DOCSLIB.ORG

Organization of the Mitochondrial Genome of Mantis Shrimp Pseudosquilla Ciliata (Crustacea: Stomatopoda)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Organization of the Mitochondrial Genome of Mantis Shrimp Pseudosquilla Ciliata (Crustacea: Stomatopoda) Organization of the Mitochondrial Genome of Mantis Shrimp Pseudosquilla ciliata (Crustacea: Stomatopoda) Lars Podsiadlowski, Thomas Bartolomaeus Institute of Biology, Freie Universita¨t Berlin, Ko¨ nigin-Luise-Strasse 1-3, D-14195 Berlin, Germany Received: 4 February 2005 / Accepted: 25 March 2005 / Online publication: 12 August 2005 Abstract have proved useful in studies concerning population genetics and speciation events. We determined the nearly complete mitochondrial For a long time the phylogeny of Crustacea has genome of Pseudosquilla ciliata (Crustacea, Sto- been controversial (for review, see Richter, 2002). matopoda), including all protein-coding genes and all Even the monophyly of this group has been ques- but one of the transfer RNAs. There were no gene tioned. In the last years molecular phylogenetic ap- rearrangements relative to the pattern shared by proaches strengthened this debate, while different crustaceans and hexapods. Phylogenetic analysis approaches using different molecular data sets (18S using concatenated amino acid sequences of the rRNA, elongation factors, and mitochondrial genes) mitochondrial protein-coding genes confirmed a ba- led to diverse views of crustacean phylogeny. A few sal position of Stomatopoda among Eumalacostraca. examples of such controversial statements from Pancrustacean relationships based on mitogenomic molecular analyses might illustrate the present sit- data were analyzed and are discussed in relation to uation. crustacean and hexapod monophyly and hexapod In a combined approach (8 partial gene se- affinities to crustacean subtaxa. quences and morphology; Giribet et al., 2001), al- most all Crustacea form a monophyletic group with Key words: arthropod phylogeny — Stomatopoda — Malacostraca and Copepoda combined in one clade, mitochondrial genome — Pancrustacea while Branchiopods, Remipedia, and Cephalocarids are grouped together as a sistergroup to that branch (in addition, an odd clade consisting of Barnacles, a dipluran insect, and Drosophila is found between Introduction the remainder of Crustacea and Hexapoda). Several studies using complete mitochondrial genomes The high information content of mitochondrial ge- suggested a sistergroup relation between Malacost- nomes has been proved very useful in phylogenetic raca and Hexapoda (Wilson et al., 2000; Hwang et analyses of higher ranked taxa (Boore, 1999). In ani- al., 2001), but in most analyses only decapod and mals the mitochondrial genome is typically a single branchiopod species represented the Crustacea. circular duplex molecule, about 16 kb in size, and Recently additional mitochondrial genomes of spe- contains 13 protein-coding genes, 2 ribosomal RNA cies from Remipedia, Cephalocarida, Branchiura, genes, 22 transfer RNA genes, and one AT-rich and Cirripedia (Lavrov et al., 2004) were published. noncoding part, the control region (Wolstenholme, Using tRNA translocation data these authors com- 1992). Nucleotide or amino acid sequences, mito- bined Cirripedia, Cephalocarida, Branchiura, and chondrial gene order, transfer RNA secondary the formerly enigmatic Pentastomida in one clade. structure, and mitochondrial deviations from the In the same study phylogenetic analysis using se- universal genetic code were formerly used as char- quence information supported monophyly of Mala- acters for phylogenetic analyses. Sequence data from costraca and Branchiopoda, but failed to support the single genes or the mitochondrial control region also cases of Maxillopoda (Cirripedia and Copepoda- Branchiura-Pentastomida as separate lineages) and Correspondence to: Lars Podsiadlowski; Hexapoda (with insects and