Neuron, Vol. 11, 903-913, November, 1993, Copyright 0 1993 by Cell Press Cloning and Pharmacological Characterization of a Rat ~1Op ioid Receptor

Robert C. Thompson, Alfred Mansour, Huda Akil, cortex, and have been shown to bind enkephalin-like and Stanley 1. Watson peptides (Mansour et al., 1988; Wood, 1988). 6 recep- Mental Health Research Institute tors are also thought to modulate several hormonal University of Michigan systems and to mediate analgesia. Ann Arbor, Michigan 48109-0720 The p receptors represent the third member of the opioid receptor family.These receptors bind morphine- like drugs and several endogenous opioid peptides, Summary including P-endorphin (derived from proopiomelano- cortin) and several members of both the enkephalin We have isolated a rat cDNA clone that displays 75% and the dynorphin opioid peptide families. These re- amino acid homology with the mouse 6 and rat K opioid ceptors have been localized in many regions of the receptors. The cDNA (designated pRMuR-12) encodes CNS, including the striatum (striatal patches), thalamus, a protein of 398 amino acids comprising, in part, seven nucleus tractus solitarius, and spinal cord (Mansour hydrophobic domains similar to those described for other et al., 1987; McLean et al., 1986; Temple and Zukin, 1987; C protein-linked receptors. Data from binding assays Wood, 1988; Mansour and Watson, 1993). p receptors conducted with COS-1 cells transiently transfected with appear to mediate the opiate phenomena classically a CMV mammalian expression vector containing the full associated with morphine and heroin administration, coding region of pRMuR-12 demonstrated p receptor including analgesia, opiate dependence, cardiovascu- selectivity. In situ hybridization mRNA analysis revealed lar and respiratory depression, and several neuroen- an mRNA distribution in rat brain that corresponds well docrine effects. Pasternak and co-workers (Pasternak to the distribution of binding sites labeled with p-selec- and Snyder, 1975; Wolozin and Pasternak, 1981; Pas- tive ligands. Based upon these observations, we con- ternak and Wood, 1986; Pasternak, 1993) and Rothman clude that pRMuR-12 encodes a p opioid receptor. and co-workers (Rothman et al., 1987) have suggested that p receptors can be subdivided into two classes, Introduction ~1 and ~2. ~1 receptors are thought to have high affin- ity for both morphine and enkephalins. In contrast, The existence of multiple forms or subtypes of opioid ~2 receptors selectively interact with morphine-like receptors was first suggested by Martin and colleagues compounds and DAMGO ([D-AlaZ,N-MePhe4,Gly-o15]en- (Gilbert and Martin, 1976; Martin et al., 1976), using the kephalin). These studies further suggest that ~1 and chronic spinal dog preparation, and has since been ~2 are functionally distinct: ~1 receptors, unlike ~2 supported by numerous behavioral, pharmacological, receptors, apparently mediate analgesia but not respi- and receptor binding studies (Gillan and Kosterlitz, ratory depression or physical dependence (Pasternak, 1982; Wood, 1982; Goldstein and James, 1984; Herling 1993). and Woods, 1984; James and Goldstein, 1984). Opioid Owing to the importance of opioid receptors in opi- receptors have been divided into at least three main oid pharmacology and physiology, many researchers classes: K, 6, and p. These receptors have unique phar- have attempted to purify these proteins with the aim macological profiles, anatomical distributions, and of ultimately describing the molecular sequence of functions in several species, including man (Wood, these receptors. In one such attempt, Schofield re- 1982; Simon, 1991; Lutz and Pfister, 1992; Mansour and ported the isolation of a protein (opioid-binding cell Watson, 1993). Several pharmacological agents as well adhesion molecule) apparently involved with an opi- as various members of the three endogenous opioid oid receptor (Schofield et al., 1989). This protein has peptide families (prodynorphin, proenkephalin, and been shown to be a member of the immunoglobulin proopiomelanocortin) have been shown to interact superfamily of cell adhesion molecules but lacks trans- with these receptors in distinctive and well-described membrane domains, a feature assumed necessary for manners. K receptors have been shown to exist in signal transduction. Using an expression cloning strat- diverse regions of the CNS; they are particularly en- egy, Xie et al. (1992) detailed the isolation and pharma- riched in the cortex, striatum, and hypothalamus (Man- cological identification of a G protein-coupled pro- sour et al., 1987; Neck et al., 1988; Unterwald et al., tein with opioid receptor binding activity. This protein 1991) and are thought to mediate many of the actions demonstrated several key features of opioid recep- of the dynorphin peptide family in addition to those tors: opioid binding and stereospecificity; however, of benzomorphans. These actions include the modu- the affinity (Ko) for pharmacologically relevant agents lation of drinking, water balance, food intake, gut mo- was low and not selective. The biochemical purifica- tility, temperature control, and various endocrine func- tion of the p receptor proteins has been reported by tions (Morley and Levine, 1983; Leander et al., 1985; several groups (Simon et al., 1975; Bidlack and Abood, lyengar et al., 1986; Manzanares et al., 1990). 6 recep- 1980; Ruegg et al., 1980; Simonds et al., -1980; Cho et tors are also found throughout the CNS, particularly al., 1981, 1986; Howells et al., 1982; Chow and Zukin, in forebrain areas such as the striatum and cerebral 1983; Demoliou-Mason and Barnard, 1984; Maneckjee Neuron 904

