the NF-kappaB pathway, Trends Biochem Sci, 29 (2004) 72-79. [41] M. Naumann and C. Scheidereit, Activation of NF-kappa B in vivo is regulated by multiple phosphorylations, EMBO J., 13 (1994) 4597-4607. [42] H. Buss, A. Dorrie, M.L. Schmitz, R. Frank, M. Livingstone, K. Resch, and M. Kracht, Phosphorylation of Serine 468 by GSK-3beta Negatively Regulates Basal p65 NF-kappaB Activity, J Biol Chem, 279 (2004) 49571-49574. [43] R.F. Schwabe and H. Sakurai, IKKbeta phosphorylates p65 at S468 in transactivaton domain 2, FASEB J, 19 (2005) 1758-60. [44] H. Geng, T. Wittwer, O. Dittrich-Breiholz, M. Kracht, and M.L. Schmitz, Phosphorylation of NFkappaB p65 at Ser468 controls its COMMD1-dependent ubiquitination and target gene-specific proteasomal elimination, EMBO Rep, 10 (2009) 381-386. [45] P. Arun, M.S. Brown, R. Ehsanian, Z. Chen, and C. Van Waes, Nuclear NF-kappaB p65 phosphorylation at serine 276 by protein kinase A contributes to the malignant phenotype of head and neck cancer, Clin Cancer Res, 15 (2009) 5974-5984. [46] J. Dong, E. Jimi, H. Zhong, M.S. Hayden, and S. Ghosh, Repression of gene expression by unphosphorylated NF-kappaB p65 through epigenetic mechanisms, Genes & Development, 22 (2008) 1159-1173. [47] M.S. Hayden and S. Ghosh, Signaling to NF-kappaB, Genes Dev, 18 (2004) 2195-2224. [48] J.K. Dowman, J.W. Tomlinson, and P.N. Newsome, Pathogenesis of non-alcoholic fatty liver disease, QJM, 103 (2010) 71-83. [49] C.P. Day and O.F. James, Steatohepatitis: A tale of two “hits”?, Gastroenterology, 114 (1998) 842-845. [50] P. Pettinelli, A.M. Obregon, and L.A. Videla, Molecular mechanisms of steatosis in nonalcoholic fatty liver disease, Nutr Hosp, 26 (2011) 441-450. [51] W. Huang, A. Metlakunta, N. Dedousis, P. Zhang, I. Sipula, J.J. Dube, D.K. Scott, and R.M. O’Doherty, Depletion of liver Kupffer cells prevents the development of diet-induced hepatic steatosis and insulin resistance, Diabetes, 59 (2010) 347-357. [52] E.J. Park, J.H. Lee, G.-Y. Yu, G. He, S.R. Ali, R.G. Holzer, C.H. Osterreicher, H. Takahashi, and M. Karin, Dietary and genetic obesity promote liver inflammation and tumorigenesis by enhancing IL-6 and TNF expression, Cell, 140 (2010) 197-208. [53] K.F. Tacer, D. Kuzman, M. SeliÅ¡kar, D. Pompon, and D. Rozman, TNF-alpha interferes with lipid homeostasis and activates acute and proatherogenic processes, Physiol Genomics, 31 (2007) 216-227. [54] K.R. Feingold and C. Grunfeld, Tumor necrosis factor-alpha stimulates hepatic lipogenesis in the rat in vivo, J Clin Invest, 80 (1987) 184-190. [55] S. Hao and D. Baltimore, RNA splicing regulates the temporal order of TNF-induced gene expression, Proc Natl Acad Sci USA, 110 (2013) 11934-11939. [56] D.G. Tiniakos, M.B. Vos, and E.M. Brunt, Nonalcoholic Fatty Liver Disease: Pathology and Pathogenesis, Annu Rev Pathol Mech Dis, 5 (2014) 145-171. [57] H. Koga, S. Kaushik, and A.M. Cuervo, Altered lipid content inhibits autophagic vesicular fusion, The FASEB Journal, 24 (2010) 3052-3065. [58] R. Singh, S. Kaushik, Y. Wang, Y. Xiang, I. Novak, M. Komatsu, K. Tanaka, A.M. Cuervo, and M.J. Czaja, Autophagy regulates lipid metabolism, Nature, 458 (2009) 1131-1135. [59] M. Amir and M.J. Czaja, Autophagy in nonalcoholic steatohepatitis, Expert Rev Gastroenterol Hepatol, 5 (2011) 159-166. [60] S. Tandra, M.M. Yeh, E.M. Brunt, R. Vuppalanchi, O.W. Cummings, A. Ãœnalp-Arida, L.A. Wilson, and N. Chalasani, Presence and significance of microvesicular steatosis in nonalcoholic fatty liver disease, J Hepatol, 55 (2011) 654-659.

