GUN1 Regulates Tetrapyrrole Biosynthesis

GUN1 regulates tetrapyrrole biosynthesis

Takayuki Shimizu1, Nobuyoshi Mochizuki2, Akira Nagatani2, Satoru Watanabe3, Tomohiro Shimada4,5, Kan Tanaka4, Yuuki Hayashi1, Munehito Arai1, Sylwia M. Kacprzak6, Dario Leister7, Haruko Okamoto6,8, Matthew J. Terry6,8 & Tatsuru Masuda1*

Affiliations 1Graduate School of Arts and Sciences, The University of Tokyo, Komaba, Meguro-ku, Tokyo 153-8902, Japan 2Graduate School of Science, Kyoto University, Sakyo-ku, Kyoto 606-8502, Japan 3Department of Bioscience, Tokyo University of Agriculture, Setagaya-ku, Tokyo156- 8502, Japan 4Laboratory for Chemistry and Life Science, Institute of Innovative Research, Tokyo Institute of Technology, Yokohama, Japan 5School of Agriculture, Meiji University, Kawasaki-shi, Kanagawa 214-8571, Japan 6School of Biological Sciences, University of Southampton, Southampton SO17 1BJ, UK 7Plant Molecular Biology, Faculty of Biology, Ludwig-Maximilians-Universität München, D-82152 Planegg-Martinsried, Germany 8Institute for Life Sciences, University of Southampton, Southampton SO17 1BJ, UK

*Corresponding author: e-mail: [email protected]

GUN1 regulates tetrapyrrole biosynthesis

The biogenesis of the photosynthetic apparatus in developing chloroplasts requires the assembly of proteins encoded on both nuclear and chloroplast genomes1. To co- ordinate this process there needs to be communication between these organelles, and while we have a good understanding of how the nucleus controls chloroplast development, how the chloroplast communicates with the nucleus at this time is still essentially unknown2. What we do know comes from pioneering work in which a series of genomes uncoupled (gun) mutants were identified that show elevated nuclear gene expression after chloroplast damage3. Of the six reported gun mutations, five are in tetrapyrrole biosynthesis proteins4-6 and this has led to the development of a model for chloroplast-to-nucleus retrograde signaling in which ferrochelatase 1 (FC1)-dependent heme synthesis generates a positive signal promoting expression of photosynthesis-related genes6. However, the molecular consequences of the strongest of the gun mutants, gun17, is unknown, preventing the development of a unifying hypothesis for chloroplast-to-nucleus signaling. Here, we show that GUN1 directly binds to heme and other metal-porphyrins, affects flux through the tetrapyrrole biosynthesis pathway and can increase the chelatase activity of FC1. These results raise the possibility that the signaling role of GUN1 may be manifested through changes in tetrapyrrole metabolism and supports a role for tetrapyrroles as mediators of a single biogenic chloroplast-to- nucleus retrograde signaling pathway.

It has long been established that the expression of a large number of nuclear genes encoding chloroplast proteins is dependent on the presence of intact chloroplasts8 and mutations affecting chloroplast function or treatments with inhibitors such as norflurazon (NF) or lincomycin (Lin) result in the strong downregulation of many photosynthesis-related genes7,9,10. Mutants that lack this ability to co-ordinate the nuclear and chloroplast genomes were identified by their ability to retain expression of

LHCB1.2 after an inhibitory NF treatment3 and have been the basis for this research for the last 25 years. Of the original 5 gun mutants described, gun2 and gun3 lack a functional heme oxygenase 1 and phytochromobilin synthase4, gun4 led to the identification of the Mg-chelatase regulator GUN45, and gun5 was mutated in the H subunit of Mg-chelatase (Supplementary Fig. 1)4. More recently, the identification of a dominant gun6 mutant with increased FC1 activity6 led to the proposal that heme synthesized by FC1 is either the signal itself, a precursor of the signal or is required to generate the signal. However, very little progress has been made in further elucidating the signaling mechanism or in establishing whether this is the only biogenic retrograde signal. One barrier to tackling this problem is that the gun1 mutant7, has been suggested to act independently from the tetrapyrrole-mediated GUN signaling pathway4,11,12. The GUN1 protein is a pentatricopeptide repeat (PPR) protein with a small MutS-related (SMR) domain7. The function of GUN1 is unknown, but it has been proposed to have a role in plastid protein homeostasis13-16, and can interact with proteins involved in both plastid protein synthesis and the tetrapyrrole pathway13 To further explore the interaction of GUN1 with tetrapyrrole biosynthesis, we first tested whether GUN1 could alter the flow through the tetrapyrrole pathway17 (Supplementary Fig. 1). Fig. 1a shows that feeding the precursor 5-aminolevulinic acid (ALA) to two gun1 mutant alleles resulted in increased accumulation of protochlorophyllide (Pchlide) compared to wild-type (WT), while seedlings overexpressing GUN113 had reduced accumulation of Pchlide (Fig. 1a). As ALA synthesis is the rate-limiting step in the pathway, one possibility to explain the altered Pchlide levels is that GUN1 is leading to a redistribution of tetrapyrrole to the heme branch. However, analysis of heme levels in dark-grown seedlings showed that gun1-1 had more heme and GUN1ox lines had less heme than WT (Fig. 1b) indicating that GUN1 is impacting on flux through both branches of the pathway. Such a conclusion is consistent with the observation that gun1 can rescue the reduction of heme caused by the sig2 mutation10. Next, we tested whether overexpression of GUN1 also resulted in increased sensitivity to NF. As shown in Fig. 1c, both GUN1ox lines showed a stronger response to NF for HEMA1 and LHCB2.1 expression than WT seedlings, while, as expected, gun1 rescued gene expression very strongly. Together these results show that altering GUN1 levels affects tetrapyrrole metabolism and that these changes correlate with changes in nuclear gene expression.

