sign in sign up
<<
Home , Armillifer, Eucarida, Eumalacostraca, Krill, Mantis Shrimp, Pancrustacea

Organization of the Mitochondrial Genome of (Crustacea: Stomatopoda)

Lars Podsiadlowski, Thomas Bartolomaeus

Institute of Biology, Freie Universita¨t Berlin, Ko¨ nigin-Luise-Strasse 1-3, D-14195 Berlin, Germany

Received: 4 February 2005 / Accepted: 25 March 2005 / Online publication: 12 August 2005

Abstract have proved useful in studies concerning population genetics and events. We determined the nearly complete mitochondrial For a long time the phylogeny of Crustacea has genome of Pseudosquilla ciliata (Crustacea, Sto- been controversial (for review, see Richter, 2002). matopoda), including all -coding and all Even the monophyly of this group has been ques- but one of the transfer RNAs. There were no tioned. In the last molecular phylogenetic ap- rearrangements relative to the pattern shared by proaches strengthened this debate, while different and hexapods. Phylogenetic analysis approaches using different molecular data sets (18S using concatenated sequences of the rRNA, elongation factors, and mitochondrial genes) mitochondrial protein-coding genes confirmed a ba- led to diverse views of phylogeny. A few sal position of Stomatopoda among . examples of such controversial statements from Pancrustacean relationships based on mitogenomic molecular analyses might illustrate the present sit- data were analyzed and are discussed in relation to uation. crustacean and hexapod monophyly and hexapod In a combined approach (8 partial gene se- affinities to crustacean subtaxa. quences and morphology; Giribet et al., 2001), al- most all Crustacea form a monophyletic group with Key words: phylogeny — Stomatopoda — and Copepoda combined in one , mitochondrial genome — Pancrustacea while Branchiopods, , and Cephalocarids are grouped together as a sistergroup to that branch (in addition, an odd clade consisting of , a dipluran , and Drosophila is found between Introduction the remainder of Crustacea and ). Several studies using complete mitochondrial genomes The high information content of mitochondrial ge- suggested a sistergroup relation between Malacost- nomes has been proved very useful in phylogenetic raca and Hexapoda (Wilson et al., 2000; Hwang et analyses of higher ranked taxa (Boore, 1999). In ani- al., 2001), but in most analyses only decapod and mals the mitochondrial genome is typically a single branchiopod represented the Crustacea. circular duplex molecule, about 16 kb in size, and Recently additional mitochondrial genomes of spe- contains 13 protein-coding genes, 2 ribosomal RNA cies from Remipedia, , , genes, 22 transfer RNA genes, and one AT-rich and Cirripedia (Lavrov et al., 2004) were published. noncoding part, the control region (Wolstenholme, Using tRNA translocation data these authors com- 1992). Nucleotide or amino acid sequences, mito- bined Cirripedia, Cephalocarida, Branchiura, and chondrial gene , transfer RNA secondary the formerly enigmatic in one clade. structure, and mitochondrial deviations from the In the same study phylogenetic analysis using se- universal were formerly used as char- quence information supported monophyly of Mala- acters for phylogenetic analyses. Sequence data from costraca and , but failed to support the single genes or the mitochondrial control region also cases of (Cirripedia and Copepoda- Branchiura-Pentastomida as separate lineages) and Correspondence to: Lars Podsiadlowski; Hexapoda (with and collembolans as sepa- E-mail: [email protected] rate lineages). All in all the interrelation between

618 DOI: 10.1007/s10126-005-0017-8  Volume 7, 618–624 (2005)  Springer +Business Media, Inc. 2005 LARS PODSIADLOWSKI AND THOMAS BARTOLOMAEUS:STOMATOPOD MITOCHONDRIAL GENOME 619