166 Discussion

[61] R. Vetelainen, A. van Vliet, and T.M. van Gulik, Essential pathogenic and metabolic differences in steatosis induced by choline or methione-choline deficient diets in a rat model, J Gastroenterol Hepatol, 22 (2007) 1526-1533. [62] F.E. Sharkey, I. Lytvak, T.J. Prihoda, K.V. Speeg, W.K. Washburn, and G.A. Halff, High-grade microsteatosis and delay in hepatic function after orthotopic liver transplantation, Hum Pathol, 42 (2011) 1337-1342. [63] M.S. Brown and J.L. Goldstein, A receptor-mediated pathway for cholesterol hoeostasis, Science, 232 (1986) 34-47. [64] S. Calandra, P. Tarugi, H.E. Speedy, A.F. Dean, S. Bertolini, and C.C. Shoulders, Mechanisms and genetic determinants regulating sterol absorption, circulating LDL levels, and sterol elimination: implications for classification and disease risk, J Lipid Res, 52 (2011) 1885-1926. [65] J.L. Burkhead, C.T. Morgan, U. Shinde, G. Haddock, and S. Lutsenko, COMMD1 forms oligomeric complexes targeted to the endocytic membranes via specific interactions with phosphatidylinositol 4,5-bisphosphate, J Biol Chem, 284 (2009) 696-707. [66] K.H. Weiss, J. Carbajo Lozoya, S. Tuma, D. Gotthardt, J. Reichert, R. Ehehalt, W. Stremmel, and J. Fallekrug, Copper-induced translocation of the Wilson disease protein ATP7B independent of Murr1/COMMD1 and Rab7, Am J Pathol, 173 (2008) 1783-1794. [67] A.E. Klomp, B. van de Sluis, L.W. Klomp, and C. Wijmenga, The ubiquitously expressed MURR1 protein is absent in canine copper toxicosis, J Hepatol, 39 (2003) 703-709. [68] C. Jones, R.E. Hammer, W.-P. Li, J.C. Cohen, H.H. Hobbs, and J. Herz, Normal sorting but defective endocytosis of the low density lipoprotein receptor in mice with autosomal recessive hypercholesterolemia, J Biol Chem, 278 (2003) 29024-29030. [69] T.A. Lagace, D.E. Curtis, R. Garuti, M.C. McNutt, S.W. Park, H.B. Prather, N.N. Anderson, Y.K. Ho, R.E. Hammer, and J.D. Horton, Secreted PCSK9 decreases the number of LDL receptors in hepatocytes and inlivers of parabiotic mice, J Clin Invest, 116 (2006) 2995-3005. [70] J.-H. Wu, K. Peppel, C.D. Nelson, F.-T. Lin, T.A. Kohout, W.E. Miller, S.T. Exum, and N.J. Freedman, The adaptor protein beta-arrestin2 enhances endocytosis of the low density lipoprotein receptor, J Biol Chem, 278 (2003) 44238-44245. [71] M. Takamitsu, H. Daisuke, K. Fumika, N. Emi, S. Noriyuki, and O. Yasumitsu, Roles of COMM-domain- containing 1 in stability and recruitment of the copper-transporting ATPase in a mouse hepatoma cell line, Biochem J, 429 (2010) 53-61.