collembolans as sepa- E-mail: [email protected] rate lineages). All in all the interrelation between 618 DOI: 10.1007/s10126-005-0017-8 Volume 7, 618–624 (2005) Ó Springer Science+Business Media, Inc. 2005 LARS PODSIADLOWSKI AND THOMAS BARTOLOMAEUS:STOMATOPOD MITOCHONDRIAL GENOME 619 Table 1. PCR Primers Used to Amplify Crustacean Mitochondrial Gene Fragments PCR primer name Sequence (5¢–3¢) Annealing temperature (°C) crust-cox1f ACTAATCACAARGAYATTGG 45 crust-cox1r TAGTCTGAGTANCGTCGWGG 45 crust-cox3f ATAATTCAATGATGACGAGA 45 crust-cox3r CCAATAATWACATGWAGACC 45 crust-nd4f TTGAGGTTAYCAGCCYG 45 crust-nd4r ATATGAGCYACAGAAGARTAAGC 45 crust-nd5f AGAATTCACTAGGDTGRGATGG 45 crust-nd5r AAAGAGCCTTAAATAAAGCATG 45 crust-16Sf GCGACCTCGATGTTGGATTAA 48 crust-16Sr CCGGTCTGAACTCAYATC 48 crust-12Sf CAGCAKYCGCGGTTAKAC 50 crust-12Sr ACACCTACTWTGTTACGACTTATCTC 50 the above-mentioned taxa remain poorly resolved. Materials and Methods Hexapod polyphyly was proposed previously by Nardi et al. (2003), who also used mitochondrial DNA Isolation and PCR. A specimen of Pseudo- genome data. Finally, a study of combined 18S and squilla ciliata was obtained from a commercial 28S rRNA (Mallatt et al., 2004) found a monophy- source. A single pleopod was used for total genomic letic Hexapoda as a sistergroup to copepods, as well DNA extraction, using the DNeasy Tissue and branchiopods as next relatives to that clade. Kit (Qiagen) and following the manufacturerÕs pro- These 3 taxa form in turn the sistergroup to Mala- tocol. costraca. Other crustacean species in this study Initially 6 partial mitochondrial sequences (cox1, were taken from Branchiura and Cirripedia, while cox3, nd4, nd5, 16S, and 12S) were determined with Remipedia and Cephalocarida were not represented. PCR primer pairs specially designed for this purpose The phylogenetic position of Stomatopoda (Table 1) by looking for conserved regions of mito- among Malacostraca is also under discussion. chondrial genes from other crustacean sequences. Schram (1986) as well as Richter and Scholtz PCR primers were purchased from Metabion. PCR (2001) proposed Stomatopods as a sistergroup to all was performed on Mastercycler and Mastercycler other Eumalacostraca. Schram and Hof (1998) and Gradient (Eppendorf) using the Eppendorf HotMas- Wills (1998) found that Stomatopoda was a sister- terTaq kit. Reaction volumes of 50 ll were set up in group to Eucarida, while Peracarida and Syncarida the following manner: 42 ll sterilized distilled wa- formed more basal branches in Eumalacostraca. To ter, 5 ll10· reaction buffer, 1 ll dNTP mix (Eppen- date phylogenetic analyses of arthropod or crusta- dorf), 1 ll primer mix (10 lM each), 1 ll DNA cean relations with mitochondrial genomes have template, 0.2 ll (1 U) HotMasterTaq polymerase. included malacostracan species only from the de- The cycling protocol includes an initial denaturation rived clade Decapoda. Recently the nearly com- step (94°C, 2 minutes), 40 cycles of denaturation plete mitochondrial genome of a euphausiacean (94°C, 30 seconds), annealing (1 minute; see Table 1 species was added (Machida et al., 2004), but phy- for annealing temperature of each primer), and logenetic analysis was not included in this study. extension (68°C, 90 seconds), and a final extension To sequence mitochondrial genomes of malacos- step (68°C, 1 minute). After agarose (0.9%) gel sepa- tracan species, we developed a versatile polymerase ration and ethidium bromide staining, PCR products chain reaction (PCR) primer set for short fragments were inspected under UV transillumination. PCR of 6 mitochondrial genes (Table 1). For better taxon purification was done using the PCR purification kit sampling among Malacostraca, we sequenced the (Qiagen) or if necessary using the gel extraction kit nearly complete mitochondrial genome of Pseud- (Qiagen). PCR products were subsequently se- osquilla ciliata (Stomatopoda). We then used the quenced (see below). concatenated sequence data of 12 protein-coding In a second step the determined first sequences genes for phylogenetic analyses of eumalacostracan were used to design 5 additional PCR primer pairs and pancrustacean interrelations in order to obtain bridging the gaps between them. PCR was performed better information about the phylogenetic posi- as described above, except an extension time of 7 tions of Stomatopoda and Malacostraca, respec- minutes was used. PCR products were inspected and tively. purified as described above. 