Previously, it was shown by yeast two-hybrid analysis that GUN1 could interact with four tetrapyrrole biosynthesis enzymes including ferrochelatase 1 (FC1) (Supplementary Fig. 1)13. Although two FC isoforms are present in the Arabidopsis genome, GUN1 interaction was specific to FC1 and since an increase in FC1 activity is associated with increased nuclear gene expression in the gun6 mutant6, we hypothesized that GUN1 may affect FC1 activity. To test this possibility, we attempted to express both GUN1 and FC1, but failed to express full-length GUN1 protein (Supplementary Fig. 2a, b). Prediction of the secondary and tertiary structure of GUN1 suggested a highly disordered domain in the N-terminal region (Supplementary Fig. 3), which may destabilize the GUN1 protein. Removal of this N-terminal domain allowed us to obtain GUN1 protein containing PPR and SMR motifs (GUN1-PS; Supplementary Fig. 2). We also expressed recombinant Arabidopsis FC1 as a glutathione-S-transferase (GST) fusion protein. The obtained GST-FC1 showed enzyme activity as measured by an increase in Zn-protoporphyrin (ZnProto) fluorescence (Fig. 2a)18. We then evaluated the effect of GUN1-PS on the ability of FC1 to catalyze Zn-chelation. The addition of GUN1-PS to FC1 enhanced the Zn-chelatase activity linearly with increasing concentration of GUN1-PS (Fig. 2a). In comparison, the same concentration of BSA had only a slight effect on activity, suggesting GUN1-PS did not merely stabilize FC1 (Fig. 2a). GUN1-PS itself had no Zn-chelating activity. Analysis of Michaelis-Menten

kinetics revealed that addition of GUN1-PS decreased KM values from 26.5 µM to 4.5 µM (Fig. 2b), suggesting GUN1-PS stimulated Zn-chelatase activity by enhancing substrate affinity for FC1. It has previously been shown that GUN4 can enhance Mg-chelatase activity by directly binding Mg-protoporphyrin (MgProto), the product of this reaction5. To examine whether a similar stimulating mechanism is employed in GUN1-dependent enhancement of FC1 activity, we tested the ability of GUN1-PS to bind heme using hemin-agarose beads. As shown in Fig. 3a, GUN1-PS demonstrated hemin-binding activity. To identify domains required for hemin binding, a series of truncations were constructed (Supplemental Fig. 2a) and tested for hemin binding (Fig. 3b). GUN1 proteins containing the PPR motifs (PPR1 and PPR2) showed significantly more hemin binding than those containing only the SMR motifs (SMR1 and SMR2). During the heme-binding assay, we observed that the colour of the hemin solution changed upon GUN1-PS binding (Fig. 3c inset), suggesting that changes in the hemin spectrum had

occurred on binding. Spectrophotometric analysis showed that the GUN1-hemin complex exhibited a red shift of the Soret band and Q-band peaks compared to unbound hemin, consistent with specific binding (Fig. 3c). To determine the affinity of GUN1 for hemin, GUN1-PS was incubated with increasing hemin concentrations and binding determined by differential spectrophotometry (Fig. 3d). The increase in absorbance of the shifted Soret peak was plotted against porphyrin concentration (Fig. 3e) and a dissociation constant (KD) for the binding of GUN1-PS to hemin was estimated to be 6.08±1.11 µM using non-linear regression analysis and assuming a one-site binding model. This value sits within the range measured for a variety of heme-binding proteins19. Similar analyses for GUN1 binding to other metal-porphyrins resulted in estimated KD values for MgProto and ZnProto of 8.65±1.80 µM, and 3.10±0.86 µM, respectively (Supplementary Fig. 4). Thus, GUN1-PS has similar binding affinities for all three metal-porphyrins. Finally, to test whether GUN1 can bind to hemin in plant extracts, we constructed Arabidopsis lines expressing FLAG-tagged GUN1 under the control of its own promoter in the gun1-102 mutant background (lines A3022 and A3026). As a control we also expressed FLAG-tagged GUN5 (line cchZ 3-17) in the cchZ GUN5- deficient mutant20. The gun1-102 phenotype was complemented by GUN1 expression with de-repression of LHCB1.2, RBCS1A and CHLH expression by Lin rescued in these lines (Supplementary Fig. 5). Since GUN1 accumulates detectable levels only at very young stages of leaf development16, proteins were extracted from 4-day-old seedlings and subjected to the hemin binding assay (Fig. 3f). FLAG-tagged GUN1 was observed in the fraction bound to hemin, while the GUN5 protein, which also binds porphyrins21, was not. Thus, the binding of GUN1 to hemin shows specificity. Our results suggest that GUN1 has two, likely independent functions, in modifying tetrapyrrole metabolism (Fig. 4). Firstly, it was able to restrict flow through both branches of the tetrapyrrole pathway such that feeding ALA resulted in reduced accumulation of both Pchlide and heme in dark-grown seedlings. The mechanism for this restriction is unknown but may be related to the observation here that GUN1 can bind metal-porphyrins and/or that it can interact with the tetrapyrrole enzymes porphobilinogen deaminase and uroporphyrinogen III decarboxylase 2 that catalyze shared steps in the tetrapyrrole pathway13. GUN1 is not a very abundant protein16 and it is unlikely that any restriction of the flow of tetrapyrroles is due to sequestration.

Rather, we propose that the mode of action of GUN1 is regulatory. Moreover, the rapid degradation in the light16 would permit an increased flow of tetrapyrroles at a time when the demand for photosynthetic tetrapyrroles, both heme and Chl, is at its greatest. The second molecular function of GUN1 identified in this study, is the

enhancement of FC1 activity through a more than 5-fold reduction in KM (Fig. 2). It is likely that GUN1 stimulates FC1 activity through enhancing substrate affinity in a similar way to GUN4 enhancement of Mg-chelatase activity5. However, it should be

noted that GUN1 product binding is more than 10-fold weaker than GUN4 (KD value for Mg-deuteroprotoporphyrin binding to GUN4 is 0.26 µM5). The control protein used for this assay, BSA, also binds heme22, and thus enhancement of FC1 activity by GUN1 is quite specific. Nevertheless, this result was surprising given that GUN1ox lines showed reduced heme levels and it is probable that GUN1-dependent FC1 stimulation does not reflect the total heme content. We did not test whether GUN1 could also promote FC2 activity, but given that the interaction of GUN1 is specific for FC113 this is not likely. To understand why GUN1 restricts tetrapyrrole synthesis, but promotes FC1 activity will take more detailed analysis of heme metabolism in young seedlings. However, one possible explanation is that GUN1 enhances FC1 activity to ensure a supply of heme to the rest of the cell under conditions in which tetrapyrrole synthesis is maintained at a low level (i.e. before the demand for photosynthetic tetrapyrroles). Once seedlings move to the light, the flow through the tetrapyrrole pathway is greatly increased through transcriptional upregulation of tetrapyrrole synthesis genes23. This would negate the need for GUN1 to promote FC1 to ensure a sufficient cellular heme supply and degradation of GUN1 would redress the balance between FC1 and FC2 to favour FC2 activity required to synthesize photosynthetic hemes24. The observations presented here demonstrate that GUN1 alters tetrapyrrole metabolism (Fig. 4) and therefore that all described gun mutations affect this pathway. This observation therefore supports a model in which tetrapyrroles are mediators of a single biogenic retrograde signal during de-etiolation. The prevailing model is that FC1- dependent heme synthesis is required to generate a positive signal6,25. Our observations on the restriction of heme synthesis by GUN1 in seedlings are consistent with this model as it would be expected to result in more flow through FC1. However, the demonstration that GUN1 enhances FC1 activity does not appear to support it and may require the development of a new hypothesis. One scenario that could reconcile these

two observations is if the restriction of tetrapyrrole synthesis by GUN1 was a more significant effect than enhancement of FC1, such that overall there was still less FC1- dependent heme in the presence of GUN1 than in its absence. Our own data showing that heme levels were reduced overall in GUN1ox lines do support such an interpretation. Alternatively, it is possible that binding of FC1-synthesized heme by GUN1 blocks release or propagation of the retrograde signal. In this case, GUN1 degradation in the light would ensure an increased signal to promote further chloroplast protein synthesis for continued development and the supply of new chloroplasts.

