US007871.803B2

(12) United States Patent (10) Patent No.: US 7,871,803 B2 Takenaka (45) Date of Patent: Jan. 18, 2011

(54) GENE ENCODING NOVEL LUCIFERASE WO WO99/49019 A2 9, 1999 (75) I Hi i Takenaka. Tokvo (JP OTHER PUBLICATIONS nVentor: iromi Takenaka, Tokyo (JP) Y. Nakajimaetal. “cDNACloning and Characterization of a Secreted Luciferase from the Luminous Japanese Ostracod, Cypridina (73) Assignee: NEC Soft, Ltd., Tokyo (JP) noctiluca”. Biosci. Biotechnol. Biochem, 68(3): 565-570 (Mar. (*) Notice:- r Subject to any disclaimer,- the term of this 2004).*Markova SV. Et al., Cloning and Expression of cDNA for a patent is extended or adjusted under 35 Luciferase from the Marine Copepod Metridia longa. J. Biol. Chem. U.S.C. 154(b) by 649 days. 2004. 1, vol. 279, No. 5, pp. 3212 to 3217. Yasuo Kakunami et al., “Toyamawan ni Okeru Kaiashirui Metridia (21) Appl. No.: 11/721,032 pacifica (Calanoida) No Biomass Model', Bulletin of the Japanese Society of Scientific Fisheries, 2000 Nen, pp. 1014 to 1019. (22) PCT Filed: Dec. 9, 2004 * cited by examiner (86). PCT No.: PCT/UP2004/O184O1 Primary Examiner Rebecca Prouty (74) Attorney, Agent, or Firm Sughrue Mion, PLLC S371 (c)(1), (2), (4) Date: Jun. 6, 2007 (57) ABSTRACT (87) PCT Pub. No.: WO2006/061906 The present invention provides genes encoding novel luciferases having at least the properties of being capable of PCT Pub. Date: Jun. 15, 2006 using coelenterazine aS their luminescent substrates: and being capable of being recombinantly expressed in a mammal (65) Prior Publication Data cell as a host and produced to be secreted to the outside of the host cell. Specifically, the gene encoding novel luciferases US 2009/O23332O A1 Sep. 17, 2009 according to the present invention is a DNA molecule com prising a nucleotide sequence encoding any of the full-length (51) Int. Cl amino acid sequences of two types of luciferase proteins, CI2N 15/53 (2006.01) luciferase 1 and luciferase 2, from M. pacifica,p and is, for C12N 9/02 (2006.01) example, a gene encoding the following full-length amino : |2. 3.08: acid sequence of the luciferase 1. (52) U.S. Cl...... 435/189: 435/6: 435/8: 435/320.1; 435/325; 536/23.2 MMEIOVLFAL ICFALVOANP TENKDDIDIV GVEGKFGTTD 60 (58) Field of Classification Search ...... None See application file for complete search history. LETDLFTIWE DMNWISRDTN (56) References Cited LANSDADRGK MPGKKLPLEW LIEMEANARK AGCTRGCLIC 12O

U.S. PATENT DOCUMENTS LSKIKCTAKM. KWYIPGRCHD 5,292,658 A * 3/1994 Cormier et al...... YGGDKKTGQA GIVGAIVDIP EISGFKELGP MEQFIAQVDL 180 CADCTTGCLK GLANWKCSAL

FOREIGN PATENT DOCUMENTS LKKWLPDRCA SFADKIOSEW DNIKGLAGDR 210 JP 2002-507410 A 3, 2002 JP 2002-320482 A 11, 2002 13 Claims, 6 Drawing Sheets U.S. Patent Jan. 18, 2011 Sheet 1 of 6 US 7,871,803 B2 Fig. 1

U.S. Patent Jan. 18, 2011 Sheet 2 of 6 US 7,871,803 B2

Fig. 2 Luciferase 1&2 pH dependency

s

5H C

r rp HM r U.S. Patent Jan. 18, 2011 Sheet 3 of 6 US 7,871,803 B2 Fig. 3

i

i s

US 7,871,803 B2 1. GENE ENCOOING NOVEL LUCFERASE

TECHNICAL FIELD Formula 1

The present invention relates to genes encoding novel luciferases. In particular, the present invention relates to cod ing genes available in the recombinant expression of novel luciferases from marine plankton. 10 N

BACKGROUND ART HO

Luciferase, which is an enzyme protein capable of emitting 15 bioluminescence through the enzymatic oxidation of lumi Such secreted luciferase capable of causing desired lumines nescent Substrates (luciferins), has conventionally been uti cence is preferable for constructing a variety of bioassay lized as a reporter protein in a variety of bioassay systems. systems. For example, there have been reported luciferases That is, genes encoding several luciferases have been col from Cypridina (Vargula) hilgendorfii belonging to Ostra lected for the purpose of being recombinantly expressed in coda, from Oplophorus gracilirostris belonging to Decapoda, from Gaussia princeps, and from Metridia longa, which are the host cell in in-vitro cell culture systems, and recombinant all capable of using the coelenterazine as their luminescent expression systems thereof have also been established. Par substrates (luciferins). ticularly, in the recombinant expression systems of luciferase, 25 a gene encoding luciferase is transcribed under the control of DISCLOSURE OF THE INVENTION a heterologous promoter in a host cell, and the transcribed Some of previously reported luciferases have such proper mRNA is translated into a peptide chain to produce luciferase ties of: protein of interest. 30 being capable of using coelenterazine as their luminescent The use of secreted luciferase, which is a luciferase protein Substrates (luciferins); and recombinantly expressed in a host cell and secreted to the being capable of being produced by recombinant expres outside of the cell, enables the convenient monitoring of Sion, for example, using a mammal cell as a host as to be reporter protein yields by Sampling a medium containing the 35 secreted to the outside of the host cell, secreted reporter protein without sampling the cultured host which properties are desired for constructing a variety of cell. For example, when time-dependent changes in reporter bioassay systems. However, the types of the luciferases reported are very limited, and options of available secreted protein yield are observed in in-vitro cell culture systems, the luciferases have been desired to be further increased for con use of the Secreted luciferase enables the use of an approach 40 structing diverse bioassay systems. That is to say, it has fur comprising sampling a predetermined amount of a medium at ther been desired to search novel secreted luciferases that each point in time and monitoring the concentration of satisfy the properties described above and to provide genes secreted luciferase contained in the medium. There were pre encoding the secreted luciferases, which are used in the viously reported Secreted luciferases capable of being recom recombinant expression of Such novel secreted luciferases. binantly expressed that can be employed in Such application, The present invention solves such problems. That is to say, Such as luciferases from Cypridina (Vargula) hilgendorfii 45 an object of the present invention is to provide genes encoding belonging to Ostracoda (Thompson, E. M., et al., Proc. Natl. novelluciferases having at least the properties of: Acad. Sci. USA, 86,6567-6571 (1989)) and from Oplopho being capable of using coelenterazine as their luminescent rus gracilirostris belonging to Decapoda (Inouye, S., et al., Substrates (luciferins); and FEBS Lett., 481, 19-25 (2000); JP 2002-320482 A). It have 50 being capable of being produced by recombinant expres also been reported that these two types of secreted luciferases Sion, for example, using a mammal cell as a host as to be were produced by recombinant expression using animal cells secreted to the outside of the host cell. as hosts to be secreted therefrom. The present inventors pursued the search of novel Furthermore, there were previously reported, as for luciferases in order to solve said problems in questions. As a secreted luciferases found in other origins, luciferases from 55 result, the present inventors found that Metridia pacifica, one Gaussia princeps (GenBankTM/EBI accession number species of marine plankton belonging to Metridinidae, pro AYO15993) and Metridia longa (GenBankTM/EBI accession duces secreted luciferases capable of using coelenterazine as number AY364164: J. Biol. Chem. Vol.279, No. 5 pp. 3212 their luminescent substrates (luciferins). The present inven 3217 (2004)) both belonging to Metridinidae. tors pursued the cloning of genes encoding the Secreted 60 luciferases from Metridia pacifica and consequently found These secreted luciferases cause luminescence through the out that Metridia pacifica actually produces two types of actions on their respective luminescent Substrates (luciferins) secreted luciferases. The present inventors separately cloned specific to the organisms. For constructing a variety of bio genes encoding these two types of secreted luciferases, assay systems, the luciferases are desired to be capable of Metridia pacifica luciferase 1 and Metridia pacifica acting on more versatile luminescent Substrates (luciferins). 65 luciferase 2, from Metridia pacifica, and recombinantly For example, when the following coelenterazine is utilized as expressed them in human-derived established cell lines, dem a more versatile luminescent Substrate (luciferin), onstrating that the two types of luciferases are actually US 7,871,803 B2 3 secreted to the outside of the host cells. The present inventors completed the present invention on the basis of a series of ATG ATG GAA. ATA CAA GTT CTT TTT GCT CTC ATT 36 these findings. Met Met Glu Ile Glin Wall Lieu Phe Ala Luell Ile In particular, a gene encoding a luciferase protein from M. 10 pacifica according to the first embodiment of the present TTT GCA TTG. GTG CAG GCC AAT CCA ACT GAA AAC 72 invention is Phe Ala Lieu Wall Glin Ala Asn Pro Thir Glu Asn a gene encoding a luciferase protein: luciferase 1 from M. 15 2O pacifica, characterized in that GAT GAC ATT GAC ATT GTT GGT GTA GAA GGA TTT 108 the gene is a DNA molecule having a nucleotide sequence 10 Asp Asp Ile Asp Ile Val Gly Wall Glu Gly Lys Phe comprising a nucleotide sequence encoding the following 25 3 O 35 full-length amino acid sequence (SEQ ID NO: 1) of the GGT ACA ACA GAC CTT GAG ACA GAC TTA. TTC ACC ATC 144 Gly Thir Thr Asp Lell Glu Thir Asp Lieu. Phe Thir Ile luciferase protein: luciferase 1 from M. pacifica. 4 O 45 15 GTG GAG GAT ATG AAT GTC ATC AGT AGA GAC ACC AAT 18O Wall Glu Asp Met Asn Wall Ile Ser Arg Asp Thir Asn SO 55 6 O Met Met Glu Ile Glin Wall Lieu. Phe Ala Luell Ile Cys 10 CTA GCC AAC AGT GAT GCT GAC CGC GGT ATG CCT 216 Luell Ala Asn. Ser Asp Arg Gly Lys Met Pro Phe Ala Luell Wall Glin Ala Asn Pro Thir Glu Ala Asp Asn Lys 65 70 15 GGT AAA AAA CTG CCA CTG GAG GTA CTC ATA GAG ATG 252 Asp Asp Ile Asp Wall Glu Gly Ile Val Gly Llys Phe Gly Pro Lieu. Glu Wall Lieu Ile Glu Met 25 3 O 35 Llys Llys Lieu. 7s Gly Thir Thir Asp Lieu. Glu. Thir Asp Luell Phe Thir Ile 25 GCC AAT GCT CGT AAA GCT GGC TGC ACC AGG GGA 288 4 O 45 Ala Asn Ala Arg Lys Ala Thir Arg Gly 9 O 95 Wall Glu Asp Met Asn. Wall Ile Ser Arg Asp Thir Asn SO 55 6 O CTC ATC TGT CTT TCA. AAG ATC AAG ACA GCA 324 Lell Thir Ala Lell Ala Asn Ser Arg Gly Lys Met Pro Lieu. Ile Cys Ser Lys Ile Llys Asp Ala Asp 30 1 OO 105 65 70 ATG AAG GTG TAC ATT CCA GGA, AGA CAT GAT 360 Gly Lys Lieu Pro Leu Glu. Wall Lieu Ile Glu Met Met Llys Val Ile Pro Gly Arg His Asp 115 12 O Glu Ala Asn Ala Gly Thir Arg Gly Arg Lys Ala GGC GGT GAC AAG AAA ACT GGA CAG GCA GGA ATA 396 85 9 O 95 35 Gly Gly Asp Lys Lys Thr Gly Glin Ala Gly Ile 125 13 O Lell Ile Cys Lieu. Ser Lys Ile Lys Thir Ala 105 GGT GCC ATT GTT GAC ATT CCC GAA ATT TCT GGA 432 Gly Ala Ile Wall Asp Ile Pro Glu Ile Ser Gly Lys Met Wall Tyr Ile Pro Gly Arg His Asp 135 14 O 11 O 115 12 O 40 TTC AAG GAG TTG GGA CCC ATG GAG CAG TTT ATT GCT 468 Gly Gly Asp Llys Llys Thr Gly Glin Ala Gly Ile Phe Lys Glu Lieu. Gly Pro Met Glu Glin Phe Ile Ala 125 13 O 145 15 O 155

Wall Gly Ala Ile Val Asp Ile Pro Glu Ile Ser Gly GTT GAT CTT GCT GAC TGC ACA ACT GGC TGC SO4 135 14 O 45 G Val Asp Lieu. Ala Asp Cys Thr Thir Gly 16 O 1.65 Phe Glu Luell Gly Pro Met Glu Glin Phe Ile Ala 145 15 O 155 AAA. GGT CTT GCC AAT GTC AAG TGC TCC GCA CTC 54 O Lys Gly Lieu. Ala Asn. Wall Lys Cys Ser Ala Lell Glin Wall Asp Luell Cys Ala Asp Thir Thir Gly Cys 17 O 17s 18O 50 16 O 1.65 CTG AAG AAA TGG CTT CCA GAC AGA TGT GCA AGT TTT 576 Lell Lys Gly Luell Ala Asn. Wall Ser Ala Lieu. Luell Llys Llys Trp Lell Pro Asp Arg Cys Ala Ser Phe 17O 17s 18O 185 19 O

Lell Ala Ser Phe GCT GAC AAA ATC CAG AGT GAA GTA GAC AAC ATC AAG 61.2 Trp Lieu Pro Asp Arg Cys 55 185 190 Ala Asp Llys Ile Glin Ser Glu Val Asp Asn Ile 195 2 OO Ala Asp Lys Ile Glin Ser Glu Wall Asp Asn Ile Llys 195 GGC TTG GCT GGA GAT CGT TGA 633 Gly Lieu Ala Gly Asp Arg * 2O5 210 Gly Lell Ala Gly Asp Arg 60 2O5 210 For example, the gene may be a DNA molecule having the In this context, it is preferred that the nucleotide sequence following nucleotide sequence (SEQID NO: 5) as the nucle encoding the full-length amino acid sequence (SEQID NO: 65 otide sequence comprising the nucleotide sequence encoding 1) of the luciferase protein: luciferase 1 from M. pacifica be the full-length amino acid sequence (SEQ ID NO: 1) of the the following nucleotide sequence (SEQID NO: 2). luciferase protein: luciferase 1 from M. pacifica.

US 7,871,803 B2 7 8

- Continued TATTGAATTG TTTATTAATA TGAATGGAAT TCCTATAAAT ATATTCTATG 831

TAATCCAAAA AAAAAAAAAA AAAAAAAAAA AAAAAG 867

In addition, the first embodiment of the present invention luciferase protein: luciferase 1 from M. pacifica is the follow also provides even a gene encoding a variant of a luciferase ing nucleotide sequence (SEQID NO: 9): protein from M. pacifica described below. That is to said, a gene encoding a variant of a luciferase 10 protein from M. pacifica according to the first embodiment of ATG ATG GAA. ATA AAA GTT CTT TTT GCT. CTC ATT TGC 36 the present invention includes: Met Met Glu Ile Llys Val Lieu. Phe Ala Lieu. Ile Cys a gene encoding a variant of a luciferase protein: luciferase 1 from M. pacifica, characterized in that TTT GCA TTG. GTG. CAG GCC AAT CCA ACT GAA. AAC AAA 72 the gene is a DNA molecule having a nucleotide sequence 15 Phe Ala Leu Val Glin Ala Asn Pro Thr Glu Asn Lys comprising a nucleotide sequence encoding the following 15 2O full-length amino acid sequence (SEQID NO. 7) of the Wa1- GAT GAC ATT GAC ATT GTT GGT GTA GAA. GGA AAA TTT 108 ant of a luciferase protein: luciferase 1 from M. pacifica: Asp Asp Ile Asp Ile Val Gly Val Glu Gly Llys Phe 25 3O 35 2O Met Met Glu Ile Llys Val Lieu. Phe Ala Lieu. Ile Cys GGT ACA ACA GAC CTT GAG ACA GAC TTA TTC ACC ATC 144 1. 5 10 Gly. Thir Thr Asp Lieu. Glu Thir Asp Leu Phe Thir Ile 4 O 45 Phe Ala Lieu Val Glin Ala Asn Pro Thr Glu Asn Lys 15 2O GTG GAG GAT ATG AAT GTC ATC AGT AGA. GAC ACC AAT 18O Val Glu Asp Met Asn Val Ile Ser Arg Asp Thr Asn 25 Asp Asp Ile Asp Ile Val Gly Val Glu Gly Llys Phe SO 55 6 O 25 3 O 35 CTA GCC AAC AGT, GAT GCT GAC CGC GGT AAA ATG CCT 216 Gly. Thir Thr Asp Leu Glu Thir Asp Leu Phe Thir Ile Lieu Ala Asn. Ser p Ala Asp Arg Gly : Met Pro 4 O 45 Val Glu Asp Met Asn Val Ile Ser Arg Asp Thr Asn 3O GGT AAA AAA CTG CCA CTG GAG GTA CTC ATA GAG ATG 252 SO 55 6 O Gly Lys Llys Lieu Pro Lieu. Glu Val Lieu. Ile Glu Met 7s 8O Lieu Ala Asn. Ser Asp Ala Asp Arg Gly Lys Met Pro 65 70 GAA GCC AAT GCT CCGT AAA GCT GGC TGC ACC AGG GGA. 288 Glu Ala Asn Ala Arg Lys Ala Gly Cys Thr Arg Gly Gly Lys Lys Leu Pro Leu Glu Val Leu. Ile Glu Met 35 9 O 95 7s 8O TGT CTC ATC TGT CTT, TCA AAG ATC AAG TGT ACA GCA 324 Glu Ala Asn Ala Arg Lys Ala Gly Cys Thir Arg Gly Cys Lieu. Ile Cys Lieu. Ser Lys Ile Lys Cys Thr Ala 85 9 O 95 1 OO 105

Cys Lieu. Ile Cys Lieu. Ser Lys Ile Lys Cys Thr Ala 40 AAA. ATG AAG GTG TAC ATT CCA. GGA, AGA TGT CAT GAT 360 1 OO 105 Llys Met Llys Val Tyr Ile Pro Gly Arg Cys His Asp 11 O 115 12 O Llys Met Llys Val Tyr Ile Pro Gly Arg Cys His Asp 11O 115 12 O TAT GGC GGT GAC AAG AAA ACT GGA CAG GCA. GGA, ATA 396 Tyr Gly Gly Asp Llys Llys Thr Gly Glin Ala Gly Ile Tyr Gly Gly Asp Llys Llys Thr Gly Glin Ala Gly Ile 45 125 13 O 125 13 O GTT GGT GCC ATT GTT GAC ATT CCC GAA ATT TCT GGA 432 Val Gly Ala Ile Val Asp Ile Pro Glu Ile Ser Gly Val Gly Ala Ile Val Asp Ile Pro Glu Ile Ser Gly 135 14 O 135 14 O Phe Lys Glu Lieu. Gly Pro Met Glu Glin Phe Ile Ala TTC AAG GAG TTG. GGA CCC ATG GAG CAG TTT ATT GCT. 468 145 15 O 155 50 Phe Lys Glu Lieu. Gly Pro Met Glu Glin Phe Ile Ala 145 15 O 155 Glin Val Asp Lieu. Cys Ala Asp Cys Thir Thr Gly Cys 16 O 1.65 CAA GTT GAT. CTT TGC GCT GAC TGC ACA ACT GGC TGC O4 Glin Val Asp Lieu. Cys Ala Asp Cys Thir Thr Gly Cys Lieu Lys Gly Lieu Ala Asn. Wall Lys Cys Ser Ala Lieu. 16 O 1.65 17O 17s 18O 55 CTC AAA GGT CTT GCC AAT GTC AAG. T.G.C. TCC GCA CTC 4 O Lieu Lys Llys Trp Lieu Pro Asp Arg Cys Ala Ser Phe Lieu Lys Gly Lieu Ala Asn. Wall Lys Cys Ser Ala Lieu. 185 190 17 O 17s 18O

Ala Asp Llys Ile Glin Ser Glu Val Asp Asn. Ile Llys CTG AAG AAA TGG. CTT CCA GAC AGA TGT, GCA AGT TTT 576 195 2OO 60 Leu Lys Lys Trp Leu Pro Asp Arg Cys Ala Ser Phe 185 19 O Gly Lieu Ala Gly Asp Arg 2O5 210; for i h di f a lucif GCT GAC AAA ATC CAG AGT GAA GTA. GAC AAC ATC AAG 612 or 1nstance, the gene encoding a variant of a luciferase Ala Asp Llys Ile Glin Ser Glu Val Asp Asn. Ile Llys protein from M. pacifica, 65 195 2 OO wherein the nucleotide sequence encoding the full-length amino acid sequence (SEQ ID NO: 7) of the variant of a US 7,871,803 B2 9 10

