Transcriptome and Proteome Profiling of Neural Induced Pluripotent Stem
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
The GATA2 Transcription Factor Negatively Regulates the Proliferation of Neuronal Progenitors
RESEARCH ARTICLE 2155 Development 133, 2155-2165 (2006) doi:10.1242/dev.02377 The GATA2 transcription factor negatively regulates the proliferation of neuronal progenitors Abeer El Wakil*, Cédric Francius*,†, Annie Wolff, Jocelyne Pleau-Varet† and Jeannette Nardelli†,§ Postmitotic neurons are produced from a pool of cycling progenitors in an orderly fashion that requires proper spatial and temporal coordination of proliferation, fate determination, differentiation and morphogenesis. This probably relies on complex interplay between mechanisms that control cell cycle, specification and differentiation. In this respect, we have studied the possible implication of GATA2, a transcription factor that is involved in several neuronal specification pathways, in the control of the proliferation of neural progenitors in the embryonic spinal cord. Using gain- and loss-of-function manipulations, we have shown that Gata2 can drive neural progenitors out of the cycle and, to some extent, into differentiation. This correlates with the control of cyclin D1 transcription and of the expression of the p27/Kip1 protein. Interestingly, this functional aspect is not only associated with silencing of the Notch pathway but also appears to be independent of proneural function. Consistently, GATA2 also controls the proliferation capacity of mouse embryonic neuroepithelial cells in culture. Indeed, Gata2 inactivation enhances the proliferation rate in these cells. By contrast, GATA2 overexpression is sufficient to force such cells and neuroblastoma cells to stop dividing but not to drive either type of cell into differentiation. Furthermore, a non-cell autonomous effect of Gata2 expression was observed in vivo as well as in vitro. Hence, our data have provided evidence for the ability of Gata2 to inhibit the proliferation of neural progenitors, and they further suggest that, in this regard, Gata2 can operate independently of neuronal differentiation. -
Olig1 and Sox10 Interact Synergistically to Drivemyelin Basic
The Journal of Neuroscience, December 26, 2007 • 27(52):14375–14382 • 14375 Cellular/Molecular Olig1 and Sox10 Interact Synergistically to Drive Myelin Basic Protein Transcription in Oligodendrocytes Huiliang Li,1 Yan Lu,2 Hazel K. Smith,1 and William D. Richardson1 1Wolfson Institute for Biomedical Research and Department of Biology, University College London, London WC1E 6BT, United Kingdom, and 2Medical Research Council, Clinical Sciences Centre, Imperial College London, London W12 0NN, United Kingdom The oligodendrocyte lineage genes (Olig1/2), encoding basic helix-loop-helix transcription factors, were first identified in screens for master regulators of oligodendrocyte development. OLIG1 is important for differentiation of oligodendrocyte precursors into myelin- forming oligodendrocytes during development and is thought to play a crucial role in remyelination during multiple sclerosis. However, itisstillunclearhowOLIG1interactswithitstranscriptionalcofactorsandDNAtargets.OLIG1wasreportedlyrestrictedtomammals,but we demonstrate here that zebrafish and other teleosts also possess an OLIG1 homolog. In zebrafish, as in mammals, Olig1 is expressed in the oligodendrocyte lineage. Olig1 associates physically with another myelin-associated transcription factor, Sox10, and the Olig1/Sox10 complex activates mbp (myelin basic protein) transcription via conserved DNA sequence motifs in the mbp promoter region. In contrast, Olig2 does not bind to Sox10 in zebrafish, although both OLIG1 and OLIG2 bind SOX10 in mouse. Key words: Olig1; Olig2; Sox10; Mbp; oligodendrocyte; myelin; zebrafish; mouse; evolution; development Introduction directly regulates Mbp transcription (Stolt et al., 2002), and over- Myelin, the multilayered glial sheath around axons, is one of the expression of SOX10 alone is sufficient to induce myelin gene defining features of jawed vertebrates (gnathostomes). It is expression in embryonic chick spinal cord (Liu et al., 2007). -