Methods

Plant material and growth conditions Arabidopsis thaliana wild type (WT), the mutants gun1-1, gun1-1027, gun1-10326, and the GUN1ox lines13 were in the Columbia-0 (Col-0) ecotype. For physiological analyses, seeds were sown onto half-strength Murashige and Skoog (MS) medium (Melford Laboratories, Ipswich, UK) supplemented with 1% (w/v) agar (pH 5.8) and incubated in white light (WL; 120 µmol.m-2.s-1) for 2 h to induce germination. For Pchlide and heme assays seedlings were then grown for 4 d dark at 22 °C with or without 0.1 or 0.2 mM aminolevulinic acid (ALA; Sigma Aldrich) with 5mM MES. For gene expression analyses, seedlings were grown with or without 1 µM NF (a gift from John Gray, University of Cambridge, UK) in the absence of sucrose, kept for 2 d in the dark, followed by 3 d in continuous WL (WLc, 100 µmol.m-2.s-1) at 22 °C. For analysis of gene expression in complemented gun1-102 lines, seeds were sown onto MS medium supplemented with 0.8% (w/v) agar (pH 5.8) and 2% (w/v) sucrose, with or without 560 µM Lin and grown for 4 d under WLc (100 µmol.m-2.s-1) at 23°C.

Pchlide measurements Pchlide levels were measured from 4-d old dark-grown seedlings. Seedlings were harvested into liquid nitrogen under green safe light, covered with foil and stored at - 80°C until required. Seedlings were ground under green safe light in a mortar and pestle

on ice with 2 x 400 µL cold alkaline acetone solution (acetone: 0.1 M NH4OH; 9:1 (v/v)). Samples were vortexed briefly and centrifuged at 16,000 x g for 5 min at room temperature. Supernatants from two sequential extraction steps were collected and

Pchlide levels were measured using a fluorescence spectrophotometer F-2000 (Hitachi High-Tech, Japan). Pchlide emission for the peak at ~636 nm following excitation at 440 nm was recorded.

Heme detection by chemiluminescence Total non-covalently-bound heme measurements were performed following the protocol27 with minor modifications. 4-d old dark seedlings were harvested into liquid nitrogen under green safe light, covered with foil and stored at -80°C until required. Seedlings were ground in liquid nitrogen to a powder, extracted twice with 1 mL of acidic acetone (acetone:1.6 M HCl (80/20, v/v) and centrifuged at 16,000 x g at 4°C for 15 min to remove cell debris. Cleared extracts were diluted 1:1000 with sterile water. A 1 mM hemin stock solution (bovine hemin chloride, Sigma Aldrich, UK) was prepared in DMSO to create a calibration curve. To reconstitute horseradish peroxidase (HRP), 10 µL of extract or hemin standard was mixed with 40 µL of apo-HRP enzyme (BBI Solutions, Sittingbourne, UK) in 100 mM Tris-HCl, pH 8.4. The final enzyme concentration in each sample was 2.5 nM apo-HRP. Samples were vortexed, spun briefly and incubated for 30 min at room temperature. After transferring samples to a

96-well white polystyrene plate, 50 µL of HRP substrate (H2O2:luminol, 1:1; ImmobilonTM Western Chemiluminescent HRP Substrate, Merckmillipore) was added to each sample, mixed by pipetting and incubated for 5 min. Chemiluminescence was recorded using micro-plate reader (GloMax® 96 Microplate Luminometer, Promega) with 0.5 s integration time.

Heme-binding assays. Different versions of GUN1 recombinant proteins (10 µM) in

binding buffer (20 mM HEPES-NaOH (pH 7.9), 100 mM KCl, 1 mM MgCl2, 0.2 mM

CaCl2, 10% (v/v) glycerol, 1 mM DTT, 0.2 mM PMSF, 0.1% Tween 20) were assessed for their ability to bind hemin-agarose beads (Sigma-Aldrich). For detection of GUN1- FLAG in Arabidopsis, total proteins were extracted from 4 d-old whole seedlings in the binding buffer. Hemin-immobilized FG beads28 prepared by Tamagawa Seiki (Tokyo, Japan) were used for assessment. Beads and protein were mixed for 2 h on a rotator at 4°C. Beads were extensively washed with the binding buffer, re-suspended in 2x Laemmli sample buffer containing 4% (v/v) b-ME, and heated for 5 min at 100°C before loading onto SDS gels. Proteins were transferred by western blotting to HyBond

ECL membrane (GE Healthcare) and detected using anti-HisTag (MBL Life Science, Nagoya, Japan) and anti-DYKDDDDK (Fuji Film Wako) antibodies for the recombinant and in planta GUN1 proteins, respectively.

Ferrochelatase assay. FC1 activity was measured by Zn-chelating activity as described 18 previously . The reaction mixture contained 10 µM protoporphyrin IX, 50 µM ZnSO4, and various ratios of GST-FC1 and GUN1-PS proteins in a total volume of 100 µL. The reaction was started by adding protoporphyrin IX solution, and was carried out at 30°C for 10 min, and then stopped by addition of 900 µL acetone. After centrifugation at 10,000 x g for 5 min, fluorescence emission spectra of the cleared supernatant were recorded between 550-650 nm with excitation at 420 nm in a FP-6200 fluorescence spectrometer (JASCO, Tokyo, Japan). Non-enzymatic formation of Zn-Proto formation was verified with denatured controls.

Absorbance spectroscopy. Metal-porphyrin (hemin, MgProto, ZnProto) solutions were prepared by solubilizing in DMSO, followed by dilution in 20 mM Tris-HCl, pH 8.0. For assays, 10 µM GUN1-PS protein was subjected to UV-visible absorbance spectroscopy at room temperature in a Ultrospec 2100 pro spectrophotometer (GE Healthcare Bioscience) using 20 mM Tris-HCl buffer as a reference. Spectra were recorded between 350 and 650 nm using a 1 cm path length cuvette, with a metal porphyrin concentration range of 0–25 µM. Difference spectra were obtained by subtracting the metal-porphyrin spectrum from that of the protein-metal porphyrin complexes. Emerging peaks in the Soret region corresponding to metal-porphyrin- GUN1-PS complexes were plotted. Quantitative analysis of peak emergence was used

to determine KD values for metal-porphyrin binding assuming one-site ligand binding model as described29. Titration data were analyzed using non-linear regression (OriginPro8 software; OriginPro Corporation, Massachusetts, USA).