- Continued GGC TTG GCT GGA. GAT CGT TGA 633 ATG ATG GAA GTA GTT GTT TTT GCT CTC ATT 36 Gly Lieu Ala Gly Asp Arg * Met Met Glu Wall Wall Wall Phe Ala Luell Ile 2O5 210; 1O

TTT GCA TTG GTG CAG GCC AAT CCA ACT GAA AAC 72 O Phe Ala Lieu Wall Glin Ala Asn Pro Thir Glu Asn alternatively, 15 2O a gene encoding a variant of a luciferase protein: luciferase GAT GAC ATT GAC ATT GTT GGT GTA GAA GGA TTT 108 10 Asp Ile Asp Ile Wall Gly Wall Glu Gly Lys Phe 1 from M. pacifica, characterized in that 25 3 O 35 the gene is a DNA molecule having a nucleotide sequence GGT ACA ACA GAC CTT GAG ACA GAC TTA TTC ACC ATC 144 comprising a nucleotide sequence encoding the following Gly Th Thr Asp Lell Glu Thir Asp Luell Phe Thir Ile full-length amino acid sequence (SEQID NO: 8) of the vari 4 O 45 15 ant of a luciferase protein: luciferase 1 from M. pacifica: GTG GAG GAT ATG AAT GTC ATC AGT AGA GAC ACC AAT 18O Wa. Glu Asp Met Asn Wall Ile Ser Arg Asp Thir Asn SO 55 6 O Met Met Glu Val Llys Val Val Phe Ala Lieu. Ile Cys CTA GCC AAC AGT GAT GCT GAC CGC GGT ATG CCT 216 Luell Ala Asn Ser Asp Ala Asp Gly Lys Met Pro Phe Ala Lieu Val Glin Ala Asn Pro Thr Glu Asn Lys 65 70 15 2O GGT CTG CCA CTG GAG CTC ATA GAG ATG 252 Asp Asp Ile Asp Ile Val Gly Val Glu Gly Llys Phe Gly Llys Llys Lell Pro Lell Glu Luell Ile Glu Met 25 3 O 35 7s

Gly. Thir Thr Asp Leu Glu Thir Asp Leu Phe Thir Ile 25 GCC AAT GCT CGT GCT ACC AGG GGA 288 4 O 45 Ala Asn Ala Arg Lys Ala Thir Arg Gly 9 O 95 Val Glu Asp Met Asn Val Ile Ser Arg Asp Thr Asn SO 55 6 O CTC ATC TGT CTT TCA AAG AAG ACA GCA 324 Lieu. Ile Cys Lell Ser Lys Lys Thir Ala Lieu Ala Asn. Ser Asp Ala Asp Arg Gly Lys Met Pro 30 105 65 70 ATG AAG GTG TAC ATT CCA AGA CAT GAT 360 Gly Llys Llys Lieu Pro Lieu. Glu Val Lieu. Ile Glu Met Met Lys Wall Ile Pro Arg His Asp 7s 8O 115 12 O

Glu Ala Asn Ala Arg Lys Ala Gly Cys Thir Arg Gly 35 GGC GGT GAC AAG AAA ACT CAG GCA GGA ATA 396 85 9 O 95 Gly Gly Asp Lys Lys Thir Glin Ala Gly Ile 125 13 O Cys Lieu. Ile Cys Lieu. Ser Lys Ile Lys Cys Thr Ala 1OO 105 GGT GCC ATT GTT GAC ATT CCC GAA ATT TCT GGA 432 Gly Ala Ile Wall Asp Ile Pro Glu Ile Ser Gly Llys Met Llys Val Tyr Ile Pro Gly Arg Cys His Asp 135 14 O 11O 115 12 O 40 TTC AAG GAG TTG GGA CCC ATG GAG CAG TTT ATT GCT 468 Tyr Gly Gly Asp Llys Llys Thr Gly Glin Ala Gly Ile Phe Lys Glu Lell Gly Pro Met Glu Glin Phe Ile Ala 125 13 O 145 15 O 155

Val Gly Ala Ile Val Asp Ile Pro Glu Ile Ser Gly GTT GAT CTT GCT GAC ACA ACT GGC TGC SO4 135 14 O 45 G Val Asp Lell Ala Asp Thir Thir Gly 16 O 1.65 Phe Lys Glu Lieu. Gly Pro Met Glu Glin Phe Ile Ala 145 15 O 155 AAA. GGT CTT GCC AAT GTC TGC TCC GCA CTC 54 O Lys Gly Lell Ala Asn Wall Cys Ser Ala Lell Glin Val Asp Lieu. Cys Ala Asp Cys Thir Thr Gly Cys 17 O 17s 18O 16 O 1.65 50 AAG AAA TGG CTT CCA GAC AGA TGT GCA AGT TTT 576 Lieu Lys Gly Lieu Ala Asn. Wall Lys Cys Ser Ala Lieu. Llys Llys Trp Lell Pro Asp Arg Cys Ala Ser Phe 17 O 17s 18O 185 19 O

Lieu Lys Llys Trp Lieu Pro Asp Arg Cys Ala Ser Phe GAC AAA ATC CAG AGT GAA GTA GAC AAC ATC AAG 61.2 185 190 55 Asp Llys Ile Glin Ser Glu Val Asp Asn Ile 195 Ala Asp Llys Ile Glin Ser Glu Val Asp Asn. Ile Llys 195 2 OO TTG GCT GGA GAT CGT TGA 633 Gly Lieu Ala Gly Asp Arg Gly Lieu Ala Gly Asp Arg 2O5 210 2O5 210; 60 On the other hand, a gene encoding a luciferase protein for example, the gene encoding a variant of a luciferase from M. pacifica according to the second embodiment of the protein from M. pacifica, present invention is wherein the nucleotide sequence encoding the full-length a gene encoding a luciferase protein: luciferase 2 from M. amino acid sequence (SEQ ID NO: 8) of the variant of a 65 pacifica, characterized in that luciferase protein: luciferase 1 from M. pacifica is the follow the gene is a DNA molecule having a nucleotide sequence ing nucleotide sequence (SEQID NO: 10). comprising a nucleotide sequence encoding the following US 7,871,803 B2 11 12 full-length amino acid sequence (SEQ ID NO: 3) of the luciferase protein: luciferase 2 from M. pacifica. - Continued 15 2O

GAA GAC ATT GAT. CTT GTA GCT ATA GGT GGC AGC TTT 108 Met Gly Val Lys Lieu. Ile Phe Ala Wall Wall Wall 10 Glu Asp Ile Asp Lieu Val Ala Ile Gly Gly Ser Phe 25 3 O 35 Ala Ala Ala Glin Ala Ala Thr Ile Asn Glu Asn Phe GCT. CTG GAT GTT GAT GCT. AAC AGA. GGT GGA CAT GGT 144 15 Ala Lieu. Asp Val Asp Ala Asn Arg Gly Gly His Gly 4 O 45 Wall Ala Ile Gly Gly Ser Phe Glu Asp Ile Asp Lieu. 10 25 3 O 35 GGA CAT CCT GGC AAG AAG ATG CCA. AAA GAA GTA. CCT 18O Ala Asn Arg Gly Gly His Gly Gly His Pro Gly Llys Llys Met Pro Lys Glu Val Lieu. Ala Lieu. Asp Val Asp SO 55 6 O 4 O 45 GTT GAA. ATG GAA GCT. AAT GCT AAA AGG GCT GGG TGC 216 Gly His Pro Gly Lys Lys Met Pro Glu Wall Luell SO 55 6 O 15 Val Glu Met Glu Ala Asn Ala Lys Arg Ala Gly Cys 65 70 Wall Glu Met Glu Ala Asn Ala Arg Ala Gly CAC AGA. GGA TGT CTG ATT T.G.T. CTT. TCC CAC ATC AAG 2s2 65 70 His Arg Gly Cys Lieu. Ile Cys Lieu. Ser His Ile Llys 7s 8O His Arg Gly Cys Lieu. Ile Cys Lell Ser His Ile 7s 8O TGC ACC AAG AAA. ATG AAG AAG TTT ATC CCA. GGA, AGA. 288 Llys Llys Phe Ile Pro Gly Arg Cys Thir Lys Llys Met Lys Llys Phe Ile Pro Gly Arg Cys Thr Lys Llys Met 85 9 O 95 85 90 95 TGC CAC AGT TAT GAA. GGA. GAC AAG GAT TCT, GCA CAG 324 Cys His Ser Tyr Glu Gly Asp Asp Ser Ala Glin 1OO 105 Cys His Ser Tyr Glu Gly Asp Lys Asp Ser Ala Glin 25 1OO 105 Glu Ile Wall Asp Met Pro Glu Gly Gly Ile Gly Glu GGA. GGC ATT GGA GAA GAA. ATT GTT GAC ATG CCT GAA 360 11O 115 12O Gly Gly Ile Gly Glu Glu Ile Val Asp Met Pro Glu 11 O 115 12O Ile Pro Gly Phe Lys Asp Llys Glu Pro Met Asp Glin 125 13 O 30 ATT CCC GGA TTC AAA. GAC AAG GAA CCA. ATG GAC CAA 396 Phe Ile Ala Glin Wall Cys Wall Asp Thir Ile Pro Gly Phe Lys Asp Llys Glu Pro Met Asp Glin Asp Lieu. 125 13 O 135 14 O TTC ATC GCT CAA GTT GAT CTC TGC GTA GAT TGC ACA 432 Thr Gly Cys Lieu Lys Gly Lieu Ala Asn Wall His 145 15 O 155 Phe Ile Ala Glin Val Asp Lieu. Cys Val Asp Cys Thr 35 135 14 O Pro Ser Arg Ser Asp Lieu. Lieu Lys Llys Trp Lieu ACT GGA TGC CTC AAG GGT CTT GCC AAT GTC CAT TGC 468 16 O 1.65 Thr Gly Cys Lieu Lys Gly Lieu Ala Asn. Wal His Cys 145 15 O 155 Lys Thr Phe Ala Ser Lys Ile Glin Ser Glin Wall Asp 17O 17s 18O TCT GAT CTC CTG AAG AAA TGG CTT CCT TCA AGA TGC O4 40 Arg Ser Asp Lieu Lleu Lys Llys Trp Lieu Pro Ser Arg Cys Thir Ile Lys Gly Lieu Ala Gly Asp 16 O 1.65 185 AAG ACA TTT GCT. TCC AAA ATT CAA TCT CAA. GTG GAT 54. O In this context, it is preferred that the nucleotide sequence Llys Thr Phe Ala Ser Lys Ile Glin Ser Glin Val Asp encoding the full-length amino acid sequence (SEQID NO: 17 O 17s 18O 3) of the luciferase protein: luciferase 2 from M. pacifica be 45 the following nucleotide sequence (SEQID NO: 4). ACC ATC AAG GGA TTA. GCT GGA. GAT CGT TGA st O Thir Ile Lys Gly Lieu Ala Gly Asp Arg * 185 ATG GGA GTC AAA CTT ATC TTT GCT GTT GTT TGT GTT 36 Met Gly Val Lys Lieu. Ile Phe Ala Val Val Cys Val so For example, the gene may be a DNA molecule having the 1. 5 following nucleotide sequence (SEQID NO: 6) as the nucle GCC GCG GCC CAG GCT, GCC ACA ATC AAT GAA AAC TTT 72 otide sequence comprising the nucleotide sequence encoding Ala Ala Ala Glin Ala Ala Thir Ile Asn. Glu Asn. Phe the full-length amino acid sequence (SEQ ID NO: 2) of the luciferase protein: luciferase 2 from M. pacifica.

GAGTCCAAAC TGAAAGGTAC TCAAAA 26

ATG GGA GTC AAA CTT ATC TTT GCT GTT GTT TGT GTT 62 Met Gly Val Lys Lieu. Ile Phe Ala Val Val Cys Val 1. 5 10

GCC GCG GCC CAG GCT, GCC ACA ATC AAT GAA. AAC TTT 98 Ala Ala Ala Glin Ala Ala Thir Ile Asn. Glu Asn. Phe 15 2O

GAA GAC ATT GAT. CTT GTA GCT ATA GGT GGC AGC TTT 134 US 7,871,803 B2 13 14

- Continued Glu Asp Ile Asp Lieu. Wall Ala Ile Gly Gly Ser Phe 25 3 O 35

GCT CTG GAT GTT GAT GCT AAC AGA GGT GGA CAT GGT 17O Ala Luell Asp Wall Asp Ala Asn Arg Gly His Gly 4 O

GGA CAT CCT GGC AAG AAG ATG GAA GTA CCT Gly His Pro Gly Met Glu Wall Lell SO 55 6 O

GTT GAA ATG GAA GCT AAT GCT GCT GGG TGC 242 Wall Glu Met Glu Ala Asn Ala Ala Gly 65 70

CAC AGA GGA CTG ATT TGT CTT TCC CAC ATC 278 His Arg Gly Lell Ile Lel Ser His Ile 7s 8O

TGC ACC AAG ATG AAG TTT ATC CCA GGA AGA 314 Cys Thir Lys Met Lys Phe Ile Pro Gly Arg 85 9 O 95

TGC CAC AGT TAT GAA GGA GAC AAG GAT TCT GCA CAG 350 His Ser Tyr Glu Gly Asp Lys Asp Ser Ala Glin 1 OO 105

GGA GGC ATT GGA GAA GAA ATT GTT GAC ATG CCT GAA 386 Gly Gly Ile Gly Glu Glu Ile Wall Asp Met Pro Glu 11 O 115 12 O

ATT CCC GGA TTC AAA GAC AAG GAA CCA ATG GAC CAA 422 Ile Pro Gly Phe Lys Asp Lys Glu Pro Met Asp Glin 125 13 O

TTC ATC GCT CAA GTT GAT CTC. TCC GTA GAT TGC ACA 458 Phe Ile Ala Glin Wall Asp Lieu. Cys Wa. Asp Thir 135 14 O

ACT GGA TGC CTC AAG GGT CTT GCC GTC CAT 494 Thir Gly Cys Luell Lys Gly Lell Ala Asn Wall His 145 15 O 155

TCT GAT CTC CTG AAG AAA TGG CTT CCT TCA AGA 53 O Ser Asp Lieu. Luell Llys Llys Trp Luell Pro Ser Arg 16 O 1.65

AAG ACA TTT GCT TCC AAA ATT CAA TCT CAA GTG GAT 566 Thir Phe Ala Ser Lys Ile Glin Ser Glin Val Asp 17 O 17s 18O

ACC ATC AAG GGA TTA GCT GGA GAT CGT TGA 596 Thir Ile Lys Gly Lell Ala Gly Asp Arg * 185

GGGATAAAAA AATGGATAAT TTGATGATGA TACTTTAGCC CAATGATGTT 646

AAAAATGGCC ATTTTCGTAT TAAACCATAA CTATGTAAAA. ATGTAATGTA 696

TGCAAATAAA AAAAACCTTA ACGGTTTAAA AAAAAAAAAA AAAAAAAAAA 746

AAAAAAA 75.3

The present invention further provides even the invention the amino acid sequence represented by any of SEQID NOs: ofuse of the genes encoding aforementioned novelluciferase 55 1, 3, 7, and 8 in order to utilize the luciferase protein as a proteins. reporter protein which is produced in a secreted luciferase That is to say, the invention of use of the genes encoding form to be secreted to the outside of the mammal cell. Par luciferase proteins from M. pacifica according to the present ticularly preferable is such the use of DNA in which said invention is mammal cell is a cell line from human that is culturable in 60 vitro. Use of DNA having a nucleotide sequence represented by any of SEQID NOS: 2, 4, 9, and 10 as a nucleotide sequence BRIEF DESCRIPTION OF THE DRAWINGS encoding a peptide chain having an amino acid sequence represented by any of SEQID NOs: 1,3,7, and 8, wherein the FIG. 1 shows a result of microscopically observing, under use of DNA is aimed at allowing a mammal cell in an in-vitro 65 ultraviolet irradiation, the outer shape of marine plankton culture system thereof to recombinantly express therein a Metridia pacifica serving as an origin of novel luciferase luciferase protein whose full-length amino acid sequence is proteins according to the present invention. US 7,871,803 B2 15 16 FIG. 2 shows the pH dependency of the luminescent activi located at the N-terminal portions of the full-length amino ties of recombinantly expressed proteins of Metridia pacifica acid sequences thereof. That is to say, the luciferase proteins luciferase 1 and Metridia pacifica luciferase 2, which are both from Metridia pacifica can be utilized as reporter proteins recombinantly expressed from the genes encoding luciferase that will be secreted to the outside of host cells by construct proteins from Metridia pacifica according to the present ing recombinant expression systems of mammal cells using invention, and shows a result of plotting, against pH values the genes encoding luciferase proteins from Metridia pacifica adjusted with a variety of buffer solutions, blue lumines of the present invention. cences (luminescence intensity measured at a wavelength of Hereinafter, the genes encoding luciferase proteins from 480 nm) emitted from a luminescent substrate coelenterazine Metridia pacifica of the present invention and novel by the actions of the recombinantly expressed luciferase pro 10 luciferase proteins encoded by the genes will be explained teins at the pHs adjusted with a variety of buffer solutions. more specifically. FIG.3 shows the necessity of a metal cation for exerting the First, Zooplankton serving as an origin of two types of luminescentactivities of recombinantly expressed proteins of novel secreted luciferase proteins according to the present Metridia pacifica luciferase 1 and Metridia pacifica invention is crustacean plankton that has been found in deep luciferase 2, which are both recombinantly expressed from 15 ocean water collected from the sea near Japan. The plankton the genes encoding luciferase proteins from Metridia pacifica is one species of White Copepoda (red copepods) having a according to the present invention, and shows a result of form microscopically observed to be white under white light comparing blue luminescences (luminescence intensity mea irradiation. On the other hand, the plankton exhibits an outer sured at a wavelength of 480 nm) emitted from a luminescent shape shown in FIG.1, when microscopically observed under substrate coelenterazine by the actions of the recombinantly ultraviolet irradiation. Furthermore, the crustacean plankton expressed luciferase proteins at pH 7.5 in the presence of was found to produce luciferase that uses coelenterazine as a alkali metal cations (K' and Na") and alkaline earth metal luminescent Substrate, particularly, to produce externally cations (Ca" and Mg"). secreted luciferase that is secreted from shell glands present FIG. 4 shows increases in the luminescent activity of in the exoskeleton (carapace) of the Surface of the plankton mature M. pacifica luciferase 1 that was secreted to a medium 25 body to the outside of the plankton body. by procedures wherein a HeLa cell, which has undergone The White Copepoda having the ability to produce the recovery treatment for cell injury after the introduction of an externally secreted luciferase was identified in terms of expression vector White luc1-10/pcDNA3.2 thereinto, was detailed taxonomy and, in conclusion, is Metridia pacifica cultured in the medium to induce recombinant expression belonging to the genus Metridia, family Metridimidae, order thereof. 30 Calanoida, Superorder Gymnoplea, infraclass Neocopepoda, FIG. 5 shows the comparison in amino acid sequence Subclass Copepoda, class Maxillopoda, Subphylum Crusta between the luciferase protein from Metridia pacifica accord cea, phylum Arthropoda, and kingdom Metazoa. ing to the present invention and luciferase from Metridia After that, prior to the cloning of genes encoding luciferase longa or from Gaussia princeps, and shows the comparison proteins from Metridia pacifica, mixed primers used in the between the Metridia pacifica luciferase 1 and the luciferase 35 from Metridia longa in the upper column and the comparison cloning process were designed. between the Metridia pacifica luciferase 2 and the luciferase Since M. pacifica was confirmed to produce externally from Gaussia princeps in the lower column. secreted luciferase, a search was conducted on known exter FIG. 6 shows the comparison between the amino acid nally secreted luciferases reported about marine plankton sequences of luciferases from Metridia longa and from Gaus 40 also belonging to Metridia. As a result, luciferase from sia princeps and the comparison between nucleotide Metridia longa (GenBankTM/EBI accession number sequences encoding the amino acid sequences, and also AY364164: J. Biol. Chem. Vol. 279, No. 5 pp. 3212-3217 shows 4 types of regions that were selected based on partial (2004)) was found. Furthermore, reported cases of luciferases amino acid sequences identical between them and coding from crustacean plankton belonging to Metridimidae were nucleotide sequences thereof and serve as a basis for mixed 45 seeked for. As a result, luciferase from Gaussia princeps primer design. belonging to the genus Gaussia (GenBankTM/EBI accession number AYO15993) and luciferase from Pleuromamma sp. BEST MODE FOR CARRYING OUT THE CSG-2001 belonging to the genus Pleuromamma (Gen INVENTION BankTM/EBI accession number AYO15993) were hit. 50 The three types of searched luciferases from the crustacean The use of genes encoding luciferase proteins from planktons belonging to Metridimidae were compared in their Metridia pacifica of the present invention enables the recom amino acid sequences. However, a highly conserved “consen binant expression of the luciferase proteins as proteins having Sus sequence' was not found among the three types of natural luminescent properties and having proper three-di luciferases. Next, the luciferase from Metridia longa and mensional structures in a variety of host cells. Moreover, the 55 each of the other two types of luciferases were compared in recombinantly expressed luciferases from Metridia pacifica their amino acid sequences. As a result, the presence of can emit blue luminescence with the maximum wavelength regions highly homologous between the luciferase from max=480 nm through the oxidation of a luminescent sub Metridia longa and the luciferase from Gaussia princeps was strate coelenterazine using molecular oxygen in the presence found. of metal cations, for example, alkali metal cations (K' and 60 This result suggests that the luciferase from Metridia longa Na") and alkaline earth metal cations (Ca" and Mg"), nec and the luciferase from Gaussia princeps may evolutionarily essary for exerting their luminescent properties. Particularly, have the same origins. There were found no confirmatory the genes encoding luciferase proteins from Metridia paci basis to ascertain whether or not the luciferase from M. paci fica, when recombinantly expressed in in-vitro cell culture fica evolutionarily has the same origin as the other two types systems using mammal cells, for example, human cells, have 65 of luciferases, but such possibility was hypothetically the advantage of being produced as secreted luciferases to the assumed without any grounds. Designing of mixed primers outside of the host mammal cells by use of signal peptides that provide for PCR products by using, as templates, at least US 7,871,803 B2 17 18 genes of the luciferases from Metridia longa and from Gaus Downstream Mixed Primers: sia princeps were attempted on the assumption.