et al., 1985; Ueda et al., 1987). Many of these reports hZAPll cDNA librarywas plated and screened with the suggest that this protein is approximately 40-60 kd. radiolabeled DNA insert from p5A-1. Twelve positive Additionally, this receptor can be functionally cou- clones were obtained. Restriction mapping and South- pled to G proteins (Koski and Klee, 1981; Barchfeld ern blot analysis were performed on rescued plasmid and Medzihradsky, 1984; Hsia et al., 1984; Puttfarchen DNA. One clone, designated pRMuR-12, demonstrated et al., 1988; Attali et al., 1989). However, the low abun- a strong hybridization signal on Southern blots and dance of the protein and its apparently high hydro- contained a cDNA insert of approximately2.0 kb. Vari- phobicity have proved to be major stumbling blocks ous restriction enzyme digestion fragment of pRMuR- for the sequencing of sufficiently long peptide frag- 12 were subcloned into Bluescript and completely se- ments necessary for the molecular cloning of this re- quenced in both orientations. DNA sequence analysis ceptor. revealed that pRMuR-12 contained a full open reading Kieffer et al. (1992) and Evans et al. (1992) reported frame with 74% homology with the mouse 8 and rat the isolation and pharmacological characterization of K opioid receptor proteins. the first high affinity opioid receptor, the 6 opioid receptor, using an expression cloning strategy. This DNA and Protein Structure Analysis receptor was shown to contain seven hydrophobic An EcoRl-Hindlll fragment isolated form pRMuR-12 domains characteristic of membrane receptors known was shown to contain the entire protein coding region to transduce extracellular signals (e.g., ligand binding) of this cDNA and was used for all subsequent experi- via G proteins to the intracellular environment. The ments. The complete DNA sequence contained an cloned receptors exhibited high affinity and selectiv- open reading frame encoding a protein of 398 amino ity for 8 opioid ligands, and Evans et al. (1992) showed acids comprising, in part, seven hydrophobic domains. that activation of their receptor with selective 8 ago- GenBank data base searches using both the amino nists could decrease CAMP levels in transfected COS acid and the nucleic acid sequences revealed that the cells. The mouse S receptors were found to be highly pRMuR-12 sequence was novel and highly homolo- homologous to several members of the G protein- gous to the mouse 6 opioid receptor (74% similar and coupled receptor family, particularlythesomatostatin 59.5% identical at the amino acid level) and the so- receptors. The cloning of the mouse 6 receptors facili- matostatin receptors (60.5% similar and 39.5% identi- tated the cloning of other members of the opioid re- cal at the amino acid level). As can be seen in Figure ceptor family. Recently, Yasuda and co-workers de- 1, the regions of greatest homology were found in scribed the isolation of a mouse K receptor cDNA the hydrophobic domains, particularly domains I, II, that had been isolated as a member of the related III, VI, and VII. The regions of greatest divergence somatostatin receptor family (Yasuda et al., 1993). In- included the amino and carboxyl termini of the pro- dependently, our laboratory, using DNA fragments tein, the region surrounding and including hydropho- homologous to the mouse 6 opioid receptor and low bic domain IV, and the region between hydrophobic stringency cDNA library screening, isolated and phar- domains V and VI. In addition to the seven hydropho- macologically characterized a rat K receptor cDNA bic domains classically associated with G protein- (Meng et al., 1993). The rat and mouse K receptors coupled receptors, the open reading frame contains contain seven transmembrane domains and are nega- several other features of this receptor family, includ- tivelycoupled toadenylatecyclase via G proteins. This ing potential N-linked glycosylation sites (five at amino report describes the cloning and characterization of acids 9,31, 38,46, and 53), palmitoylation sites (two at a homologous seven transmembrane domain protein amino acids 346 and 351), and three phosphorylation whose pharmacological profile and mRNA localiza- sites (protein kinase C phosphorylation at amino acid tion suggest that it is a rat t.r receptor. 363, calcium/calmodulin-dependent kinase phosphory- lation at amino acid 261, and CAMP-dependent protein Results kinase [protein kinase A] phosphorylation at amino acid 279). Isolation and Characterization of Rat p Receptor cDNA Clones Transient Transfection of CMV-pRMuR DNA Using random primed cDNA from rat olfactory bulb into COS-1 Cells and oligonucleotide primers (based upon transmem- Initial binding assays performed on COS-1 cells trans- branedomains III,V,VI,andVIIofthemouse6opioid fected with the pCMV-neo (a gift from Dr. Michael receptor mRNA [Evans et al., 1992; Kieffer et al., 1992]), Uhler, University of Michigan) expression vector con- amplified fragments were generated by the polymerase taining the full open reading frame of pRMuR-12 dem- chain reaction (PCR) and subcloned. One clone, p5A-1, onstrated the opioid nature of the encoded receptor. contained a DNA sequence that was 74% homologous [3H]DAMG0 bound with high affinity (Ko = 1.2 nM), at the nucleic acid level to the mouse8 opioid receptor whereas the selective K agonist [3H]U69,593 (n-(5a, mRNA sequence between transmembrane regions III 7a;8(3)-(+)-N-methyl-N-[7-(l-pyrroIidinyl)-l-oxaspiro-(4,5) and VI. The p5A-1 sequence was also similar (59% ho- dec-8-yllbenzeneacetamide) and the selective 8 ago- mology at the nucleic acid level) to several species nist [3H]DPDPE (cyclic (o-penicillamine*, o-penicilla- of somatostatin receptor mRNAs. A rat olfactory bulb mines) enkephalin) did not. To characterize this clone Rat F Opioid Receptor Cloning 905

Table 1. Pharmacological Profile of the Cloned Rat p Receptor

K, (nM) p ligands DAMGO 1.57 Morphine 7.14 Levorphanol 0.78 S ligands DADLE 6.56 DPDPE 4100.00 DSLET 541.63 K ligands E2078 2.87 U50,488 1464.00 U69,593 1910.00 Nonselective ligands EKC I .2a (-)Bremazocine 0.05 Enantiomers (+)Bremazocine >5000.0 Dextrorphan >5000.0

KU Pat LEAETRPLP...... Antagonists K Rat ...... D Mouse PI ...... CTAP 0.21 Naloxone 2.74 0.36 Figure 1. Amino Acids Comparison between the Rat B, Rat K, Naltrexone 3.90 and Mouse S Opioid Receptor Sequences nBNl The deduced amino acid sequence of the rat p receptor (Mu Using [‘HIDAMCO (1.6 nM) as the labeling ligand, competition Rat) is compared with the rat K (K Rat) and mouse 6 (D Mouse) studies were performed on membrane preparations from COS-1 receptors. Amino acids conserved in all three receptors are cells transiently transfected with pCMV-neo containing the full shown in bold. Putative transmembrane domains are under- open reading frame of pRMuR-12. See text for description of lined. The positions of potential N-linked glycosylation sites are ligands and abbreviations. indicated by closed arrows. Consensus recognition sites for pro- tein kinase C (asterisks), protein kinase A (open circle), and pal- mitoylation (open arrowheads) are also shown.

zocine and levorphanol bound with high affinity, but their enantiomers, (+)bremazocine and dextorphan, further, [3H]DAMG0 (1.6 nM) was used as a labeling respectively, bound with low affinity. ligand, and various IL-, 6-, and K-selective ligands and nonselective ligands were tested in competition stud- Northern Blot Analysis of p Receptor mRN.4 ies (Table 1). Several classic p-selective ligands had Figure 2 show results from total RNA and poly(A) RNA high affinities for the expressed receptor (morphine, from rat medullalpons as well as poly(A) RNA from K, = 7.14 nM; levorphanol, Ki = 0.78 nM), whereas 6 humanSY5Ycells(6~gforSY5Yand10~gformedulla/ (DSLET [(D-Ser2, LeuS)enkephalin-Thr], K, = 541.63 nM; pons) electrophoresed on 16% formaldehyde-agar- DPDPE, K, = 4,100.OO nM) and K (U50,488 [(trans)-3,4- ose (1%) gels hybridized with cRNA probes comple- dichloro-N-methyl-N-[2-(l-pyrrolidinyl)cyclohexyl] ben- mentary to p5A-1. Blots were hybridized and washed zene acetamide methanesulfonate], K, = 1464.00 nM; at high stringency. Lane 1 represents a short photo- U69,593, Ki = 1910.00 nM) ligands did not. DADLE graphic exposure of the SY5Y mRNA lane (lane 2). (o-Ala-o-Leu-enkephalin; Ki = 6.56 nM) and the syn- Lanes2and3arefroma44 hrautoradiogramdetecting thetic dynorphin (l-8) analog E2078 ((N-methyl-Tyrl, a single mRNA species in the rat medulla/pans mRNA N-a-methyl-Arg7,0-Leu8) dynorphin A-(1-8) ethylamide; sample and one prominent mRNA species in the hu- Ki = 2.87 nM) were also potent in displacing man SY5Y cellular mRNA sample. Although less clear, [3H]DAMG0. analysis of total RNA from rat medulla/pans tissue Several antagonists were also tested. Naloxone (Ki = (lane 4) identified a p receptor RNA species that comi- 2.74 nM), naltrexone (K, = 0.36 nM), CTAP (D-Pen-Cys- grated with the band seen in the poly(A) RNA (lane 3). Tyr-D-Trp-Arg-Thr-Pen-Thr-NH?; Ki = 0.21), and nBNl These mRNAs are approximately 12,000-14,000 and (nor-binaltrophine HCI; Ki = 3.90) all displaced 14,000-16,000 nucleotides in length, respectively. [3H]DAMG0 binding with high affinity. The expressed receptor also bound several nonselective opioid li- Genomic Southern Blot Analysis gands such as (-)bremazocine (K, = 0.05 nM) and EKC Figure 3 show results from analysis of rat genomic (ethylketoclazocine; Ki = 1.28 nM) with high affinity. DNA (20 pg per restriction enzyme diges#t) digested Furthermore, ligand binding to the transiently ex- with restriction enzymes, electrophoresed on 0.8% pressed receptor clone was stereospecific. (-)Brema- agarose gels, and hybridized with random hexamer- Neuron 906