Circular dichroism (CD) spectrometry. CD spectra were measured in a JASCO J-805 spectropolarimeter (JASCO, Tokyo, Japan) at 200-250 nm with a quartz cuvette of 1 mm path length at 25°C (controlled by a thermostat circulating water bath). Analysis was performed using recombinant GUN1-PS proteins obtained during the serial dilution of urea at a protein concentration of 0.2 mg/mL.

RNA extraction and gene expression analysis by RT-qPCR RNA extraction and RT-qPCR analysis was performed as described previously30. Total RNA was extracted from around 100 mg of 5 d-old whole seedlings using a phenol:chloroform method, treated with RNase free DNase I (Promega Corporation, Madison, USA) and 1 µg RNA was used for cDNA synthesis with equal amounts of oligo(dT) and random nonamer primers using the nanoScript2 reverse transcription kit (Primerdesign Ltd., Southampton, UK). Transcript levels were measured by reverse transcription quantitative PCR (RT-qPCR) using Sybr Green master mix (Primerdesign Ltd.) and a StepOnePlusTM Real Time PCR System (Applied Biosystems, Foster City, USA). The thermal cycling conditions used were 95 °C for 10 min, followed by 40 cycles of 95 °C for 15 s and 60 °C for 60 s. Expression was normalized to YELLOW LEAF SPECIFIC GENE 8 (YLS8, At5g08290). For analysis of gene expression in complemented gun1-102 lines, total RNA was extracted from 4 d-old whole seedlings using the Agencourt Chloropure System (Beckman Coulter, Miami, USA) according to the manufacturer’s instructions. RNA was treated with RNase free DNase I (Sigma- Aldrich) and 1 µg RNA was used for cDNA synthesis with oligo(dT)12-18 using Transcriptor first-strand synthesis kit (Roche, Basel, Switzerland). Transcript levels were measured by qRT-PCR using LightCycler 480 SYBR Green I Master (Roche) and a LightCycler 96 (Roche). The thermal cycling conditions used were 95°C for 5 min, followed by 40 cycles of 95 °C for 5 s, 55 °C for 10 s, and 72 °C for 20 s. Expression was normalized to TUBULIN BETACHAIN 2 (TUB2, At5g62690). All of the genes analyzed by RT-qPCR, with their accession numbers and corresponding primer sequences are listed in Supplementary Table S2.

Construction of GUN1-FLAG lines. The endogenous promoter region of GUN1 (ca. 1.5 kb) was amplified with P1 and P2 primers (see Supplementary Table 1) from Col genomic DNA using PrimeStarMax (Takara Bio, Kusatsu, Japan) and inserted in HindIII-XbaI digested pGWB51131 by the SLiCE method32 to give p511G1pro. GUN1 cDNA was reverse transcribed using total RNA isolated from Col with Transcriptor High Fidelity (Sigma-Aldrich, Tokyo, Japan). GUN1 cDNA (ca. 2.8 kb) was amplified using G1f and G1r primers, and cloned into pENTR-D-TOPO vector to give pENTR-D- GUN1 (Thermo Fisher, Tokyo, Japan). p511G1pro was digested with XhoI, purified,

and subjected to the Gateway LR reaction with pENTR-D-GUN1 to give p511G1pro- GUN1.p511G1pro-GUN1 was introduced to Agrobacterium strain GV3101(MP90) and used for transformation of gun1-102. The expression of GUN1-FLAG was confirmed by qPCR and western blotting using an anti-DYKDDDDK antibody (Fuji Film Wako, Osaka, Japan).

Plasmid constructions and expression of recombinant proteins. For in vitro translation and transcription experiment, full-length GUN1 cDNA (At2g31400) and pIVEX1.3 WG (Roche) fragments were amplified by PCR and ligated using the In- Fusion HD Cloning Kit (Takara Bio). Using RTS 100 Wheat Germ CECF Kit (Roche), GUN1 protein was expressed in RTS ProteoMaster (Roche). Full-length GUN1 cDNA and N-terminal truncated versions as EcoRI-SalI PCR fragments were ligated into pET48b (Novagen, Wisconsin, USA) and transformed into E. coli Rosetta gami2 (DE3) (Novagen). For other truncated versions of GUN1 (PPR1, PPR2, SMR1 and SMR2), primers were designed to exclude domains of interests, and PCR fragments were self- ligated (see Supplementary Table 1 for all primers). After pre-culture in LB medium containing 100 µg mL-1 kanamycin, GUN1-PS was induced by adding 0.1 mM IPTG at 37°C for 3 h. After collecting cells by centrifugation at 4,000 x g for 5 min, the cell pellet was re-suspended in 20 mM Tris-HCl, pH 8.0, and subjected to ultrasonic disruption. Since GUN1-PS formed inclusion bodies, the insoluble fraction was repeatedly washed with buffer containing 20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 1 M urea, 2% (v/v) Triton X-100, 20 mM DTT and 10 mM EDTA. The resultant insoluble fraction was dissolved in 20 mM Tris-HCl (pH 8.0) and 8 M urea, and subjected to dialysis with serial dilution of urea (6, 4, 2, 0 M urea). Full-length FC1 cDNA was ligated into pGEX-2T vector (GE Healthcare, Buckinghamshire, UK) using the In- Fusion HD Cloning Kit (Takara Bio) and transformed into E. coli DH5a. After pre- culture, GST-FC1 fusion protein was induced by adding 0.1 mM IPTG at 16°C overnight. After collecting cells by centrifugation, the cell pellet was re-suspended in 20 mM Tris-HCl, pH 8.0, and 10% (v/v) glycerol and subjected to ultrasonic disruption. After centrifugation at 10,000 x g for 10 min, the supernatant was used directly in the ferrochelatase assay.