Large Meta-Analysis of Genome-Wide Association Studies
medRxiv preprint doi: https://doi.org/10.1101/2020.10.01.20200659; this version posted October 4, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. It is made available under a CC-BY-NC-ND 4.0 International license . Large meta-analysis of genome-wide association studies expands knowledge of the genetic etiology of Alzheimer’s disease and highlights potential translational opportunities Céline Bellenguez1,*,#, Fahri Küçükali2,3,4*, Iris Jansen5,6*, Victor Andrade7,8*, Sonia Morenau- Grau9,10,*, Najaf Amin11,12, Benjamin Grenier-Boley1, Anne Boland13, Luca Kleineidam7,8, Peter Holmans14, Pablo Garcia9,10, Rafael Campos Martin7, Adam Naj15,16, Yang Qiong17, Joshua C. Bis18, Vincent Damotte1, Sven Van der Lee5,6,19, Marcos Costa1, Julien Chapuis1, Vilmentas Giedraitis20, María Jesús Bullido10,21, Adolfo López de Munáin10,22, Jordi Pérez- Tur10,23, Pascual Sánchez-Juan10,24, Raquel Sánchez-Valle25, Victoria Álvarez26, Pau Pastor27, Miguel Medina10,28, Jasper Van Dongen2,3,4, Christine Van Broeckhoven2,3,4, Rik Vandenberghe29,30, Sebastiaan Engelborghs31,32, Gael Nicolas33, Florence Pasquier34, Olivier Hanon35, Carole Dufouil36, Claudine Berr37, Stéphanie Debette36, Jean-François Dartigues36, Gianfranco Spalletta38, Benedetta Nacmias39,40, Vincenzo Solfrezzi41, Barbara Borroni42, Lucio Tremolizzo43, Davide Seripa44, Paolo Caffarra45, Antonio Daniele46,47, Daniela Galimberti48,49, Innocenzo Rainero50, Luisa Benussi51, Alesio Squassina52, Patrizia Mecoci53, Lucilla Parnetti54, Carlo Masullo55, Beatrice Arosio56, John Hardy57, Simon Mead58, Kevin Morgan59, Clive Holmes60, Patrick Kehoe61, Bob Woods62, EADB, Charge, ADGC, Jin Sha15,16, Yi Zhao15,63, Chien-Yueh Lee15,63, Pavel P. -
Meta-Analysis of Genetic Association with Diagnosed Alzheimer's Disease Identifies Novel Risk Loci and Implicates Abeta, Tau, Immunity and Lipid Processing
bioRxiv preprint doi: https://doi.org/10.1101/294629; this version posted April 4, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Meta-analysis of genetic association with diagnosed Alzheimer's disease identifies novel risk loci and implicates Abeta, Tau, immunity and lipid processing Kunkle BW+*1, Grenier-Boley B+2,3,4, Sims R5, Bis JC6, Naj AC7, Boland A8, Vronskaya M5, van der Lee SJ9, Amlie- Wolf A10, Bellenguez C2,3,4, Frizatti A5, Chouraki V2,11, Martin ER1,12, Sleegers K13,14, Badarinarayan N5, Jakobsdottir J15, Hamilton-Nelson KL1, Aloso R8, Raybould R5, Chen Y10, Kuzma AB10, Hiltunen M17,18, Morgan T5, Ahmad S9, Vardarajan BN19-21, Epelbaum J22, Hoffmann P23,24,25, Boada M26, Beecham GW1,12, Garnier JG8, Harold D27, Fitzpatrick AL28,29, Valladares O10, Moutet ML8, Gerrish A5, Smith AV30,31, Qu L10, Bacq D8, Denning N5, Jian X32, Zhao Y10, Zompo MD33, Fox NC34, Grove ML23, Choi SH16, Mateo I35, Hughes JT36, Adams HH9, Malamon J10, Garcia FS36, Patel Y37, Brody JA6, Dombroski B10, Naranjo MCD36, Daniilidou M38, Eiriksdottir G15, Mukherjee S39, Wallon D40,41, Uphill J42, Aspelund T15,43, Cantwell LB10, Garzia F8, Galimberti D44, Hofer E45,46, Butkiewics M47, Fin B8, Scarpini E44, Sarnowski C16, Bush W47, Meslage S8, Kornhuber J48, White CC49, Song Y47, Barber RC50, Engelborghs S51,52, Pichler S53, Voijnovic D9, Adams PM54, Vandenberghe -
SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line -
Hormonal Regulation of Oligodendrogenesis I: Effects Across the Lifespan