620 LARS PODSIADLOWSKI AND THOMAS BARTOLOMAEUS:STOMATOPOD MITOCHONDRIAL GENOME Table 2. Taxa and Accession Numbers of Mitogenomic Sequences Used in Phylogenetic Analyses Species Phylogenetic position Accession no. Limulus polyphemus Chelicerata – Xiphosura NC003057 Lithobius forficatus Myriapoda – Chilopoda NC002629 Narceus annularus Myriapoda – Diplopoda NC003343 Tetrodontophora bielanensis Hexapoda – Collembola NC002735 Gomphiocephalus hodgsoni Hexapoda – Collembola NC005438 Tricholepidion gertschi Hexapoda – Zygentoma NC005437 Locusta migratoria Hexapoda – Pterygota NC001712 Speleonectes tulumensis Crustacea – Remipedia NC005938 Hutchinsoniella macrantha Crustacea – Cephalocarida NC005937 Pollicipes polymerus Crustacea – Cirripedia NC005936 Tigriopus japonicus Crustacea – Copepoda NC003979 Vargula hilgendorfi Crustacea – Ostracoda NC005306 Argulus americana Crustacea – Branchiura NC005935 Armillifer armillatus Crustacea – Pentastomida NC005934 Artemia franciscana Crustacea – Anostraca NC001620 Daphnia pulex Crustacea – Phyllopoda NC000844 Triops cancriformis Crustacea – Phyllopoda NC004465 Euphausia superba Crustacea – Euphausiacea AB084378 Pagurus longicarpus Crustacea – Decapoda NC003058 Portunus trituberculatus Crustacea – Decapoda NC005037 Panulirus japonicus Crustacea – Decapoda NC004251 Penaeus monodon Crustacea – Decapoda NC002184 Cherax destructor Crustacea – Decapoda NC011243 Pseudosquilla ciliata
Load more

Recommended publications
  • Learning in Stomatopod Crustaceans
    International Journal of Comparative Psychology, 2006, 19 , 297-317. Copyright 2006 by the International Society for Comparative Psychology Learning in Stomatopod Crustaceans Thomas W. Cronin University of Maryland Baltimore County, U.S.A. Roy L. Caldwell University of California, Berkeley, U.S.A. Justin Marshall University of Queensland, Australia The stomatopod crustaceans, or mantis shrimps, are marine predators that stalk or ambush prey and that have complex intraspecific communication behavior. Their active lifestyles, means of predation, and intricate displays all require unusual flexibility in interacting with the world around them, imply- ing a well-developed ability to learn. Stomatopods have highly evolved sensory systems, including some of the most specialized visual systems known for any animal group. Some species have been demonstrated to learn how to recognize and use novel, artificial burrows, while others are known to learn how to identify novel prey species and handle them for effective predation. Stomatopods learn the identities of individual competitors and mates, using both chemical and visual cues. Furthermore, stomatopods can be trained for psychophysical examination of their sensory abilities, including dem- onstration of color and polarization vision. These flexible and intelligent invertebrates continue to be attractive subjects for basic research on learning in animals with relatively simple nervous systems. Among the most captivating of all arthropods are the stomatopod crusta- ceans, or mantis shrimps. These marine creatures, unfamiliar to most biologists, are abundant members of shallow marine ecosystems, where they are often the dominant invertebrate predators. Their common name refers to their method of capturing prey using a folded, anterior raptorial appendage that looks superficially like the foreleg of a praying mantis.