References 1 Jarvis, P. & Lopez-Juez, E. Biogenesis and homeostasis of chloroplasts and other plastids. Nat Rev Mol Cell Bio 14, 787-802 (2013). 2 Chan, K. X., Phua, S. Y., Crisp, P., McQuinn, R. & Pogson, B. J. Learning the languages of the chloroplast: Retrograde signaling and beyond. Ann Rev Plant Biol 67, 25-53 (2016). 3 Susek, R., Ausubel, F. & Chory, J. Signal transduction mutants of Arabidopsis uncouple nuclear CAB and RBCS gene expression from chloroplast development. Cell 74, 787-799 (1993). 4 Mochizuki, N., Brusslan, J., Larkin, R., Nagatani, A. & Chory, J. Arabidopsis genomes uncoupled 5 (GUN5) mutant reveals the involvement of Mg-chelatase H subunit in plastid-to-nucleus signal transduction. Proc Natl Acad Sci U S A 98, 2053-2058 (2001). 5 Larkin, R., Alonso, J., Ecker, J. & Chory, J. GUN4, a regulator of chlorophyll synthesis and intracellular signaling. Science 299, 902-906 (2003). 6 Woodson, J. D., Perez-Ruiz, J. M. & Chory, J. Heme synthesis by plastid ferrochelatase I regulates nuclear gene expression in plants. Curr Biol 21, 897- 903 (2011). 7 Koussevitzky, S. et al. Signals from chloroplasts converge to regulate nuclear gene expression. Science 316, 715-719 (2007). 8 Gray, J. C., Sullivan, J. A., Wang, J. H., Jerome, C. A. & MacLean, D. Coordination of plastid and nuclear gene expression. Philos Trans R Soc Lond B Biol Sci 358, 135-145 (2003). 9 Page, M. T., McCormac, A. C., Smith, A. G. & Terry, M. J. Singlet oxygen initiates a plastid signal controlling photosynthetic gene expression. New Phytol 213, 1168-1180 (2017). 10 Woodson, J. D., Perez-Ruiz, J. M., Schmitz, R. J., Ecker, J. R. & Chory, J. Sigma factor-mediated plastid retrograde signals control nuclear gene expression. Plant J 73, 1-13 (2012). 11 Vinti, G. et al. Interactions between hy1 and gun mutants of Arabidopsis, and their implications for plastid/nuclear signalling. Plant J 24, 883-894 (2000). 12 McCormac, A. C. & Terry, M. J. The nuclear genes Lhcb and HEMA1 are differentially sensitive to plastid signals and suggest distinct roles for the GUN1

and GUN5 plastid-signalling pathways during de-etiolation. Plant J 40, 672-685 (2004). 13 Tadini, L. et al. GUN1 controls accumulation of the plastid ribosomal protein S1 at the protein level and interacts with proteins involved in plastid protein homeostasis. Plant Physiol 170, 1817-1830 (2016). 14 Colombo, M., Tadini, L., Peracchio, C., Ferrari, R. & Pesaresi, P. GUN1, a jack- of-all-trades in chloroplast protein homeostasis and signaling. Front Plant Sci 7, 1427 (2016). 15 Llamas, E., Pulido, P. & Rodriguez-Concepcion, M. Interference with plastome gene expression and Clp protease activity in Arabidopsis triggers a chloroplast unfolded protein response to restore protein homeostasis. Plos Genet 13, e1007022 (2017). 16 Wu, G. Z. et al. Control of retrograde signaling by rapid turnover of GENOMES UNCOUPLED1. Plant Physiol 176, 2472-2495 (2018). 17 Mochizuki, N. et al. The cell biology of tetrapyrroles: a life and death struggle. Trend Plant Sci 15, 488-498 (2010). 18 Papenbrock, J., Mock, H., Kruse, E. & Grimm, B. Expression studies in tetrapyrrole biosynthesis: Inverse maxima of magnesium chelatase and ferrochelatase activity during cyclic photoperiods. Planta 208, 264-273 (1999). 19 Mitra, A., Speer, A., Lin, K., Ehrt, S. & Niederweis, M. PPE surface proteins are required for heme utilization by Mycobacterium tuberculosis. MBio 8, e01720- 01716 (2017). 20 Ibata, H., Nagatani, A. & Mochizuki, N. CHLH/GUN5 function in tetrapyrrole metabolism is correlated with plastid signaling but not ABA responses in guard cells. Front Plant Sci 7, 1650 (2016). 21 Karger, G., Reid, J. & Hunter, C. Characterization of the binding of deuteroporphyrin IX to the magnesium chelatase H subunit and spectroscopic properties of the complex. Biochemistry 40, 9291-9299 (2001). 22 Hargrove, M. S., Barrick, D. & Olson, J. S. The association rate constant for heme binding to globin is independent of protein structure. Biochemistry 35, 11293-11299 (1996). 23 Kobayashi, K. & Masuda, T. Transcriptional regulation of tetrapyrrole biosynthesis in Arabidopsis thaliana. Front Plant Sci 7, 1811 (2016).

24 Espinas, N. A. et al. Allocation of heme is differentially regulated by ferrochelatase isoforms in Arabidopsis cells. Front Plant Sci 7, 1326 (2016). 25 Terry, M. J. & Smith, A. G. A model for tetrapyrrole synthesis as the primary mechanism for plastid-to-nucleus signaling during chloroplast biogenesis. Front Plant Sci 4, 14 (2013). 26 Page, M. T. et al. Seedlings lacking the PTM protein do not show a genomes uncoupled (gun) mutant phenotype. Plant Physiol 174, 21-26 (2017). 27 Espinas, N. A., Kobayashi, K., Takahashi, S., Mochizuki, N. & Masuda, T. Evaluation of unbound free heme in plant cells by differential acetone extraction. Plant Cell Physiol 53, 1344-1354 (2012). 28 Sakamoto, S., Kabe, Y., Hatakeyama, M., Yamaguchi, Y. & Handa, H. Development and application of high-performance affinity beads: toward chemical biology and drug discovery. Chem Rec 9, 66-85 (2009). 29 Wojaczynski, J. et al. Iron(III) mesoporphyrin IX and iron(III) deuteroporphyrin IX bind to the Porphyromonas gingivalis HmuY hemophore. Biochem Biophys Res Commun 411, 299-304 (2011). 30 Kacprzak, S. M. et al. Plastid-to-nucleus retrograde signalling during chloroplast biogenesis does not require ABI4. Plant Physiol (2018). 31 Nakagawa, T. et al. Improved Gateway binary vectors: high-performance vectors for creation of fusion constructs in transgenic analysis of plants. Biosci Biotechnol Biochem 71, 2095-2100 (2007). 32 Zhang, Y. W., Werling, U. & Edelmann, W. SLiCE: a novel bacterial cell extract-based DNA cloning method. Nucleic Acids Res 40 (2012).