8

167

SUMMARIES

Summary SUMMARY

The Copper Metabolism MURR1 Domain Protein 1 (COMMD1) is the prototype of the COMMD family of proteins. It has been shown to regulate various cellular processes, like copper homeostasis, inflammatory response, and hypoxia adaptation, and to mediate the cellular localization of numerous proteins. However, the biological role of COMMD1 and the exact molecular mechanisms by which it regulates these processes are still ill-defined. This thesis aims to give more insight into the biological role of COMMD1 in the pathogenesis of inflammatory diseases, including colitis and non-alcoholic fatty liver disease (NAFLD). In addition, we report identifying COMMD1 as a potential hypercholesterolemia risk gene. Chapter 1 provides a general introduction to NAFLD and non-alcoholic steatohepatitis (NASH), which are obesity-related health problems. The pathology of the majority of hepatic disorders is intertwined with aberrant inflammatory responses. We discuss here the contribution of inflammation and the role of the NF-κB signaling pathway, a key pathway in inflammation. We also discuss the significance of increased circulating low- density lipoprotein cholesterol (LDL-c) levels, as a risk factor for cardiovascular diseases and as one of the features of the metabolic syndrome. A brief description of the low-density lipoprotein receptor (LDLR) trafficking pathway is given. Although all COMMD proteins can suppress NF-κB activity in vitro, COMMD1 is the best-studied family member in this signaling pathway to date. Chapter 2 reviews the current knowledge about the molecular mechanisms which terminate NF-κB activity. We specifically focus on the contribution of the COMMD family to NF-κB signaling. Apart from regulating the activity of NF-κB, COMMD1 is a protein with multiple functions. It was initially discovered to regulate copper homeostasis, as COMMD1-deficient dogs progressively accumulate copper in their livers up to toxic levels. Based on our current knowledge, we speculate that COMMD1 modulates the trafficking of the copper transporting protein ATP7B. The mechanism by which COMMD1 regulates this pathway might be similar to the way it coordinates the trafficking of other transmembrane proteins. An overview of current knowledge about the pleiotropic function of COMMD1 is given in Chapter 3. Chapter 4 describes the first in vivo evidence that COMMD1 restrains the proinflammatory response. Mice devoid of myeloid Commd1 were found to have lower survival in a murine model of DSS-induced colitis as well as in LPS-induced sepsis. We show also the first link between genetic variation in the human COMMD1 3’region and the risk for inflammatory bowel disease. Furthermore, an increased progression to colonic dysplasia was found in myeloid Commd1-deficient mice, advocating a possible role of Commd1 in tumor development. Further studies on the role of Commd1 in inflammation are presented in Chapter 5. In order to investigate the effect of Commd1 deficiency on hepatic inflammation, we used a mouse model of NAFLD. Mice were fed a high-fat high-cholesterol diet (HFC) diet for 12 weeks. The inhibitory role of Commd1 on inflammation was shown to be cell- S

171 Summary

type-specific, since hepatocyte Commd1-deficiency did not alter the level of diet-induced inflammation, whereas myeloid Commd1 depletion exacerbated liver inflammation. Unexpectedly, both myeloid and hepatocyte Commd1 depletion resulted in an increased fat accumulation in the liver. The effect on steatosis is suggested to be a result of two different mechanisms: one inflammation-dependent and the other independent of inflammation. Depletion of hepatocyte-specific Commd1 also led to the discovery of COMMD1 as a modulator of cholesterol homeostasis (Chapter 6). Hepatic COMMD1 deficiency in mice and dogs results in hypercholesterolemia; both animals show elevated levels of circulating atherogenic LDL-c. The observed phenotype is likely related to aberrant LDLR trafficking. COMMD1 was shown to interact with LDLR and mediate the uptake of LDL in mouse embryonic fibroblasts. Furthermore, depletion of Commd1 markedly impairs PCSK9-induced Ldlr degradation, suggesting that Commd1 mediates cellular trafficking of the Ldlr. Further investigations into its mechanistic action in Ldlr trafficking are essential to gain a better understanding of how cholesterol homeostasis is regulated. The study we report in Chapter 7 suggested that hepatic Commd1 plays a role in the progression of HFC-diet induced microvesicular steatosis to macrovesicular steatosis. Here, we demonstrated that microvesicular steatosis is associated with a lower inflammatory tone in the liver and with reduced activation of the LXR pathway, which prevents cells from cholesterol overload. However, further research is necessary to elucidate the mechanism behind this observation. Finally, Chapter 8 discusses the findings presented in this thesis. It is divided into three sections related to the role of Commd1: in inflammation, in NAFLD, and in cellular trafficking of its clients. In conclusion, our data underline the multifunctional nature of COMMD1, and provide novel insights into its biological function. We demonstrate a cell-type-specific role for COMMD1 in suppressing inflammation, and identify COMMD1 as a novel gene in regulating cholesterol homeostasis. Our data indicate that COMMD1 delivers the LDLR to the right docking station in the cell. We believe that unraveling the mechanistic action of COMMD1 in the LDLR pathway will help us better understand the mechanism by which COMMD1 regulates biliary copper excretion. This thesis shows that COMMD1 is a relatively novel adaptor protein in sorting various molecules involved in a number of different biological processes, such as cholesterol and copper homeostasis.