    [Show full text]
  • Anchialine Cave Biology in the Era of Speleogenomics Jorge L
    International Journal of Speleology 45 (2) 149-170 Tampa, FL (USA) May 2016 Available online at scholarcommons.usf.edu/ijs International Journal of Speleology Off icial Journal of Union Internationale de Spéléologie Life in the Underworld: Anchialine cave biology in the era of speleogenomics Jorge L. Pérez-Moreno1*, Thomas M. Iliffe2, and Heather D. Bracken-Grissom1 1Department of Biological Sciences, Florida International University, Biscayne Bay Campus, North Miami FL 33181, USA 2Department of Marine Biology, Texas A&M University at Galveston, Galveston, TX 77553, USA Abstract: Anchialine caves contain haline bodies of water with underground connections to the ocean and limited exposure to open air. Despite being found on islands and peninsular coastlines around the world, the isolation of anchialine systems has facilitated the evolution of high levels of endemism among their inhabitants. The unique characteristics of anchialine caves and of their predominantly crustacean biodiversity nominate them as particularly interesting study subjects for evolutionary biology. However, there is presently a distinct scarcity of modern molecular methods being employed in the study of anchialine cave ecosystems. The use of current and emerging molecular techniques, e.g., next-generation sequencing (NGS), bestows an exceptional opportunity to answer a variety of long-standing questions pertaining to the realms of speciation, biogeography, population genetics, and evolution, as well as the emergence of extraordinary morphological and physiological adaptations to these unique environments. The integration of NGS methodologies with traditional taxonomic and ecological methods will help elucidate the unique characteristics and evolutionary history of anchialine cave fauna, and thus the significance of their conservation in face of current and future anthropogenic threats.
    [Show full text]
  • Climate Change and Fisheries: Policy, Trade and Sustainable Nal of Fisheries Management 22:852-862
    Climate Change and Alaska Fisheries TERRY JOHNSON Alaska Sea Grant University of Alaska Fairbanks 2016 ISBN 978-1-56612-187-3 http://doi.org/10.4027/ccaf.2016 MAB-67 $10.00 Credits Alaska Sea Grant is supported by the US Department of Commerce, NOAA National Sea Grant, grant NA14OAR4170079 (A/152-32) and by the University of Alaska Fairbanks with state funds. Sea Grant is a partnership with public and private sectors combining research, education, and extension. This national network of universities meets changing environmental and Alaska Sea Grant economic needs of people in coastal, ocean, and Great Lakes University of Alaska Fairbanks regions. Fairbanks, Alaska 99775-5040 Funding for this project was provided by the Alaska Center for Climate Assessment and Policy (ACCAP). Cover photo by (888) 789-0090 Deborah Mercy. alaskaseagrant.org TABLE OF CONTENTS Abstract .................................................................................................... 2 Take-home messages ...................................................................... 2 Introduction............................................................................................. 3 1. Ocean temperature and circulation ................................................ 4 2. Ocean acidification ............................................................................ 9 3. Invasive species, harmful algal blooms, and disease-causing pathogens .................................................... 12 4. Fisheries effects—groundfish and crab ......................................
    [Show full text]
  • Krill Oil and Astaxanthin
    Krill Oil and Astaxanthin Krill are small reddish-color crustaceans, similar to shrimp, that abound in cold Arctic waters. They survive in such cold, frigid temperatures because of their natural anti- freeze, the polyunsaturated fatty acids EPA and DHA. EPA and DHA are bound to molecules called phospholipids (especially phosphatidyl choline) that act to help transport nutrients into cells and change the structure of animal cell membranes. Studies show that these combined fatty acids have better absorption into the cell membranes throughout the body, especially the brain, as compared to other types of fish oils. Although it has less EPA/DHA content than most fish oils, krill oil seems to be almost twice as absorbable. Unlike fish oil, krill oil also contains a very potent antioxidant, astaxanthin, which helps prevent krill oil from oxidizing (turning rancid). Astaxanthin is a red pigment found in different types of algae and phytoplankton. It is astaxanthin that gives salmon and trout their reddish color. It is considered to be one of the most potent natural antioxidants, almost 50 times stronger than beta-carotenes found in fruits and vegetables and 65 times better as an anti-oxidant than vitamin C. Krill oil is composed of 40% phospholipids, 30% EPA and DHA, astaxanthin, vitamin A, vitamin C, various other fatty acids, and flavanoids (anti-oxidant compounds) Human studies indicate krill oil is powerful at decreasing inflammation throughout the body, especially in the brain. It reduces C-reactive protein, a marker for heart disease. Tests indicate it has a powerful anti-inflammatory remedy for rheumatoid as well as osteoarthritis.