Acknowledgement We would like to thank Takehito Kobayashi and Takahiro Nakamura (Kyushu University, Japan) for bioinformatic analysis of PPR domain of GUN1. We thank Saumya Awasthi for contributions to pilot studies. We also thank Biomaterial Analysis Center, Technical Department of Tokyo Institute of Technology for technical support. We are grateful for funding from JSPS KAKENHI grant numbers JP16K07393, JP18H03941, JP16H02217, JP18K05386 and JP17K07444.M.A. was supported by the Institute for Fermentation, Osaka. S.M.K. was supported by the Gatsby Charitable Foundation. Work on retrograde signalling by M.J.T. is supported by the UK Biotechnology and Biological Sciences Research Council. D.L. is supported by the Deutsche Forschungsgemeinschaft (SFB-TR 175, project C05).

Author Contributions T.S. expressed recombinant proteins and conducted enzyme assays, analysed and interpreted data and contributed to writing the article. N.M. performed experiments, analysed and interpreted data and contributed to writing the article. A.N. analysed and interpreted data. W.S. and T.S. performed heme binding experiments. K.T. analysed and interpreted data. Y.S. contributed biophysical analysis including CD spectrometry. M.A. analysed and interpreted data. S.M.K. performed the physiological and gene expression analyses, analysed and interpreted data and contributed to writing the article. D.L. provided research materials and contributed to writing the article. H.O. analysed and interpreted data and contributed to writing the article. M.J.T. jointly conceived the study, analysed and interpreted data and co-wrote the article. T.M.jointly conceived the study, performed experiments, analysed and interpreted data and co-wrote the article.

Competing interests The authors declare no competing interests.

Figure legends

Figure 1. GUN1 affects tetrapyrrole metabolism. a, Protochlorophyllide accumulation in WT (Col-0), gun1-1, gun1-103 mutants and GUN1ox1 and GUN1ox2 overexpressor lines grown 4 d in the dark on half-strength Murashige and Skoog medium supplemented with 1% (w/v) agar, 5 mM MES, (pH 5.8) and with or without 0.1-0.2 mM 5-aminolevulinic acid (ALA). 30 seedlings were analysed for each replicate. b, Total heme accumulation in seedlings treated with or without 0.2 mM ALA, as described in (a). c, Reverse transcription quantitative PCR (RT-qPCR) analysis of HEMA1 and LHCB2.1 transcript levels in WT (Col-0), gun1-1, gun1-103, GUN1ox1 and GUN1ox2 seedlings grown on half-strength Murashige and Skoog medium supplemented with 1% (w/v) agar with or without 1 µM NF under the following conditions: 2 d dark, 3 d WLc (100 µmol m-2 s-1). Expression is relative to Col-0 -NF and normalised to YELLOW LEAF SPECIFIC GENE 8 (YLS8, At5g08290). Data shown are means +SEM or ± SEM of three independent biological replicates. Asterisks denote a significant difference vs. Col-0 for the same treatment, Student’s t-test (*p < 0.05; **p < 0.01).

Fig. 2 GUN1-PS enhances ferrochelatase 1 (FC1) activity. a, Arabidopsis FC1 protein expressed as a GST-fusion protein showed Zn-chelatase activity. Addition of GUN1-PS enhanced the formation of Zn-protoporphyrin IX (Zn-Proto) from Protoporphyrin IX (Proto) linearly with increasing concentration of GUN1-PS. Bovine serum albumin (BSA) was used as a negative control. b, Double reciprocal plot analysis of Zn-Proto formation by FC1 in the presence or absence of GUN1-PS. Inset shows

Michaelis–Menten plot of the same data. KM values of FC1 in the presence or absence of GUN1-PS are shown. Data shown are means +SEM (or ± SEM) of three independent replicates.

Fig. 3 Recombinant GUN1 protein binds to heme through PPR motifs. a, Binding of GUN1-PS to hemin-agarose beads. b, Binding of a truncated series of GUN1 proteins (see Supplementary Fig. 2a) to hemin-agarose beads. I, input; B, bound. c, Absorption spectra of hemin and hemin-GUN1-PS complexes. Inset: photograph of hemin solution (50 µM) and hemin-GUN1-PS complex purified by gel filtration. d,

Absorbance difference spectra of hemin-GUN1-PS minus hemin solution at different hemin concentrations. e, Change in absorbance of the Soret peak plotted against hemin concentration was used to determine the dissociation constant (Kd) of the heme-GUN1- PS complex assuming a one-site binding model. f, Binding of FLAG-tagged GUN1 isolated from Arabidopsis lines A3022 and A3026 (overexpressed in a gun1 mutant background) to hemin-beads. The GUN5 protein (expressed in the cchz mutant background) is shown as a control.

Fig. 4 Model for GUN1 function in tetrapyrrole metabolism a, In the dark GUN1 represses flow through the tetrapyrrole pathway, but promotes FC1 activity to ensure a sufficient supply of heme to the rest of the cell. b, In the light GUN1 is degraded promoting total tetrapyrrole synthesis required for chloroplast development. Under these conditions, FC1 activity is no longer promoted. The increased tetrapyrrole flux ensures a sufficient supply of substrate to FC1 to supply heme to the rest of the cell. c, In dark-grown gun1 mutants tetrapyrrole synthesis is greater than in a wild-type seedlings and will continue to be during early stages of de-etiolation.

Supplementary Fig. 1 Tetrapyrrole biosynthetic pathway A simplified schematic of tetrapyrrole biosynthesis in higher plants. Arrows indicate enzymatic steps; the proteins and genes involved are indicated to the right of the arrow. Boxed proteins and genes indicate the steps that result in a gun phenotype when blocked. Dashed lines indicate proteins that showed interaction with GUN1 in a yeast 2- hybrid analysis (Tadini et al., 2016).

Supplementary Fig. 2 a, Schematic diagrams of recombinant GUN1 proteins used. b, Attempted expression of full-length GUN1 protein using in vitro transcription and translation system with the pIVEX1.3. c, Expression of full-length and N-terminal truncated GUN1 proteins in E. coli. Expression of recombinant GUN1 proteins were induced at 16°C and 37°C for 0, 2, 4 and 21 h. d, Purification of GUN1-PS inclusion body. GUN1-PS was solubilized in buffer containing 8 M urea and refolded by serial dilution. e, CD spectra of GUN1-PS during serial dilution of the urea concentration. Note that initial attempts to express recombinant full-length GUN1 protein by in vitro transcription and translation and in E. coli (a) were unsuccessful (b, c). Therefore, we truncated the N-terminal region and successfully expressed the GUN1 protein

containing the PPR and SMR motifs as an N-terminal thioredoxin (Trx)-His6-fused protein (a). This recombinant protein was expressed as an inclusion body, which required treatment with 8 M urea to denature the protein, and subsequent serial dilution to isolate a refolded recombinant protein. In this fraction, GUN1-PS comprised more than 95% of the total protein (d) and CD analysis suggested that substantial refolding of GUN1-PS had occurred (e).