172 Podsumowanie PODSUMOWANIE

Białko COMMD1 (ang. Copper Metabolism MURR1 Domain Protein 1) należy do rodziny białek COMMD. Bierze ono udział w regulacji różnych procesów komórkowych, takich jak gospodarka miedzi, reakcja zapalna czy adaptacja komórkowa do hipoksji (niedotlenienia) oraz odgrywa rolę we właściwej lokalizacji komórkowej wielu innych białek. Jednakże precyzyjna funkcja COMMD1 oraz dokładny mechanizm molekularny, poprzez który reguluje ono określone procesy komórkowe nie są w pełni poznane. Praca ta ma na celu pogłębienie dotychczasowej wiedzy na temat biologicznej roli białka COMMD1 w patogenezie chorób zapalnych, w tym zapalenia jelit i niealkoholowego stłuszczenia wątroby (ang. Non-Alcoholic Fatty Liver Disease, NAFLD). Ponadto gen COMMD1 został zidentyfikowany w niniejszej pracy jako potencjalny gen ryzyka hipercholesterolemii. Rozdział 1 stanowi ogólny wstęp do zagadnienia NAFLD oraz niealkoholowego stłuszczeniowego zapalenia wątroby (ang. Non-Alcoholic Steatohepatitis, NASH), stanowiących problemy zdrowotne związane z otyłością. Ponieważ patologia większości zaburzeń czynności wątroby jest powiązana z nieprawidłowymi reakcjami zapalnymi, omówiona została rola stanu zapalnego oraz szlaku sygnałowego NFκB odgrywającego kluczową rolę podczas zapalenia. Podkreślone zostało również znaczenie podwyższonego stężenia lipoprotein niskiej gęstości (ang. Low Density Lipoprotein, LDL) w osoczu krwi jako czynnika ryzyka wystąpienia chorób układu sercowo-naczyniowego oraz jako jednego z objawów zespołu metabolicznego. W rozdziale tym zawarty został również krótki opis wewnątrzkomórkowego transportu (ang. trafficking) receptora cholesterolu typu LDL (ang. LDL receptor, LDLR). Mimo, że wszystkie białka z rodziny COMMD mogą tłumić aktywność NF-κB in vitro, to właśnie rola białka COMMD1 została dotychczas najlepiej poznana w tym szlaku komórkowym. Rozdział 2 stanowi przegląd aktualnego stanu wiedzy na temat mechanizmów molekularnych hamujących aktywność NF-κB. Jednakże szczególna uwaga została poświęcona udziałowi rodziny białek COMMD w ścieżce przekazu sygnału NF-κB. COMMD1, oprócz wpływu na aktywność NF-κB, ma wiele innych funkcji. Początkowo zostało ono odkryte jako regulator homeostazy miedzi w komórkach. Odkrycia tego dokonano na podstawie badań z udziałem psów z wykrytą mutacją genu dla białka COMMD1 prowadzącą do zahamowania jego produkcji. U zwierząt tych miedź gromadzona jest w wątrobie stopniowo, aż do osiągnięcia toksycznego poziomu. W oparciu o naszą obecną wiedzę wnioskować możemy, że COMMD1 moduluje przemieszczanie białka ATP7B transportującego miedź wewnątrz komórek. Mechanizm odpowiadający za ten proces może być zbliżony do koordynacji przemieszczania innych transmembranowych (transbłonowych) białek przez COMMD1. Aktualny stan wiedzy na temat plejotropowych funkcji COMMD1 przedstawiony został w rozdziale 3. W rozdziale 4 opisane zostały pierwsze dowody pochodzące z badań in vivo¸ świadczące o tym, że COMMD1 powstrzymuje prozapalną odpowiedź komórkową. S