    [Show full text]
  • Going Deeper Into High and Low Phylogenetic Relationships of Protura
    G C A T T A C G G C A T genes Article Going Deeper into High and Low Phylogenetic Relationships of Protura 1, , 2,3, 3 1 1 Antonio Carapelli * y , Yun Bu y, Wan-Jun Chen , Francesco Nardi , Chiara Leo , Francesco Frati 1 and Yun-Xia Luan 3,4,* 1 Department of Life Sciences, University of Siena, Via A. Moro 2, 53100 Siena, Italy; [email protected] (F.N.); [email protected] (C.L.); [email protected] (F.F.) 2 Natural History Research Center, Shanghai Natural History Museum, Shanghai Science & Technology Museum, Shanghai 200041, China; [email protected] 3 Key Laboratory of Insect Developmental and Evolutionary Biology, Institute of Plant Physiology and Ecology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200032, China; [email protected] 4 Guangdong Provincial Key Laboratory of Insect Developmental Biology and Applied Technology, Institute of Insect Science and Technology, School of Life Sciences, South China Normal University, Guangzhou 510631, China * Correspondence: [email protected] (A.C.); [email protected] (Y.-X.L.); Tel.: +39-0577-234410 (A.C.); +86-18918100826 (Y.-X.L.) These authors contributed equally to this work. y Received: 16 March 2019; Accepted: 5 April 2019; Published: 10 April 2019 Abstract: Proturans are small, wingless, soil-dwelling arthropods, generally associated with the early diversification of Hexapoda. Their bizarre morphology, together with conflicting results of molecular studies, has nevertheless made their classification ambiguous. Furthermore, their limited dispersal capability (due to the primarily absence of wings) and their euedaphic lifestyle have greatly complicated species-level identification.
    [Show full text]
  • Stomatopod Interrelationships: Preliminary Results Based on Analysis of Three Molecular Loci
    Arthropod Systematics & Phylogeny 91 67 (1) 91 – 98 © Museum für Tierkunde Dresden, eISSN 1864-8312, 17.6.2009 Stomatopod Interrelationships: Preliminary Results Based on Analysis of three Molecular Loci SHANE T. AHYONG 1 & SIMON N. JARMAN 2 1 Marine Biodiversity and Biodescurity, National Institute of Water and Atmospheric Research, Private Bag 14901, Kilbirnie, Wellington, New Zealand [[email protected]] 2 Australian Antarctic Division, 203 Channel Highway, Kingston, Tasmania 7050, Australia [[email protected]] Received 16.iii.2009, accepted 15.iv.2009. Published online at www.arthropod-systematics.de on 17.vi.2009. > Abstract The mantis shrimps (Stomatopoda) are quintessential marine predators. The combination of powerful raptorial appendages and remarkably developed sensory systems place the stomatopods among the most effi cient invertebrate predators. High level phylogenetic analyses have been so far based on morphology. Crown-group Unipeltata appear to have diverged in two broad directions from the outset – one towards highly effi cient ‘spearing’ with multispinous dactyli on the raptorial claws (dominated by Lysiosquilloidea and Squilloidea), and the other towards ‘smashing’ (Gonodactyloidea). In a preliminary molecular study of stomatopod interrelationships, we assemble molecular data for mitochondrial 12S and 16S regions, combined with new sequences from the 16S and two regions of the nuclear 28S rDNA to compare with morphological hypotheses. Nineteen species representing 9 of 17 extant families and 3 of 7 superfamilies were analysed. The molecular data refl ect the overall patterns derived from morphology, especially in a monophyletic Squilloidea, a monophyletic Lysiosquilloidea and a monophyletic clade of gonodactyloid smashers. Molecular analyses, however, suggest the novel possibility that Hemisquillidae and possibly Pseudosquillidae, rather than being basal or near basal in Gonodactyloidea, may be basal overall to the extant stomatopods.