When a search was conducted for regions having partial White luc LP2 (26 mer: mixed primer of 16 amino acid sequences identical over 8 or more amino acid degeneracy) residues in the mutual alignment between the amino acid s' - TC AAG TTG WTC AAT RAA YTG YTC CAT-3' sequences of the luciferases from Metridia longa and from Gaussia princeps, 4 partial amino acid sequences in total (W = A, T; R = G, A.; Y = C) were found, as shown in FIG. 6. With reference to nucleotide White luc LP1 (23 mer: mixed primer of 12 sequences encoding these 4 partial amino acid sequences, two degeneracy) types of upstream mixed primers and two types of down 10 5 - AC ATT GGC AAG ACC TT WAG RCA-3' stream mixed primers were designed so that cDNAS prepared (Y W R A) form mRNAs encoding the luciferases from Metridia longa and from Gaussia princeps were used as templates to obtain In the cloning process of genes encoding luciferases from one type of corresponding PCR amplification product for 15 Metridia pacifica described below, selected genes offer PCR each of them. That is to say, the nucleotide sequence of each amplification products for all primer pairs in PCR reaction mixed primer was selected so that the mixed primer was using, as templates, cDNAS prepared from mRNAS and 4 capable of hybridizing to the region serving as a basis for its types in total of PCR primer pairs combined from the two design on the cDNA nucleotide sequence but, when misfit types of upstream mixed primers and the two types of down tingly hybridizing to the other regions, did not permit for stream mixed primers. Specifically, the selected genes encod DNA strand extension from the 3' terminus of the mixed ing proteins from Metridia pacifica have nucleotide primer. sequences exceedingly highly homologous at least at 4 areas In particular, the nucleotide sequences of two types of with genes encoding the luciferases from Metridia longa and upstream mixed primers and two types of downstream mixed from Gaussia princeps. Furthermore, as a result of attempt of primers shown below were selected. 25 cloning in new clNA preparation from the mRNAs, two Upstream Mixed Primers: types of genes encoding proteins from Metridia pacifica were selected which have nucleotide sequences exceedingly highly homologous at least at 4 areas with genes encoding the White luc UP1 (26 mer: mixed primer of 16 luciferases from Metridia longa and from Gaussia princeps. degeneracy) 30 It was demonstrated that these two types of genes encode the 5 - GGC TGC ACY AGG GGA TGY CTK ATM TC-3' two types of luciferases from Metridia pacifica and that two types of proteins recombinantly expressed from the genes in animal cells are both secreted luciferases. White luc UP2 (23 mer: mixed primer of 16 degeneracy) Specifically, two types of genes described below were s' - GCT ATT GTT GAY ATY CCY GAR 35 cloned as genes encoding luciferases expressed from the genes encoding luciferases from Metridia pacifica. Nucleotide Sequence of cDNA Corresponding to mRNA of Luciferase 1 from Metridia pacifica:

GGAGACAACG GATCCAAAAG GAAAGGAGCT AAATCTACAG TCTAGAAC 48

ATG ATG GAA. ATA CAA GTT CTT TTT GCT. CTC ATT TGC 84 M M I Q W L A. L I C

TTT GCA TTG. GTG. CAG GCC AAT CCA ACT GAA AAC AAA 12 O A. W Q A. N P T E N K

GAT GAC ATT GAC ATT GTT GGT GTA GAA. GGA AAA TTT 156 D D D I W G W E G K

GGT ACA ACA GAC CTT GAG ACA GAC TTA TTC ACC ATC 192 G T D L E T D L T I

GTG GAG GAT ATG AAT GTC ATC AGT AGA. GAC ACC AAT 228 W E M N W I S R D T N

CTA GCC AAC AGT, GAT GCT GAC CGC GGT AAA ATG CCT 264 L A. S D A. D R G K M P

GGT AAA AAA CTG CCA CTG GAG GTA CTC ATA GAG ATG 3OO G K L P L E W L I E M

GAA GCC AAT GCT CCGT AAA GCT GGC TGC ACC AGG GGA 336 E A. A. R K A. G C T R G

TGT CTC ATC TGT CTT, TCA AAG ATC AAG TGT ACA GCA 372 C L C L S K I K C T A.

AAA. ATG AAG GTG TAC ATT CCA. GGA, AGA TGT CAT GAT 408 K M W Y I P G R C H D

US 7,871,803 B2 21 22

- Continued

TCT GAT CTC CTG AAG AAA TGG CTT CCT TCA AGA TGC 53 O S D L L K K W L P S R C

AAG ACA TTT GCT. TCC AAA ATT CAA TCT CAA. GTG GAT 566 K T F A S K I Q S Q V D

ACC ATC AAG GGA TTA, GCT. GGA GA CGT. IGA 596 T I K G L A. G D R k

GGGATAAAAA AATGGATAAT TTGATGATGA TACTTTAGCC CAATGATGTT 646

AAAAATGGCC ATTTTCGTAT TAAACCATAA CTATGTAAAA. ATGTAATGTA 696

TGCAAATAAA AAAAACCTTA ACGGTTTAAA AAAAAAAAAA AAAAAAAAAA 746

AAAAAAA 75.3

In the nucleotide sequences shown above, sites are under Besides, two types of recombinant expression vectors in lined which are respectively hybridized by the upstream which each of the genes (cDNAs) encoding the two types of mixed primers White luc UP1 and White luc UP2 and the luciferases, luciferase 1 and luciferase 2, from Metridia paci downstream mixed primers White luc LP2 and White luc LP1 fica according to the present invention was inserted into the utilized in primary screening. multicloning site of a plasmid vector pcDNA3.2/V5-GW/D- When the full-length amino acid sequences encoded by the TOPO have been deposited internationally (December 6, Heisei 16 (2004)) as deposition No. FERM BP-10179 for the genes are compared between the two types of luciferase pro 25 teins, i.e. luciferase 1 and luciferase 2, from Metridia pacifica recombinant expression vector pMpLuc1-10 for the according to the present invention and the luciferases from luciferase 1 and as deposition No. FERM BP-10178 for the Metridia longa and Gaussia princeps belonging to Metri recombinant expression vectorpMpLuc2-7 for the luciferase dimidae, considerably high homology was found as shown in 2 with International Patent Organism Depositary, National FIG. 5, which includes amino acid residues showing identity 30 Institute of Advanced Industrial Science and Technology or homologous between the luciferase 1 and the luciferase (AIST Tsukuba Central 6, 1-1, Higashi 1-chome, Tsukuba from Metridia longa and between the luciferase 2 and the shi, Ibaraki-ken, 305-8566, Japan) under the Budapest treaty. luciferase from Gaussia princeps. Particularly, extremely For the recombinant expression of the luciferases from M. high homology is shown between the sequence Subsequent pacifica according to the present invention as reporter pro from the 65" amino acid of Asp downward of the luciferase 1 35 teins in mammal cells, expression systems that have been and the sequence subsequent from the 74" amino acid of Asp applied to luciferases from Cypridina (Vargula) hilgendorfii downward of the luciferase from Metridia longa and between belonging to Ostracoda and from Oplophorus grachlorostris the sequence subsequent to the 40" amino acid of Asp down belonging to Decapoda are utilized, and approaches compris ward of the luciferase 2 and the sequence Subsequent from the ing replacing the coding regions thereof with that of the gene 40" amino acid of Asp downward of the luciferase from 40 in questions are available. Alternatively, the luciferases from Gaussia princeps. Hence. It is deduced from this result that M. pacifica can also be expressed recombinantly in hosts the two types of luciferases from Metridia pacifica according other than the mammal cells that allow for the recombinant to the present invention have an origin of the same species as expression of conventionalluciferase, such as bacteria, yeast, the luciferases from Metridia longa and from Gaussia prin fungi, and insect cells. It is preferred that the genes encoding ceps, and however, two lines of luciferases having partial 45 difference in amino acid sequence, which are divided with luciferases from M. pacifica, when used in these recombinant evolution, are coexistently expressed in Metridia pacifica. In expressions, be subjected to codon-conversion to a codon addition, high homology is shown between the sequence on with high usage in hosts as appropriate and then inserted into the N-terminal side from the 22" amino acid of Glu of the an expression vector. Of course, any mutations are not intro luciferase 1 and the sequence on the N-terminal side from the 50 duced in amino acid sequences themselves encoded by the 21 amino acid of Glu of the luciferase from Metridia longa genes resulting from the codon-conversion. For the insertion and between the sequence on the N-terminal side from the to an expression vector, the coding genes that have undergone 23" amino acid of Asn of the luciferase 2 and the sequence on codon-conversion in advance are digested in their both termi the N-terminal side from the 23" amino acid of Asn of the nal uncoding regions with restriction enzymes to obtain frag luciferase from Gaussia princeps. These sequences on the 55 ments thereof. When there exist no restriction enzyme sites N-terminal side are regions containing signal peptides used appropriate for this restriction enzyme digestion, a mutation for secretion. A predicted cleavage site for signal peptidase is can be introduced in the nucleotide sequence in the uncoding VQA-KS in the luciferase from Metridia longa, while a site region by site-specific mutagenesis to thereby introduce the corresponding thereto is VOA-NP in the luciferase 1. This desired restriction enzyme site therein. site may correspond to AEA-KP in the luciferase from Gaus 60 sia princeps and AQA-AT in the luciferase 1. Taking the Examples homology into consideration, the two types of luciferases from Metridia pacifica according to the present invention, Hereinafter, the present invention will be explained spe when recombinantly expressed in mammal cells, are also cifically with reference to Examples. Although the specific secreted to the outside of the host cells with high efficiency by 65 examples shown here are one example of the best modes of use of the N-terminal signal peptides rich in hydrophobic the present invention, the scope of the present invention is not amino acids. limited to these specific examples. US 7,871,803 B2 23 24 (Picking-Out of Novel Luciferase from Crustacean Plank that provide for PCR products by using, as templates, at least ton) genes of the luciferases from Metridia longa and from Gaus The present inventors searched crustacean plankton pro sia princeps were attempted on the assumption. ducing luciferases that use coelenterazine as their lumines When a search was conducted for regions having partial cent Substrates, among many species of Zooplankton col amino acid sequences identical over 8 or more amino acid lected from the sea near Japan. The present inventors residues in the mutual alignment between the amino acid particularly searched crustacean plankton producing exter sequences of the luciferases from Metridia longa and from nally secreted luciferase that is secreted from shell glands Gaussia princeps, 4 partial amino acid sequences in total present in the exoskeleton (carapace) of the Surface of the 10 were found, as shown in FIG. 6. With reference to nucleotide plankton body to the outside of the plankton body. sequences encoding these 4 partialamino acid sequences, two In the search process, the present inventors conducted the types of upstream mixed primers and two types of down detailed examination of many species of Zooplankton present stream mixed primers were designed so that cDNAS prepared in deep ocean water collected from a depth of 321 m (321 m form mRNAs encoding the luciferases from Metridia longa below the sea surface, approximately 5 m above the sea 15 and from Gaussia princeps were used as templates to obtain bottom), approximately 2,600 m off the coast of Toyama Bay, one type of corresponding PCR amplification product for the Sea of Japan, and consequently found that one species of each of them. Specifically, the nucleotide sequence of each Copepoda microscopically observed to be white under white mixed primer was selected so that the mixed primer was light irradiation exhibits an outer shape shown in FIG. 1, capable of hybridizing to the region serving as a basis for its when microscopically observed under ultraviolet irradiation, design on the cDNA nucleotide sequence but, when misfit and produces externally secreted luciferase that is secreted tingly hybridizing to the other regions, did not permit for from its shell glands to the outside of the body. The Copepoda DNA strand extension from the 3' terminus of the mixed having the ability to produce the externally secreted primer. luciferase was identified in terms of detailed taxonomy and, 25 in conclusion, is Metridia pacifica belonging to the genus Specifically, the nucleotide sequences of two types of Metridia, family Metridimidae, order Calanoida, superorder upstream mixed primers and two types of downstream mixed Gymnoplea, infraclass Neocopepoda, Subclass Copepoda, primers shown below were selected. class Maxillopoda, Subphylum Crustacea, phylum Arthro Upstream Mixed Primers: poda, and kingdom Metazoa. 30 (Mixed Primer Design for Cloning of Gene Encoding White luc UP1 (26 mer: mixed primer of 16 Luciferase Protein from Metridia pacifica) degeneracy) Prior to the cloning of genes encoding luciferase proteins 5 - GGC TGC ACY AGG GGA TGY CTK ATM TC-3' from Metridia pacifica, mixed primers used in the cloning process were designed. 35 Since M. pacifica was confirmed to produce externally secreted luciferase, a search was conducted on known exter White luc UP2 (23 mer: mixed primer of 16 nally secreted luciferases reported about marine plankton degeneracy) s' - GCT ATT GTT GAY ATY CCY GAR AT-3' also belonging to Metridia. As a result, luciferase from 40 Metridia longa (GenBankTM/EBI accession number (Y = T, C; R = G, A) AY364164: J. Biol. Chem. Vol. 279, No. 5 pp. 3212-3217 (2004)) was found. Furthermore, reported cases of luciferases Downstream Mixed Primers: from crustacean plankton belonging to Metridimidae were seeked for. As a result, luciferase from Gaussia princeps 45 White luc LP2 (26 mer: mixed primer of 16 belonging to the genus Gaussia (GenBankTM/EBI accession degeneracy) number AYO15993) and luciferase from Pleuromamma sp. s' - TC AAG TTG WTC AAT RAA YTG YTC CAT-3' CSG-2001 belonging to the genus Pleuromamma (Gen (W = A, T; R = G, A, Y = T, C) BankTM/EBI accession number AYO15993) were hit. 50 The three types of searched luciferases from the crustacean White luc LP1 (23 mer: mixed primer of 12 planktons belonging to Metridimidae were compared in their degeneracy) amino acid sequences. However, a highly conserved “consen 5 - AC ATT GGC AAG ACC TT WAG RCA-3' Sus sequence' was not found among the three types of (Y = T, C; W = A, G, C; R = G, A) luciferases. Next, the luciferase from Metridia longa and 55 each of the other two types of luciferases were compared in In the cloning process of genes encoding luciferases from their amino acid sequences. As a result, the presence of Metridia pacifica described below, selected genes offer PCR regions highly homologous between the luciferase from amplification products for all primer pairs in PCR reaction Metridia longa and the luciferase from Gaussia princeps was using, as templates, cDNAS prepared from mRNAS and 4 found. 60 This result suggests that the luciferase from Metridia longa types in total of PCR primer pairs combined from the two and the luciferase from Gaussia princeps may evolutionarily types of upstream mixed primers and the two types of down have the same origins. There was found no confirmatory stream mixed primers. Specifically, the selected genes encod evidence to ascertain whether or not the luciferase from M. ing proteins from Metridia pacifica have nucleotide pacifica evolutionarily has the same origin as the other two 65 sequences extremely highly homologous at least at 4 areas types of luciferases, but such possibility was hypothetically with genes encoding the luciferases from Metridia longa and assumed without any grounds. Designing of mixed primers from Gaussia princeps. US 7,871,803 B2 25 26 (Cloning of Gene Encoding Luciferase from Metridia gotex-dT30 mRNA Purification Kit (produced by pacifica) TAKARA) from 205 uL of the thus-prepared purified total Collection of Total RNA RNA solution (RNA concentration: 0.872 ug/uL). Four hundred individuals of Copepoda (M. pacifica) col To 200 u, of the total RNA solution, 200 uL of hybridiza lected from the sampled ocean water were dewatered, then suspended in 4 mL in total of TRIZOL reagent, and frozen to tion buffer 2x Binding buffer included in the kit was added, storage at -80°C. and then total 400 uL of solution was homogenized. This The Copepoda individuals preserved by refrigeration were RNA solution was well mixed after the addition of 20 uL of thawed at room temperature. This Suspension was transferred Oligotex-dT30 dispersion. The solution in the tube was to a 15-mL Teflon homogenizer container and loaded to a 10 heated up to 70° C. and kept for 3 minutes. Subsequently, the homogenizer 10 times to thereby homogenize the outer shells solution was allowed to cool down at room temperature for 10 and the cells within the bodies. Subsequently, the cell homo minutes to perform the hybridization of the poly(A) terminal genates were made uniform by 10 treatments using a 5-mL of the poly(A)--RNA (mRNA) with the oligo-dT probe por Syringe and a 22 G needle, in which they were sent under tion of the Oligotex-dT30. The Oligotex-dT30 was separated pressure and thereby passed through the needle. 15 as a precipitated fraction by centrifugation (15,000 rpm) for 5 The obtained uniform homogenates were transferred to a minutes. The Supernatant was removed which contained 15-mL Falcon tube and were well shaken for 15 seconds after RNA components unhybridized with the Oligotex-dT30. the addition of 0.8 mL of chloroform per 4 mL of TRIZOL The precipitated fraction was dispersed into 350 uL of reagent. Then, the Solution was left standing at room tempera washing buffer included in the kit and transferred to a tube for ture for 2 to 3 minutes to perform phase separation. The a centrifugation column. The Solution was centrifuged (15. solution was further centrifuged (12,000xg) at 2 to 8° C. for 000 rpm) for 30 seconds, and the supernatant was removed. 15 minutes. Approximately 4 mL of the Supernatant (aqueous The same washing procedure was further performed by use of phase) was collected into another 15-mL Falcon tube. The collected aqueous phase was well mixed after the the same amount of washing buffer. addition of 2 mL ofisopropanol per 4 mL of TRIZOL reagent. 25 After twice washings, the precipitated fraction was supple The solution was kept at room temperature for 10 minutes to mented with 50 uL of DEPC-water (aqueous solution) perform alcohol precipitation. Then, the Solution was centri included in the kit, which was heated in advance to 70° C. fuged (12,000xg) at 2 to 8°C. for 10 minutes. The supernatant This mixture was transferred to another tube for a centrifu was removed, and the pellet (alcohol-precipitated fraction) gation column. Following centrifugation (15,000 rpm) for 30 was collected. 30 seconds, the Supernatant was collected which contained poly After the addition of 4 mL of 75% ethanol per 4 mL of (A)+RNA (mRNA) released from the Oligotex-dT30 probe. TRIZOL reagent to the pellet (alcohol-precipitated fraction), The precipitated fraction was supplemented again with 50 uL the mixture was subjected to vortex so to be well-dispersed of DEPC-water (aqueous solution) heated in advance to 70° and mixed. The dispersed mixture solution was centrifuged C. The releasing procedure from the probe was performed, (11,000 rpm) at 2 to 8°C. for 10 minutes. The supernatant was 35 and the Supernatant was collected. The collected Supernatants removed, and the pellet (alcohol-precipitated fraction) was were pooled to prepare 100LL in total of a solution containing collected. This washing was repeated twice. purified mRNA. Following the washings, the pellet of precipitated RNA To this solution containing purified mRNA, 10 uL of 3 M was left at 37° C. for 10 minutes and thereby dried by the sodium acetate aqueous solution and 100 uL of 100% isopro evaporation of the residual solvent. The dried pellet of pre 40 panol was added, and then the mixture was well mixed. Then, cipitated RNA was left standing for 10 to 20 minutes after the the mixture was left at -20° C. for 10 minutes to alcohol addition of 210 uL of RNase-free water and thereby redis precipitate the contained mRNA. The precipitated mRNA solved to prepare a total RNA sample solution. was collected into a precipitated fraction by centrifugation An aliquot (5ull) of the lysate was sampled from 210 uL of (14,000 rpm) for 30 minutes, and the supernatant was the prepared total RNA sample solution, and absorbances at 45 removed. To the precipitated fraction containing the sepa wavelengths of 260 nm, 280 nm, and 320 nm: ODo, ODso rated mRNA, 1 mL of 75% ethanol was again added, and then and OD (background absorption) were measured for the the mixture was well mixed. The precipitated fraction con sample. Based on the results, an RNA concentration con taining the deposited mRNA was separated by centrifugation tained therein was calculated from the absorbance ODo (14,000 rpm) for 5 minutes, and the supernatant was removed. according to a standard method. 50 The obtained purified mRNA deposit was redissolved in 11 Table 1 shows the evaluation results of the RNA concen uL of DEPC-water (aqueous solution). tration contained in the obtained total RNA samples. An aliquot (0.5 LL) of an evaluation sample was collected Table 1 from 11 uL of the purified mRNA sample solution and evalu

TABLE 1.