173 Podsumowanie

Stwierdzono, że myszy pozbawione Commd1 w komórkach szpikowych cechują się niższą przeżywalnością w mysim modelu eksperymentalnego zapalenia jelita grubego (ang. colitis) indukowanym poprzez podawanie dekstranu siarczanu sodu (DSS) oraz w modelu posocznicy indukowanej lipopolisacharydem bakteryjnym (LPS). Po raz pierwszy również pokazano zależność pomiędzy wariantem genetycznym w regionie 3’ ludzkiego genu COMMD1 a ryzykiem wystąpienia nieswoistego zapalenia jelit (ang. Inflammatory Bowel Disease, IBD). Ponadto zaobserwowana została zwiększona progresja dysplazji jelita grubego u myszy pozbawionych Commd1 w komórkach szpikowych, co może świadczyć o potencjalnej roli białka Commd1 w rozwoju nowotworów. Dalsze badania dotyczące roli białka Commd1 w reakcji zapalnej przedstawione zostały w rozdziale 5. Mysi model NAFLD został użyty w celu zbadania wpływu niedoboru Commd1 na stan zapalny wątroby. Myszom podawana była wysokotłuszczowa karma o podwyższonej zawartości cholesterolu (ang. High-Fat, High Cholesterol, HFC) przez okres 12 tygodni. Brak białka Commd1 w mysich hepatocytach nie spowodował zmian w poziomie stanu zapalnego wywołanego dietą HFC, jednakże brak Commd1 w komórkach szpiku doprowadził do zwiększenia reakcji zapalanej. Wykazano tym samym, iż hamujący wpływ białka Commd1 na reakcję zapalną jest komórkowo specyficzny. Jednakże pozbawienie myszy Commd1, czy to w hepatocytach czy w komórkach szpiku, doprowadziło do zwiększonej akumulacji tłuszczu w wątrobie. Wpływ na stłuszczenie wydaje się być w tym wypadku wynikiem działania dwóch różnych mechanizmów: jednego, zależnego i drugiego, niezależnego od reakcji zapalnej. Pozbawienie myszy białka Commd1 w hepatocytach doprowadziło do odkrycia COMMD1 jako nowego modulatora homeostazy cholesterolu (rozdział 6). Brak Commd1 w hepatocytach u myszy oraz całkowity brak tego białka u psów wywołał w obu przypadkach hipercholesterolemię. Zarówno u myszy, jak i u psów zaobserwowano podwyższone stężenie miażdżycogennego cholesterolu LDL we krwi. Fenotyp ten jest najprawdopodobniej związany z nieprawidłowym wewnątrzkomórkowym transportem receptora LDLR. Używając mysich embrionalnych fibroblastów (ang. Mouse Embryonic Fibroblasts, MEFs) dowiedziono, że COMMD1 oddziałuje z LDLR oraz pośredniczy w internalizacji lipoprotein LDL do wnętrza komórek. Co więcej, brak Commd1 znacząco osłabia degradację receptora Ldlr indukowaną przez PCSK9, co sugeruje, że Commd1 pośredniczy w wewnątrzkomórkowym transporcie Ldlr. Jednakże dalsze badania dotyczące mechanizmu molekularnego odpowiedzialnego za ten transport są niezbędne do pełnego wyjaśnienia sposobu, w jaki regulowana jest homeostaza cholesterolu w komórkach. Na podstawie badań przedstawionych w rozdziale 7 wydaje się, że Commd1 odgrywa w hepatocytach dodatkową rolę w progresji drobnokropelkowego stłuszczenia wątroby (ang. microvesicular steatosis) indukowanego dietą HFC w kierunku jego wielkokroplekowej odmiany (ang. macrovesicular steatosis). Pokazano, że drobnokropelkowe stłuszczenie związane jest z niższym odczynem zapalnym w wątrobie oraz ze zredukowaną aktywacją szlaku LXR, który chroni komórki przed nadmiernym nagromadzeniem

174 Podsumowanie cholesterolu. Niemniej jednak kolejne badania będą kluczowe, aby zrozumieć mechanizm odpowiedzialny za opisane zjawiska. Rozdział 8 stanowi dyskusję wyników badań przedstawionych w niniejszej pracy. Jest on podzielony na trzy sekcje traktujące o roli Commd1 w: stanie zapalnym, NAFLD oraz regulacji wewnątrzkomórkowego transportu innych białek. Podsumowując, wyniki opisanych badań podkreślają wielofunkcyjną naturę białka COMMD1 oraz dostarczają nowych informacji na temat jego biologicznej funkcji. Pokazana została specyficzność komórkowa COMMD1 w tłumieniu stanu zapalnego oraz zidentyfikowano COMMD1 jako nowy gen istotny w regulacji homeostazy cholesterolu. Przedstawione dane pozwalają sądzić, że COMMD1 może być odpowiedzialne za dostarczanie LDLR do właściwej „stacji dokującej” w komórce. Odkrycie mechanizmów działania COMMD1 w szlaku receptora LDLR być może pozwoli również lepiej zrozumieć mechanizmy działania tego białka odpowiedzialne za regulację wydzielania miedzi z żółcią. Praca ta pokazuje, że COMMD1 to relatywnie nowe białko adaptorowe uczestniczące w sortowaniu innych cząsteczek biorących udział w wielu różnych procesach biologicznych, takich jak homeostaza miedzi i cholesterolu.