123 4

-10 2.37- I -5

-3

0.24- -2

-1 Figure 2. Northern Blot Analysis of Rat p Receptor mRNA in Rat Medulla/Ports and SY5Y Cells Poly(A) RNA (6 pg for SY5Y [lane 1 and 21 and IO ug for medulla/ pons [lane 31) and total RNA (20 ug for medulla/pans [lane 41) was electrophoresed on formaldehyde-agarose (1%) gels, trans- ferred to nylon membrane, and hybridized (overnight) at 6OT in 50% formamide, 1 x HYB buffer. cRNA probes complementary to p5A-1 (see text) were used at approximately 2 x IO6 cpms of cRNA per ml of hybridization solution. Blots were washed in progressively decreasing SSC solutions (final concentrations of 0.1 x SSC, 0.5% SDS) at 72T for 2 hr. Lane 1 represents a short photographic exposure of the SY5Y mRNA in lane 2. Lanes 2 and 3 represent exposures generated using two intensifying screens Figure 3. Cenomic Southern Blot of Rat or Receptor at -7OT for 44 hr. Lane 4 represents an exposures using two intensifying screens at -70°C for 7 days. Molecular weights were Rat genomic DNA (20 ug per restriction enzyme digest) was di- determined using an RNA ladder (BRL). gested with the indicated enzymes. Random hexamer priming of the full 2.0 kb cDNA from pRMuR-I2 was used as a probe. Blots were washed in decreasing SSC solutions (final concentra- tions of 0.1 x SSC, 0.5% SDS) at 60°C for 30 min. Exposures were primed 2.0 kb cDNA from pMuR-12 as a probe under performed using two intensifying screens at -70°C for 48 hr. Molecular weights were determined using an DNA ladder (BRL). high stringency conditions. Several DNA bands were detected. Two bands were detected in the BamHl and Pstl lanes, consistent with the presence of these re- striction endonuclease siteswithin thecDNAsequence. studies. A thin layer of cells expressing the p receptor Multiple hybridization-positive bands were detected mRNA was observed in the deepest extents of layer in the Hindlll and EcoRl lanes. There were no internal VI, and no cells were detectable in layers I and IV, as EcoRl sites and only one Hindlll site found within was demonstrated with receptor binding. Low levels the cDNA probe sequence. The presence of introns of l.r receptor mRNA could be detected in the piriform separating the 2.0 kb cDNA sequence into multiple and cingulate cortex and the deep layer of the entorhi- exons would be consistent with the observed hybrid- nal cortex. v receptor mRNA was expressed at high lev- ization pattern in these two lanes. The presence of els in the striatal patches and the subcallosal streakven- two hybridization-positive bands in the BamHl and tral to the corpus callosum (Figure 4A). The f.r striatal Pstl lanes suggests that there is one p receptor gene patches were most prominent in the rostra1 and lateral in the rat genome. extents of the caudate-putamen and extended ventrally into the nucleus accumbens, where theywere the most Distribution of the p Receptor mRNA dense in the medial and ventral shell. Specific hybrid- In the olfactory bulb, from which the p receptorcDNA ization was also observed in the striatal matrix; how- clone was derived, p receptor mRNA was localized to ever, expression levels were comparatively reduced. the internal granular and glomerular layers. More laterally, the cells of the medial septum ex- Neocortical areas such as the parietal and temporal pressed high levels of u receptor mRNA. cortices did not demonstrate the same receptor distri- Scattered cells expressing high levels of f.r receptor bution, as might be expected from receptor binding mRNA were seen in the bed nucleus stria terminalis Rat n Opioid Receptor Cloning 907

demonstrating a low level of ~1 receptor binding and enkephalinergic projections. Of the diencephalic structures expressing the TVre- ceptor mRNA (Figure 4B), highest levels are observed in several thalamic nuclei, including the medial ha- benula, dorsomedial, ventrolateral, central, reuniens, and medial geniculate nuclei of the thalamus. Bycom- parison, the vast majority of hypothalamic nuclei, in- cluding the paraventricular, periventricular, supraop- tic, suprachiasmatic, ventromedial, and dorsomedial, did not appear to have cells that expressed t.t opioid receptor mRNA. Scattered cells expressing moderate levels of p receptor mRNA were seen in the lateral hypothalamus and the mammillary nuclei. In the hippocampus (Figure 4B), j.r receptor mRNA expression was observed in the pyramidal cell layer of the hippocampal formation and the granular cells of the dentate gyrus. As can be seen from the high magnification image of CA2 cells in Figure 5A, p recep- tor mRNA expression was heterogeneous in the pyra- midal cell layer; either not all cells expressed this gene or the cells expressed it at markedly reduced levels. It is unclear presentlywhat the functional significance of this heterogeneity may be. Several amygdaloid nuclei expressed the u receptor mRNA, including the medial, basolateral, and cortical nuclei (Figure 48). Levels were highest in the medial, posterior medial cortical amygdala, and intercalated nuclei of the basolateral amygdala. In the midbrain (data not shown), or receptor mRNA was observed in the ventral and lateral periaquaductal gray, a region known to subserve a role in pain and analgesia. j.r receptor mRNA expression did extend to the pontine central gray. Low levels of w receptor mRNA were also observed in scattered cells of the ventral tegmental area and substantia nigra, pars com- pacta. Cells expressing p receptor mRNA were also local- ized in the superior and inferior colliculi. Within the superior colliculus, p receptor mRNA was primarily found in the large cells of the intermediate gray layer and in the inferior colliculus, cells of both the external cortex and the central nucleus express p receptor Figure 4. Dark-Field Autoradiograms Demonstrating the Distri- mRNA. bution of p Receptor mRNA at Three Levels of the Rat Brain The large cells of the red nucleus and the rostral, (A), (B), and (C) are sections through three levels of the brain. p receptor mRNA is expressed in the striatal patches of the cau- central, and lateral interpeduncular nuclei expressed date-putamen (CPU) and nucleus accumbens (ACB), subcallosal kt receptor mRNA. As can be seen in Figure 5B, the streak, olfactory tubercle, several nuclei of the thalamus, includ- highest density of cells expressing u receptor mRNA ing the medial habenula (Hb), the medial dorsal (MD), and the were in the rostra1 division, with scattered cells in the central (CM) nuclei, hippocampus (HPC), dentate gyrus, basolat- central division. The levels of p receptor mRNA ex- eral amygdala, medial amygdala (Me), locus ceruleus (LC) and parabrachial nucleus (PB). pression in the lateral interpeduncular nucleus was low compared with other subdivisions. Several brain stem nuclei expressed ).I receptor and the medial preoptic area. In the medial preoptic mRNA. Highest levels were observed in the locus cer- area, the highest density of cellsexpressing p receptor uleus and parabrachial nuclei (Figure 4C; Figure 5C). mRNA were observed in the anterior ventral division This distribution was consistent with the ability of ).I in the anterior medial preoptic and more posteriorly opioid drugs to modulate norepinephrine release and in the medial preoptic nucleus itself. to affect the levels of behavioral arousal. Scattered Scattered cells expressing f.t receptor mRNA were u-expressing cells were observed in the sensory and also seen in the globus and ventral pallidum, regions motor trigeminal, medial cerebellar, vestibular, and NC3JPXl 908