Table 1. PCR Primers Used to Amplify Crustacean Mitochondrial Gene Fragments PCR primer name Sequence (5¢–3¢) Annealing temperature (°C) crust-cox1f ACTAATCACAARGAYATTGG 45 crust-cox1r TAGTCTGAGTANCGTCGWGG 45 crust-cox3f ATAATTCAATGATGACGAGA 45 crust-cox3r CCAATAATWACATGWAGACC 45 crust-nd4f TTGAGGTTAYCAGCCYG 45 crust-nd4r ATATGAGCYACAGAAGARTAAGC 45 crust-nd5f AGAATTCACTAGGDTGRGATGG 45 crust-nd5r AAAGAGCCTTAAATAAAGCATG 45 crust-16Sf GCGACCTCGATGTTGGATTAA 48 crust-16Sr CCGGTCTGAACTCAYATC 48 crust-12Sf CAGCAKYCGCGGTTAKAC 50 crust-12Sr ACACCTACTWTGTTACGACTTATCTC 50

the above-mentioned taxa remain poorly resolved. Materials and Methods Hexapod polyphyly was proposed previously by Nardi et al. (2003), who also used mitochondrial DNA Isolation and PCR. A specimen of Pseudo- genome data. Finally, a study of combined 18S and squilla ciliata was obtained from a commercial 28S rRNA (Mallatt et al., 2004) found a monophy- source. A single pleopod was used for total genomic letic Hexapoda as a sistergroup to , as well DNA extraction, using the DNeasy Tissue and branchiopods as next relatives to that clade. Kit (Qiagen) and following the manufacturerÕs pro- These 3 taxa form in turn the sistergroup to Mala- tocol. costraca. Other crustacean species in this study Initially 6 partial mitochondrial sequences (cox1, were taken from Branchiura and Cirripedia, while cox3, nd4, nd5, 16S, and 12S) were determined with Remipedia and Cephalocarida were not represented. PCR primer pairs specially designed for this purpose The phylogenetic position of Stomatopoda (Table 1) by looking for conserved regions of mito- among Malacostraca is also under discussion. chondrial genes from other crustacean sequences. Schram (1986) as well as Richter and Scholtz PCR primers were purchased from Metabion. PCR (2001) proposed Stomatopods as a sistergroup to all was performed on Mastercycler and Mastercycler other Eumalacostraca. Schram and Hof (1998) and Gradient (Eppendorf) using the Eppendorf HotMas- Wills (1998) found that Stomatopoda was a sister- terTaq kit. Reaction volumes of 50 ll were set up in group to , while and the following manner: 42 ll sterilized distilled wa- formed more basal branches in Eumalacostraca. To ter, 5 ll10· reaction buffer, 1 ll dNTP mix (Eppen- date phylogenetic analyses of arthropod or crusta- dorf), 1 ll primer mix (10 lM each), 1 ll DNA cean relations with mitochondrial genomes have template, 0.2 ll (1 U) HotMasterTaq polymerase. included malacostracan species only from the de- The cycling protocol includes an initial denaturation rived clade . Recently the nearly com- step (94°C, 2 minutes), 40 cycles of denaturation plete mitochondrial genome of a euphausiacean (94°C, 30 seconds), annealing (1 minute; see Table 1 species was added (Machida et al., 2004), but phy- for annealing temperature of each primer), and logenetic analysis was not included in this study. extension (68°C, 90 seconds), and a final extension To sequence mitochondrial genomes of malacos- step (68°C, 1 minute). After agarose (0.9%) gel sepa- tracan species, we developed a versatile polymerase ration and ethidium bromide staining, PCR products chain reaction (PCR) primer set for short fragments were inspected under UV transillumination. PCR of 6 mitochondrial genes (Table 1). For better purification was done using the PCR purification kit sampling among Malacostraca, we sequenced the (Qiagen) or if necessary using the gel extraction kit nearly complete mitochondrial genome of Pseud- (Qiagen). PCR products were subsequently se- osquilla ciliata (Stomatopoda). We then used the quenced (see below). concatenated sequence data of 12 protein-coding In a second step the determined first sequences genes for phylogenetic analyses of eumalacostracan were used to design 5 additional PCR primer pairs and pancrustacean interrelations in order to obtain bridging the gaps between them. PCR was performed better information about the phylogenetic posi- as described above, except an extension time of 7 tions of Stomatopoda and Malacostraca, respec- minutes was used. PCR products were inspected and tively. purified as described above. 620 LARS PODSIADLOWSKI AND THOMAS BARTOLOMAEUS:STOMATOPOD MITOCHONDRIAL GENOME