    [Show full text]
  • Phylogenomic Resolution of Sea Spider Diversification Through Integration Of
    bioRxiv preprint doi: https://doi.org/10.1101/2020.01.31.929612; this version posted February 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Phylogenomic resolution of sea spider diversification through integration of multiple data classes 1Jesús A. Ballesteros†, 1Emily V.W. Setton†, 1Carlos E. Santibáñez López†, 2Claudia P. Arango, 3Georg Brenneis, 4Saskia Brix, 5Esperanza Cano-Sánchez, 6Merai Dandouch, 6Geoffrey F. Dilly, 7Marc P. Eleaume, 1Guilherme Gainett, 8Cyril Gallut, 6Sean McAtee, 6Lauren McIntyre, 9Amy L. Moran, 6Randy Moran, 5Pablo J. López-González, 10Gerhard Scholtz, 6Clay Williamson, 11H. Arthur Woods, 12Ward C. Wheeler, 1Prashant P. Sharma* 1 Department of Integrative Biology, University of Wisconsin–Madison, Madison, WI, USA 2 Queensland Museum, Biodiversity Program, Brisbane, Australia 3 Zoologisches Institut und Museum, Cytologie und Evolutionsbiologie, Universität Greifswald, Greifswald, Germany 4 Senckenberg am Meer, German Centre for Marine Biodiversity Research (DZMB), c/o Biocenter Grindel (CeNak), Martin-Luther-King-Platz 3, Hamburg, Germany 5 Biodiversidad y Ecología Acuática, Departamento de Zoología, Facultad de Biología, Universidad de Sevilla, Sevilla, Spain 6 Department of Biology, California State University-Channel Islands, Camarillo, CA, USA 7 Départment Milieux et Peuplements Aquatiques, Muséum national d’Histoire naturelle, Paris, France 8 Institut de Systématique, Emvolution, Biodiversité (ISYEB), Sorbonne Université, CNRS, Concarneau, France 9 Department of Biology, University of Hawai’i at Mānoa, Honolulu, HI, USA Page 1 of 31 bioRxiv preprint doi: https://doi.org/10.1101/2020.01.31.929612; this version posted February 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder.
    [Show full text]
  • DINÂMICA POPULACIONAL DO SIRI-AZUL Callinectes Sapidus (RATHBUN, 1896) (CRUSTACEA: DECAPODA: PORTUNIDAE) NO BAIXO ESTUÁRIO DA LAGOA DOS PATOS, RS, BRASIL
    UNIVERSIDADE FEDERAL DO RIO GRANDE PÓS-GRADUAÇÃO EM OCEANOGRAFIA BIOLÓGICA DINÂMICA POPULACIONAL DO SIRI-AZUL Callinectes sapidus (RATHBUN, 1896) (CRUSTACEA: DECAPODA: PORTUNIDAE) NO BAIXO ESTUÁRIO DA LAGOA DOS PATOS, RS, BRASIL LEONARDO SIMÕES FERREIRA Tese apresentada ao Programa de Pós- graduação em Oceanografia Biológica da Universidade Federal do Rio Grande, como requisito parcial à obtenção do título de DOUTOR. Orientador: Fernando D´Incao RIO GRANDE Janeiro/2012 AGRADECIMENTOS Em primeiro lugar ao meu amigo, professor e orientador Dr. Fernando D´Incao, por seus ensinamentos durante todos esses anos. Ao meu coorientador e amigo Dr. Duane Fonseca, por toda ajuda no decorrer da Tese, e principalmente por me passar todo o seu conhecimento sobre o assunto “lipofuscina”. Aos Doutores, Paulo Juarez Rieger, Enir Girondi Reis (Neca), Wilson Wasieleski (Mano), e Rogério Caetano (Cebola) da Unespe, por aceitarem fazer parte da minha banca examinadora, e por suas valiosas correções e sugestões. Toda a galera do Laboratório de Crustáceos Decapodes, os quais são muitos! A minha amiga especial Laboratorista/Dra. Roberta Barutot que me ajudou em grande parte da Tese, assim como o Doutor Luiz Felipe Dumont. Aos meus estagiários, Andréia Barros, Renan (bonitão.com) e Diego Martins (guasco). Meus amigos pescadores: Pingo, Sarinha, Leandro, Giovani e Didico. A minha família, meus pais, minha esposa Juliana e a minha princesinha Luana! Ao Programa de Pós-graduação em Oceanografia Biológica, a Capes pela concessão da bolsa de estudos, ao Instituto de
    [Show full text]
  • JCPA-S-19-00140.Pdf