S

175 Samenvatting Samenvatting

Het Copper Metabolism MURR1 Domain 1 (COMMD1) eiwit is het prototype voor de eiwit familie COMMD. Eerdere studies hebben aangetoond dat COMMD1 verschillende biologische processen reguleert zoals koper homeostase, ontstekingen, en hypoxia adaptatie. Daarnaast bepaald COMMD1 de lokalisatie van verschillende eiwitten in de cel. Echter de biologische functie van COMMD1 en de exacte moleculaire mechanismes waarmee dit eiwit al deze processen reguleert is nog onduidelijk. Het doel van dit proefschrift is om meer inzicht te krijgen in de biologische rol van COMMD1 in de pathogenese van verschillende ziekten die gerelateerd zijn aan chronische ontstekingen zoals colitis en niet-alcoholische leververvetting (NAFLD). In dit proefschrift tonen we voor het eerst aan dat COMMD1 een potentieel kandidaat gen is voor hypercholesterolemie. Hoofdstuk 1 geeft een algemene introductie over NAFLD en niet-alcoholische leverontsteking (NASH). In beide gevallen draagt overgewicht bij aan het ontstaan en het verloop van deze leveraandoeningen. Daarnaast speelt chronische ontsteking van de lever een belangrijke rol in de pathogenese van NAFLD en NASH. De bijdrage van leverontsteking en nuclear factor-κB (NF-κB), een belangrijke transcriptie factor in ontstekingsreacties, in NAFLD en NASH worden in dit hoofdstuk beschreven. Tevens wordt de gevolgen van verhoogd circulerend low-density lipoprotein cholesterol (LDL-c) als risico factor bij cardiovasculaire aandoeningen, een van de aandoeningen van het metabool syndroom, besproken. Er wordt een korte omschrijving gegeven over de functie van de low-density lipoprotein receptor (LDLR) en hoe de LDLR wordt getransporteerd in de cel. Hoewel alle COMMD eiwitten de NF- κB activiteit in vitro kunnen remmen, is COMMD1 tot op heden het best bestudeerde eiwit uit deze familie. In hoofdstuk 2 wordt de huidige kennis over de moleculaire mechanisme waarmee NF-κB activiteit wordt geremd beschreven. Met name wordt de rol van de COMMD eiwitten in dit proces behandeld. Naast de functie van COMMD1 als NF-kB terminator, reguleert COMMD1 nog verschillende andere biologische processen. In eerste instantie werd COMMD1 ontdekt als een eiwit betrokken bij koper huishouding. Honden deficiënt voor het COMMD1 eiwit stapelen koper op, tot zeer hoge toxische waardes, in de lever. Gebaseerd op onze huidige kennis denken we dat COMMD1 het intracellulaire transport van het koper transport eiwit ATP7B moduleert. Het mechanisme waarmee COMMD1 dit controleert is mogelijkerwijs op dezelfde manier waarmee COMMD1 ook het transport van andere transmembraan eiwitten reguleert. Een samenvatting over de huidige kennis van de pleiotropische functie van COMMD1 wordt in hoofdstuk 3 beschreven. In hoofdstuk 4 leveren we voor de eerste keer bewijs dat Commd1 ontstekingen ook in vivo remt. In een muismodel voor colitis (darmontsteking), en een model voor sepsis blijken muizen deficiënt voor Commd1 in myeloïde cellen in beide modellen een lagere overlevingskans te hebben dan wild type muizen. Wij laten ook zien dat er een correlatie is tussen een specifieke genetische variatie in de 3’ regio van COMMD1 en de kans op het ontstaan van ontsteking in de darm (inflammatoire bowel disease) bij de mens. Daarnaast is de progressie van afwijkingen van de weefsel structuur van de dikke darm (dysplasie)