Table 2. Taxa and Accession Numbers of Mitogenomic Sequences Used in Phylogenetic Analyses Species Phylogenetic position Accession no. Limulus polyphemus – NC003057 Lithobius forficatus – Chilopoda NC002629 Narceus annularus Myriapoda – Diplopoda NC003343 Tetrodontophora bielanensis Hexapoda – Collembola NC002735 Gomphiocephalus hodgsoni Hexapoda – Collembola NC005438 Tricholepidion gertschi Hexapoda – NC005437 Locusta migratoria Hexapoda – NC001712 Speleonectes tulumensis Crustacea – Remipedia NC005938 Hutchinsoniella macrantha Crustacea – Cephalocarida NC005937 Pollicipes polymerus Crustacea – Cirripedia NC005936 Tigriopus japonicus Crustacea – Copepoda NC003979 Vargula hilgendorfi Crustacea – Ostracoda NC005306 Argulus americana Crustacea – Branchiura NC005935 Crustacea – Pentastomida NC005934 Artemia franciscana Crustacea – Anostraca NC001620 Daphnia pulex Crustacea – Phyllopoda NC000844 Triops cancriformis Crustacea – Phyllopoda NC004465 superba Crustacea – Euphausiacea AB084378 Pagurus longicarpus Crustacea – Decapoda NC003058 Crustacea – Decapoda NC005037 Panulirus japonicus Crustacea – Decapoda NC004251 Crustacea – Decapoda NC002184 destructor Crustacea – Decapoda NC011243 Pseudosquilla ciliata Crustacea – Stomatopoda AY947836

Sequencing and Sequence Analysis. All se- GENEBLOCKS software (Version 0.91b; Castresana, quencing reactions were run on Mastercycler and 2000) with user-defined settings. Parameters in Mastercycler Gradient using the CEQ DTCS Kit analysis of Eumalacostraca (10 taxa) were as follows: following manufacturerÕs protocols. Initially PCR minimum number of sequences for a conserved po- primers were used, and subsequently newly designed sition, 8; minimum number of sequences for a internal primers were used until completion of se- flanking position, 8; maximum number of contigu- quences (primer walking). Separation was done on a ous nonconserved positions, 3; minimum length of a CEQ 8000 (Beckman Coulter); sequencing results block, 5; and recovered amino acids, 2309. Parame- were primarily analyzed using CEQ software. ters in analysis of Pancrustacea (21 taxa) were 17, 17, To determine gene identity BLAST searches on 3, 5, and 1899, respectively. NCBI Blast Entrez databases were performed. Not Phylogenetic analyses were done with two dif- determinable by sequence information alone, ferent taxa sets. One included the majority of mal- boundaries of ribosomal RNAs were assumed to acostracan species with published mitochondrial extend to the boundaries of flanking genes. Start genomes and was used to address the question of codons in protein-coding genes were presumed to be stomatopod relations among Eumalacostraca. The the nearest start codon in frame around the begin- other included representatives from all crustacean ning of the sequence alignment of genes homologous subtaxa and was used to evaluate the position of with other malacostracan species. Most of the Malacostraca among Pancrustacea. tRNAs were identified using tRNAscan-SE 1.21 Species names and accession numbers are listed (Lowe and Eddy, 1997) and DOGMA (Wyman et al., in Table 2. Phylogenetic inference was estimated by 2004); the others were found by visual inspection of the following methods. (1) Distance analysis used the suspected regions. Transfer RNA identities were logdet distances for amino acids under the minimum specified by their anticodon sequence. evolution criterion implemented in the DAMBE package (Version 4.2.13; Xia and Xie, 2001), with 100 Methods of Phylogenetic Inference. A concate- bootstrap replicates. (2) Maximum parsimony anal- nated data set of individual amino acid alignments ysis used PROTPARS from the PHYLIP package from 12 protein-coding genes was used for phyloge- (Version 3.62; Felsenstein, 1989). Bootstrap repli- netic analysis (only atp8 was excluded, due to its cates (100) were created and analyzed using the ambigous alignment). The alignment was done with SEQBOOT and CONSENSE tools. (3) Maximum CLUSTAL X (Version 1.81; Jeanmougin et al., 1998). likelihood analysis used PROTML from the same Ambiguously aligned regions were omitted using package, with JTT model and gamma distribution LARS PODSIADLOWSKI AND THOMAS BARTOLOMAEUS:STOMATOPOD MITOCHONDRIAL GENOME 621