of expression were far higher in the median raphe. The nucleus of the solitary tract also demonstrated high levels of u receptor mRNA and has been shown to be associated with cardiovascular, gustatory, and respiratory functions. Moderate to high levels of p receptor expression were also observed in cells of the cuneate, gracilis, and vagus nuclei (Figure 6). Figure 6A shows a low magnification in situ hybridization image of the u re- ceptor mRNA distribution in the medulla, with the gracilis, vagus, and cuneate nuclei highlighted in boxes. As can also be seen from Figure 6A, the large cells of the medulla reticular nucleus also expressed u recep- tor mRNA. In the spinal cord, the highest levels of opioid recep- tor binding were found in layers I and II, and only very low levels of u receptor mRNA could be found in the spinal cord. However, as can be seen in the coronal section of spinal cord in which the dorsal root ganglia were also transected, high levels of p receptor mRNA were found in the cells of the dorsal root gan- glia that project to layers I and II of the dorsal horn (Figure 7). To control for potential cross-hybridization between this u receptor cDNA sequence and other closely re- lated receptors (K and 6 opioid receptors and somato- statin receptors), cRNA probes directed to different regions of the pRMuR-12 protein (both to transmem- brane domains Ill-VI and to the 5’ untranslated/N- terminus regiomwere used. In both cases, cRNA probes revealed indistinguishable mRNA distributions.

Discussion

The results of the present study demonstrate that we have cloned a novel member of the G protein-cou- pled receptor family that can be identified as a rat j.r opioid receptor. This conclusion is based on the following observations: First, the cloned receptor in- teracts with several classic opioid ligands, such as morphine, naltrexone, naloxone, levorphanol, and bremazocine, and their relative affinities are consis- tent with its opioid nature. Second, binding data show that the protein encoded by pRMuR-12 has a high affinity for the u agonist DAMGO and the u antagonist CTAP, whereas it has very low affinity for K-selective Figure 5. Dark-Field Photomicrographs of In Situ Hybridization U50,488 and U69,593 and S-selective DPDPE. Third, Showing Cells Expressing p Opioid Receptor mRNA in the CA2 the receptor exhibits the predicted stereospecificity, Field of the Hippocampus, lnterpeduncular Nucleus, and Locus recognizing (-)bremazocine and levorphanol with af- Ceruleus finities several orders of magnitude higher than the Note The high levels of expression in select cells of CA2 and in affinities for their respective enantiomers, (+)brema- the rostra1 subdivision of the interpeduncular nucleus (IPR). LC, locus ceruleus. Bar, 100 pm. zocine and dextrorphan. Fourth, the rank orders of agonist and antagonist binding are consistent with previously described in vivo pharmacology reported facial nuclei, in the rostra1 olive, and in widely distrib- for p receptors. Finally, the anatomical distribution uted cells of the recticular pontine. No p receptor of the mRNA coding for this receptor is in agreement expression was found in the hypoglossal and cochiear with the distribution of u receptor binding as defined nuclei. with pharmacological ligands. Taken together, these Scattered cells of the raphe magnus and median results provide compelling evidence that the present raphe also expressed p receptor mRNA, but the levels clone encodes a rat u opioid receptor. Rat p Opioid Receptor Cloning 909

Figure 6. Dark-Field Photomicrographs of p Receptor mRNA Expression Detected in the Caudal Rat Medulla Using In Situ Hy- bridization (A) Low magnification image with regions of the gracilis (B), vagus (C:I, and cuneate (D) nuclei highlighted in boxes. High mag- nifications of the cells in each nucleus are provided in the corresponding panels. Notealso p receptor expression in the scat- tered cells of the medulla reticular forma- tion, ventral and lateral to the vagus nu- cleus. Bar, 100 pm.

Several reports have suggested the presenceof mul- regions are the transmembrane domains and the in- tiple receptor subtypes referred to as ~1 and ~2. ~1 tracellular loops. Putative transmembrane domains II, receptor sites are defined as having high affinity (be- III, and VII are very similar among the three opioid low 1 nM) for the p and 6 ligands DAMGO, morphine, receptors, followed by transmembrane domains I, V, DADLE, and DSLET and may be preferentially im- and VI, with transmembrane IV being the least con- portant in mediating analgesia. ~2 sites are defined served.The highdegreeof homologyamonetheintr+ by the ability of these same compounds to bind with lower affinity (I-IO nM), with DAMGO having the highest affinity and morphine and DADLE having slightly lower affinities. If one accepts this classifica- tion, our cDNA clone appears to fit best with the ~2 subtype of p receptors. Until a second p receptor type is isolated and cloned, these assignments should re- main tentative. It was interesting to note that nBNI, the K-selective antagonist, has a high affinity for the transiently ex- pressed rat p receptor. However, this should be viewed in relation to the affinity of nBNl for the cloned K receptor. When the rat K receptor is transiently trans- fected into COS-1 cells, nBNl demonstrates approxi- mately II-fold greater affinity for the rat K receptor (Ki = 0.26 nM for K versus K, = 2.87 nM for p) (Meng et al., 1993). These results compare well with nBNl’s relative lack of selectivity in in vitro binding studies Figure 7. Dark-Field Autoradiogram of p Receptor mRNAExpres- and point to the usefulness of comparing the pharma- sion in the Spinal Cord and Dorsal Root Ganglion Detected Us- cology of opioid ligands in transiently transfected cell ing In Situ Hybridization systems expressing an individual receptor. Thoracic spinal cord and its attached dorsal root ganglia were Amino acid sequence comparisons of all three opi- simultaneously dissected, frozen, sectioned, and subjected to in situ hybridization procedure (see Experimental Procedures). oid receptors indicated that the p receptor has a high The spinal cord found between the two dorsal root ganglia in degree of homology with the recently cloned mouse the figure demonstrates comparatively little p receptor mRNA 6 and rat K opioid receptors. The most homologous and is difficult to see at this film exposure. NellrOn 910