176 Samenvatting verslechterd in de myeloïde Commd1 deficiënte muizen. Hieruit veronderstellen we dat Commd1 een belangrijke regulerende rol heeft in de ontwikkeling van darmtumoren. Verdere studies waarin de rol van COMMD1 in ontstekingsreacties wordt beschreven zijn opgenomen in hoofdstuk 5. Om het effect van Commd1 deficiëntie te bestuderen in leverontsteking hebben we een muis model voor NAFLD/NASH gebruikt. Deze muizen hebben 12 weken lang een hoog-vet cholesterol (HFC) dieet gekregen. Uit deze studie blijkt dat de beschermende rol van Commd1 op ontstekingen celtype specifiek is. Muizen waarbij Commd1 is uitgeschakeld in hepatocyten lieten geen verandering zien in de mate van de dieet- geïnduceerde leverontsteking. Daarentegen was de leverontsteking wel verergerd in de muizen die Commd1 missen in myeloïde cellen. Zowel de lever- als de myeloïde-deficiënte Commd1 muis lieten onverwachts een verhoogde vet ophoping (steatose) in de lever zien. Het effect van de toegenomen leververvetting in deze twee muis modellen blijkt een gevolg te zijn van twee verschillende mechanismen: een ontstekings afhankelijke en - onafhankelijke mechanisme. Door Commd1 specifiek in hepatocyten uit te schakelen, ontdekte we dat COMMD1 ook een rol speelt in cholesterol homeostase (hoofdstuk 6). Muizen en honden die COMMD1 deficiënt zijn leiden beide aan hypercholesterolemie; een verhoogd cholesterol (LDL-c) gehalte in het bloed. Dit fenotype is waarschijnlijk te koppelen aan verstoord intracellulair LDLR (Low Density Lipoprotein receptor) transport. COMMD1 bindt fysiek aan de LDLR en is belangrijk voor de opname van LDL in muizen embryonale fibroblasten (MEF). Opvallend is dat PCSK9-geïnduceerde degradatie van de LDLR verminderd is door de afwezigheid van Commd1. Verder onderzoek is nodig om het mechanisme van LDLR transport beter te begrijpen en we hopen hiermee beter inzicht te krijgen in cholesterol homeostase. De studie beschreven in hoofdstuk 7 suggereert dat hepatisch Commd1 een rol speelt in de progressie van HFC-geïnduceerde micro-vesiculaire steatose naar macro-vesiculaire steatose. In dit hoofdstuk laten wij ook zien dat micro-vesiculaire steatose geassocieerd is met een lager ontstekingsniveau in de lever en met een verlaagde activiteit van de LXR signaleringsroute. LXR zorgt ervoor dat er niet te veel cholesterol is in de cel. Echter er is meer onderzoek nodig om het mechanisme achter deze observatie te verklaren. Ten slotte wordt in hoofdstuk 8 alle bevindingen van dit proefschrift bediscussieerd. Het is onderverdeeld in drie secties die gerelateerd zijn aan de rol van COMMD1 in ontstekingsreacties, in NAFLD en in intracellulair eiwit transport. Onze resultaten benadrukken de multifunctionele rol van COMMD1 en geven nieuwe inzichten in de biologische functie van COMMD1. Ons onderzoek demonstreert een celtype specifieke rol van COMMD1 in het onderdrukken van ontstekingen, en laat zien dat COMMD1 een nieuw gen is in cholesterol homeostase. Onze resultaten suggereren dat COMMD1 de LDLR naar de juiste plaats in cel brengt. Wij zijn er van overtuigd dat inzichten in de mechanistische rol van COMMD1 in de LDLR transport ook inzichten zullen geven in hoe COMMD1 de koper uitscheiding via de gal reguleert. Samenvattend, dit proefschrift toont aan dat COMMD1 een relatief nieuw adapter eiwit is in het sorteren van verschillende eiwitten die betrokken zijn in aantal verschillende biologische processen zoals cholesterol en koper homeostase. S

177

Acknowledgements

After (altogether) almost five years that I spent in Groningen, now is the happy time to close this chapter of my life. So I would like to thank every person that I have had a chance to work and spent some time with throughout those past years. Every encounter changed me a little bit and made me realize something new! I am not really fond of a long-form writing and I am aware that there are many people that I could omit, hence I will try to keep (at least) this chapter rather short! My apologies upfront, if that will cause someone to feel offended! That was surely done unintentionally! First of all I have to thank Prof. Marten Hofker. Marten, you agreed to have me in your lab back in 2008 as a Socrates-Erasmus scholarship student. If not for that, I would probably never come to Groningen at all;-). Thank you for giving me this opportunity and for ensuring your constant readiness to help in all PhD-related matters in the past years! I would like to express my deepest, deepest gratitude for Dr. Bart van de Sluis. Bart, I appreciate a lot a chance that I had to work directly with you in the lab and in the Mouse Clinic. To learn from you, observe, draw conclusions, and (mostly) laugh a lot and tease each other! The fact that you were available for your students round-the-clock, literally round-the-clock(!), was sometimes disturbing (especially when receiving mails from you around 2 a.m.), but mostly it was simply amazing! Bart, a big big THANK YOU for being not only the promotor, but also a person that I knew I could count on! I wish all PhD’s had supervisors like you! I would like to take a chance and thank all great(!) Technicians, whose outstanding assistance in many experiments was the key to success! I was very lucky to work with experienced and motivated people. Further, I would like to thank my colleagues from the university with whom I share a lot of memories. I wish you all finish your projects timely (and proudly) and be happy with every next step in your career. I would also like to thank all PI’s with whom I have had a chance to discuss my results for a lot of priceless input that you gave! Dear Ezra, Haiying, Lilly and Peter! Thank you for hosting me in the lab in Dallas, for making me feel like I was a member of your small “Lab Family” for a moment, and for your true care! It was great to meet your Families and to spend a lot of time with you All! My dear Paranymphs, Agata and Daphne! Thank you for your time, efforts and commitment to help me organize This Day. But mostly, Girls, thank you for all your support beforehand: talks, laughter and never saying “no” when help was required! And also a big big thank you to all my Friends! Justyna J., Aśka, Marcin, Barbara, Marcela – without you Groningen would definitely feel a lot different! Sawisiaki: dzięki, że zawsze na nas czekacie przy okazji wizyt w Polsce! Justyś M.: powodzenia z Twoim doktoratem i dzięki, że jeszcze o mnie pamiętasz i zawsze jesteś gotowa do wspólnego narzekania;-)