    This is a post-peer-review, pre-copyedit version of an article published in Journal of Comparative Physiology A. The final authenticated version is available online at: https://doi.org/10.1007/s00359-019-01387-5. Access to this work was provided by the University of Maryland, Baltimore County (UMBC) ScholarWorks@UMBC digital repository on the Maryland Shared Open Access (MD-SOAR) platform. Please provide feedback Please support the ScholarWorks@UMBC repository by emailing [email protected] and telling us what having access to this work means to you and why it’s important to you. Thank you. Journal of Comparative Physiology A Optic lobe organization in stomatopod crustacean species having different degrees of retinal complexity --Manuscript Draft-- Manuscript Number: Full Title: Optic lobe organization in stomatopod crustacean species having different degrees of retinal complexity Article Type: S.I. : Visual Circuits Funding Information: Air Force Office of Scientific Research Dr. Thomas W Cronin (FA9550-18-1-0278) Abstract: Stomatopod crustaceans possess tripartite compound eyes; upper and lower hemispheres are separated by an equatorial midband of several ommatidial rows. The organization of stomatopod retinas is well studied, but their optic lobes are less understood. We used histological staining, immunolabeling, and fluorescent tracer injections to compare optic lobes in two 6-midband-row species, Neogonodactylus oerstedii and Pseudosquilla ciliata , to those in two 2-midband-row species, Squilla empusa and Alima pacifica . Compared to the 6-row species, we found structural simplification in all optic neuropils in both 2-row species. Photoreceptor axons from 2- row midband ommatidia supply two sets of enlarged lamina cartridges, but a gap in the lamina exists at the location where the cartridges of the dorsal four ommatidial rows of 6-row species would appear.
    [Show full text]
  • Crustacea, Malacostraca)*
    SCI. MAR., 63 (Supl. 1): 261-274 SCIENTIA MARINA 1999 MAGELLAN-ANTARCTIC: ECOSYSTEMS THAT DRIFTED APART. W.E. ARNTZ and C. RÍOS (eds.) On the origin and evolution of Antarctic Peracarida (Crustacea, Malacostraca)* ANGELIKA BRANDT Zoological Institute and Zoological Museum, Martin-Luther-King-Platz 3, D-20146 Hamburg, Germany Dedicated to Jürgen Sieg, who silently died in 1996. He inspired this research with his important account of the zoogeography of the Antarctic Tanaidacea. SUMMARY: The early separation of Gondwana and the subsequent isolation of Antarctica caused a long evolutionary his- tory of its fauna. Both, long environmental stability over millions of years and habitat heterogeneity, due to an abundance of sessile suspension feeders on the continental shelf, favoured evolutionary processes of “preadapted“ taxa, like for exam- ple the Peracarida. This taxon performs brood protection and this might be one of the most important reasons why it is very successful (i.e. abundant and diverse) in most terrestrial and aquatic environments, with some species even occupying deserts. The extinction of many decapod crustaceans in the Cenozoic might have allowed the Peracarida to find and use free ecological niches. Therefore the palaeogeographic, palaeoclimatologic, and palaeo-hydrographic changes since the Palaeocene (at least since about 60 Ma ago) and the evolutionary success of some peracarid taxa (e.g. Amphipoda, Isopo- da) led to the evolution of many endemic species in the Antarctic. Based on a phylogenetic analysis of the Antarctic Tanaidacea, Sieg (1988) demonstrated that the tanaid fauna of the Antarctic is mainly represented by phylogenetically younger taxa, and data from other crustacean taxa led Sieg (1988) to conclude that the recent Antarctic crustacean fauna must be comparatively young.