RNA RNA Gross RNA concentration concentration volume amount ODo/ SAMPLE OD26o OD2 so ODo Ig|LL ng LL |LL Lig OD280 M. pacifica O.872 872 210 183.12

ated for an RNA concentration contained therein. Table 2 Purification of Poly(a)+RNA (mRNA) 65 Poly(A)--RNA (mRNA) contained was separated and puri shows the evaluation results of the RNA concentration con fied by use of a commercially available purification kit Oli tained in the obtained purified mRNA sample. US 7,871,803 B2 28 Table 2

TABLE 2

RNA Gross RNA Dilution concentration volume amount OD26o SAMPLE OD26o OD2 so ODo ratio Ig|L |LL Lig OD2so M. pacifica x2OO 0.525 11 5.76

cDNA Synthesis with Use of mRNA as Template (RNA/5'-Ready Primer mix) or 3CDS primer-supplemented A commercially available cDNA synthesis kit was used to mRNA solution (RNA/3'-Ready Primer mix) prepared in synthesize cDNA through reverse transcriptase reaction advance, respectively. using the purified mRNA as a template. 15 First, a 5'CDS primer-supplemented mRNA solution Table 4 (RNA/5'-Ready Primer mix) containing the purified mRNA sample solution, a 5'CDS (cDNA synthesis) primer and TABLE 4 SMART II oligo included in the kit as well as a 3'CDS primer-supplemented mRNA solution (RNA/3'-Ready Composition of reverse transcription reaction Solution Primer mix) containing the purified mRNA sample solution Concentration Formulated and a 3'CDS (cDNA synthesis) primer included in the kit was ofundiluted amount Final prepared in advance according to composition shown in Table Component Solution |LL concentration 3 below. RNA primer mix 5.5 25 5x RT Buffer 5x 2.O 1x Table 3 DTT 100 mM O.S 5 mM RNase inhibitor 40 UL O.S 2 UIL dNTP mix 10 mM O.S O.5 mM TABLE 3 Super Script III 1.O Concentration Formulated ofundiluted amount Final 30 Total 1O.O Component Solution |L concentration Content Composition of RNA 5'-Ready Primer mix In the cDNA syntheses, a reverse transcriptase SuperScript mRNA solution 0.525 g/L 1.91 0.050 g/LL 100 ng III included in the kit was utilized. This reaction solution was SMART II 10 M O.S 0.5 M 35 subjected to incubation at 50° C. for 1 hour and subsequent oligo 5'CDS primer 10 M O.S 0.5 M 5 ng incubation at 70° C. for 15 minutes to thereby perform DNA DEPC-water 2.6 strand extension reaction from the primers hybridized with the template mRNA strands. After the completion of reaction, Total 5.5 Composition of RNA/3'-Ready Primer mix the reaction Solution containing the synthesized cDNA was 40 stored at -20°C. mRNA solution 0.525 g/L 1.91 0.050 g/LL 100 ng 3'CDS primer 500 ng/L O.S 25.0 ng LL 250 ng Acquisition of cDNA Fragment Through RT-PCR Reac DEPC-water 3.1 tion

Total 5.5 Four sets of primer pairs shown in Table 5 below were used 45 to prepare PCR amplification products from the 3' Ready cDNA prepared with the mRNA from M. pacifica as a tem The components were mixed and kept at 65° C. for 5 plate. minutes. Then, the obtained mixture solution was cooled on ice for 1 minute. All the mRNAs contained in the mixture Table 5 Solution were converted by the heating to single-stranded 50 RNA molecules. TABLE 5 The nucleotide sequence of the 3'CDS primer (3'-Ready Primer) is Primer pair used for RT-PCR reaction Predicted 55 ranking of 3'-Ready Primer (57 mer) Primer pair Upstream primer Downstream primer product size s' - AAGCAGTGGT AACAACGCAG. AGTACTTTTT TTTTTTTTTT Set1 UP1-LP1 White Luc UP1 White Luc LP1 1 TTTTTTTTTT TTTTTVN-3 (16 degeneracy) (12 degeneracy) Set2UP1-LP2 White Luc UP1 White Luc LP2 2 60 (16 degeneracy) (16 degeneracy) (wherein V means A, G, C; and N means A, C, G, T in said Set UP2-LP1 White Luc UP2 White Luc LP1 3 sequence), and it hybridizes at the dT30 portion to the poly (16 degeneracy) (12 degeneracy) SetAUP2-LP2 White Luc UP2 White Luc LP2 4 (A) terminal of the mRNA. (16 degeneracy) (16 degeneracy) 5' Ready clNA synthesis and 3' Ready cDNA synthesis were performed by preparing a reverse transcription reaction 65 Solution according to composition shown in Table 4 below by Table 6 shows the composition of the reaction solution and use of the 5'CDS primer-supplemented mRNA solution the conditions used for PCR amplification reaction. US 7,871,803 B2 30 Table 6 Table 8 TABLE 8 TABLE 6 Upstream primer Temperature conditions of PCR reaction: 5 Primer pair (GS primer) Downstream primer Apparatus used: Mastercycler Gradient (eppendorf) Primer pair used for 3' RACE reaction Operation Cycle Temperature C. Time Template cDNA: 3' Ready cDNA Set1 UP1-3' Ready White Luc UP1 3' Ready primer denature 96 1 min. (16 degeneracy) anneal 55 10 sec. 10 Set2 UP2-3' Ready White Luc UP2 3' Ready primer extention 68 30 sec. 35 times (16 degeneracy) denature 96 5 sec. Primer pair for 5' RACE reaction extention 68 30 sec. Template cDNA: 5’ Ready cDNA Store 10 Overnight (14 hours) Set 3 LP1-5' Ready White Luc LP1 5' Ready primer 15 (12 degeneracy) Composition of PCR reaction solution Set4 LP2-5' Ready White Luc LP2 5' Ready primer DNA polymerase: Advantage 2 (16 degeneracy)

Concentration Formulated ofundiluted amount Final Table 9 shows the composition of the reaction solution and Composition Solution |L concentration 2O the conditions used for PCR amplification reaction. HO 9.6 Table 9 10 x Advan 2 Buffer 10x 2.0 1x TABLE 9 dNTP 2 mM 2.0 O.2 mM Temperature conditions used for PCR reaction: Advan 2 Pol 50 U/L 0.4 1 UIL Apparatus used: Mastercycler Gradient (eppendorf) Upstream Primer 10 M 2.0 1 M 25 Downstream Primer 10 M 2.0 1 M Operation cycle Temperature C. Time cDNA 10 dil 2.0 1 dil denature 96 1 min. Total 2O.O anneal 55 10 sec. extention 68 40 sec. 30 times 30 denature 96 5 sec. extention 68 40 min. After PCR reaction performed at each reaction solution Store 1O Overnight amount of 20LL, 5uLaliquots of the reaction Solutions were (14 hours) sampled and electrophoresed on 1% agarose gel to confirm Composition of PCR reaction solution the presence or absence of PCR amplification products and 35 DNA polymerase: Advantage 2 their molecular weights. Table 7 shows the confirmed base Concentration Formulated number of the PCR amplification product obtained when each ofundiluted amount Final primer pair was used. Composition Solution |LL concentration Table 7 40 HO 9.6 10x Advan 2 Buffer 10x 2.O 1x dNTP 2 mM 2.O O.2 mM TABLE 7 Advan 2 Pol 50 U/L 0.4 1 UIL GS Primer 10 M 2.O 1 M Primer pair used for RT-PCR reaction and Upstream Primer 10 M 2.O 1 M PCR amplification product obtained therewith 45 cDNA 10 dil 2.O 1 dil

Amplified Total 2O.O Primer pair Upstream primer Downstream primer product Set 1 UP1-LP1 White Luc UP1 White Luc LP1 258 bp (16 degeneracy) (12 degeneracy) After PCR reaction performed at each reaction solution Set2UP1-LP2 White Luc UP1 White Luc LP2 159 bp 50 amount of 20LL, 5uLaliquots of the reaction Solutions were (16 degeneracy) (16 degeneracy) sampled and electrophoresed on 1% agarose gel to confirm Set UP2-LP1 White Luc UP2 White Luc LP1 123 bp the presence or absence of PCR amplification products and (16 degeneracy) (12 degeneracy) Seta. UP2-LP2 White Luc UP2 White Luc LP2 75 bp their molecular weights. Table 10 shows the confirmed base (16 degeneracy) (16 degeneracy) number of the PCR amplification product obtained when each 55 primer pair was used. Table 10 Based on these results, it was confirmed that the mRNAs from M. pacifica include mRNA having a partial nucleotide TABLE 10 sequence encoding a partial amino acid sequence similar to Primer pair for PCR reaction and those of the luciferases from M. longa and from G. princeps. 60 3 RACE and 5' RACE reaction products obtained Acquisition of 3' RACE and 5' RACE Reaction Products therewith The 3' Ready cDNA and 5' Ready cDNA prepared based on Downstream Amplified the mRNA from M. pacifica were used as templates to respec Primer pair Upstream primer primer product tively prepare 3' RACE and 5' RACE reaction products by use 6s Set1 UP1-3' Ready White Luc UP1 mix 3' Ready primer 360 bp of two sets of primer pairs shown in Table 8 below for each of Set2 UP2-3' Ready White Luc UP2 mix 3' Ready primer 230 bp them. US 7,871,803 B2 31 32 After PCR reaction performed at each reaction solution TABLE 10-continued amount of 20LL, 5uLaliquots of the reaction Solutions were collected and electrophoresed on 1% agarose gel to confirm Primer pair for PCR reaction and 3 RACE and 5' RACE reaction products obtained the presence or absence of PCR amplification products and therewith their molecular weights. The Nested PCR product prepared with use of the 3' RACE Downstream Amplified reaction product as a template was temporarily inserted into a Primer pair Upstream primer primer product cloning vector pCR2.1 TOPO, which was then introduced Set 3 LP1-5' Ready White Luc LP1 mix 5' Ready primer 582 bp into Chemical competent cell TOP10 strains, and then trans Set4 LP2-5' Ready White Luc LP2 mix 5' Ready primer 560 bp 10 formed strains were selected therefrom. The plasmid vector introduction into the host E. coli was performed by proce Acquisition of Nested PCR Product Using 3' RACE and dures described below. 5'-RACE Reaction Products as Templates Cryopreserved Competent cells of TOP10 strains used as The 3' RACE and 5' RACE reaction products were used as host E. coli are thawed at an ice temperature. 3 ul of a templates to respectively prepare Nested PCR products by 15 solution of the plasmid vector with the cDNA insert is added use of each primer pair shown in Table 11 below. to a 50 uL aliquot of the suspension of the thawed host E. coli Competent cells. Subsequently, the mixture is kept on ice for Table 11 10 minutes, then heated at 42°C. for 30 seconds, and returned onto ice again. After the vector injection treatment, 100LL of TABLE 11 SOC medium is added to 53 uL of the host E. coli suspension Upstream primer to be cultured by shaking at 37°C. for 10 minutes. Primer pair (GS primer) Downstream primer Then, transformed strains contained in the culture Solution are selected with use of the selection marker from the cloning Primer pair used for Nested PCR reaction for 3' RACE reaction product vector pCR2.1 TOPO. From among the selected transformed Template cDNA: 3' RACE reaction product (product 25 strains, those carrying the plasmid vector with the cDNA obtained with use of primer pair Set1 UP1-3' Ready) insert are chosen. Set1 UP2-3' Ready White Luc UP2 3' Ready primer Replication and Purification of Plasmid Vector Introduced (16 degeneracy) in Screened Clone Primer pair used for Nested PCR reaction for 5 RACE The introduced plasmid vectors are replicated and purified reaction product 30 Template cDNA: 5’ RACE reaction product (product from 4 screened clones by procedures described below. obtained with use of primer pair Set3 UP1-5' Ready) Each of the four colonies (clones), which were screened from the cDNA-introduced strains using the host E. coli Set4 LP2-5' Ready White Luc LP2 5' Ready primer TOP10 strains, was suspended in 10 mL of LB/Carbenicillin (16 degeneracy) medium to be cultured at 37° C. for 16 hours, respectively. 35 The culture solutions were each centrifuged (5000xg) for 10 Table 12 shows the composition of the reaction solution minutes to fractionate cells therefrom. and the conditions of PCR amplification reaction. The plasmids are separated and purified from the collected Table 12 cells by use of a commercially available plasmid purification 40 kit QIAGEN plasmid purification kit (produced by QIAGEN). Specifically, 0.25 mL of P1 solution included in TABLE 12 the purification kit is added to the collected cells, and then the Temperature conditions of PCR reaction: mixture is subjected to vortex to be well dispersed. To this cell Apparatus used: Mastercycler Gradient (eppendorf) dispersion, 0.25 mL of P2 solution included in the kit is 45 added, and mixed together. The mixture is left standing at Operation cycle Temperature C. Time room temperature (20°C.) for 5 minutes. Subsequently, to the denature 96 1 min. mixture, 0.35 mL of N3 solution included in the kit is added, anneal 60 10 sec. and mixed up. Following lysis treatment, centrifugation (11. extention 68 30 sec. 20 times denature 96 5 sec. 000 rpm) at 4°C. for 15 minutes is carried out to separate and extention 68 30 min. 50 collect a soluble fraction containing the plasmid DNA (super Store 10 Overnight natant). (14 hours) The soluble fraction containing the plasmid DNA (super Composition of PCR reaction solution natant) is applied to a QIAprep column included in the puri DNA polymerase: Advantage 2 fication kit. The column is subjected to centrifugation (15,000 55 rpm) at 4° C. to remove the liquid layer therefrom. The Concentration Formulated ofundiluted amount Final column is washed by the addition of 0.5 mL of buffer PB and Composition Solution |L concentration subsequently washed by the addition of 0.75 mL of buffer PE. Finally, the washing solution is removed therefrom by cen HO 1O.O trifugation (15,000 rpm) at 4°C. for 1 minute. The plasmids 10x Advan 2 Buffer 10x 2.0 1x dNTP 2 mM 2.0 O.2 mM 60 adsorbed onto the QIAprep of the purification kit are eluted Advan 2 Pol 50 U/L 0.4 1 UIL with 30 ul of buffer EB, and then collected therein. Of 30 ul GS Primer 10 M 1.6 0.8 M of this solution containing the purified plasmids, a 1 uL ali Upstream Primer 10 M 2.0 1 M quot is sampled and added with 99 uL of distilled water to cDNA 10 dil 2.0 1 dil prepare a solution diluted 100-fold thereof. Total 2O.O 65 Table 13 shows results of evaluation of each clone for a DNA concentration contained in the Solution containing the purified plasmid. US 7,871,803 B2

Table 13

TABLE 13

DNA Gross DNA Dilution concentration volume amount OD26o SAMPLE OD26o OD2 so ODo rate Ig|L |LL 19. OD2so No. 1 O.O63 O.O36 <0.001 x100 O.340 29 9.86 1.89 No. 3 O.OSO O.O2S <0.001 x100 O.2SO 29 7.25 2.OO No. 4 O.O75 O.O39 <0.001 x100 0.375 29 10.88 1.92 No. 6 O.047 O.O23 <0.001 x100 O.240 29 6.96 2.OO

Nucleotide Sequence Analysis of cDNA Fragment (Nested 95% ethanol are to be mixed with 5uL of the sample solution. PCR Product) Contained in Screened Clone 15 The sample solution collected in advance is added into this From the cDNA portions (Nested PCR products) inserted 1.5-mL tube. The solution is uniformly mixed and then left in the plasmid vectors that are carried by the 4 clones, prod standing under ice cooling for 10 minutes to ethanol-precipi ucts of nucleic acid strand extension reaction are prepared for tate (deposit) the DNA fragments contained therein. The nucleotide sequence analysis thereof according to procedures deposited DNA fragments are sedimented by centrifugation (14,000 rpm) for 20 minutes, and the supernatant is removed described below. therefrom. Subsequently, the deposited DNA fragments are The Solutions containing the plasmid vectors collected and rinsed by the addition of 125 u of 70% ethanol. The depos purified from the screened clones are subjected to concentra ited DNA fragments are sedimented again by centrifugation tion adjustment so as to set their DNA concentrations at 250 (14,000 rpm) for 5 minutes, and the supernatant is removed ng/uL. Subsequently, the purified plasmid vector is used as a by aspiration. The remaining pellets of deposited DNA frag template to prepare a sample for nucleotide sequence analysis 25 ments are dried up. with use of two types of primers: M13 sense M4 and M13 RV. The purified DNA fragments of sample for analysis are which are corresponding to the site from the cloning vector redispersed in Template suppressor Reagent (TSR). The solu pCR2.1 TOPO, as sequencing primers by means of a com tion is well mixed by vortex and then is subjected to centrifu mercially available sequencing DNA sample preparation kit gation to collect a solution therefrom. The solution is heated BigDye Terminator Cycle Sequencing Ready Reaction Kit 30 up at 95°C. for 2 minutes to split the DNA fragments to with AmpliTaq polymerase. Table 14 shows the temperature single-stranded DNA, and cooled on ice. The solution is conditions used for the DNA strand extension reaction and Subjected to Vortex once again, and then is centrifugated again the composition of the reaction solution thereof. to collect the solution containing the extended single stranded DNA therefrom. Then, the DNA fragments of Table 14 35 sample for analysis (extended single-stranded DNA) is loaded to a commercially available sequencing apparatus ABI TABLE 1.4 PRISM 3100 Genetic Analyzer to analyze the nucleotide Composition of reaction solution sequence thereof. The nucleotide sequence of the inserted cDNA fragment Concentration Ratio of 40 ofundiluted formulated (Nested PCR product) is determined by combining the results Component Solution amount LL of sequencing from the 5' terminus and the results of sequenc ing from the 3' terminus with each another. Terminator Reaction Mix 1.O Two types of downstream primers: White luc LP3 and Template DNA 250 ng LL 2.0 White luc LP4 having nucleotide sequences described below primer 1 M O.8 45 DDW 1.2 were designed based on the analyzed nucleotide sequence of said Nested PCR product that were prepared with the 3' Total S.O RACE reaction product as a template: Temperature conditions of DNA strand extension reaction: Apparatus used: Mastercycler Gradient 50 White luc LP3: (30 mer) s' - AACGATCTCCAGCCAAGCCCTTGATGTTGT-3' Operation for temperature White luc LP4: (30 mer) cycle Temperature C. Time 5-TCAGCGCAAAGATCAACTTGAGCAATGAAC-3' denature 96 1 min. 55 Reacquisition of 5' RACE Reaction Product denature 96 10 sec. 25 times 3' Ready cDNA and 5' Ready cINA are prepared again anneal 50 5 sec. Ramp. Rate 1° C.'s based on the mRNA from M. pacifica. Then, 5 RACE reac extention 60 4 min. Ramp. Rate 1° C.'s tion products are newly prepared by using the 5' Ready cloNA Store 4 Overnight (14 hours) as a template with use of the two types of downstream prim 60 ers: White luc LP3 and White luc LP4. First, according to the procedures described in the para The prepared samples for nucleotide sequence analysis are graphs “Collection of total RNA and “Purification of poly purified by procedures described below. (A)+RNA (mRNA), total RNAs are separately collected The prepared sample solution is transferred from each from 900 individuals of M. Pacifica, and purified mRNA reaction tube to another 0.5-mL tube. An additional solution 65 samples are prepared therefrom. Table 15 shows results of is prepared in advance in a 1.5-mL tube, in such a ratio that 0.5 quantifying RNA amounts contained in the collected total LL of 3 M Sodium acetate aqueous solution and 12.5 LL of RNAs and in the purified mRNA samples. US 7,871,803 B2