cellular loops of the 6, xl, and p receptors suggests stringency. We are currently using DNA fragments that the receptors may share similar second messen- from different regions of the rat p receptor cDNA to ger systems, since the intracellular loops are thought determine whether these fragments identify the same to be critical for the coupling of this receptor family mRNA species in this human cell line. It is interesting to G proteins (Clark et al., 1989). Additionally, many to note that in the g-expressing cell line NC108 five to of the potential posttranslational features thought to six mRNA species were detected, although it appears be involved in the regulation of other receptors also that only two mRNAs are found in brain tissue. appear to be conserved in opioid receptors. In addi- Genomic Southern blot analysis of rat DNA using tion to the general presence of N-terminal glycosyla- thefull cDNA isolated from pRMuR-12 (approximately tion sites, p receptor phosphorylation sites at amino 2.0 kb) indicates several interesting features of the acid279(protein kinaseA)andaminoacid363(protein structure of the rat u receptor gene. First, the hybrid- kinase C) and a palmitoylation site at amino acid 346 ization pattern in the BamHl and Pstl digests is con- appear to be conserved across opioid receptor pro- sistant with the hypothesis that a single p receptor teins. One of these sites, Th?“, in the p receptor gene exists in the rat genome. Second, there appears corresponds to a similar phosphorylation site in the to be several introns separating the 2.0 kb cDNA. This B-adrenergic receptor. In the B-adrenergic receptor, is deduced from the multiple hybridization-positive this phosphorylation site is thought to be critical in bands in the EcoRl and Hindlll digest lanes seen in agonist-induced desensitization mediated via G, acti- Figure3.Thereare noEcoRl sitesandonlyone Hindlll vation and elevation of CAMP levels, wherebythis site site in the 2.0 kb cDNA fragment used as a hybridiza- is phosphorylated, causing the dissocation of the re- tion probe, although several hybridization-positive ceptor from the G protein (Clark et al., 1989). This site is bands are detected. Approximately, three to five bands completely conserved among the three known classes are detected in the EcoRl lane, and five bands are of opioid receptors despite the fact that opioid recep- detected in the Hindlll lane,although onecannot rule tors inhibit the generation of CAMP. Further studies out the possibilitythat some of these bands represent will be needed to investigate the precise role, if any, incomplete enzyme digests. In isolating cDNA clones of this conserved and putative phosphorylation site encoding the rat p receptor, one unusual cDNA clone in opioid receptors. appeared to contain an intron near the transmem- Regions of divergence include the amino and car- brane IV location. Whether this cDNA clone contains boxy1 termini of the protein, as well as extracellular an authentic intron or represents a cloning artifact is loops II and III. This sequence heterogeneity in these currently being evaluated. Interestingly, the mouse S receptor domains is particularly striking and may be opioid receptor gene has an intron in a very similar useful not only for discriminating opioid from non- location (Evans, personal communication). Isolation opioid receptors (e.g., opioid from somatostatin), but and characterization of rat genomic clones will ad- also for discriminating opioid receptor types (K from dress the complete structure of the ).I receptor gene. 6 from p), as several of these regions are thought to ~1 receptor mRNA is expressed in many regions and be on the extracellular surface of the protein and may nuclei throughout the CNS. The high level of pRMuR- be involved in ligand selectivity. The notion that such 12 mRNA in theolfactory bulb, striatal patches, subcal- extracellular domains may play an important role in losal streak, thalamus, medial preoptic area, amygdala, determining ligand binding and ligand selectivity for interpeduncular, locus cerulus, parabrachial, cuneate, peptide receptors was elegantly demonstrated in a gracilis, and vagus nuclei, as well as in the nucleus of series of studies on luteinizing hormone and follicle- the solitarytract, isconsistentwith the known p-binding stimulating hormone receptors (Braun et al., 1991; site distribution (Mansour et al., 1987; Mansour and Roche et al., 1992). Watson, 1993; McLean et al., 1986; Temple and Zukin, Rat u receptor mRNA detected by Northern blot 1987) and the behavioral and pharmacological effects analysis is shown in Figure 2. Analysis of total RNA thought to be mediated by these receptors, including from many regions of the rat brain generated weak analgesia, respiration, cardiovascular effects, and hor- signals but indicated thatthe medulla/pans contained monal regulation. The visualization of p opioid recep- the greatest amount of p receptor mRNA and was cho- tor mRNA in the locus cerulus, ventral tegmental area, sen for poly(A) mRNA purification. A single large mo- and substantia nigra, pars compacta is consistent with lecular weight mRNA of approximately 12,000-14,000 the ability of p ligands to modulate presynaptic nor- nucleotides was detected in this poly(A) RNA from epinephrine and dopamine release and may be criti- the medulltipons. Human SY5Y cellular mRNA was cal in behavioral arousal and reward systems. also analyzed because of the presence of p receptors In situ hybridization results shown in Figure 7 sug- in this cell line (as well as S receptors). It appears that gest that while opioid receptor binding is localized a prominent mRNA of approximately 14,000-16,000 predominantly in layers I and II of the spinal cord nucleotides is detected in this human cell line in addi- (Besse, 1991), b receptor mRNA is found predominantly tion to several other smaller mRNA species. It is un- in the dorsal root ganglia. This suggests that the vast clear at this time whether these additional mRNAs are majority of u receptors are likely transported from u receptor forms or represent nonspecific hybridiza- their site of synthesis in the dorsal root ganglia and tion, even though these blots were hybridized at high are localized in presynaptic terminals in layers I and II Rat p Opioid Receptor Cloning 911