    [Show full text]
  • Cannibalism and Habitat Selection of Cultured Chinese Mitten Crab: Effects of Submerged Aquatic Vegetation with Different Nutritional and Refuge Values
    water Article Cannibalism and Habitat Selection of Cultured Chinese Mitten Crab: Effects of Submerged Aquatic Vegetation with Different Nutritional and Refuge Values Qingfei Zeng 1,*, Erik Jeppesen 2,3, Xiaohong Gu 1,*, Zhigang Mao 1 and Huihui Chen 1 1 State Key Laboratory of Lake Science and Environment, Nanjing Institute of Geography and Limnology, Chinese Academy of Sciences, Nanjing 210008, China; [email protected] (Z.M.); [email protected] (H.C.) 2 Department of Bioscience, Aarhus University, Vejlsøvej 25, 8600 Silkeborg, Denmark; [email protected] 3 Sino-Danish Centre for Education and Research, University of CAS, Beijing 100190, China * Correspondence: [email protected] (Q.Z.); [email protected] (X.G.) Received: 26 September 2018; Accepted: 26 October 2018; Published: 29 October 2018 Abstract: We examined the food preference of Chinese mitten crabs, Eriocheir sinensis (H. Milne Edwards, 1853), under food shortage, habitat choice in the presence of predators, and cannibalistic behavior by comparing their response to the popular culture plant Elodea nuttallii and the structurally more complex Myriophyllum verticillatum L. in a series of mesocosm experiments. Mitten crabs were found to consume and thus reduce the biomass of Elodea, whereas no negative impact on Myriophyllum biomass was recorded. In the absence of adult crabs, juveniles preferred to settle in Elodea habitats (appearance frequency among the plants: 64.2 ± 5.9%) but selected for Myriophyllum instead when adult crabs were present (appearance frequency among the plants: 59.5 ± 4.9%). The mortality rate of mitten crabs in the absence of plant shelter was higher under food shortage, primarily due to cannibalism.
    [Show full text]
  • Crustaceans Topics in Biodiversity
    Topics in Biodiversity The Encyclopedia of Life is an unprecedented effort to gather scientific knowledge about all life on earth- multimedia, information, facts, and more. Learn more at eol.org. Crustaceans Authors: Simone Nunes Brandão, Zoologisches Museum Hamburg Jen Hammock, National Museum of Natural History, Smithsonian Institution Frank Ferrari, National Museum of Natural History, Smithsonian Institution Photo credit: Blue Crab (Callinectes sapidus) by Jeremy Thorpe, Flickr: EOL Images. CC BY-NC-SA Defining the crustacean The Latin root, crustaceus, "having a crust or shell," really doesn’t entirely narrow it down to crustaceans. They belong to the phylum Arthropoda, as do insects, arachnids, and many other groups; all arthropods have hard exoskeletons or shells, segmented bodies, and jointed limbs. Crustaceans are usually distinguishable from the other arthropods in several important ways, chiefly: Biramous appendages. Most crustaceans have appendages or limbs that are split into two, usually segmented, branches. Both branches originate on the same proximal segment. Larvae. Early in development, most crustaceans go through a series of larval stages, the first being the nauplius larva, in which only a few limbs are present, near the front on the body; crustaceans add their more posterior limbs as they grow and develop further. The nauplius larva is unique to Crustacea. Eyes. The early larval stages of crustaceans have a single, simple, median eye composed of three similar, closely opposed parts. This larval eye, or “naupliar eye,” often disappears later in development, but on some crustaceans (e.g., the branchiopod Triops) it is retained even after the adult compound eyes have developed. In all copepod crustaceans, this larval eye is retained throughout their development as the 1 only eye, although the three similar parts may separate and each become associated with their own cuticular lens.
    [Show full text]