Table 15 Table 17

TABLE 1.5 Total RNA sample

RNA RNA Gross RNA concentration concentration volume amount OD26o SAMPLE ODo ODso ODo |g|LL ng LL |IL 19. OD280 White O.266 O158 O.OO1 1.060 1060 399 422.94 1.69 Copepoda Purified mRNA sample

RNA Gross RNA Dilution concentration volume amount ODoy SAMPLE OD26o OD2so OD320 rate |g|L |L Lig OD280 White x2OO O.728 1O.S 7.64 Copepoda

2O Subsequently, according to the procedures described in the paragraph “cDNA synthesis with use of mRNA as template'. TABLE 17 cDNAs are synthesized from the purified mRNA samples Composition of reverse transcription reaction solution through reverse transcriptase reaction using the contained 25 purified mRNAs as templates. Concentration Formulated A 5'CDS primer-supplemented mRNA solution (RNA/5'- ofundiluted amount Final Ready Primer mix) as well as a 3CDS primer-supplemented Component solution |L concentration mRNA solution (RNA/3'-Ready Primer mix) is prepared in advance according to composition shown in Table 16 below. 30 RNA primer mix 5.5 5x RT Buffer 5x 2.0 1x Table 16 DTT 100 mM 0.5 5 nM RNase inhibitor 40 UL O.S 2 UIL TABLE 16 dNTP mix 10 mM O.S O.5 mM 35 Super Script III 1.O Concentration ofundiluted Formulated Final Total 1O.O Component Solution amount LL concentration Content Composition of RNA 5'-Ready Primer mix 40 In the cDNA syntheses, this reaction solution is subjected mRNA solution 0.728 g/L 1.37 0.050 g/LL 100 ng to treatment involving incubation at 50° C. for 1 hour and SMART II 10 M O.S 0.5 M oligo subsequent incubation at 70° C. for 15 minutes, and thereby 5'CDS primer 10 M O.S 0.5 M 5 ng DNA strand extension reaction from the primers hybridized DEPC-water 3.1 with the template mRNA strands is carried out by using a 45 Total 5.5 reverse transcriptase SuperScript III included in the kit. After Composition of RNA/3'-Ready Primer mix the completion of reaction, the reaction solution containing the synthesized cDNA is stored at -20°C. mRNA solution 0.728 g/L 1.37 0.050 g/LL 100 ng 3'CDS primer 500 ng/L O.S 25.0 ng LL 250 ng The 5' Ready cDNAs newly prepared based on the mRNAs DEPC-water 3.6 50 from M. pacifica are used as templates to respectively prepare 5' RACE reaction products with use of two sets of primers Total 5.5 shown in Table 18 below. Table 18 The components are mixed and kept at 65° C. for 5 min 55 utes. Then, the obtained mixture solution is cooled on ice for TABLE 1.8 1 minute. All the mRNAs contained in the mixture solution Primer pair for 5' RACE reaction are converted by the heating to single-stranded RNA mol Template cDNA: 5’ Ready cDNA ecules. The synthesis of 5' Ready cDNA and the synthesis 3' Ready 60 Downstream primer cDNA are performed by preparing a reverse transcription Primer pair Upstream primer (GS primer) reaction Solution according to composition shown in Table 17 Set1 LP4-5' Ready White Luc LP4 5' Ready primer below with use of the 5'CDS primer-supplemented mRNA Set2 LP3-5' Ready White Luc LP3 5' Ready primer solution (RNA/5'-Ready Primer mix) or 3CDS primer 65 supplemented mRNA solution (RNA/3'-Ready Primer mix) Table 19 shows the composition of the reaction solution prepared in advance. and the conditions of PCR amplification reaction. US 7,871,803 B2 37 38 Table 19 ing each colony is confirmed by means of the colony PCR method according to procedures described below. TABLE 19 In the colony PCR. PCR amplification is performed by Temperature conditions of PCR reaction: using the vector DNA contained in the clone as a template, Apparatus used: Mastercycler Gradient (eppendorf) with use of White luc UP1 (mixed primer) and White luc LP2 Operation Cycle Temperature C. Time (mixed primer) as a forward primer and as a reverse primer, by means of commercially available DNA synthetase KOD denature 96 1 min. anneal 60 10 sec. Dash DNA polymerase. In this case, selected are such clones extention 68 50 sec. 50 times 10 that provide a 159-bp DNA fragment as the PCR product denature 96 5 sec. obtained with the primer pair; White luc UP1 and White luc extention 68 50 sec. Store 10 Overnight LP2, as described above. Table 21 shows the temperature (14 hours) conditions of the PCR reaction used and the composition of the reaction solution thereof. Composition of PCR reaction solution 15 DNA polymerase: Pyrobest DNA polymerase Table 21 Concentration ofundiluted Formulated Final TABLE 21 Composition Solution amount LL concentration Temperature conditions of PCR reaction: HO 13.75 Apparatus used: Mastercycler (eppendorf) 10x Pyro Buffer 10x 2.5 1x dNTP 2 mM 2.5 O.2 mM Pyrobest DNA Pol 5 U/L O.25 0.050 U/L Operation cycle Temperature C. Time GS Primer 10 M 1.O 0.4 M Upstream Primer 10 M 2.5 1 M denature 96 1 min. cDNA 10 dil 2.5 1 dil 25 anneal 55 5 sec. extention 74 15 sec. 25 times Total 2S.O denature 96 5 sec. extention 74 15 sec. Store 10 Overnight After PCR reaction performed at each reaction solution 30 (14 hours) amount of 25 ul, 5uL aliquots of the reaction solutions are collected and electrophoresed on 1% agarose gel to confirm Composition of reaction solution the presence or absence of PCR amplification products and DNA polymerase: KOD Dash their molecular weights. Table 20 shows the base number of Concentration the confirmed amplification product obtained with each 35 ofundiluted Formulated Final primer pair. Component Solution amount LL concentration

Table 20 HO 5.8 Dash Buffer 10x 1.O 1x TABLE 20 40 dNTP 2 mM 1.O O.2 mM KOD Dash 2.5 U/L O.2 0.050 U/L Primer pair used for 5' RACE reaction and 5' RACE UP1 primer 10 M O.S 0.5 LM reaction product prepared therewith LP2 primer 10 M O.S 0.5 LM Amplified Colony Soln. 1.O Primer pair Upstream primer Downstream primer product 45 Total 1O.O Set1 UP4-5' Ready White Luc LP4 5' Ready primer bp Set2 UP3-5' Ready White Luc UP3 5' Ready primer bp Forty-eight colonies were randomly selected from the The 5' RACE reaction product is temporarily inserted into colonies on the Petri dish. The bacterial cells in each colony a cloning vector pCR4Blunt-TOPO (produced by Invitro 50 were suspended in 70 uL of water (DDW). This bacterial cell gen), and then the obtained vector is introduced into Chemi suspension was treated at 95°C. for 5 minutes. The solution cal competent cell TOP10 strains to select the transformed containing the vector collected from the bacterial cells was strains therefrom. The plasmid vector introduction into the utilized as a colony Solution for the reaction Solution. host E. coli was performed according to the procedures 55 After the completion of PCR reaction, a 3 ul. aliquot is described above. collected from 10 uL of the reaction solution containing the After that, transformed strains contained in the culture amplified product and electrophoresed on 2% gel to examine Solution are selected on a drug-Supplemented medium with the presence or absence of a PCR amplification product cor use of the selection marker (drug resistance gene) from the cloning vector pCR4Blunt-TOPO. From among the selected responding to the cDNA fragment and a size range thereof. transformed strains, those carrying the plasmid vector with 60 The primary screening found out 189-bp expected PCR the cDNA insert are selected by means of a colony PCR amplification products in 16 colonies of Nos. 4–7, 10, 18, 22. method. 24, 25, 27, 29, 31, 33, 35, 36, and 38 among the 48 randomly Screening of Clone Carrying Plasmid Vector with cDNA selected colonies. Insert by Colony PCR Method 65 Subsequently, secondary Screening is carried for the 16 The presence or absence of cDNA fragment insertion in the colonies screened in the primary screening by means of plasmid vectors collected from the transformed strains form colony PCR under conditions shown in Table 22 below. US 7,871,803 B2 39 40 Table 22 then the mixture was subjected to vortex so as to be well dispersed. To this cell dispersion, 0.25 mL of P2 solution TABLE 22 included in the kit was added, and mixed together. The mix Temperature conditions of PCR reaction: ture was left standing at room temperature (20° C.) for 5 Apparatus used: Mastercycler (eppendorf) minutes. Subsequently, to the mixture, 0.35 mL of N3 solu Operation cycle Temperature C. Time tion included in the kit was added, and mixed up. Following lysis treatment, centrifugation (11,000 rpm) at 4°C. for 15 denature 96 1 min. minutes was carried out to separate and collect a soluble anneal 55 5 sec. extention 74 40 sec. 25 times 10 fraction containing the plasmid DNA (Supernatant). denature 96 5 sec. The soluble fraction containing the plasmid DNA (super extention 74 40 sec. Store 10 Overnight natant) was applied to a QIAprep column included in the (14 hours) purification kit. The column was subjected to centrifugation (15,000 rpm) at 4°C. to remove the liquid layer therefrom. Composition of reaction solution 15 The column was washed by the addition of 0.5 mL of buffer DNA polymerase: KOD Dash PB and subsequently washed by the addition of 0.75 mL of Concentration buffer PE. Finally, the washing solution was removed there ofundiluted Formulated Final from by centrifugation (15,000 rpm) at 4°C. for 1 minute. The Component solution amount LL concentration plasmids adsorbed onto the QIAprep of the purification kit HO 6.4 were eluted with 30 uL of buffer EB, and then collected Dash Buffer 10x 1.O 1x therein. Of 30 uL of this solution containing the purified dNTP 2 mM 1.O O.2 mM KOD Dash 2.5 U/L O.2 0.050 U/L plasmids, a 1 Laliquot was sampled and added with 99 uL of UP1 primer 10 M O.2 0.2 M distilled water to prepare a solution diluted 100-fold thereof. O.2 LP2 primer 10 M 0.2 M 25 Table 23 shows results of evaluation of each clone for a Colony Soln. 1.O DNA concentration contained in the Solution containing the Total 1O.O purified plasmid. Table 23

TABLE 23

DNA Gross DNA Dilution concentration volume amount ODo/ Sample OD280 OD320 ratio Igul |L 19. OD2so No. 4 O.042 O.O23 <0.001 x100 O.210 29 6.09 1.83 No. 5 O.047 O.O24 <0.001 x100 O.235 29 6.82 1.96 No. 7 0.077 O.O41 <0.001 x100 O.385 29 11.17 1.88 No. 10 O.064 O.O34 <0.001 x100 O.32O 29 9.28 1.88 No. 27 O.066 O.O34 <0.001 x100 O.330 29 9.57 1.94 No. 29 O.OS4 O.O27 <0.001 x100 O.270 29 7.93 2.OO No. 31 O.OSO O.O26 <0.001 x100 O.260 29 7.54 1.86 No. 33 O.O60 O.O31 <0.001 x100 O.310 29 8.99 1.88

After the completion of PCR reaction, a 3 ul. aliquot is 45 Nucleotide Sequence Analysis of cDNA Fragment (5' collected from 10 uL of the reaction solution containing the RACE Reaction Product) in Screened Clone amplified product and electrophoresed on 2% gel to examine the presence or absence of a PCR amplification product cor From the cDNA portions (5 RACE reaction products) responding to the cDNA fragment and a size range thereof. inserted in the plasmid vectors carried by said 8 clones, prod This screening found out PCR amplification products having 50 ucts of nucleic acid strand extension reaction were prepared a size corresponding to the cloning site with the cDNA frag for nucleotide sequence analysis thereof according to proce ment insert in 8 colonies of Nos. 4, 5, 7, 10, 27, 29, 31, and 33 dures described below. among the 16 colonies screened in the primary Screening. The solutions containing the plasmid vectors collected and Replication and Purification of Plasmid Vector with 5' purified from the screened clones were subjected to concen RACE Reaction Product Insert Carried by Screened Clone 55 tration adjustment so as to set their DNA concentrations at The plasmid vector with the 5' RACE reaction product 250 ng/ul. Subsequently, the purified plasmid vector was insert was replicated and purified from the 8 screened clones by procedures described below. used as a template to prepare a sample for nucleotide The 8 screened colonies (clones) were separately sus sequence analysis with use of two types of primers; M13 pended in 10 mL of LB/Carbenicillin medium and cultured at 60 sense M4 and M13 RV, which are corresponding to the site 37°C. for 15.6 hours. The culture solutions were centrifuged from the cloning vector pCR4Blunt-TOPO, as sequencing (5000xg) for 10 minutes to collect cells therefrom. primers by means of a commercially available sequencing The plasmids were separated and purified from the col DNA sample preparation kit BigDye Terminator Cycle lected cells by means of a commercially available plasmid Sequencing Ready Reaction Kit with AmpliTaq polymerase. purification kit QIAGEN plasmid purification kit (produced 65 Table 24 shows the temperature conditions used for the DNA by QIAGEN). Specifically, 0.25 mL of P1 solution included Strand extension reaction and the composition of the reaction in the purification kit was added to the collected cells, and solution thereof. US 7,871,803 B2 42 Table 24 5'-UP1, White luc1 5'-UP2 and White luc2 5'-UP1 were TABLE 24 designed from their respective 5'-uncoding regions: Composition of reaction solution 5 White luc1 5'-UP1: (39 mer) Concentration Ratio of formulated 5 " - GGAGACAACTGGATCCAAAAGGAAAGGAGCCAAATCTAC-3' ofundiluted amount Component solution |LL White luc1 5'-UP2: (29 mer) 5'-AAAAGGAAAGGAGCCAAATCTACAGTCTA-3' Terminator Reaction Mix 1.O Template DNA 250 ng LL 2.0 White luc2 5' UP1: (37 iner) primer 1 M O.8 10 5 " - GAGTCCAAACTGAAAGGTACT CAAAAATGGGAGTCAA-3' DDW 1.2 Reacquisition of 3' RACE Reaction Product Total S.O 3' Ready cDNA prepared again based on the mRNA from Temperature conditions of DNA strand extension M. pacifica was used as a template to newly prepare 3' RACE reaction: 15 reaction products having a nucleic acid strand extended from Apparatus used: Mastercycler Gradient each upstream primer with use of the three types of upstream Operation for Temperature primers White luc1 5'-UP1, White luc1 5'-UP2, and White temperature cycle o C. Time luc25'-UP1. 3 RACE reaction products were prepared by using 3' denature 96 1 min. 2O denature 96 10 sec. 25 times Ready cDNA, which was newly prepared based on the mRNA anneal 50 5 sec. Ramp. Rate 1° C.'s from M. pacifica, as a template with use of three sets of primer extention 60 4 min. Ramp. Rate 1° C.'s pairs shown in Table 25 below. Store 4 Overnight (14 hours) Table 25 25 The prepared samples for nucleotide sequence analysis TABLE 25 were purified by procedures described below. Primer pair for 5' RACE reaction The prepared sample solution was transferred from each Template cDNA: 5’ Ready cDNA reaction tube to another 0.5-mL tube. An additional solution 30 was prepared in advance in a 1.5-mL tube, in Such a ratio that Downstream primer 0.5uL of 3M sodium acetate aqueous solution and 12.5uL of Primer pair Upstream primer (GS primer) 95% ethanol are to be mixed with 5uL of the sample solution. Set luc15'-UP1 White Luc15'-UP1 3' Ready primer The sample solution collected in advance was added into this Set c1 S-UP2 White Luc15'-UP2 3' Ready primer 1.5-mL tube. The solution was uniformly mixed and then left Setluc2S-UP1 White Luc25'-UP1 3' Ready primer standing under ice cooling for 10 minutes to ethanol-precipi- 35 tate (deposit) the DNA fragments contained therein. The deposited DNA fragments were sedimented by centrifugation Table 26 shows the composition of the reaction solution (14,000 rpm) for 20 minutes, and the Supernatant was and the conditions of PCR amplification reaction. removed therefrom. Subsequently, the deposited DNA frag Table 26 ments were rinsed by the addition of 125 uL of 70% ethanol. 40 The deposited DNA fragments were sedimented again by centrifugation (14,000 rpm) for 5 minutes, and the superna TABLE 26 tant was removed by aspiration. The remaining pellets of Temperature conditions of PCR reaction: deposited DNA fragments were dried up. Apparatus used: Mastercycler Gradient (eppendorf) The purified DNA fragments of sample for analysis were 45 redispersed in Template suppressor Reagent (TSR). The solu Operation cycle Temperature C. Time tion was well mixed by vortex and then was subjected to denature 96 1 min. centrifugation to collect a solution therefrom. The solution anneal 60 10 sec. extention 68 60 sec. 40 times was heated up at 95° C. for 2 minutes to split the DNA denature 96 5 sec. fragments to single-stranded DNA, and cooled on ice. The 50 extention 68 60 sec. Solution was Subjected to Vortex once again, and then was Store 10 Overnight centrifugated again to collect the solution containing the (14 hours) extended single-stranded DNA therefrom. Then, the DNA fragments of sample for analysis (extended single-stranded Composition of PCR reaction solution DNA) was loaded to a commercially available sequencing DNA polymerase: Pyrobest DNA polymerase apparatus ABI PRISM 3100 Genetic Analyzer to analyze the SS Concentration nucleotide sequence thereof. ofundiluted Formulated Final The nucleotide sequence of the inserted cDNA fragment (5' Composition Solution amount LL concentration RACE reaction product) was determined by combining the HO 13.75 results of sequencing from the 5' terminus and the results of 10x Pyro Buffer 10x 2.5 1x sequencing from the 3' terminus with each another. 60 dNTP 2 mM 2.5 O.2 mM When the determined nucleotide sequences of the 5' RACE Pyrobest DNA Pol 5 U/L O.25 0.050 U/L reaction products were mutually compared among the 8 GS Primer 10 M 1.O 0.4 M clones, two types of 5' RACE reaction products were found Upstream Primer 10 M 2.5 1 M which differed in their N-terminal amino acid sequences cDNA 10 dil 2.5 1 dil encoded by the ORF portions. Based on the nucleotide 65 Total 2SO sequences of these two types of 5 RACE reaction products, the following three types of upstream primers White luc1 US 7,871,803 B2 43 44 After PCR reaction performed at each reaction solution amount of 25uL. 5uLaliquots of the reaction Solutions were TABLE 27-continued sampled and electrophoresed on 1% agarose gel to confirm Temperature conditions of DNA strand extension the molecular weights of the PCR amplification products (3' reaction: RACE reaction products). Apparatus used: Mastercycler Gradient The reacquired 3' RACE reaction product was temporarily Operation for Temperature inserted into a cloning vector pCR4Blunt-TOPO. The temperature cycle o C. Time obtained vector was introduced into Chemical competent cell denature 96 1 min. TOP10 strains, and then transformed strains were selected 10 denature 96 10 sec. 25 times anneal 50 5 sec. Ramp. Rate 1° C.'s therefrom. The introduction of the plasmid vector in which extention 60 4 min. Ramp. Rate 1° C.'s the reacquired 3 RACE reaction product was subcloned, into Store 4 Overnight the host E. coli was performed by use of the Chemical com (14 hours) petent cell according to the aforementioned procedures for the preparation of the transformed strain in which the 5' 15 The prepared samples for nucleotide sequence analysis RACE reaction product was subcloned. were purified by procedures described below. Nucleotide Sequence Analysis of cDNA Fragment (3' The prepared sample solution was transferred from each reaction tube to another 0.5-mL tube. An additional solution RACE Reaction Product) in Screened Clone was prepared in advance in a 1.5-mL tube, in Such a ratio that The reacquired 3' RACE reaction product-containing por 0.5uL of 3M sodium acetate aqueous solution and 12.5uL of tion inserted in the plasmid vector carried by each of the 95% ethanol are to be mixed with 5uL of the sample solution. screened clones was used as a template to prepare nucleic acid The sample solution collected in advance was added into this Strand extension reaction products for nucleotide sequence 1.5-mL tube. The solution was uniformly mixed and then left analysis according to procedures described below. standing under ice cooling for 10 minutes to ethanol-precipi 25 tate (deposit) the DNA fragments contained therein. The The Solutions containing the plasmid vectors collected and deposited DNA fragments were sedimented by centrifugation purified from the screened clones were subjected to concen (14,000 rpm) for 20 minutes, and the supernatant was tration adjustment so as to set their DNA concentrations at 70 removed therefrom. to 100 ng/u. Subsequently, the purified plasmid vector was Subsequently, the deposited DNA fragments were rinsed used as a template, and only M13 RV that was selected from 30 by the addition of 125uL of 70% ethanol. The deposited DNA two types of primers M13 sense M4 and M13 RV, which are fragments were sedimented again by centrifugation (14,000 corresponding to the site from the cloning vectorpCR4Blunt rpm) for 5 minutes, and the Supernatant was removed by TOPO, was used as sequencing primer to prepare a sample for aspiration. The remaining pellets of deposited DNA frag nucleotide sequence analysis from the region containing the 35 ments were dried up. 3 RACE reaction product inserted in the plasmid vector, by The purified DNA fragments of sample for analysis were means of a commercially available sequencing DNA sample redispersed in Template suppressor Reagent (TSR). The solu tion was well mixed by vortex and then was subjected to preparation kit BigDye Terminator Cycle Sequencing Ready centrifugation to collect a solution therefrom. The solution Reaction Kit with AmpliTaq polymerase. Table 27 shows the was heated up at 95° C. for 2 minutes to split the DNA temperature conditions used for the DNA strand extension 40 fragments to single-stranded DNA, and cooled on ice. The reaction and the composition of the reaction solution thereof. Solution was Subjected to Vortex once again, and then was centrifugated again to collect the solution containing the Table 27 extended single-stranded DNA therefrom. Then, the DNA fragments of sample for analysis (extended single-stranded TABLE 27 45 DNA) was loaded to a commercially available sequencing Composition of reaction solution apparatus ABI PRISM 3100 Genetic Analyzer to analyze the nucleotide sequence thereof. Concentration Ratio of Ten colonies were selected for each transformed strain, and ofundiluted formulated amount newly analyzed nucleotide sequences were compared among Component solution |LL 50 the 3' RACE reaction products of which the nucleic acid Terminator Reaction Mix 1.O Strand was extended from each upstream primer with use of Template DNA 70-100 ng L 3.2 the three types of upstream primers White luc15'-UP1, White primer 1 M O.8 luc1 5'-UP2 and White luc2 5'-UP1. As a result, it was DDW O.8 revealed that the nucleotide sequence of the 3' RACE reaction 55 product that was extended from the upstream primer White Total S.O luc1 5'-UP1, which was carried in one clone White luc1 3'RACE UP1-UPM/pCR4Blunt No. 10, is that presented below.