of the spinal cord. This agrees well with lesion results plated according to the manufacturer’s recommendations (Stra- (Besse et al., 1990), in which dorsal rhizotomy produced tagene). Approximately 3.2 x 106 cDNA clones, were plated, and replicate nitrocellulose membranes were screened with a a 76% decrease in p receptor binding in the spinal cord. 32P-radiolabeled random-primed DNA insert from p5A-1 (432 bp). Low p receptor mRNA expression is also found in the Prehybridization and hybridization conditions were 50% for- dorsal horns of the spinal cord itself, consistent with mamide, 1 x hybridization buffer (5x SSC, 50 mM KHP04 [pH the presence of postsynaptic receptor sites. 7.01, 1 x Denhardt’s solution, 0.1% PP04, 0.1% SDS, 200 pg/ml During the preparation of this paper, Chen et al. yeast RNA) at 37OC for 16-18 hr. Twelve positive clones were obtained and plaque the purified. DNA inserts were rescued (1993) reported the cloning and pharmacological char- into plasmid using the Ml3 helper phage Exassist (Stratagene). acterization of a w receptor also isolated from rat brain. Restriction mapping and Southern blot analysiswere performed The DNA sequence reported in this paper appears on rescued plasmid DNA. One clone, designated pRMuR-12, to be almost identical to the our b receptor cDNA demonstrated a strong hybridization signal on Southern blot analysis and contained a cDNA insert of approximately 2.0 kb. sequence, differing in the translation of only 1 amino Various restriction enzyme digestion fragment of clone pRMuR- acid residue (valine for isoleucine substitution in trans- 12 were subcloned into Bluescript and completely sequenced membrane region V). These authors also report ago- in both orientations. An EcoRI-Hindlll fragment was shown to nist and antagonist binding profiles for their p recep- contain the entire open reading frame of this cDNA. DNA se- tor expressed in COS-7 cells. Many similarities are quence data were analyzed by the GCG package (Genetics Com- puter Group, 1991). The DNA sequence of pRMuR-12 has been evident; however, they do not report binding for mor- submitted to CenBank under accession number L22455. phine. Additionally, these authors demonstrate that their p receptor is functionally coupled to the inhibi- Expression of Receptor and Binding Assay tion of adenylate cyclase in the transiently transfected Initial binding assays performed on COS-1 cells transfected with cells. the pCMV-neo expression vector containing the full open read- In summary, we have reported the isolation and ing frame of pRMuR-12 documented the opioid nature of the characterization of a rat receptor cDNA whose phar- encoded receptor. For binding assays, 25 pg of plasmid DNA was transfected into each 100 mm dish of COS-1 cells using the macological profile and anatomical distribution are method of Chen and Okayama (1987). Receptor binding of the consistent with the previously characterized p recep- membrane preparation of the transfected cells was performed tor. RNA analysis demonstrated that the rat and possi- according to Goldstein and Naidu (1989). [‘H]IJ69,593 (58 Ci/ bly the human p receptor mRNAs are large molecular mmol; NEN), [3H]DAMG0 (55 Ci/mmol; NEN), and [SH]DPDPE weight species. Genomic DNA analysis in the rat sug- (34.3 Cilmmol; NEN) were used in the characterization of the receptor. Nonspecific binding was defined as the binding of radie gests that the rat ~1 receptor gene is found in a single ligand in the presence of 1 PM levorphanol. PH]DAMGO (1.6 nM) copy with several introns. The availability of cloned was used to label the receptor in competition studies. All assays opioid receptorswill greatlyenhanceour understand- were conducted in 50 mM Tris buffer (pH 7.4) at room tempera- ing of the functions of these receptors in vivo, as well ture. Receptor binding results were analyzed with the LIGAND program (Munson and Rodbard, 1980). as provide for the systematic development of more selective agonists and antagonists. Developing ligands that can discriminate between various members of Northern and Southern Blot Analyses RNA was isolated using standard guanidinium thiocyanate ex- the opioid receptor family as well as between sub- tractions with subsequent poly(A) RNA chromatography using classes within an opioid receptor group could pro- Fastrack (Invitrogen) kits. Poly(A) RNA (6 pg for ‘SYSY and 10 pg duce reagents that induce analgesia without many of for medulltipons) was electrophoresed on 16% formaldehyde- the side effects (e.g., tolerance and dependence). agarose (1%) gels, transferred to nylon membrane (Nytran, Schlei- cher & Schuell, Inc.), UV cross-linked, prehybridized (2 hr), and hybridized (overnight) at 60°C in 50% formamide, 1 x HYB buffer Experimental Procedures (5x SSC, 50 mM NaP04 [pH 7.41, 0.1% NaPPOd, 5x Denhardt’s solution, 0.5% SDS). cRNA probes complementary to pSA-1 (see Isolation of Opioid Receptor Fragment text) were generated using standard transcription methods and Oligonucleotide primers complementary to regions encoding T7 RNA polymerase. Approximately, 2 x IO6 cpms of cRNA were transmembranedomains III,V,VI,andVII ofthemouseSopioid used per ml of hybridization solution. Blots were washed in pro- receptor DNA sequence were designed and used in PCR. Pri- gressively decreasing SSC solutions, with final concentrations mer 1 (TM 3), AAGAATTCTCAACATCATGAGCCTGCACCCCTACCCTAC; of 0.1 x SSC, 0.5% SDS, at 72°C for 2 hr. DNA was isolated from primer 2 (TM S), AAGAATTCCCAACCTGCTCCCGATCCTCAT- rat liver tissue, crushed on liquid N2, resuspended in proteinase CATC; primer 3 (TM 6), AAAAGCTTCCACACCATGACGAAGAT- K buffer (50 mM Tris [pH 7.51, 0.5% SDS, 5 mM IiDTA), digested CTGCATCGC; primer 4 CTM 7), AAAACCTTITAACGGGAACGT- for 3 hr, and gently extracted several times with phenol prior to CGGGTAGGTCAGGCGGCAGCCCCACC. The PCR DNA tem- RNAase treatment. These nucleic acid samples were reextracted platewas first strand cDNA from rat olfactory bulb mRNA gener- with phenol-chloroform and ethanol precipitated. DNA was di- ated with random hexamers using the Promega RiboClone cDNA gested overnightwith the indicated enzymes under manufacturer’s Synthesis system. The PCR products were subcloned into a T-tailed recommended conditions. These digests were emlectrophoresed vector system (Novagen) and sequenced using Sequenase (USB). on 1 x Tris borate EDTA, 1% agarose gels, acid nicked (30 min, Upon DNA sequencing, one amplified DNA fragment (432 bp) 0.25 M HCI), denatured (2 x 30 min; 0.5 M NaOH, 1.5 M NaCI), was shown to be 74% homologous to the NC108 8 opioid recep- neutralized (2 x 30 min; 0.5 M Tris [pH 7.41, 1.5 M NaCI), and tor mRNA from transmembrane regions III-VI. The DNA insert transferred to nylon membranes (Nytran, Schleicher & Schuell, from this clone (designated p5A-1) was used for screening cDNA Inc.)inlOx SSCovernight. BlotswereUVcross-linkedand baked libraries and as a template to synthesize cRNA probes used for at80°C undervacuum for 1.5 hr, prehybridized (21hr), and hybrid- in situ hybridization. ized at 37OC in 50% formamide, 1 x HYB buffer (see above) over- night. Random hexamer priming of the full 2.0~ kb cDNA from Library Screening and Sequencing pRMuR-12 was used as a probe at a concentration of 1.0 x IO6 A rat olfactory bulb ZQAPII cDNA library was purchased and cpm per ml of hybridization buffer. Blots were washed in de- NeUrO” 912