Supplementary Fig. 3 Prediction of secondary and tertiary structures of Arabidopsis GUN1. a, Schematic diagram of GUN1 and prediction of the disordered region of the GUN1 protein (PONDR-FIT of DisProt (http://disorder.compbio.iupui.edu/)). b, Predicted 3D structure of GUN1 by I-TASSER (https://zhanglab.ccmb.med.umich.edu).

Supplementary Fig. 4 Spectral changes of metal-porphyrin-GUN1-PS complexes. a, d, Absorbance spectra of metal-porphyrins (Mg-protoporphyrin IX (MgP), and Zn- protoporphyrin IX (ZnP)) and metal-porphyrin-GUN1-PS complexes, respectively. b, e,

Absorbance difference spectra of MgP-GUN1-PS (b) or ZnP-GUN1-PS (e) minus metal porphyrin solution at different porphyrin concentrations. c, f, Change in absorbance the Soret peak plotted against MgP (c) or ZnP (f) concentration was used to determine the

dissociation constant (KD) of the metal porphyrin-GUN1-PS complexes assuming a one- site binding model.

Supplementary Fig. 5 Complementation of gun1-102 with GUN1pro::GUN1-FLAG Seedlings were grown on Murashige and Skoog medium supplemented with 2% (w/v) sucrose and 0.8% (w/v) agar (pH 5.8), with or without 450 µM Lin for 4 d in continuous WL (100 µmol m-2 s-1). Expression was determined by RT-qPCR and is normalized to TUBULIN BETACHAIN 2 (TUB2, At5g62690). Genotypes correspond to wild-type (Col), gun1-102, and complementation lines (A3026 and A3033) expressing GUN1pro::GUN1-FLAG. Data shown are the means ±SEM of three independent biological replicates. Asterisks denote a significant difference vs. Col-0 for the same treatment, Student’s t-test (*p < 0.05; **p < 0.01).

Supplemental Table 1 Primer sequences used in this study Primer name Gene name (AGI) Primer sequence (5’-3’) Note

pET48 GUN1-fullfor ACCAGGATCCGAATTCGGCGTCAACGCCGCCTCA Forward primer for full-length GUN1 recombinant protein (EcoRI)

pET48 GUN1-PSfor ACCAGGATCCGATTCACAGGGGAAGTTAGCTAGTGCT Froward primer for GUN1-PS recombinant protein (EcoRI)

pET48 GUN1rev CCGTCGACTCACATAAGCAAAGTATCTACAG Reverse primer for both GUN1 recombinant proteins (SalI)

pET48for CTGTCGACAAGCTTGCGGCCGGC Froward primer for truncated GUN1 variants (SalI)

pET48rev GUN1 (At2g32400) CAGGATTCGGATCCTGGTACCCGGG Reverse primer for truncated GUN1 variants (EcoRI)

GUN1-PPR1rev TTGTCGACCTATACCTTATTATCAAACAG Reverse primer for PPR1 in combination with pET48for (SalI)

GUN1-PPR2rev TTGTCGACCTACAGAGVAGAAGAAGAGAA Reverse primer for PPR2 in combination with pET48for (SalI)

GUN1-SMR1for CCGAATTCATATGGTGTTGTTCATGG Forward primer for SMR1 in combination with pET48rev (EcoRI)

GUN1-SMR2for CCGAATTCAGTTTCTTGCTTGGACTTAC Forward primer for SMR2 in combination with pET48rev (EcoRI) pIVEX1.5 GUN1 GCTTGTCGAACCATGTCAGCTCATCTTTCACAG Cloning of full-length GUN1 for in vitro transcription and for GUN1 (At2g32400) pIVEX1.5 GUN1rev CTCGCTCGAGTCGACCATAAGCAAAGTATCTACAGAG translation pIVEX1.5 GTCGACTCGAGCGAGCGCCGGG for pIVEX1.5 WG Cloning of pIVEX1.5 WG for in vitro transcription and translation pIVEX1.5rev CATGGTTCGACAAGCTGTTGTGGG pGEX2T FC1 GTTCCGCGTGGATCCTCTCAGAGAAATTCTCTGTCTTTG for FC1 (At5g26030) Cloning of full-length FC1 for GST-fusion construct pGEX2T FC1rev AGTCACGATGAATTCCTATAGGTTCCGGAACACATG pGEX2Tfor GAATTCATCGTGACTGACTGACG pGEX-2T Cloning of pGEX-2T for GST-fusion construct pGEX2Trev GGATCCACGCGGAACCAGATCCG Lhcb1.2_F GTGTGACAATGAGGAAGACTGTTGCC LHCB1.2 (At1g29910) qRT-PCR primer for LHCB1.2 Lhcb1.2_R AAATGCTCTGAGCGTGGACCAAGCTA Lhcb2.1_F CTCCGCAAGGTTGGTGTATC LHCB2.1 (At2g05100) qRT-PCR primer for LHCB2.1 Lhcb2.1_R CGGTTAGGTAGGACGGTGTAT HEMA1_F GCTTCTTCTGATTCTGCGTC HEMA1 (At1g58290) qRT-PCR primer for HEMA1 HEMA1_R GCTGTGTGAATACTAAGTCCAATC YLS8_F AAGGACAAGCAGGAGTTCATT YLS8 (At5g08290) qRT-PCR primer for YLS8 – reference gene YLS8_R AGTAATCTTTTGGAGCAATCACC CHLH_F GGCATTGATATTAGAGAGGCAG CHLH (At5g13630) qRT-PCR primer for CHLH CHLH_R GACGAGTTTTCAACAGCAAGAC RBCS1A_F CCTCCGATTGGAAAGAAGAA RBCS1A(At1g67090) qRT-PCR primer for RBCS1A RBCS1A_R TACACAAATCCGTGCTCCAA GUN1_F GUN1(At2g31400) GCGTGGCTACTAAACATACGCTCC qRT-PCR primer for GUN1

GUN1_R CTTAGTGCTCCGTCTCCAACCAC TUB2_F CCAGCTTTGGTGATTTGAAC TUB2 (At5g62690) qRT-PCR primer for TUB2 – reference gene TUB2_R CAAGCTTTCGGAGGTCAGAG GGCCAGTGCCAAGCTAAATTGGATTTTGATTATCATTGTGT P1 AATTGAC GUN1(At2g31400) GUN1 promoter cloning TGTTGATAACTCTAGAGTCCCCTGAAAGGAAGAGTTTGTG P2 GTGATTAC G1f CACCATGGCGTCAACGCCGCCTCAC GUN1(At2g31400) GUN1 protein coding region cloning G1r CAAAAGAAGAGGCTGTAAAGCAAACGAC

bioRxiv preprint doi: https://doi.org/10.1101/532036; this version posted January 28, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. bioRxiv preprint doi: https://doi.org/10.1101/532036; this version posted January 28, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

a 12 Zn-Proto 11 GUN1 10 10 BSA Proto [GUN1-PS]/[FC1] ratio 8 0 9 1 2 6 8 4 8 4 7 FC1 activity (RFU)