Nucleotide sequence of White luc1 3 "RACE No. 1O GGAGACAACG GATCCAAAAG GAAAGGAGCT AAATCTACAG TCTAGAAC 48

ATG ATG GAA. ATA CAA GTT CTT TTT GCT. CTC ATT TGC 84 M M E I W L A. L I C

US 7,871,803 B2 47 48

- Continued E. D. I. D. L. W. A. I. G. G. S F

GCT. CTG GAT GTT GAT GCT. AAC AGA. GGT GGA CAT GGT 17O A. L D W D A. N R G G H G

GGA CAT CCT GGC AAG AAG ATG AAA GAA GTA. CCT 2O6 G H P G K K M d K E W L

GTT GAA. ATG GAA GCT. AAT GCT AGG GCT GGG TGC 242

CAC AGA. GGA TGT CTG ATT TGT TCC CAC ATC AAG 278

TGC ACC AAG ATG AAG AAG ATC CCA. GGA, AGA 314

TGC CAC AGT TAT GAA. GGA. GAC GAT TCT, GCA CAG 350

GGA. GGC ATT GGA GAA GAA. ATT GTT GAC ATG CCT GAA 386

ATT CCC GGA TTC GAC AAG GAA CCA. ATG GAC CAA 422

TTC ATC GCT CAA GTT GAT CTC TGC GTA GAT TGC ACA 458 I A. Q W D L C W D C T

ACT GGA TGC CTC AAG GGT CTT GCC AAT GTC CAT TGC 494 G

TCT GAT CTC CTG AAG AAA TGG CTT CCT TCA AGA TGC 53 O K W L P S R C

AAG ACA TTT GCT. TCC AAA ATT CAA TCT CAA. GTG GAT 566 K T A. S K

ACC ATC AAG GGA TTA. GCT GGA. GAT CGT TGA 596 T I K G L A. G D R k

GGGATAAAAA AATGGATAAT TTGATGATGA TACTTTAGCC CAATGATGTT 646

AAAAATGGCC ATTTTCGTAT TAAACCATAA CTATGTAAAA ATGTAATGTA 696

TGCAAATAAA AAAAACCTTA. ACGGTTTAAA AAAAAAAAAA AAAAAAAAAA 746

AAAAAAA 75.3

In the comparison between these two types of nucleotide was extended from the upstream primer White luc1 5'-UP1. sequences, the former contains ORF encoding 210 amino Moreover, two types of downstream primers White luc2 acid residues, while the latter contains ORF encoding 189 45 3'-LP1 and White luc23'-LP2 described below were designed amino acid residues. A protein encoded by the former gene based on the nucleotide sequence of the 3'-uncoding region in was designated as M. pacifica luciferase 1, while a protein the nucleotide sequence of the 3' RACE reaction product that encoded by the latter gene was designated as M. pacifica was extended from the upstream primer White luc2 5'-UP1. luciferase 2. From the nucleotide sequence portion encoding this M. 50 pacifica luciferase 1, the following downstream primer White White luc1 3'-LP1: (27 mer) luc1B LP1 was designed: 5 - GGATTACATAGAATATATTTATAGGAA-3' White luc1 3'-LP2: (29 mer) s" - CATGATCCAGTTATCTCTTGTTCTGTTCT-3' White luc1B LP1: (37 mer) 55 s' - ACTGTTGACTAGATTGGTGTCTCTACTGATGACATTC-3' White luc2 3'-LP1: (28 mer) s' - ATTTTTACATAGTTATGGTTTAATACGA-3'

The White luc1B LP1 is a nucleotide sequence comple White luc2 3'-LP2: (29 mer) mentary to the following portion in ORF: 5'-TAACATCATTGGGCTAAAGTATCATCATC-3' 60 Reacquisition of 5' RACE Reaction Product G AAT GTC ATC AGT AGA GAC ACC AAT CTA GTC AAC ACT The aforementioned downstream primer White luc1B LP1 N W I S R D T N L A. N S was used to newly prepare 5' RACE reaction products of In addition, two types of downstream primers White luc1 which a nucleic acid strand was extended from the down 3'-LP1 and White luc13'-LP2 described below were designed 65 stream primer, based on the mRNA from M. pacifica. based on the nucleotide sequence of the 3'-uncoding region in The reacquired 5' RACE reaction product was temporarily the nucleotide sequence of the 3' RACE reaction product that inserted into a cloning vector pCR4Blunt-TOPO, which was US 7,871,803 B2 49 50 then introduced into TOP10 strains. Transformed strains were selected therefrom. The nucleotide sequence of a portion TABLE 28-continued corresponding to the 5'-uncoding region of the gene encoding Temperature conditions of DNA strand extension the M. pacifica luciferase 1 was analyzed again by the use of reaction: the 5' RACE reaction product portion subcloned therein. 5 Apparatus used: Mastercycler Gradient Specifically, the transformed strains screened with use of the selection marker from the cloning vector pCR4Blunt Operation for Temperature TOPO were analyzed for the nucleotide sequences of the 5' Temperature cycle o C. Time RACE reaction products that were carried by subclone groups denature 96 1 min. of White luc1 5"RACE LP1B-UPM/pCR4Blunt-TOPO, 10 denature 96 10 sec. 25 times anneal 50 5 sec. Ramp. Rate 1° C.'s which contained the 5' RACE reaction product of which a extention 60 4 min. Ramp. Rate 1° C.'s nucleic acid strand was extended from the 3' terminus of the Store 4 Overnight downstream primer White luc1B LP1 to the 5'-uncoding (14 hours) region of the gene encoding the M. pacifica luciferase 1. The nucleotide sequence of the 5'-uncoding region and the portion 15 encoding the N-terminal portion of ORF thereof was recon The prepared sample solution was transferred from each firmed thereby. reaction tube to another 0.5-mL tube. An additional solution The reacquired 5 RACE reaction product-containing por was prepared in advance in a 1.5-mL tube, in Such a ratio that tion inserted in the plasmid vector, which was carried by each 0.5uL of 3M sodium acetate aqueous solution and 12.5uL of of the screened clones, was used as a template to prepare 95% ethanol are to be mixed with 5uL of the sample solution. nucleic acid strand extension reaction products for nucleotide The sample solution collected in advance was added into this sequence analysis according to procedures described below. 1.5-mL tube. The solution was uniformly mixed and then left The Solutions containing the plasmid vectors collected and standing under ice cooling for 10 minutes to ethanol-precipi purified from the screened clones were subjected to concen tate (deposit) the DNA fragments contained therein. The tration adjustment so as to set their DNA concentrations at 70 25 deposited DNA fragments were sedimented by centrifugation to 100 ng/u. Subsequently, the purified plasmid vector was (14,000 rpm) for 20 minutes, and the supernatant was used as a template, and only M13 sense M4 that was selected removed therefrom. Subsequently, the deposited DNA frag from two types of primers M13 sense M4 and M13 RV, which ments were rinsed by the addition of 125 uL of 70% ethanol. are corresponding to the site from the cloning vector The deposited DNA fragments were sedimented again by pCR4Blunt-TOPO, was used as sequencing primer to prepare 30 centrifugation (14,000 rpm) for 5 minutes, and the superna a sample for nucleotide sequence analysis from the region tant was removed by aspiration. The remaining pellets of containing the 5' RACE reaction product inserted in the plas deposited DNA fragments were dried up. mid vector, by means of a commercially available sequencing The purified DNA fragments of sample for analysis were DNA sample preparation kit BigDye Terminator Cycle redispersed in Template suppressor Reagent (TSR). The solu Sequencing Ready Reaction Kit with AmpliTaq polymerase. 35 tion was well mixed by vortex and then was subjected to At the same time, as for the subclone groups White luc1 centrifugation to collect a solution therefrom. The solution 3'RACE UP1-UPM/pCR4Blunt Nos. 1, 4, 5, 6, 7, 9, and 10 was heated up at 95° C. for 2 minutes to split the DNA and White luc13"RACE UP2-UPM/pCR4Blunt Nos. 2, 3, 4, fragments to single-stranded DNA, and cooled on ice. The 5, 6, 7, 8, 9, and 10 carrying the 3' RACE reaction products, Solution was Subjected to Vortex once again, and then was which were selected in the above screening, the nucleotide 40 centrifugated again to collect the solution containing the sequence of the 5'-uncoding region and the portion encoding extended single-stranded DNA therefrom. Then, the DNA the N-terminal portion of ORF thereof was analyzed. fragments of sample for analysis (extended single-stranded Table 28 shows the sequencing primers used therefor, the DNA) was loaded to a commercially available sequencing temperature conditions of the DNA strand extension reaction, apparatus ABI PRISM 3100 Genetic Analyzer to analyze the and the composition of the reaction solution thereof. 45 nucleotide sequence thereof. Based on the analysis results of each subclone for the Table 28 nucleotide sequences of the 5'-uncoding region and the por tion encoding the N-terminal portion of ORF, upstream and TABLE 28 downstream primers were designed as described below for 50 Sequencing primer the PCR amplification of the coding region from an initiation codon (ATG) located at the 5' terminus of ORF to a stop codon Template Sequencing primer (TGA) at the 31 terminus. In this case, PCR amplification prepared by the use of the pair of these upstream and down White luc13' RACE UP1-UPM/pCR4Blunt M13 Sense M4 stream primers was allowed to have a form capable of being White luc13' RACE UP2-UPM/pCR4Blunt M13 Sense M4 55 White luc15 RACE LP1B-UPM/pCR4Blunt M13 Sense M4 incorporated into an expression vector pBT101-TOPO. For Amplification of Coding Sequence (ORF) of M. paci Composition of reaction solution fica Luciferase 1: Concentration of Ratio of formulated Component undiluted Solution amount LL 60 White luc1-4 pETUP: (34 mer) Terminator Reaction Mix 1.O CACC ATG ATG GAA. ATA AAA GTT CTT TTT GCT. CTC Template DNA 70-100 ng L 3.2 M M E K W L A. L primer 1 M O.8 DDW O.8 White luc1-9 pETUP: (34 mer) CACC ATG ATG GAA GTA AAA GTT GTT TTT GCT. CTC Total S.O 65 M M E w K W w A. L US 7,871,803 B2 52

- Continued TABLE 29-continued White luc1-10 pETUP: (34 mer) CACC ATG ATG GAA. ATA CAA GTT CTT TTT GCT. CTC Temperature conditions of PCR reaction: M M E Q W L A. L Apparatus used: Mastercycler Gradient (eppendorf) White luc1 pET-LP: (29 mer) Operation cycle Temperature C. Time TCA ACG ATC. TCC AGC CAA GCC CTT GAT GT denature 96 1 min. This primer is a nucleotide sequence complementary to the anneal 60: Ramp. Rate 1° C.'s 5 sec. extention 68 50 sec. 30 times following sequence coding for the C-terminal portion of M. 10 denature 96 5 sec. pacifica luciferase 1: extention 68 50 sec. Store 10 Overnight AC ATC AAG GGC TTG GCT GGA. GAT CGT TGA (14 hours) I K G L A. G D R k Composition of PCR reaction solution For Amplification of Coding Sequence (ORF) of M. paci- 15 DNA polymerase: Pyrobest DNA polymerase fica Luciferase 2: Concentration ofundiluted Formulated Final Composition Solution amount LL concentration White luc2 pETUP: (30 mer) CACC ATG GGA GTC AAA CTT ATC TTT GCT GT HO 16.25 M G W K L I A. 10x Pyro Buffer 10x 2.5 1x dNTP 2 mM 2.5 O.2 mM White luc2 pETLP: (28 mer) Pyrobest DNA Pol 5 U/L O.25 0.050 U/L TCA ACG ATC. TCC AGC TAA GCC CTT GAT G Upstream Primer 10 M O.S 0.2 M Downstream 10 M O.S 0.2 M Primer This primer is a nucleotide sequence complementary to the 25 following sequence coding for C-terminal portion of M. paci Template plasmid 10 ng LL 2.5 1 ng LL fica luciferase 2: Total 2SO