creasing SSC solutions (final concentrations of 0.1 x SSC, 0.5% stimulation of brain GTPase by opiates in normal and dependent SDS) at 60°C for 30 min. rats. Biochem. Biophys. Res. Commun. 127, 641-648. Besse, D., Lombard, M. C.,Zajac, J. M., Roques, B. P., and Besson, In Situ Hybridization J. M. (1990). Pre and postsynaptic distribution of p, S, and K Adult male Sprague-Dawley rats (20-25 g; Charles River) were opioid receptors in the superficial layers of the cervical dorsal sacrificed by decapitation. The brains were then dissected and horn of the rat spinal cord. Brain Res. 521, 15-22. frozen in liquid isopentane (-3OOC) for 30 s and transferred to Beese, D., Lombard, M. C., and Besson, J. M. (1991). Autoradio- dry ice. Frozen brains were stored at -80°C until sectioning on graphic distribution of p, 6, and K opioid binding sites in the a Bright cryostat (15 urn). Brain sections were thaw mounted on superficial dorsal horn, over the rostrocaudal axis of the rat spi- precleaned and polylysine-subbed microscope slidesand stored nal cord. Brain Res. 548, 287-291. at -80°C. Frozen brain sections were directly removed from storage at Bidlack, J. M., and Abood, L. C. (1980). Solubilization of the opiate -80°C and placed into 4% formaldehyde for 60 min (22°C) prior receptor. Life Sci. 27, 331-340. to processing for in situ hybridization (Mansour et al., 1990). Braun, T., Schofieid, P. R., and Sprengel, R. (1991). Amino- Following three 5 min rinses in 2x SSC (300 mM NaCI, 30 mM terminal leucine-rich repeats in gonadotropin receptors deter- sodium citrate [pH 7.2]), sections were treated with proteinase mine hormone selectivity. EMBO J. 70, 1885-1890. K (1 Kg/ml in 100 mM Tris [pH 8.01, 50 mM EDTA) for 10 min Chen, C., and Okayama, H. (1987). High efficiency transforma- at 37OC. Slides were then rinsed in water, followed by 0.1 M tion of mammalian cells by plasmid DNA. Mol. Cell. Biol. 7,2745- triethanolamine (pH 8.0), and treated with a mixture of 0.1 M 2752. triethanolamine (pH 8.0) and acetic anhydride (400:1, v/v) with Chen, Y., Mestek, A., Liu, J., Huriey,J. A., and Yu, L. (1993). Molec- stirring for 10 min. The sections were then rinsed in water, dehy- ular cloning and functional expression of a p-opioid receptor drated through graded alcohols, and allowed to air dry. from rat brain. Mol. Pharmacol. 44, 8-12. Rat brain sections were hybridized with [3SS]UTP- and [3SS]CTP- Cho,T. M., Yamato, C., Cho,J. S., and Loh, Ii. H. (1981). Solubiliza- labeled riboprobes generated to the pRMuR-12 clone. The TVre- tion of membrane bound opiate receptors from rat brain. Life ceptor cRNA was generated from a PCR fragment subcloned into Sci. 28, 2651-2657. pCEM4Z (designated p5A-1) and corresponds to transmembrane regions III-VI of the receptor. As p5A-1 was produced using Cho, T. M., Hasegawa, J.-l., Ge, B.-L., and Loh, H. H. (1986). Purifi- mouse 8 opioid receptor mRNA primers, we also used a 759 bp cation to apparent homogeneity of a p-type opioid receptor from EcoRI-BamHI cDNA fragment derived from the 5’ region of the rat brain. Proc. Natl. Acad. Sci. USA 83, 4138-4142. pRMuR-12 cDNA clone. These two probes generated indistin- Chow, T., and Zukin, R. S. (1983). Solubilization and preliminary guishable mRNA distributions. cRNA probe was diluted in hy- characterization of mu and kappa opiate receptor subtypes from bridization buffer(75% formamide, 10% dextran sulfate, 3x SSC, rat brain. Mol. Pharmacol. 24, 203-212. 50 mM Na2P0, [pH 7.4],1 x Denhardt’s solution, 0.1 Fgiml yeast Clark, R. B., Friedman, J., Dixon, R. A., and Strader, C. D. (1989). tRNA, 10 mM dithiothreitoi) to give a final concentration of 1 x Identification of a specific site required for rapid heterologous IO6 to 2 x IO6 cpmi30 ~1. Diluted probe was applied to coronal desensitization of the beta-adrenergic receptor by cAMP-depen- (40 ul) and horizontal (100 ul) sections. Glass coverslips were dent protein kinase. Mol. Pharmacol. 36, 343-348. placed over brain sections to keep cRNA probes and hybridiza- Demoliou-Mason, C., and Barnard, E. A. (1984). Solubilization of tion buffer in contact with tissue. high yield of opioid receptors retaining high-affinity delta, mu Slides were then transferred to chambers containing 50% for- and kappa binding sites. FEBS Lett. 170, 378-382. mamide and hybridized at 55”C, overnight. The slides were then rinsed in 2x SSC (5 min) and treated with RNAase A (200 ugi Evans, C. J., Keith, D. E., Morrison, H., Magendro, K., and Ed- ml in 100 mM Tris [pH 8.01, 0.5 M NaCI) for 60 min at 37OC. wards, R. H. (1992). Cloning of a delta opioid receptor by func- Subsequently, the sections were rinsed in 2x SSC for 5 min tional expression. Science 258,1952-1955. (22OC) and 0.1 x SSC for 60 min (65°C). Following the low salt Genetics Computer Group (1991). Program Manual for the CCC wash, sections were rinsed in water, and dehydrated through Package (Madison, Wisconsin: University of Wisconsin Press). graded alcohols, and air dried. Sections were apposed to Kodak Gilbert, P. E., and Martin, W. R. (1976). The effects of morphine- XAR-5 X-ray film for 1-11 days or dipped in NTB2 film emulsion and nalorphine-like drugs in the nondependent, morphine- and developed 3-14 days later. dependent and cyclazocine-dependent chronic spinal dog. J. Pharmacol. Exp. The:. 798, 66-82.

Acknowledgments Gillan, M. C. C., and Kosterlitz, H. W. (1982). Spectrum of the mu, delta, and kappa binding sites in homogenates of rat brain. The authors would like to thank Dr. James Woods for providing Br. J. Pharmacol. 77, 461-469. the unlabeled opioid compounds used in this study and Drs. Goldstein, A., and James, I. F. (1984). Site-directed alkylation of Bianca Ruzicka and Charles A. Fox for their critical reading and multiple opioid receptors. II. Pharmacological selectivity. Mol. helpful discussion of this manuscript. This work was supported Pharmacol. 25, 343-348. by NIDA Grant ROI DA02265 to H. A. and S. J. W., by Markey Goldstein, A., and Naidu, A. (1989). Multiple opioid receptors: Grant (from the Lucille P. Markey Charitable Trust) #88-46 to ligand selectivity profiles and binding site signatures, Mol. Phar- H. A. and S. J. W., and by Gut Center Grant P30-AM34933 to macol. 36, 265-272. H. A. and S. J. W. Herling, S., and Woods, J. H. (1984). Discriminative stimulus ef- The costs of publication of this article were defrayed in part fects of narcotics: evidence for multiple receptor-mediated ac- by the payment of page charges. This article must therefore be tions. Life Sci. 28, 1571-1584. hereby marked “advertisement” in accordance with 18 USC Sec- Howells, R. D., Cioannini, T. L., Hilier, J. M., and Simon, E. J. tion 1734 solely to indicate this fact. (1982). Solubilization and characterization of active binding sites from mammalian brain. J. Pharmacol. Exp. Ther. 222, 629-634. Received July 22, 1993; revised August 25, 1993. Hsia, J. A., Moss, J., Hewlett, E. L., and Vaughan, M. (1984). ADP- References ribosylation of adenylate cyclase by pertussis toxin. effects on inhibitory agonist binding. J. Biol. Chem. 259, 1086-1090. Attali, B., Saya, D., and Vogel, Z. (1989). Kappa-opiate agonists lyengar, S., Kim, H. S., and Wood, P. L. (1986). Effects of K opiate inhibit adenylate cyclase and produce heterologous desensitiza- agonists on neurochemical and neuroendocrine indices: evi- tion in rat spinal chord. J. Neurochem. 5.2, 360-369. dence for K receptor subtypes. Life Sci. 39, 637-644. Barchfeld, C., and Medzihradsky, F. (1984). Receptor-mediated James, I. F., and Goldstein, A. (1984). Site-directed alkylation of Rat p Opioid Receptor Cloning 913