biomolecules Review Hormonal Regulation of Oligodendrogenesis I: Effects across the Lifespan Kimberly L. P. Long 1,*,†,‡ , Jocelyn M. Breton 1,‡,§ , Matthew K. Barraza 2 , Olga S. Perloff 3 and Daniela Kaufer 1,4,5 1 Helen Wills Neuroscience Institute, University of California, Berkeley, CA 94720, USA; [email protected] (J.M.B.); [email protected] (D.K.) 2 Department of Molecular and Cellular Biology, University of California, Berkeley, CA 94720, USA; [email protected] 3 Memory and Aging Center, Department of Neurology, University of California, San Francisco, CA 94143, USA; [email protected] 4 Department of Integrative Biology, University of California, Berkeley, CA 94720, USA 5 Canadian Institute for Advanced Research, Toronto, ON M5G 1M1, Canada * Correspondence: [email protected] † Current address: Department of Psychiatry and Behavioral Sciences, University of California, San Francisco, CA 94143, USA. ‡ These authors contributed equally to this work. § Current address: Department of Psychiatry, Columbia University, New York, NY 10027, USA. Abstract: The brain’s capacity to respond to changing environments via hormonal signaling is critical to fine-tuned function. An emerging body of literature highlights a role for myelin plasticity as a prominent type of experience-dependent plasticity in the adult brain. Myelin plasticity is driven by oligodendrocytes (OLs) and their precursor cells (OPCs). OPC differentiation regulates the trajectory of myelin production throughout development, and importantly, OPCs maintain the ability to proliferate and generate new OLs throughout adulthood. The process of oligodendrogenesis, Citation: Long, K.L.P.; Breton, J.M.; the‘creation of new OLs, can be dramatically influenced during early development and in adulthood Barraza, M.K.; Perloff, O.S.; Kaufer, D. -
Dynamic Gene Expression by Putative Hair-Cell Progenitors During
Dynamic gene expression by putative hair-cell PNAS PLUS progenitors during regeneration in the zebrafish lateral line Aaron B. Steiner1, Taeryn Kim, Victoria Cabot2, and A. J. Hudspeth Howard Hughes Medical Institute and Laboratory of Sensory Neuroscience, The Rockefeller University, New York, NY 10065 Edited* by Yuh Nung Jan, Howard Hughes Medical Institute, University of California, San Francisco, CA, and approved February 25, 2014 (received for review October 2, 2013) Hearing loss is most commonly caused by the destruction of been identified, however, and even fewer have been confirmed as mechanosensory hair cells in the ear. This condition is usually mantle cell-specific (15–17). permanent: Despite the presence of putative hair-cell progenitors Although previous transcriptomic screens have sought genes in the cochlea, hair cells are not naturally replenished in adult expressed in the lateral line, none has focused on mantle cells mammals. Unlike those of the mammalian ear, the progenitor cells (18–20). The results of such studies reflect gene expression in of nonmammalian vertebrates can regenerate hair cells through- several cell types, a complication that might mask gene expres- out life. The basis of this difference remains largely unexplored sion in progenitors. One factor impeding the isolation and char- but may lie in molecular dissimilarities that affect how progenitors acterization of progenitor cells has been the lack of a transgenic respond to hair-cell death. To approach this issue, we analyzed line in which these cells are inclusively and specifically labeled, gene expression in hair-cell progenitors of the lateral-line system. allowing their separation by cell sorting. -
Supplemental Data Olig2-Regulated Lineage-Restricted Pathway Controls Replication Competence in Neural Stem Cells and Malignant
View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Caltech Authors Neuron, Volume 53 Supplemental Data Olig2-Regulated Lineage-Restricted Pathway Controls Replication Competence in Neural Stem Cells and Malignant Glioma Keith L. Ligon, Emmanuelle Huillard, Shwetal Mehta, Santosh Kesari, Hongye Liu, John A. Alberta, Robert M. Bachoo, Michael Kane, David N. Louis, Ronald A. DePinho, David J. Anderson, Charles D. Stiles, and David H. Rowitch Figure S1. Olig1/2+/- Ink4a/Arf-/-EGFRvIII Gliomas Express Characteristic Morphologic and Immunophenotypic Features of Human Malignant Gliomas (A) Tumors exhibit dense cellularity and atypia. (B) Characteristic infiltration of host SVZ stem cell niche. (C) Although occasional tumors exhibited pseudopalisading necrosis (n, arrowhead) and hemorrhage (h, arrowhead) similar to human GBM (Astrocytoma WHO Grade IV), most tumors lacked these features. (D) IHC for hEGFR highlights hallmark feature of human gliomas, including perivascular (pv) and subpial (sp) accumulation of tumor cells, (E) striking white matter tropism of tumor cells in corpus callosum (cc), and (F) distant single cell infiltration of cerebellar white matter (wm, arrows). (G-J) Immunohistochemical markers characteristic of human tumors (Gfap, Olig2, Olig1, Nestin) are present. (K and L) Weak staining for the early neuronal marker TuJ1 and absence of the differentiated neuronal marker, NeuN similar to human glioma and consistent with heterogeneous lines of partial differentiation. Figure S2. Olig1/2+/- Ink4a/Arf-/-EGFRvIII Neurospheres Are Multipotent and Olig1/2-/- Ink4a/Arf-/-EGFRvIII Neurospheres Are Bipotent Olig1/2+/- or Olig1/2-/- Ink4a/Arf-/-EGFRvIII neurospheres were allowed to differentiate for 6 days in medium without EGF. -
Characterization of Transcription Factor Networks Involved in Umbilical Cord Blood CD34+ Stem Cells-Derived Erythropoiesis
Characterization of Transcription Factor Networks Involved in Umbilical Cord Blood CD34+ Stem Cells-Derived Erythropoiesis Biaoru Li1, Lianghao Ding2, Chinrang Yang2, Baolin Kang1, Li Liu3, Michael D. Story2, Betty S. Pace1* 1 Department of Pediatrics, Hematology/Oncology Division, Georgia Regents University, Augusta, Georgia, United States of America, 2 Department of Radiation Oncology and Simmons Comprehensive Cancer Center, University of Texas Southwestern Medical Center, Dallas, Texas, United States of America, 3 Department of Molecular and Cell Biology, University of Texas at Dallas, Richardson, Texas, United States of America Abstract Fetal stem cells isolated from umbilical cord blood (UCB) possess a great capacity for proliferation and differentiation and serve as a valuable model system to study gene regulation. Expanded knowledge of the molecular control of hemoglobin synthesis will provide a basis for rational design of therapies for b-hemoglobinopathies. Transcriptome data are available for erythroid progenitors derived from adult stem cells, however studies to define molecular mechanisms controlling globin gene regulation during fetal erythropoiesis are limited. Here, we utilize UCB-CD34+ stem cells induced to undergo erythroid differentiation to characterize the transcriptome and transcription factor networks (TFNs) associated with the c/b-globin switch during fetal erythropoiesis. UCB-CD34+ stem cells grown in the one-phase liquid culture system displayed a higher proliferative capacity than adult CD34+ stem cells. The c/b-globin switch was observed after day 42 during fetal erythropoiesis in contrast to adult progenitors where the switch occurred around day 21. To gain insights into transcription factors involved in globin gene regulation, microarray analysis was performed on RNA isolated from UCB-CD34+ cell-derived erythroid progenitors harvested on day 21, 42, 49 and 56 using the HumanHT-12 Expression BeadChip. -
Transcriptional and Epigenetic Characterization of Early Striosomes
bioRxiv preprint doi: https://doi.org/10.1101/2020.05.19.105171; this version posted May 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Transcriptional and epigenetic characterization of early striosomes identifies Foxf2 and Olig2 as factors required for development of striatal compartmentation and neuronal phenotypic differentiation Maria-Daniela Cirnaru1, Sicheng Song2, Kizito-Tshitoko Tshilenge3, Chuhyon Corwin1, Justyna Mleczko1, Carlos Galicia Aguirre3, Houda Benlhabib2, Jaroslav Bendl4,5,6, Jordi Creus Muncunill1, Pasha Apontes4,5,6, John F. Fullard4,5,6, Peter Carlsson7, Panos Roussos4,5,6,8, Sean D. Mooney2, Lisa M. Ellerby3, Michelle E. Ehrlich1* 1. Department of Neurology, Icahn School of Medicine at Mount Sinai, New York, New York 10029, USA. 2. Department of Epidemiology, University of Washington, Seattle, WA, USA. 3. Buck Institute for Research on Aging, Novato, CA, 94945, USA. 4. Pamela Sklar Division of Psychiatric Genomics, Icahn School of Medicine at Mount Sinai, One Gustave L. Levy Place, New York, NY, 10029, USA. 5. Institute for Genomics and Multiscale Biology, Department of Genetics and Genomic Sciences, Icahn School of Medicine at Mount Sinai, One Gustave L. Levy Place, New York, NY, 10029, USA. 6. Department of Psychiatry, Icahn School of Medicine at Mount Sinai, One Gustave L. Levy Place, New York, NY, 10029, USA. 7. Department of Chemistry and Molecular Biology, University of Gothenburg, Gothenburg, Sweden. 8. Mental Illness Research, Education, and Clinical Center (VISN 2 South), James J. Peters VA Medical Center, Bronx, NY 10468, USA. -