C ATC AAG GGA TTA. GCT GGA GAT CGT TGA The prepared PCR amplification products were purified by I K G L A. G D R k 30 procedures described below. (Recombinant Expression of Luciferase Protein from M. After PCR reaction performed at each reaction solution pacifica) amount of 25 uL, the reaction solutions from three reactions Insertion of Gene Encoding Luciferase Protein from M. in total were combined, and a 2 uL aliquot of the reaction pacifica into Plasmid pET101/D-TOPO 35 Solution was sampled and electrophoresed on 1.6% agarose gel to confirm PCR amplification products with the molecular First, the vector that was collected from the isolated clone carrying the plasmid vector White luc13"RACE UP1-UPM/ weights of interest. pCR4Blunt incorporating therein the coding sequence of M. Subsequently, the DNA product from the reaction solution pacifica luciferase 1 or from the isolated clone carrying the was concentrated with MinFlute (produced by QIAGEN). plasmid vector White luc2 3'RACE UP1-UPM/pCR4Blunt Five volumes of buffer PB was added per volume (73 uL) of incorporating therein the coding sequence of M. pacifica the reaction solution, and after mixing them was made by luciferase 1 was used as a template to prepare PCR amplifi Vortex, the mixture was transferred to the MinFlute column. cation products under conditions described below by use of The DNA-adsorbed column was separated by centrifugation the aforementioned PCR forward and reverse primers. Table 29 shows the combinations of the templates and the PCR 45 for 30 seconds, and the supernatant was removed therefrom. primer pairs, the temperature conditions of DNA strand The DNA-adsorbed column was washed with 0.7 mL of extension reaction, and the composition of the reaction solu buffer PE and separated by centrifugation (15,000 rpm) for tion used therefor. additional 1 minute, and thereby the buffer PE was com pletely removed therefrom. Then, 10 uI of elution buffer EB Table 29 50 was added to the column, and then the column was left stand ing at room temperature for 1 minute. Following this elution TABLE 29 treatment, the supernatant containing DNA eluted from the column was separated by centrifugation (15,000 rpm) for 1 PCR primers minute, and collected into a 1.5-mL Eppendorf tube. Template plasmid clone Upstream primer Downstream primer ss After 2 LL of 10x loading dye solution was added to the White luc13 RACEUP1-UPM White luc1-4 White luc1 pET-LP collected DNA solution, 12 LL/lane of the DNA solution was pCR4Blunt No. 4 bETUP electrophoresed on 1.0%. TAE agarose gel. The band with the White luc13 RACEUP1-UPM White luc1-9 White luc1 pET-LP molecular weight of interest was cut out from the gel. The gel pCR4Blunt No. 9 bETUP piece cut off was added into a 1.5-mL Eppendorf tube, and the White luc13 RACEUP1-UPM White luc1-10 White luc1 pET-LP 60 DNA was isolated and collected therefrom. pCR4Blunt No. 10 bETUP White luc23'RACEUP1-UPM White luc2 White luc2 pET-LP The purified double-stranded DNA was inserted into a pCR4Blunt No. 6 bETUP commercially available plT101-TOPO (produced by Invit White luc23'RACEUP1-UPM White luc2 White luc2 pET-LP rogen) to clone the gene (coding sequence portion) encoding pCR4Blunt No. 7 bETUP White luc23'RACEUP1-UPM White luc2 White luc2 pET-LP the luciferase protein from M. pacifica into the vector. The pCR4Blunt No. 8 bETUP 65 constructed vector was introduced into Chemical competent cell TOP10 strains, and transformed strains were selected therefrom. The plasmid vector introduction into the host E. US 7,871,803 B2 53 54 coli was performed with use of the Chemical competent cell vector collected from the bacterial cells was utilized as a according to the procedures described above. colony Solution for the reaction solution. Screening of Clone Carrying Plasmid Vector with After the completion of PCR reaction, a 3 uI aliquot was Luciferase Protein-Encoding Gene (Coding Sequence Por collected from 10 uL of the reaction solution containing the tion) Insert by Colony PCR Method amplified product and electrophoresed on 2% gel to examine The presence or absence of cDNA fragment insertion in the the presence or absence of a PCR amplification product cor plasmid-vectors collected from the transformed strains form responding to the cDNA fragment and a size range thereof. ing each colony was confirmed by means of the colony PCR The screening using the colony PCR method clearly found method according to procedures described below. out the expected PCR amplification products from the fol In the colony PCR, a T7 primer from the plasmid plT101 10 lowing colonies among the primarily screened colonies. TOPO was used as a forward primer, while White luc1 pET White luc1-4/pET101/TOP10: Nos. 2, 3 LP or White luc2 pET-LP was used as a reverse primer. The White luc1-9/pET101/TOP10: No. 2 vector DNA contained in the clone was used as a template to perform PCR amplification by using commercially available White luc1-10/plT101/TOP10: Nos. 3, 5 DNA synthetase KOD Dash DNA polymerase. In this case, 15 White luc2-6/pET101/TOP10: No. 1 such clones were selected that provide DNA fragments with White luc2-7/pT101/TOP10: Nos. 4, 6 molecular weights described below as the PCR products White luc2-8/pET101/TOP10: Nos. 2, 5 amplified with the primer pairs used. Table 30 shows the The luciferase protein-encoding gene-containing portion temperature conditions of the PCR reaction used and the inserted in the plasmid vector that was carried by each of the composition of the reaction solution thereof. screened clones was used as a template to prepare nucleic acid Strand extension reaction products for nucleotide sequence Table 30 analysis according to procedures described below. TABLE 30 The solutions containing the plasmid vectors collected and 25 purified from the screened clones were subjected to concen Primers used for colony PCR tration adjustment so as to set their DNA concentrations at 70 to 100 ng/u. Colony (upstream primer) Forward primer Reverse primer White luc1-4?pET101/TOP10 T7 primer White luc1 pET-LP Subsequently, the purified plasmid vector was used as a tem (White luc1-4 pET-UP) plate to prepare a sample for nucleotide sequence analysis White luc1-9/pET101/TOP10 T7 primer White luc1 pET-LP 30 with use of two types of primers: T7 primer and T7 termina (White luc1-9 pET-UP) tor, which are corresponding to the site from the cloning White luc1-10 pET101/TOP10 T7 primer White luc1 pET-LP vector pT101-TOPO, as sequencing primers by means of a (White luc1-10 pET-UP) White luc2-6/pET101/TOP10 T7 primer White luc2 pET-LP commercially available sequencing DNA sample preparation (White luc2 pET-UP) kit BigDye Terminator Cycle Sequencing Ready Reaction White luc2-7/pET101/TOP10 T7 primer White luc2 pET-LP 35 Kit with AmpliTaq polymerase. (White luc2 pET-UP) White luc2-8/pET101/TOP10 T7 primer White luc2 pET-LP Table 31 shows the sequencing primers used, the tempera (White luc2 pET-UP) ture conditions of the DNA strand extension reaction used, and the composition of the reaction solution thereof. Temperature conditions of PCR reaction: Apparatus used: Mastercycler Gradient (eppendorf) 40 Table 31 Operation cycle Temperature C. Time TABLE 31 denature 96 1 min. anneal 55 5 sec. Sequencing primer extention 74 20 sec. 25 times 45 denature 96 5 sec. Colony Forward primer Reverse primer extention 74 20 sec. Store 10 Overnight White luc1-4?pET101/TOP10 T7 primer T7 terminal primer No. 2, 3 (14 hours) White luc1-9/pET101/TOP10 T7 primer T7 terminal primer Composition of reaction solution No. 2 DNA polymerase: KOD Dash 50 White luc1-10 pET101/TOP10 T7 primer T7 terminal primer No. 3, 5 Concentration White luc2-6/pET101/TOP10 T7 primer T7 terminal primer ofundiluted Formulated Final No. 1 Component solution amount LL concentration White luc2-7/pET101/TOP10 T7 primer T7 terminal primer No. 4, 6 HO 5.8 55 White luc2-8/pET101/TOP10 T7 primer T7 terminal primer Dash Buffer 10x 1.O 1x No. 2, 5 dNTP 2 mM 1.O O.2 mM KOD Dash 2.5 U/L O.2 0.050 U/L Composition of reaction solution T7 primer 10 M O.S 0.5 LM pET-LP primer 10 M O.S 0.5 LM Concentration of Ratio of formulated Component undiluted Solution amount LL Colony Soln. 1.O 60 Total 1O.O Terminator Reaction Mix 1.O Template DNA 250 ng LL 2.0 primer 1 M O.8 Colonies were randomly selected from the colonies on the DDW 1.2 Petri dish. The bacterial cells in each colony were suspended 65 Total S.O in 70 uL of water (DDW). This bacterial cell suspension was treated at 95°C. for 5 minutes. The solution containing the US 7,871,803 B2 55 56 SDS-PAGE analysis was conducted on proteins respectively TABLE 31-continued contained in the soluble fractions (cytoplasm components) and the insoluble fractions (membrane components) sepa Temperature conditions of DNA strand extension rated by centrifugation (15,000 rpm; 18.800xg). As a result, reaction: new bands corresponding to the luciferase proteins of interest Apparatus used: Mastercycler Gradient were found in the soluble fractions (cytoplasm components) Operation for Temperature of the transformed E. coli. Temperature cycle o C. Time When aluminescent substrate coelenterazine was added to denature 96 1 min. the soluble fractions (cytoplasm components) of the trans denature 96 10 sec. 25 times 10 formed E. coli at pH 7.5 in the presence of 100 mM CaCl, anneal 50 5 sec. Ramp. Rate 1° C.'s blue luminescence with the maximum wavelength extention 60 4 min. Ramp. Rate 1° C.'s max=480 nm was observed therein. Specifically, it was con Store 4 Overnight firmed that the recombinant luciferase proteins are produced (14 hours) by expression from each of the genes encoding M. pacifica luciferase 1 and M. pacifica luciferase 2 in the host E. coli, The prepared sample solution was transferred from each 15 respectively. This also suggested that divalent metal cations reaction tube to another 0.5-mL tube. An additional solution Such as Ca are required for exerting their luminescent activi was prepared in advance in a 1.5-mL tube, in Such a ratio that ties. 0.5uL of 3M sodium acetate aqueous solution and 12.5uL of (pH Dependency of Luminescent Properties of Recombi 95% ethanol are to be mixed with 5uL of the sample solution. nantly Expressed Luciferase Protein from M. pacifica) The sample solution collected in advance was added into this For the two types of screened clones White luc1-10/ 1.5-mL tube. The solution was uniformly mixed and then left pET101/TOP10 and White luc2-7/pET101/TOP10, the standing under ice cooling for 10 minutes to ethanol-precipi soluble fractions (cytoplasm components) of the transformed tate (deposit) the DNA fragments contained therein. The E. coli comprising the recombinantly expressed luciferase deposited DNA fragments were sedimented by centrifugation proteins were used to evaluate the pH dependency of the (14,000 rpm) for 20 minutes, and the Supernatant was 25 luminescent properties of each recombinantly expressed removed therefrom. Subsequently, the deposited DNA frag luciferase protein. ments were rinsed by the addition of 125 uL of 70% ethanol. The pHs of the solutions containing the recombinantly The deposited DNA fragments were sedimented again by expressed luciferase proteins were changed to various values centrifugation (14,000 rpm) for 5 minutes, and the superna in the presence of 50 mM MgCl2 to allow a luminescent tant was removed by aspiration. The remaining pellets of 30 Substrate coelenterazine to emit blue luminescence according deposited DNA fragments were dried up. to the enzyme activities. The purified DNA fragments of sample for analysis were FIG. 2 shows a result of plotting, against pH values redispersed in Template suppressor Reagent (TSR). The solu adjusted with a variety of buffer solutions described below, tion was well mixed by vortex and then was subjected to centrifugation to collect a solution therefrom. The solution blue luminescences (luminescence intensity measured at a was heated up at 95° C. for 2 minutes to split the DNA 35 wavelength of 480 nm) emitted from aluminescent substrate fragments to single-stranded DNA, and cooled on ice. The coelenterazine by the actions of the recombinantly expressed Solution was Subjected to Vortex once again, and then was luciferase proteins at the pHs adjusted with a variety of buffer centrifugated again to collect the solution containing the Solutions, as for recombinantly expressed luciferase proteins extended single-stranded DNA therefrom. Then, the DNA from M. pacifica according to the present invention. The fragments of sample for analysis (extended single-stranded 40 result demonstrated that the recombinantly expressed M. DNA) was loaded to a commercially available sequencing pacifica luciferase 1 and M. pacifica luciferase 2 exhibit the apparatus ABI PRISM 3100 Genetic Analyzer to analyze the desired level of luminescent properties at least in the pH range nucleotide sequence thereof. from 6.5 to 9.0. The result of nucleotide sequence analysis demonstrated Buffer Solution Used for pH Adjustment: that the PCR amplification product prepared by the use of the 45 aforementioned PCR forward and reverse primers is inserted in the cloning site of the plasmid plT101-TOPO in each of said Screened clones. pH 5.0 Acetate pH 5.5 Acetate Because of difference in the nucleotide sequences of the pH 6.0 Phosphate upstream primers used, the coding sequences of M. pacifica 50 pH 7.0 HEPES luciferase 1 in the PCR amplification products differ in the pH 8.0 Tris-HCl portions corresponding to the N-terminal regions between the pH 8.5 Tris-HCl sequences carried by White luc1-4/pET101/TOP10 and pH 8.9 Tris-HCl White luc1-9/pET101/TOP10 and the sequence carried by pH 10.0 Carbonate White luc1-10/pHT101/TOP10. Specifically, the sequences 55 carried by White luc1-4/pET101/TOP10 and White luc1-9/ (Necessity of Metal Cation for Exerting Luminescent pET101/TOP10 differ from the sequence carried by White Properties of Recombinantly Expressed Luciferase Protein luc1-10/ph T101/TOP10 and are coding sequences of variant proteins having amino acid replacement in the portions cor from M. pacifica) responding to the N-terminal region. For the two types of screened clones White luc1-10/ (Luminescent Properties of Recombinantly Expressed 60 pET101/TOP10 and White luc2-7/pET101/TOP10, the Luciferase Protein from M. pacifica) soluble fractions (cytoplasm components) of the transformed For the two types of screened clones White luc1-10/ E. Coli comprising the aforementioned recombinantly pET101/TOP10 and White luc2-7/pET101/TOP10, the expressed luciferase proteins were used to evaluate the neces expression of the inserted genes under control of the promoter sity of metal cations for exerting the luminescent properties of from the vector pET101-TOPO was induced by using IPTG. 65 each recombinantly expressed luciferase protein. At the point in time when 4 hours passed, the cultured bacte FIG. 3 shows a result of comparing blue luminescences rial cells were collected. After bacterial cell homogenization, (luminescence intensity measuredata wavelength of 480 nm) US 7,871,803 B2 57 58 emitted from a luminescent substrate coelenterazine by the tion reagent (produced by QIAGEN). The host HeLa cells actions of the recombinantly expressed luciferase proteins at used were cultured to 70% confluence on a 100-mm dish by pH 7.5 in the presence of alkali metal cations (K' and Na") using a serum-supplemented medium (DMEM+10% FBS and alkaline earth metal cations (Ca" and Mg"), as for the 100 g/ml Kanamycin). 50.0 uL of PolyFect Transfection recombinantly expressed luciferase proteins from M. pacifica Reagent was added to 6.0LL of the expression vector/plasmid according to the present invention. The result demonstrated Solution (DNA content: 1 g/LL), and then this mixture solu that the recombinantly expressed M. pacifica luciferase 1 and tion was stirred for 10 seconds. After that, the solution was M. pacifica luciferase 2 require the presence of at least incubated at room temperature for 10 minutes for complex approximately 50 mMalkali metal cations (K' and Na") and formation to use in transfection treatment. After the transfec alkaline earth metal cations (Ca" and Mg") for exerting the 10 tion treatment, the HeLa cells were and incubated for 24 to 48 desired level of luminescent properties. hours under such condition being kept at 37° C. under 5% (Recombinant Expression of Luciferase Protein from M. CO. During this step, the recovery of cell damage resulting pacifica in Human Cell) from the treatment and the expression of the introduced genes Insertion of Gene Encoding M. pacifica Luciferase 1 or M. in the cultured cells were performed. pacifica Luciferase 2 into Plasmid pcDNA3.2/V5-GW/D- 15 The recombinant expression of the luciferase proteins from TOPO M. pacifica was induced in the HeLa cells into which the Purified double-stranded DNA prepared by a PCR method expression vector was introduced. As a result, the luciferase was inserted into the cloning site of a commercially available proteins expressed in the cultured cells were observed to be plasmid pcDNA3.2/V5-GWD-TOPO (produced by Invitro secreted to the outside of the cells and accumulated as gen) to prepare expression vectors for the expression of the secreted luciferase proteins in the medium. That is to said, luciferase proteins from M. pacifica in human cells, accord translation into recombinant preproteinforms having the full ing to the preparation procedures of the expression vectors length amino acid sequence was also performed in the HeLa White luc1-10/pleT101 and White luc2-7/pET101 for the cells from human according to the genes encoding the luciferase proteins from M. pacifica, which were utilized in luciferase proteins from M. pacifica. This clearly shows that the recombinant expression in E. Coli described above. 25 the preproteins were then secreted as mature proteins to the The double-stranded DNA fragments inserted in the outside of the cells by the help of the N-terminal signal expression vectors for expression in human cells have the peptide portions. same nucleotide sequence as those of the coding genes FIG. 4 shows increases in the luminescent activity of inserted in the expression vectors White luc1-10/plT101 and mature M. pacifica luciferase 1 or M. pacifica luciferase 2 White luc2-7/plT101 and do not undergo the conversion of a 30 secreted to a medium by procedures wherein a HeLa cell, codon to be best fit to codon selection in humans. In brief, the which has undergone recovery treatment for cell damage after double-stranded DNA fragments are the same as the double the introduction of an expression vector White luc1-10/ stranded DNA fragments inserted in the expression vectors pcDNA3.2 or White luc2-7/pcDNA3.2 thereinto, is cultured White luc1-10/pleT101 and White luc2-7/pET101. The pre in the medium, and recombinant expression is induced. The pared expression vectors White luc1-10/pcDNA3.2 and 35 luminescent activity of the luciferase protein in the medium White luc2-7/pcDNA3.2 were temporarily introduced into was compared with the luminescent activity of the luciferase Chemical competent cell TOP10 strains. Transformed strains protein remaining the cultured cell at the points in time when were selected therefrom. The plasmid vector introduction 24 hours and 48 hours passed in the recombinant expression into the host E. coli was performed by use of the Chemical induced state during culture. The luminescent activity of the competent cell according to the procedures described above. 40 luciferase protein in the medium was confirmed to be signifi Clones in which a cDNA fragment having the same nucle cantly increased with the passage of culture time. otide sequence as those of the coding genes inserted in the Thus, it was demonstrated that the genes encoding expression vectors White luc1-10/pET101 or White luc2-7/ luciferase proteins from M. pacifica are sufficiently capable pET 101 was inserted were selected by screening using a of being expressed in host human cells in in vitro culture colony PCR method. Moreover, nucleotide sequence analysis 45 systems using a variety of cell lines from human even without was actually conducted to confirm the nucleotide sequences converting a codon to be fit to codon selection in human cells of the inserted portions. and can be utilized as genes encoding reporter proteins The plasmids prepared by the culture of the selected clone secreted to the outside of the cells after expression. strains were collected and purified by the use of a commer cially available plasmid purification kit QIAGEN Plasmid 50 INDUSTRIAL APPLICABILITY Maxi Kit (produced by QIAGEN). Introduction of Expression Vector for Expression of In in vitro culture systems using mammal cells, genes Luciferase Protein from M. pacifica in Human Cell into HeLa encoding two types of luciferase proteins from M. pacifica Cell according to the present invention are both capable of being The purified expression vectors for the expression of the 55 expressed in the host cells. After expression from the genes, luciferase proteins from M. pacifica in human cells were recombinantly expressed luciferase proteins can be utilized introduced into HeLa cells by the use of PolyFect Transfec as reporter proteins secreted to the outside of the cells.

SEQUENCE LISTING

<16 Os NUMBER OF SEO ID NOS: 31

<21 Os SEQ ID NO 1 &211s LENGTH: 21 O US 7,871,803 B2 59 60

- Continued

212. TYPE : PRT &213s ORGANISM: Metridia pacifica

<4 OOs, SEQUENCE: 1.

Met Met Glu Ile Glin Wall Lell Phe Ala Luell Ile 1. 1O

Phe Ala Luell Wall Glin Ala Asn Pro Thir Glu ASn 15 2O

Asp Asp Ile Asp Ile Wall Gly Wall Glu Gly Lys Phe 25 35

Gly Thir Thir Asp Lell Glu Thir Asp Luell Phe Thir Ile 4 O 45

Wall Glu Asp Met Asn Wall Ile Ser Arg Asp Thir Asn SO 55 60

Lell Ala Asn Ser Asp Ala Asp Arg Gly Lys Met Pro 65 70

Gly Lys Luell Pro Lell Glu Wall Luell Ile Glu Met 8O

Glu Ala Asn Ala Arg Lys Ala Gly Thir Arg Gly 85 90 95

Luell Ile Cys Lell Ser Ile Lys Cys Thir Ala 105

Met Wall Tyr Ile Pro Gly Arg Cys His Asp 11 O 115 12O

Gly Gly Asp Lys Thir Gly Glin Ala Gly Ile 125 13 O

Wall Gly Ala Ile Wall Asp Ile Pro Glu Ile Ser Gly 135 14 O

Phe Glu Luell Gly Pro Met Glu Glin Phe Ile Ala 145 150 155

Glin Wall Asp Luell Cys Ala Asp Thir Thir Gly 160 1.65

Lell Lys Gly Luell Ala Asn Wall Ser Ala Lell 17 O 17s 18O

Lell Trp Lell Pro Asp Arg Ala Ser Phe 185 190

Ala Asp Lys Ile Glin Ser Glu Wall Asp Asn Ile 195 2OO

Gly Luell Ala Gly Asp Arg 2O5 210

<210s, SEQ ID NO 2 &211s LENGTH: 633 &212s. TYPE: DNA <213> ORGANISM: Metridia pacifica

<4 OOs, SEQUENCE: 2 atg atg gala at a Cala gtt citt titt gct citc. att 36 Met Met Glu Ile Glin Wall Lell Phe Ala Luell Ile 1. 1O titt gca ttg gtg Cag gcc aat CC a act gala aac 72 Phe Ala Luell Wall Glin Ala Asn Pro Thir Glu ASn 15 2O gat gac att gac att gtt ggit gta gala gga a.a.a. titt 108 Asp Asp Ile Asp Ile Wall Gly Wall Glu Gly Lys Phe 25 3O 35

US 7,871,803 B2 63 64

- Continued

Gly His Pro Gly Lys Met Pro Glu Wall Lell SO 55 60

Wall Glu Met Glu Ala Asn Ala Arg Ala Gly 65 70

His Arg Gly Lell Ile Luell Ser His Ile 7s 8O

Cys Thir Met Lys Phe Ile Pro Gly Arg 85 90 95

His Ser Tyr Glu Gly Asp Asp Ser Ala Glin 105

Gly Gly Ile Gly Glu Glu Ile Wall Asp Met Pro Glu 11 O 115 12O

Ile Pro Gly Phe Lys Asp Glu Pro Met Asp Glin 125 13 O

Phe Ile Ala Glin Wall Asp Lell Cys Wall Asp Cys Thir 135 14 O

Thir Gly Luell Lys Gly Lell Ala Asn Wall His 145 150 155

Ser Asp Luell Luell Lys Trp Luell Pro Ser Arg 160 1.65

Thir Phe Ala Ser Ile Glin Ser Glin Wall Asp 17 O 17s 18O

Thir Ile Gly Lell Ala Gly Asp Arg 185

SEQ ID NO 4 LENGTH: st O TYPE: DNA ORGANISM: Metridia pacifica

< 4 OOs SEQUENCE: 4. atg gga gt C a.a.a. citt atc. titt gct gtt tgt gtt 36 Met Gly Wall Lys Lell Ile Phe Ala Wall Cys Wall 1. gcc gcg gcc cag gct gcc a Ca at C aat aac titt 72 Ala Ala Ala Glin Ala Ala Thir Ile Asn ASn Phe 15 2O gaa gac att gat citt gta gct at a ggt agc titt 108 Glu Asp Ile Asp Lell Wall Ala Ile Gly Ser Phe 25 3O 35 gct Ctg gat gtt gat gct aac aga ggt Cat ggit 144 Ala Luell Asp Wall Asp Ala Asn Arg Gly His Gly 4 O 45 gga Cat cott ggc aag aag atg a.a.a. gta cott 18O Gly His Pro Gly Lys Lys Met Wall Lell SO 55 60 gtt gala atg gala gct aat gct agg 999 216 Wall Glu Met Glu Ala Asn Ala Arg Gly Cys 65

CaC aga gga tgt Ctg att tgt citt to c CaC atc. aag 252 His Arg Gly Cys Lell Ile Cys Lel Ser His Ile Lys 7s 8O tgc acc aag atg aag aag titt at C CC a gga aga 288 Cys Thir Lys Met Lys Lys Phe Ile Pro Gly Arg 85 90 95 tgc CaC agt gaa gga gac aag gat tot gca Cag 324 Cys His Ser Glu Gly Asp Lys Asp Ser Ala Glin

US 7,871,803 B2 69 70

- Continued tgc acc aag a.a.a. atg aag aag titt at C CC a gga aga 314 Cys Thir Lys Met Lys Lys Phe Ile Pro Gly Arg 85 90 95 tgc CaC agt tat gaa gga gac aag gat tot gca Cag 350 Cys His Ser Tyr Glu Gly Asp Lys Asp Ser Ala Glin 1OO 105 gga ggc att gga gaa gaa att gtt gac atg cott gaa 386 Gly Gly Ile Gly Glu Glu Ile Wall Asp Met Pro Glu 11 O 115 12O att cc c gga ttic a.a.a. gac aag gala CC a atg gac Cala 422 Ile Pro Gly Phe Lys Asp Lys Glu Pro Met Asp Glin 125 13 O tto at C gct Cala gtt gat citc. tgc gta gat tgc a Ca 458 Phe Ile Ala Glin Wall Asp Lell Cys Wall Asp Cys Thir 135 14 O act gga citc. aag ggit citt gcc aat gt C Cat tgc 494 Thir Gly Cys Luell Lys Gly Lell Ala Asn Wall His Cys 145 150 155 tot gat citc. Ctg aag tgg citt cott to a aga tgc 53 O Ser Asp Luell Luell Lys Trp Luell Pro Ser Arg Cys 160 1.65 aag aca titt gct t cc att Cala tot Cala gtg gat 566 Lys Thir Phe Ala Ser Ile Glin Ser Glin Wall Asp 17 O 17s 18O a CC at C aag gga tta gct gga gat cgt tga 596 Thir Ile Lys Gly Lell Ala Gly Asp Arg 185 gggataaaaa aatggata at ttgatgatga tactittagcc caatgatgtt 646 aaaaatggcc attitt.cgitat taalaccataa citatgtaaaa atgtaatgta 696 tgcaaataaa aaaaac citta acggtttalaa aaaaaaaaaa aaaaaaaaaa. 746 aaaaaaa. 73

SEO ID NO 7 LENGTH: TYPE : PRT ORGANISM: Artificial sequence FEATURE: OTHER INFORMATION: Wariant Luciferase 1 from Metridia pacifica