Fig. 1. Maximum likelihood tree of Eumalacostraca based on concatenated amino acid alignments of 12 protein-coding genes (2854 amino acids). Numbers above branches, from top to bottom: Bayesian posterior probabilities (%), maximum parsimony bootstrap values (%, out of 100 trees), and minimum evolution bootstrap values (%, 100 trees). with invariant sites. (4) Bayesian analysis was per- control region, and tRNA-Ile. The mitochondrial formed with MRBAYES (Version 3.04; Huelsenbeck genome of P. ciliata includes 13 protein-coding and 2 and Ronquist, 2001; Ronquist and Huelsenbeck, rRNA genes, as found in most other metazoans. 2003). One million generations were computed with Furthermore, we were able to detect 21 of the 22 4 parallel chains. The model set was JTT, gamma tRNA genes usually present in metazoan distribution with invariant sites. We preferred the (Table 3). Gene overlaps exist at 12 gene boundaries, JTT model over mtRev because the latter was cre- extending up to 7 nucleotides (between atp8/atp6 ated with mitochondrial data exclusively from ver- and nad4/nad4L). Genome arrangement of P. ciliata tebrate taxa, while we found better performance was identical to the mitochondrial genomes of with arthropod data using JTT. Panulirus japonicus, Penaeus monodon, and Mar- supenaeus japonicus (Malacostraca; Wilson et al., 2000; Yamauchi et al., 2002, 2005), Daphnia pulex Results and Discussion (Branchiopoda; Crease, 1999), and various insects. Genome Organization. Long-PCR with primer pairs This is thought to be the pancrustacean ground designed for the gap between 12S rRNA and cox1 pattern, which differs in the position of tRNA- yielded only a PCR fragment starting with tRNA- Leu(UUR) from the putative ground pattern of Euar- Gln and cox1. Several attempts to bridge the gap thropoda. Other malacostracan representatives show between 12S rRNA and tRNA-Gln failed, so we derivations of the pancrustacean ground pattern: 2 present here an incomplete mitochondrial genome, tRNA translocations are reported in Euphausia missing a part of 12S rRNA, the mitochondrial superba (Machida et al., 2004); one is reported in 622 LARS PODSIADLOWSKI AND THOMAS BARTOLOMAEUS:STOMATOPOD MITOCHONDRIAL GENOME

Fig. 2. Maximum likelihood tree of Pancrustacea based on concatenated amino acid alignments of 12 protein-coding genes (1899 amino acids). Limulus polyphemus and 2 myriapod species serve as outgroup members. Numbers above branches from top to bottom: Bayesian posterior probability (%), maximum parsimony bootstrap value (%, out of 100 trees), and minimum evolution bootstrap value (%, 100 trees).

Portunus trituberculatus (Yamauchi et al., 2003); character for eumalacostraca or malacostraca. Three and Pagurus longicarpus (Hickerson and Cunning- of the 13 protein-coding genes show incomplete stop ham, 2000) and Cherax destructor (Miller et al., codons. This is often described in other 2004) show several unique major rearrangements. mitochondrial genomes and is hypothesized to be Further rearrangements in decapod species are re- completed by polyadenylation after cleavage of ported without complete mitogenomic data by messenger RNA from the polycistronic transcript Morrison et al. (2002). (Ojala et al., 1981).