Combinatorial Profiles of Oligodendrocyte-Selective Classes of Transcriptional Regulators Differentially Modulate Myelin Basic Protein Gene Expression
The Journal of Neuroscience, September 7, 2005 • 25(36):8311–8321 • 8311 Development/Plasticity/Repair Combinatorial Profiles of Oligodendrocyte-Selective Classes of Transcriptional Regulators Differentially Modulate Myelin Basic Protein Gene Expression Solen Gokhan,1,2,3,7* Mireya Marin-Husstege,8* Shau Yu Yung,4 Darah Fontanez,8,9 Patrizia Casaccia-Bonnefil,8,9 and Mark F. Mehler1,2,3,4,5,6,7 1Institute for Brain Disorders and Neural Regeneration, 2F. M. Kirby Program in Neural Protection and Repair, Departments of 3Neurology, 4Neuroscience, and 5Psychiatry and Behavioral Sciences, 6Einstein Cancer Center, and 7Rose F. Kennedy Center for Research in Mental Retardation and Developmental Disabilities, Albert Einstein College of Medicine, Bronx, New York 10461, and 8Department of Neuroscience and Cell Biology, University of Medicine and Dentistry of New Jersey, Robert Wood Johnson Medical School, and 9Undergraduate Research Program RISE at Rutgers, The State University of New Jersey, Piscataway, New Jersey 08854 Recent studies suggest that specific neural basic helix-loop-helix (HLH; i.e., Olig1 and Olig2, Mash1), associated inhibitory HLH (i.e., Id2 andId4),high-mobilitygroupdomain(i.e.,Sox10),andhomeodomain(i.e.,Nkx2.2)transcriptionfactorsareinvolvedinoligodendrocyte (OL) lineage specification and progressive stages of maturation including myelination. However, the developmental interplay among theselineage-selectivedeterminants,inacell-andmaturationalstage-specificcontext,hasnotyetbeendefined.Weshowhereinvivoand in vitro developmental -
Investigating the Gene Regulatory Network Underlying Caudal Hindbrain Specification in Embryonic Zebrafish
University of Massachusetts Medical School eScholarship@UMMS GSBS Dissertations and Theses Graduate School of Biomedical Sciences 2018-06-13 Investigating the Gene Regulatory Network Underlying Caudal Hindbrain Specification in Embryonic Zebrafish Priyanjali Ghosh University of Massachusetts Medical School Let us know how access to this document benefits ou.y Follow this and additional works at: https://escholarship.umassmed.edu/gsbs_diss Part of the Developmental Biology Commons Repository Citation Ghosh P. (2018). Investigating the Gene Regulatory Network Underlying Caudal Hindbrain Specification in Embryonic Zebrafish. GSBS Dissertations and Theses. https://doi.org/10.13028/M2S971. Retrieved from https://escholarship.umassmed.edu/gsbs_diss/979 This material is brought to you by eScholarship@UMMS. It has been accepted for inclusion in GSBS Dissertations and Theses by an authorized administrator of eScholarship@UMMS. For more information, please contact [email protected]. INVESTIGATING THE GENE REGULATORY NETWORK UNDERLYING CAUDAL HINDBRAIN SPECIFICATION IN EMBRYONIC ZEBRAFISH A Dissertation Presented By Priyanjali Ghosh Submitted to the Faculty of the University of Massachusetts Graduate School of Biomedical Sciences, Worcester in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY June 13, 2018 Department of Biochemistry and Molecular Pharmacology INVESTIGATING THE GENE REGULATORY NETWORK UNDERLYING CAUDAL HINDBRAIN SPECIFICATION IN EMBRYONIC ZEBRAFISH A Dissertation Presented By Priyanjali Ghosh This work was undertaken in the Graduate School of Biomedical Sciences Department of Biochemistry and Molecular Pharmacology Under the mentorship of Charles G. Sagerström, PhD, Thesis Advisor Michael M. Francis, PhD Member of Committee Lawrence J. Hayward, MD, PhD, Member of Committee Scot A. Wolfe, PhD, Member of Committee Sarah McMenamin, PhD, External Member of Committee Alonzo H.