FC1 activity (RFU) 16

2 6

0 5 550 570 590 610 630 650 0 4 8 12 16 Wavelength (nm) [GUN1-PS]/[FC1] ratio b 0.6 14 0.5 Mock Km=26.6 µM 12 +GUN1-PS Km=4.5 µM 0.4 10 0.3

FC1 activity 0.2 8 1/v 0.1 Mock +GUN1-PS 6 (mol Zn-Proto/min/mol protein) (mol Zn-Proto/min/mol 0 0 5 10 15 20 25 Protoporphyrin IX (µM) 4

0 -1 -0.8 -0.6 -0.4 -0.2 0 0.2 0.4 0.6 1/[S]

Shimizu et al. Fig. 2 bioRxiv preprint doi: https://doi.org/10.1101/532036; this version posted January 28, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

a b f

(kDa) Input Bound (kDa) A3033 A3026 (kDa) Col cchZ 3-17 180 180 180 130 130 CHLH/GUN5 130 100 Input 100 75 GUN1 180 100 63 GUN1-PS -Ligand 130 48 100 75 35 180 28 130 63 +Hemin 100 17 GUN1

c d e 1.2 0.6 0.5 Heme conc. (µM) Hemin 0.5 1.0 1.0 Hemin+GUN1-PS 1.9 2.8 0.4 0.4 3.7 4.5 0.8 8.3 0.3 11.5 14.3 0.3 16.7 0.6 0.2 18.8 20.6 22.2 0.1 23.7 0.2 0.4 Absorbance Absorbance

0 Absorbance (A422) Δ 0.1 0.2 Δ -0.1 KD=6.08±1.11 µM 0.0 -0.2 0 350 400 450 500 550 600 650 350 400 450 500 550 600 650 0 5 10 15 20 25 Wavelength (nm) Wavelength (nm) Heme concentration (µM)

Shimizu et al. Fig. 3 bioRxiv preprint doi: https://doi.org/10.1101/532036; this version posted January 28, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

a b c Dark Light gun1

ALA ALA GUN1 ALA

GUN1

DI I D DI FC1 FC1 FC1 H (GUN5) H (GUN5) Proto IX Proto IX (GUN6) H (GUN5) ProtoIX (GUN6) (GUN6)

Mg Fe Mg FC2 Fe Mg FC2 Fe FC2

Fe Fe Fe

Respiration, Photosynthesis Respiration, Photosynthesis Respiration, Photosynthesis P450, etc P450, etc P450, etc

Shimizu et al. Fig. 4 bioRxiv preprint doi: https://doi.org/10.1101/532036; this version posted January 28, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Glutamate

5-Aminolevulinic acid (ALA)

Porphobilinogen Porphobilinogen diaminase PBGD

Uroporphyrinogen III Uroporphyrinogen decarboxylase UROD Mg-chelatase CHLH/GUN5 Ferrochelatase Protoporphyrin IX CHLI1/CHLI2 FC1/GUN6 CHLD FC2 GUN4 Heme oxygenase Mg-protoporphyrin IX Heme HO1/HY1/GUN2 (MgProto) HO2, HO3 Biliverdin IXα GUN1 MgProto ME HY2/GUN3 Phytochromobilin Plastid Translation Chlorophyll (Chl) Machinery

Shimizu et al. Sup. Fig. 1 bioRxiv preprint doi: https://doi.org/10.1101/532036; this version posted January 28, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

a b

PPR

(kDa)

180 130 100 Full length? 75 N-terminal deleted? 63 48 35 28 17

c d

250

(kDa) 180 130 100 75 63 48

Shimizu et al. Sup. Fig. 2 bioRxiv preprint doi: https://doi.org/10.1101/532036; this version posted January 28, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

a GUN1 (At2g31400) b N-terminal region

Shimizu et al. Sup. Fig. 3 bioRxiv preprint doi: https://doi.org/10.1101/532036; this version posted January 28, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

a b c 2.5 1 1.2 MgP conc. (µM) MgP 0.8 1.0 1 2.0 MgP+GUN1-PS 1.9 2.8 3.7 0.6 4.5 8.3 0.8 1.5 11.5 0.4 14.3 16.7 18.8 0.6 0.2 20.6 1.0 22.2

Absorbance 23.7 Absorbance 0.4 Δ 0 Absorbance (A423)

0.5 Δ 0.2 -0.2 KD=8.65±1.80 µM 0.0 -0.4 0 350 400 450 500 550 600 650 350 400 450 500 550 600 650 0 5 10 15 20 25 d Wavelength (nm) e Wavelength (nm) f MgP concentration (µM) 2.5 1.4 1.6 ZnP ZnP conc. (µM) 1.2 1.4 ZnP+GUN1-PS 1.0 2.0 1.9 1 2.8 3.7 1.2 4.5 0.8 8.3 1 1.5 11.5 14.3 0.6 16.7 0.8

1.0 0.4 0.6 Absorbance Absorbance Δ 0.4

0.2 Absorbance (A424) 0.5 Δ 0 0.2 KD=3.10±0.86 µM 0.0 -0.2 0 350 400 450 500 550 600 650 350 400 450 500 550 600 650 0 5 10 15 20 Wavelength (nm) Wavelength (nm) ZnP concentration (µM)

Shimizu et al. Sup. Fig. 4 bioRxiv preprint doi: https://doi.org/10.1101/532036; this version posted January 28, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Lhcb1 .2 RBCS1A 100.0 1.00E-02 uni t)

** uni t) **

10.0 1.00E-03

1.0 1.00E-04 **

(Ar bi trary express ion Rela tive ** bi trary(Ar express ion Rela tive 0.1 1.00E-05 CL3Col- gun1-102 A3026 A3033 CL3Col-5 gun1-102 A3026 A3033

CHLH GUN 1 1.00E-02 5.00E+01 ** uni t) uni t) * 4.00E+01

1.00E-03 3.00E+01

2.00E+01 1.00E-04 **

1.00E+01

bi trary(Ar express ion Rela tive (Ar bi trary express ion Rela tive 1.00E-05 0.00E+00 ** CL3-Col 5 gun1-102 A3026 A3033 CL3Col-5 gun1-102 A3026 A3033

Shimizu et al. Supplementary Fig. 5