Protein-Coding Genes. The AT content of the Phylogenetic Analysis. All phylogenetic analy- protein-coding genes is 67.6% (A, 28.1%; C, 15.7%; ses were performed with concatenated amino acid G, 16.7%; T, 39.5%), which is within the range of sequences from 12 protein-coding genes. Ambi- other malacostracan species; The minimum is given gously aligned portions were sorted using GENE- by Cherax destructor, 60.0% (Miller et al., 2004), and BLOCKS software (Castresana, 2000) for maximum the maximum by Penaeus monodon, 69.3% (Wilson objectivity. Our phylogenetic analysis of malacos- et al., 2000). tracan mitochondrial genomes (Figure 1) shows that Most protein coding genes begin with the usual P. ciliata splits off from the base of Eumalacostraca. start codons in mitochondria, but cox1 is an excep- Caridoida and Decapoda show good support in tion in that its putative start codon is ACG (coding Bayesian inference, but not in distance and maxi- for Thr). Except for P. trituberculata (Yamauchi mum parsimony analyses. Owing to the lack of mi- et al., 2003), all other malacostracan species with togenomic data for Syncarida and Peracarida, no determined mitochondrial genomes show this start decision between the conflicting morphology-based codon at cox1, whereas other crustacean species hypotheses (Schram, 1986; Wills, 1997; Richter and have usual start codons. This may be an apomorphic Scholtz, 2001) is possible. LARS PODSIADLOWSKI AND THOMAS BARTOLOMAEUS:STOMATOPOD MITOCHONDRIAL GENOME 623

Table 3. Organization of the Mitochondrial Genome of P. ciliata Gene Strand Position number Size (nt) Size (aa) Start codon Stop codon Intergenic nucleotides tRNA-Gln ) 13–80 68 20 tRNA-Met + 101–169 69 9 ND2 + 179–1171 993 330 ATT TAA )2 tRNA-Trp + 1170–1238 69 )1 tRNA-Cys ) 1238–1301 64 0 tRNA-Tyr ) 1302–1367 66 1 CO1 + 1369–2907 1539 512 ACG TAA )5 tRNA-LeuCUN + 2903–2970 68 2 CO2 + 2973–3660 688 228 ATG T 0 tRNA-Lys + 3661–3728 68 )1 tRNA-Asp + 3728–3796 68 0 ATP8 + 3797–3955 159 52 ATC TAA )7 ATP6 + 3949–4626 678 225 ATG TAA )1 CO3 + 4626–5417 792 263 ATG TAA 3 tRNA-Gly + 5421–5486 66 0 ND3 + 5487–5840 354 117 ATG TAG )2 tRNA-Ala + 5839–5902 64 12 tRNA-Arg + 5915–5979 65 1 tRNA-Asn + 5981–6048 68 8 tRNA-SerAGN + 6057–6124 68 2 tRNA-Glu + 6127–6194 68 )3 tRNA-Phe ) 6192–6260 69 1 ND5 ) 6262–7971 1702 567 ATA TAA 18 tRNA-His ) 7990–8057 68 )1 ND4 ) 8057–9397 1341 446 ATG TAA )7 ND4L ) 9391–9690 300 99 ATG TAA 2 tRNA-Thr + 9693–9759 67 )4 tRNA-Pro ) 9756–9825 65 10 ND6 + 9836–10353 518 172 ATA TA )1 CYTB + 10353–11489 1137 379 ATG TAA 0 tRNA-SerUCN + 11490–11559 70 26 ND1 ) 11586–12527 942 313 ATA TAG )3 tRNA-LeuUUR ) 12525–12589 65 16S-rRNA ) 12590–13949 1360 tRNA-Val ) 13950–14021 72 12S-rRNAa ) 14022–14621a 600a a Incomplete.