179 Bardzo dziękuję mojej Rodzinie „krakowskiej”: Mamie i Dziadkom, oraz Rodzinie „puławsko-lubelskiej”: Rodzicom i Małpiakom; za to, że zawsze mogliśmy na Was wszystkich liczyć, w każdej sytuacji! Finally, I would like to close this chapter expressing how happy and proud I am to have such a great husband like Łukasz! You’re one of a kind: without your jokes, sarcasm, your temper mixed with occasional grumpiness (which always makes me laugh) and mostly love, I would not make it. I know it. Only you were fully aware what this PhD meant to me. Thank you for all the sacrifices that you made for me. With you I am the happiest person on Earth!

Paulina

180 CURRICULUM VITAE

Paulina Bartuzi was born on August 1st, 1986, in Kraków, Poland. She studied Biotechnology (2004-2009) at the Faculty of Biophysics, Biochemistry and Biotechnology at Jagiellonian University in Kraków, Poland. There she conducted research under supervision of Prof. Jolanta Jura at the Department of Cell Biochemistry. During the last year of her studies she was awarded a Socrates-Erasmus scholarship and got the opportunity to join Prof. Marten Hofker’s group in Groningen, the Netherlands, where she stayed for one semester. She came back to Kraków and graduated in 2009 with a MSc degree in Biotechnology. Her Master’s thesis was entitled “Identification of transcripts regulated by MCPIP”. Afterwards she was invited by Dr. Bart van de Sluis to return to Groningen, and in November 2009 she started her PhD project at the Department of Pathology and Medical Biology, University Medical Center Groningen. There she worked in the Molecular Genetics group under supervision of Dr. Bart van de Sluis and Prof. Marten Hofker. In December 2014 she concluded her 4,5-year research with a PhD dissertation “New insights into the biological role of COMMD1: From inflammation to steatosis and hypercholesterolemia”.

181 LIST OF PUBLICATIONS • A cell-type-specific role for murine Commd1 in liver inflammation Bartuzi P, Wijshake T, Dekker DC, Fedoseienko A, Kloosterhuis NJ, Youssef SA, Li H, Shiri-Sverdlov R, Kuivenhoven JA, de Bruin A, Burstein E, Hofker MH, van de Sluis B. Biochim Biophys Acta. 2014 Jul 27; 1842(11):2257-2265. doi: 10.1016/j.bbadis.2014.06.035. [Epub ahead of print] • Copper metabolism domain-containing 1 represses genes that promote inflammation and protects mice from colitis and colitis-associated cancer Li H, Chan L, Bartuzi P, Melton SD, Weber A, Ben-Shlomo S, Varol C, Raetz M, Mao X, Starokadomskyy P, van Sommeren S, Mokadem M, Schneider H, Weisberg R, Westra HJ, Esko T, Metspalu A, Kumar V, Faubion WA, Yarovinsky F, Hofker M, Wijmenga C, Kracht M, Franke L, Aguirre V, Weersma RK, Gluck N, van de Sluis B, Burstein E. Gastroenterology. 2014 Jul;147(1):184-195.e3. doi: 10.1053/j.gastro.2014.04.007. Epub 2014 Apr 13. • Functional understanding of the versatile protein copper metabolism MURR1 domain 1 (COMMD1) in copper homeostasis Fedoseienko A, Bartuzi P, van de Sluis B. Ann N Y Acad Sci. 2014 May;1314:6-14. doi: 10.1111/nyas.12353. Epub 2014 Feb 12. • The copper metabolism MURR1 domain protein 1 (COMMD1) modulates the aggregation of misfolded protein species in a client-specific manner Vonk WI, Kakkar V, Bartuzi P, Jaarsma D, Berger R, Hofker MH, Klomp LW, Wijmenga C, Kampinga HH, van de Sluis B. PLoS One. 2014 Apr 1;9(4):e92408. doi: 10.1371/journal.pone.0092408. eCollection 2014. • Tuning NF-κB activity: A touch of COMMD proteins Bartuzi P, Hofker MH, van de Sluis B. Biochim Biophys Acta. 2013 Dec;1832(12):2315-21. doi: 10.1016/j.bbadis.2013.09.014. Epub 2013 Sep 29. Review. • Liver-specific Commd1 knockout mice are susceptible to hepatic copper accumulation Vonk WI, Bartuzi P, de Bie P, Kloosterhuis N, Wichers CG, Berger R, Haywood S, Klomp LW, Wijmenga C, van de Sluis B. PLoS One. 2011;6(12):e29183. doi: 10.1371/journal.pone.0029183. Epub 2011 Dec 22.

182