<4 OOs, SEQUENCE: 7

Met Met Glu Ile Lys Wall Lell Phe Ala Luell Ile 1. 5

Phe Ala Luell Wall Glin Ala Asn Pro Thir Glu ASn 15

Asp Asp Ile Asp Ile Wall Gly Wall Glu Gly Lys Phe 25 35

Gly Thir Thir Asp Lell Glu Thir Asp Luell Phe Thir Ile 4 O 45

Wall Glu Asp Met Asn Wall Ile Ser Arg Asp Thir Asn SO 55 60

Lell Ala Asn Ser Asp Ala Asp Arg Gly Lys Met Pro 65 70

Gly Lys Luell Pro Lell Glu Wall Luell Ile Glu Met

Glu Ala Asn Ala Arg Lys Ala Gly Thir Arg Gly 85 90 95

Luell Ile Lell Ser Ile Thir Ala US 7,871,803 B2 71 72

- Continued

105

Met Wall Tyr Ile Pro Gly Arg Cys His Asp 11 O 115 12O

Gly Gly Asp Lys Thir Gly Glin Ala Gly Ile 125 13 O

Wall Gly Ala Ile Wall Asp Ile Pro Glu Ile Ser Gly 135 14 O

Phe Glu Luell Gly Pro Met Glu Glin Phe Ile Ala 145 150 155

Glin Wall Asp Luell Cys Ala Asp Thir Thir Gly 160 1.65

Lell Lys Gly Luell Ala Asn Wall Ser Ala Lell 17 O 17s 18O

Lell Trp Lell Pro Asp Arg Ala Ser Phe 185 190

Ala Asp Lys Ile Glin Ser Glu Wall Asp Asn Ile 195 2OO

Gly Luell Ala Gly Asp Arg 2O5 210

SEQ ID NO 8 LENGTH: TYPE : PRT ORGANISM: Artificial sequence FEATURE: OTHER INFORMATION: Wariant Luciferase 1 from Metridia pacifica

SEQUENCE: 8

Met Met Glu Wall Lys Wall Wall Phe Ala Luell Ile 1. 5

Phe Ala Luell Wall Glin Ala Asn Pro Thir Glu ASn 15

Asp Asp Ile Asp Ile Wall Gly Wall Glu Gly Lys Phe 25 35

Gly Thir Thir Asp Lell Glu Thir Asp Luell Phe Thir Ile 4 O 45

Wall Glu Asp Met Asn Wall Ile Ser Arg Asp Thir Asn SO 55 60

Lell Ala Asn Ser Asp Ala Asp Arg Gly Lys Met Pro 65 70

Gly Lys Luell Pro Lell Glu Wall Luell Ile Glu Met

Glu Ala Asn Ala Arg Lys Ala Gly Thir Arg Gly 85 90 95

Luell Ile Cys Lell Ser Ile Lys Thir Ala 105

Met Wall Tyr Ile Pro Gly Arg His Asp 11 O 115 12O

Gly Gly Asp Lys Thir Gly Glin Ala Gly Ile 125 13 O

Wall Gly Ala Ile Wall Asp Ile Pro Glu Ile Ser Gly 135 14 O

Phe Glu Luell Gly Pro Met Glu Glin Phe Ile Ala 145 150 155

Glin Wall Asp Luell Cys Ala Asp Thir Thir Gly US 7,871,803 B2 73 74

- Continued

160 1.65

Lieu Lys Gly Lieu Ala Asn. Wall Lys Cys Ser Ala Lieu 17 O 18O

Lieu Lys Llys Trp Lieu Pro Asp Arg Cys Ala Ser Phe 185 190

Ala Asp Lys Ile Glin Ser Glu Val Asp Asn. Ile Llys 195 Gly Lieu Ala Gly Asp Arg 210

SEO ID NO 9 LENGTH: 633 TYPE: DNA ORGANISM: Artificial sequence FEATURE: OTHER INFORMATION: cDNA encoding variant Luciferase 1 from Metridia pacifica

<4 OOs, SEQUENCE: 9 atg atg gala ata aaa. gtt citt titt gct citc. att 36 Met Met Glu Ile Llys Wall Lell Phe Ala Luell Ile 1. 5 1O titt gca ttg gtg Cag gcc aat CC a act gala aac 72 Phe Ala Luell Wall Glin Ala Asn Pro Thir Glu ASn 15 2O gat gac att gac att gtt ggit gta gala gga a.a.a. titt 108 Asp Asp Ile Asp Ile Wall Gly Wall Glu Gly Lys Phe 25 3O 35 ggit aca aca gac citt gag a Ca gac tta ttic acc atc. 144 Gly Thir Thir Asp Lieu. Glu Thir Asp Luell Phe Thir Ile 4 O 45 gtg gag gat atgaat gtc atc. agt aga gac acc aat 18O Wall Glu Asp Met Asn Wall Ile Ser Arg Asp Thir Asn SO 55 60

Cta gcc aac agt gat gct gac cgc ggt a.a.a. atg cott 216 Lell Ala Asn Ser Asp Ala Asp Arg Gly Lys Met Pro 65 70 ggit a.a.a. a.a.a. ct g cca Ctg gag gta citc. at a gag atg 252 Gly Lys Leul Pro Lell Glu Wall Luell Ile Glu Met 7s 8O gaa gcc aat gct ct a.a.a. gct ggc tgc acc agg gga 288 Glu Ala Asn Ala Arg Lys Ala Gly Cys Thir Arg Gly 85 90 95

citc. at C tgt citt toa aag at C aag tgt aca gca 324 Cys Luell Ile Cys Lieu Ser Lys Ile Lys Cys Thir Ala 1OO 105 a.a.a. atg aag gtg tac att C Ca gga aga tgt Cat gat 360 Met Lys Val Tyr Ile Pro Gly Arg Cys His Asp 11 O 115 12O

ggc ggt gac aag a.a.a. act gga cag gca gga ata 396 Gly Gly Asp Llys Thir Gly Glin Ala Gly Ile 125 13 O gtt ggt gcc att gtt gac att cc c gala att tot gga 432 Wall Gly Ala Ile Wall Asp Ile Pro Glu Ile Ser Gly 135 14 O tto aag gag ttg gga c cc atg gag cag titt att gct 468 Phe Lys Glu Lieu. Gly Pro Met Glu Glin Phe Ile Ala 145 150 155

Cala gtt gat citt togc gct gac tgc aca act ggc tgc SO4 Glin Wall Asp Lieu. Cys Ala Asp Cys Thir Thir Gly Cys US 7,871,803 B2 75 76

- Continued

160 1.65 citc. a.a.a. ggt citt gcc aat gtc aag tgc to c gca citc. 54 O Lell Lys Gly Luell Ala Asn Wall Lys Cys Ser Ala Lell 17 O 17s 18O

Ctg aag a.a.a. tgg citt C Ca gac aga tgt gca agt titt 576 Lell Lys Trp Lell Pro Asp Arg Cys Ala Ser Phe 185 190 gct gac a.a.a. at C Cag gaa gta gac aac atc. aag 61.2 Ala Asp Lys Ile Glin Ser Glu Wall Asp Asn Ile 195 2OO ggc ttg gct gga gat cgt tga 633 Gly Luell Ala Gly Asp Arg 2O5 210

SEQ ID NO 10 LENGTH: 633 TYPE: DNA ORGANISM: Artificial sequence FEATURE: OTHER INFORMATION: cDNA encoding variant Luciferase 1 from Metridia pacifica

<4 OOs, SEQUENCE: 10 atg atg gala gta gtt gtt titt gct citc. att 36 Met Met Glu Wall Wall Wall Phe Ala Luell Ile 1. 1O titt gca ttg gtg Cag gcc aat CC a act gala aac 72 Phe Ala Luell Wall Glin Ala Asn Pro Thir Glu ASn 15 2O gat gac att gac att gtt ggit gta gala gga a.a.a. titt 108 Asp Asp Ile Asp Ile Wall Gly Wall Glu Gly Lys Phe 25 3O 35 ggit aca aca gac citt gag a Ca gac tta ttic acc atc. 144 Gly Thir Thir Asp Lell Glu Thir Asp Luell Phe Thir Ile 4 O 45 gtg gag gat atg aat gtc atc. agt aga gac acc aat 18O Wall Glu Asp Met Asn Wall Ile Ser Arg Asp Thir Asn SO 55 60

Cta gcc aac agt gat gct gac cgc ggt a.a.a. atg cott 216 Lell Ala Asn Ser Asp Ala Asp Arg Gly Lys Met Pro 65 70 ggit a.a.a. a.a.a. Ctg C Ca Ctg gag gta citc. at a gag atg 252 Gly Lys Luell Pro Lell Glu Wall Luell Ile Glu Met 7s 8O gaa gcc aat gct cgt a.a.a. gct ggc tgc acc agg gga 288 Glu Ala Asn Ala Arg Lys Ala Gly Cys Thir Arg Gly 85 90 95 tgt citc. at C citt toa aag at C aag tgt aca gca 324 Cys Luell Ile Lell Ser Lys Ile Lys Cys Thir Ala 105 a.a.a. atg aag gtg tac att C Ca gga aga tgt Cat gat 360 Met Lys Wall Ile Pro Gly Arg Cys His Asp 11 O 115 12O

ggc ggt gac aag a.a.a. act gga cag gca gga ata 396 Gly Gly Asp Lys Thir Gly Glin Ala Gly Ile 125 13 O gtt ggt gcc att gtt gac att cc c gala att tot gga 432 Wall Gly Ala Ile Wall Asp Ile Pro Glu Ile Ser Gly 135 14 O tto aag gag ttg gga c cc atg gag cag titt att gct 468 Phe Lys Glu Luell Gly Pro Met Glu Glin Phe Ile Ala US 7,871,803 B2 77 78

- Continued

145 150 155 caa gtt gat citt togc gct gac toc aca act ggc tgc SO4 Glin Val Asp Lieu. Cys Ala Asp Cys Thr Thir Gly Cys 160 1.65 ctic aaa ggit citt gcc aat gtc. aag togc to c gca citc. 54 O Lieu Lys Gly Lieu Ala Asn. Wall Lys Cys Ser Ala Lell 17 O 17s 18O

Ctg aag aaa tog Ctt cca gac aga tigt gca titt 576 Lieu Lys Llys Trp Lieu Pro Asp Arg Cys Ala Ser Phe 185 190 gct gaC aaa at C cag agt gaa gta gac aac atc. aag 61.2 Ala Asp Llys Ile Glin Ser Glu Val Asp Asn Ile Lys 195 2OO ggc titg gct gga gat cit ta 633 Gly Lieu Ala Gly Asp Arg * 2O5 210

<210s, SEQ ID NO 11 &211s LENGTH: 57 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide primer 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (57) . . (57) <223> OTHER INFORMATION: n is a c, 9. or t <4 OOs, SEQUENCE: 11 aagcagtggit aacaacgcag agtacttittt tttittttittt tttitttittitt tttittvin

<210s, SEQ ID NO 12 &211s LENGTH: 26 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide primer

<4 OOs, SEQUENCE: 12 ggctgcacy a ggggatgyct katimtc 26

<210s, SEQ ID NO 13 &211s LENGTH: 23 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide primer

<4 OOs, SEQUENCE: 13 gctattgttg ayatyccyga rat 23

<210s, SEQ ID NO 14 &211s LENGTH: 26 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide primer

<4 OOs, SEQUENCE: 14 t caagttgwt caatraayitg ytic cat 26

<210s, SEQ ID NO 15 &211s LENGTH: 23 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence US 7,871,803 B2 79 80

- Continued

22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide primer

<4 OOs, SEQUENCE: 15 acattggcaa gaccyttvag rca 23

<210s, SEQ ID NO 16 &211s LENGTH: 30 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide primer

<4 OOs, SEQUENCE: 16 aacgat citco agccaa.gc.cc ttgatgttgt 3 O

<210s, SEQ ID NO 17 &211s LENGTH: 30 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide primer

<4 OOs, SEQUENCE: 17 t cagcgcaaa gat Caacttg agcaatgaac 3 O

<210s, SEQ ID NO 18 &211s LENGTH: 39 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide primer

<4 OOs, SEQUENCE: 18 ggagacaact ggat.ccaaaa ggaaaggagc taaatctac 39

<210s, SEQ ID NO 19 &211s LENGTH: 29 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide primer

<4 OOs, SEQUENCE: 19 aaaaggaaag gagctaaatc tacagticta 29

<210s, SEQ ID NO 2 O &211s LENGTH: 37 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide primer

<4 OOs, SEQUENCE: 2O gagt ccaaac talaagg tact caaaaatgg gag tdaa 37

<210s, SEQ ID NO 21 &211s LENGTH: 37 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide primer

<4 OOs, SEQUENCE: 21 actgttgact agattggtgt ct c tactgat gacattc 37 US 7,871,803 B2 81 82

- Continued

<210s, SEQ ID NO 22 &211s LENGTH: 27 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide primer

<4 OOs, SEQUENCE: 22 ggattacata gaatatattt at aggaa 27

<210s, SEQ ID NO 23 &211s LENGTH: 29 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide primer

<4 OOs, SEQUENCE: 23 catgat coag titat ct cittg ttctgttct 29

<210s, SEQ ID NO 24 &211s LENGTH: 28 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide primer

<4 OOs, SEQUENCE: 24 atttitt acat agittatggitt taatacga 28

<210s, SEQ ID NO 25 &211s LENGTH: 29 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide primer

<4 OOs, SEQUENCE: 25 taac at catt gggctaaagt atcatcatc 29

<210s, SEQ ID NO 26 &211s LENGTH: 34 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide primer

<4 OOs, SEQUENCE: 26 cacc atg atg gaa ata aaa gtt citt titt gct ct c 34 Met Met Glu Ile Llys Val Lieu. Phe Ala Lieu. 1. 5 10

<210s, SEQ ID NO 27 &211s LENGTH: 34 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide primer

<4 OOs, SEQUENCE: 27 cacc atg atg gaa gta aaa gtt gtt titt gct ct c 34 Met Met Glu Val Llys Val Val Phe Ala Leu 1. 5 10

<210s, SEQ ID NO 28 &211s LENGTH: 34 US 7,871,803 B2 83 84

- Continued

TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Synthetic oligonucleotide primer

< 4 OOs SEQUENCE: 28 cacc atg atg gaa at a caa gtt citt titt gct ct c 34 Met Met Glu Ile Glin Wall Leu Phe Ala Lieu. 1. 5 10

SEQ ID NO 29 LENGTH: 29 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Synthetic oligonucleotide primer

<4 OOs, SEQUENCE: 29 t caacgat ct c cagocaa.gc ccttgatgt 29

SEQ ID NO 3 O LENGTH: 30 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Synthetic oligonucleotide primer

< 4 OOs SEQUENCE: 3 O cacc atg gga gttcaaa citt at c titt gct gt 3 O Met Gly Val Lys Lieu. Ile Phe Ala 1. 5

SEQ ID NO 31 LENGTH: 28 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Synthetic oligonucleotide primer

< 4 OOs SEQUENCE: 31 t caacgat ct c cagotaagc ccttgatg 28

The invention claimed is: 45 wherein the method comprises steps of 1. An isolated gene encoding a luciferase from M. pacifica introducing the DNA into the mammal cell to form a trans comprising a nucleotide sequence encoding the full-length formed mammal cell; and amino acid sequence of SEQID NO: 1. culturing the transformed mammal cell in the in vitro cul ture system to recombinantly express therein the 2. The isolated gene encoding a luciferase protein from M. luciferase protein whose full-length amino acid pacifica as claimed in claim 1, wherein the nucleotide 50 sequence is the amino acid sequence of SEQID NO: 1. sequence encoding the full-length amino acid sequence of 5. The method according to claim 4, wherein the mammal SEQID NO: 1 is the nucleotide sequence of SEQ. ID NO: 2. cell is a cell line from human that is culturable in vitro. 3. The isolated gene encoding a luciferase protein from M. 6. An isolated gene encoding a variant of a luciferase from pacifica as claimed in claim 1, wherein the nucleotide 55 M. pacifica, comprising a nucleotide sequence encoding the sequence encoding the full-length amino acid sequence of full-length amino acid sequence of SEQID NO: 7. SEQ ID NO: 1 is the nucleotide sequence of SEQID NO:5. 7. The isolated gene encoding a variant of a luciferase 4. A method for using DNA having a nucleotide sequence protein from M. pacifica as claimed in claim 6, wherein the of SEQID NO: 2 as a nucleotide sequence encoding a peptide nucleotide sequence encoding the full-length amino acid chain having an amino acid sequence of SEQ ID NO: 1, 60 sequence of SEQID NO: 7 is the nucleotide sequence of SEQ wherein the use of DNA is aimed at allowing a mammal cell ID NO: 9. in an in vitro culture system thereof to recombinantly express 8. A method for using DNA having a nucleotide sequence therein a luciferase protein whose full-length amino acid of SEQID NO:9 as a nucleotide sequence encoding a peptide sequence is the amino acid sequence of SEQ ID NO: 1 in chain having an amino acid sequence of SEQ ID NO: 7. order to utilize the luciferase protein as a reporter protein 65 wherein the use of DNA is aimed at allowing a mammal cell which is produced in a secreted luciferase form to be secreted in an in vitro culture system thereof to recombinantly express to the outside of the mammal cell, therein a luciferase protein whose full-length amino acid US 7,871,803 B2 85 86 sequence is the amino acid sequence of SEQ ID NO: 7 in 12. A method for using DNA having a nucleotide sequence order to utilize the luciferase protein as a reporter protein of SEQ ID NO: 10 as a nucleotide sequence encoding a which is produced in a secreted luciferase form to be secreted peptide chain having an amino acid sequence of SEQID NO: to the outside of the mammal cell, 8, wherein the use of DNA is aimed at allowing a mammal cell wherein the method comprises steps of: in an in vitro culture system thereof to recombinantly express introducing the DNA into the mammal cell to form a trans therein a luciferase protein whose full-length amino acid formed mammal cell; and culturing the transformed sequence is the amino acid sequence of SEQ ID NO: 8 in mammal cell in the in vitro culture system to recombi order to utilize the luciferase protein as a reporter protein nantly express therein the luciferase protein whose full which is produced in a secreted luciferase form to be secreted length amino acid sequence is the amino acid sequence 10 to the outside of the mammal cell, of SEQID NO: 7. wherein the method comprises steps of: 9. The method according to claim 8, wherein the mammal introducing the DNA into the mammal cell to form a trans cell is a cell line from human that is culturable in vitro. formed mammal cell; and 10. An isolated gene encoding a variant of a luciferase from culturing the transformed mammal cell in the in vitro cul M. pacifica, comprising a nucleotide sequence encoding the 15 ture system to recombinantly express therein the full-length amino acid sequence of SEQID NO: 8. luciferase protein whose full-length amino acid 11. The isolated gene encoding a variant of a luciferase sequence is the amino acid sequence of SEQID NO: 8. protein from M. pacifica as claimed in claim 10, wherein the 13. The method according to claim 9, wherein the mammal nucleotide sequence encoding the full-length amino acid cell is a cell line from human that is culturable in vitro. sequence of SEQID NO: 8 is the nucleotide sequence of SEQ 20 ID NO: 1.O. UNITED STATES PATENT AND TRADEMARK OFFICE CERTIFICATE OF CORRECTION PATENT NO. : 7,871,803 B2 Page 1 of 1 APPLICATIONNO. : 1 1/721032 DATED : January 18, 2011 INVENTOR(S) : Hiromi Takenaka It is certified that error appears in the above-identified patent and that said Letters Patent is hereby corrected as shown below:

In the Specifications Column 16, Line 29: delete “Metridimidae, and insert -- Metridinidae, -- Column 16, Line 44: delete “Metridimidae, and insert -- Metridinidae. -- Column 16, Line 51: delete “Metridimidae, and insert -- Metridinidae, -- Column 21, Line 28: delete “Metridimidae, and insert -- Metridinidae, -- Column 22, Line 37: delete "grachlorostris and insert -- gracilirostris -- Column 23, Line 27: delete “Metridimidae, and insert -- Metridinidae, -- Column 23, Line 44: delete “Metridimidae, and insert -- Metridinidae. -- Column 23, Line 52: delete “Metridimidae, and insert -- Metridinidae, -- Column 27, Line 59: delete “3 and insert -- 3'-- Column 42, Line9: delete “iner) and insert -- mer) -- Column 44, Line 30: delete "Subsequently, the deposited...... were dried up.’ and insert the same on Col. 44, Line 29, after “therefrom as the continuation of the paragraph. Column 50, Line 52: delete “31 and insert -- 3'-- In the Claims Column 83, Line 52: In Claim 2, delete “SEQ. and insert -- SEQ --

Signed and Sealed this Thirtieth Day of July, 2013

Teresa Stanek Rea Acting Director of the United States Patent and Trademark Office