Because of the higher divergence of sequences in monophyletic Hexapoda in the maximum likelihood the alignment of pancrustacean species, we sorted tree, but with moderate support only in Bayesian out ambiguously aligned positions more strictly. In inference (0.89). Hexapoda were not recovered in this way an alignment of 1899 amino acids was analyses in which alignments were only superficially recovered and used for phylogenetic analysis. Only cleaned from ambiguously aligned parts (data not Malacostraca were recovered with highly significant shown), so this may be a crucial point in phylogenetic support by minimum evolution, maximum parsi- analyses based on mitogenomic amino acid align- mony, and Bayesian inference analysis (Figure 2). In ments. Hexapods form a monophyletic clade with other cases only Bayesian inference led to highly Malacostraca and Branchiopoda in the maximum significant support of nodes (0.99–1.00). In detail likelihood tree, but again with only moderate support these are Branchiopoda, a branch combining Bran- from Bayesian inference (0.88). None of the tested chiopoda and Malacostraca, and a branch combining methods support a monophyletic Crustacea, and al- Branchiura, Pentastomida, Copepoda, Ostracoda, though our results are not highly significant, we be- and Cephalocarida. The latter grouping corresponds lieve that hexapods are derived from a crustacean to the interpretation of tRNA translocation data by ancestor as mentioned previously in other molecular Lavrov et al. (2004), with the exception that Cirri- studies of arthropod relations (e.g., Wilson et al., 2000; pedia are also included in that group, whereas in our Hwang et al., 2001, Mallatt et al., 2004). The relations analysis they are not. of Hexapoda to the crustacean subtaxa remains an Contrary to the analysis of Nardi et al. (2003), we open question. While mitogenomic data up to now found collembolans and insects combined in a have favored Malacostraca and analyses based on 18S 624 LARS PODSIADLOWSKI AND THOMAS BARTOLOMAEUS:STOMATOPOD MITOCHONDRIAL GENOME rRNA have favored Branchiopoda as sistergroup to Australian freshwater , Cherax destructor Hexapoda, we propose a third hypothesis for consid- (Crustacea : Decapoda : Parastacidae): a novel gene eration: a combined taxon of Malacostraca and Bran- order revealed. Gene 331, 65–72 chiopoda as sistergroup to Hexapoda. 16. Morrison CL, Harvey AW, Lavery S, Tieu K, Huang Y, Cunningham CW (2002) Mitochondrial gene rear- rangements confirm the parallel evolution of the - Acknowledgments like form. Proc R Soc Lond B 269, 345–50 17. Nardi F, Spinsanti G, Boore JL, Carapelli A, Dallai R, The authors thank Achim Meyer for providing us Frati F (2003) Hexapod origins: monophyletic or para- with a P. ciliata specimen. phyletic? Science 299, 1887–1889 18. Ojala D, Montoya J, Attardi G (1981) tRNA punctua- References tion model of RNA processing in human mitochon- dria. 290, 470–474 1. Boore JL (1999) Animal mitochondrial genomes. Nu- 19. Richter S (2002) The Tetraconata concept: Hexapod- cleic Acids Res 27, 1767–1780 crustacean relationships and the phylogeny of Crus- 2. Castresana J (2000) Selection of conserved blocks from tacea. Org Div Evol 2, 217–237 multiple alignments for their use in phylogenetic 20. Richter S, Scholtz G (2001) Phylogenetic analysis of analysis. Mol Biol Evol 17, 540–552 the Malacostraca (Crustacea). J Zool Sys Evol Res 39, 3. Crease TJ (1999) The complete sequence of the mito- 113–136 chondrial genome of Daphnia pulex (Cladocera: 21. Ronquist F, Huelsenbeck JP (2003) MrBayes 3: Bayes- Crustacea). Gene 233, 89–99 ian phylogenetic inference under mixed models. Bio- 4. Felsenstein J (1989) PHYLIP — Phylogeny Inference informatics 19, 1572–1574 Package (Version 3.2). Cladistics 5, 164–166 22. Schram FR (1986) Crustacea. (New York, NY: Oxford 5. Giribet G, Edgecombe GD, Wheeler WC (2001) University Press) Arthropod phylogeny based on eight molecular loci 23. Schram FR, Hof HJH (1998) Fossils and the interrela- and morphology. Nature 413, 157–161 tionships of major crustacean groups. In: Arthropod 6. Hickerson MJ, Cunningham CW (2000) Dramatic Fossils and Phylogeny, Edgecombe GD, ed. (New mitochondrial rearrangements in the hermit crab York, NY: Columbia University Press) pp 233–302 Pagurus longicarpus (Crustacea, ). Mol Biol 24. Wills MA (1998) A phylogeny of recent and fossil Evol 17, 639–644 Crustacea derived from morphological characters. In: 7. Huelsenbeck JP, Ronquist F (2001) MRBAYES: Bayes- Arthropod Relationships. The Systematics Associa- ian inference of phylogenetic trees. Bioinformatics 17, tion Special Volume Series 55, Fortey RA, Thomas 754–755 RH, ed. (London, UK: Chapman and Hall) pp 87–96 8. Hwang UW, Friedrich M, Tautz D, Park CJ, Kim W 25. Wilson K, Cahill V, Ballment E, Benzie J (2000) The (2001) Mitochondrial protein phylogeny joins myria- complete sequence of the mitochondrial genome of pods with chelicerates. Nature 413, 154–157 the crustacean Penaeus monodon: Are malacostracan 9. Jeanmougin F, Thompson JD, Gouy M, Higgins DG, crustaceans more closely related to insects than to Gibson TJ (1998) Multiple sequence alignment with branchiopods? Mol Biol Evol 17, 863–874 CLUSTAL X. Trends Biochem Sci 23, 403–405 26. Wolstenholme DR (1992) Animal mitochondrial 10. Lavrov DV, Brown WM, Boore JL (2004) Phylogenetic DNA: structure and evolution. Int Rev Cytol 141, 173– position of the Pentastomida and (pan)crustacean 216 relationships. Proc R Soc Lond B 271, 537–544 27. Wyman SK, Jansen RK, Boore JL (2004) Automatic 11. Lowe TM, Eddy SR (1997) tRNAscan-SE: a program for annotation of organellar genomes with DOGMA. improved detection of transfer RNA genes in genomic Bioinformatics 20, 3252–5 sequence. Nucleic Acids Res 25, 955–964 28. Xia X, Xie Z (2001) DAMBE: software package for data 12. Machida RJ, Miya MU, Nishida M, Nishida S (2002) analysis in molecular biology and evolution. J Hered Complete mitochondrial DNA sequence of Tigriopus 92, 371–373 japonicus (Crustacea: Copepoda). Mar Biotechnol 4, 29. Yamauchi M, Miya M, Nishida M (2002) Complete 406–417 mitochondrial DNA sequence of the Japanese spiny 13. Machida RJ, Miya MU, Yamauchi MM, Nishida M, , Panulirus japonicus (Crustacea: Decapoda). Nishida S (2004) Organization of the mitochondrial Gene 295, 89–96 genome of Antarctic Euphausia superba (Crus- 30. Yamauchi MM, Miya MU, Nishida M (2003) Com- tacea: Malacostraca). Mar Biotechnol 6, 238–250 plete mitochondrial DNA sequence of the swimming 14. Mallatt JM, Garey JR, Shultz JW (2004) Ecdysozoan crab, Portunus trituberculatus (Crustacea: Decapoda: phylogeny and Bayesian inference: first use of nearly Brachyura). Gene 311, 129–135 complete 28S and 18S rRNA gene sequences to classify 31. Yamauchi MM, Miya MU, Machida RJ, Nishida M the and their kin. Mol Phylogenet Evol 31, (2005) PCR-based approach for sequencing mitochon- 178–191 drial genomes of Decapod crustaceans, with a practical 15. Miller AD, Nguyen TT, Burridge CP, Austin CM example from Kuruma (Marsupenaeus (2004) Complete mitochondrial DNA sequence of the japonicus). Mar Biotechnol 6, 419–429