multipleopioid receptors. I. Binding selectivity. Mol. Pharmacol. tides. Endocrinology 737, 268-274. 25, 337-342. Rothman, R. B., Jacobson, A. E., Rice, K. C., and Herkenham, M. Kieffer, B. L.,Befort, K.,Caveriaux-Ruff,C.,and Hirth, C.C.(1992). (1987). Autoradiographic evidence for two classes of p opioid The&opioid receptor: isolation of acDNA by expression cloning binding sites in rat brain using [‘251]FK33824. Peptides 8, 1015- and pharmacological characterization. Proc. Natl. Acad. Sci. USA 1021. 89, 1204812052. Ruegg, U. T., Hiller, J. M., and Simon, E. J. (1980). Solubilization Koski, G., and Klee, W. (1981). Opiates inhibit adenylate cyclase of an active opiate receptor from Bufo marinus. Eur. J. Pharmacol. by stimulating CTP hydrolysis. Proc. Natl. Acad. Sci. USA 78, 64, 367-368. 4185-4189. Schofield, P. R., McFarland, K. C., Hayflick, J. S., Wilcox, J. N., Leander, J. D., Zerbr, R. L., and Hart, j. C. (1985). Diuresis and Cho, T. M., Roy, S., Lee, N. M., Loh, H. H., and Seeburg, P. H. suppression of vasopressin by kappa opioids: comparison with (1989). Molecular characterization of a new immunoglobulin su- mu and delta opioids and clonidine. J. Pharmacol. Exp. Ther. perfamily protein with potential roles in opioid binding and cell 234, 463-469. contact. EMBO J. 8, 489-495. Lutz, R. A., and Pfister, H. P. (1992). Opioid receptors and their Simon, E. J. (1991). Opioid receptors and endogenous opioid pharmacological profiles. J. Receptor Res. 72, 267-286. peptides. Medicinal Res. Rev. 77, 357-374. Maneckjee, R., Zukin, R. S., Archer, S., Michael, J., and Osei- Simon, E. J., Hiller, J. M., and Edelman, I. (1975). Solubilization of Gyimah, P. (1985). Purification and characterization of the p opi- a stereospecific opiate-macromolecular complex from rat brain. ate receptor from rat brain using affinity chromatography. Proc. Science 790, 389-390. Natl. Acad. Sci. USA 82, 594-598. Simonds, W. F., Koski, C., Streaty, R. A., Hjelmeland, L. M., and Mansour, A., and Watson, S. J. (1993). Anatomical Distribution Klee, W. A. (1980). Solubilization of active opiate receptors. Proc. of Opioid Receptors in Mammalians: An Overview (Berlin: Natl. Acad. Sci. USA 77, 4623-4627. Springer-Verlag). Temple, A., and Zukin, R. S. (1987). Neuroanatomical patterns Mansour, A., Khachaturin, H., Lewis, M. E., Akil, H., and Watson, of the p, 8, and K opioid receptors of rat brain as determined S. J. (1987). Autoradiographic differentiation of mu, delta, and by quantitative in vitro autoradiography. Proc. INatl. Acad. Sci. kappaopioid receptors in the rat forebrain and midbrain. J. Neu- USA 84, 4308-4312. roscience 7, 2445-2464. Ueda, H., Harada, H., Misawa, H., Nozaki, M., and Takagi, H. Mansour, A., Khachaturian, H., Lewis, M. E.,Akil, H.,and Watson, (1987). Purified opioid p-receptor is of a different molecular size S. J. (1988). Anatomy of CNS opioid receptors. Trends Neurosci. than 8- and x-receptors. Neurosci. Lett. 75, 339-344. 11, 308-314. Unterwald, E. M., Knapp, C., and Zukin, R. S. (1091). Neuroana- Manzanares, I., Lookingland, K. J., and Moore, K. E. (1990). tomical localization of kappa 1 and kappa 2 opioid receptors in Kappa-opioid-receptor-mediated regulation of alpha-melano- rat and guinea pig brain. Brain Res. 562, 57-65. cyte-stimulating hormone secretion and tuberohypophyseal Wolozin, B. L., and Pasternak, C. W. (1981). Classjfication of mul- dopaminergic neuronal activity. Neuroendocrinology 52, 200- tiple morphine and enkephalin binding sites in the central ner- 205. vous system. Proc. Natl. Acad. Sci. USA 78, 6181-6185. Martin, W. R., Eades, C. C., Thompson, J. A., Huppler, R. E., and Wood, P. L. (1982). Multiple opiate receptors: support for unique Gilbert, P. E. (1976). The effects of morphine- and nalorphine-like mu, delta, and kappa sites. Neuropharmacology 27, 487-497. drugs in the nondependent and morphine-dependent chronic Wood, P. L. (1988).Thesignificanceof multiple CNS opioid recep- spinal dog. J. Pharmacol. Exp. Ther. 797, 517-532. tor types: a review of critical considerations relating to technical McLean, S., Rothman, R. B., and Herkenham, M. (1986). Autora- details and anatomy in the study of central opioid actions. Pep- diographic localization of p-and S-opiate receptors in the fore- tides 7, 49-55. brain of the rat. Brain Res. 378, 49-60. Xie, Y. B., Wang, H., and Segaloff, D. L. (1990). Extracellular do- Meng, F., Xie, G.-X., Thompson, R. C., Mansour, A., Watson, main of lutropinlchoriogonadotropin receptor expressed in S. J., and Akil, H. (1993). Cloning and pharmacological character- transfected cells binds choriogonadotropin with high affinity. J. ization of a rat kappaopioid receptor. Proc. Natl. Acad. Sci. USA, Biol. Chem. 265, 21411-21414. in press. Xie, G.-X., Miyajima, A., and Goldstein, A. (1992). Expression clon- Morley, J. E., and Levine, A. S. (1983). Involvement of dynrophin ing of cDNA encoding a seven-helix receptor from human pla- and the K opioid receptor in feeding. Peptides 4, 797-800. centa with affinity for opioid ligands. Proc. Natl. Acad. Sci. USA Munson, P. J., and Rodbard, D. (1980). LICAND: a versatile com- 89, 4124-4128. puterized approach for characterization of ligand-binding sys- Yasuda, K., Raynor, K., Kong, H., Breder, C. D., Reisene, T., and tems. Anal. Biochem. 707, 220-239. Bell, C. I. (1993). Cloning and functional comparison of kappa Neck, B., Rajpara, A., O’Connor, L. H., and Cicero, T. J. (1988). and delta opioid receptors from mouse brain. Proc. Natl. Acad. Autoradiography of (3H]U-69593 binding sites in rat brain: evi- Sci. USA, in press. dence for kappa opioid receptor subtypes. Eur. J. Pharmacol. 154, 27-34. Pasternak, G. W. (1993). Pharmcological mechanisms of opioid analgesics. Clin. Neuropharmacol. 76, 1-18. Pasternak, G. W., and Snyder, S. H. (1975). Identification of novel high affinity opiate receptor binding in rat brain. Nature 253, 563-565. Pasternak, G. W., and Wood, P. L. (1986). Multiple R receptors. Life Sci. 38, 1889-1898. Puttfarchen, P. S., Werling, L. L., and Cox, B. M. (1988). Effects of chronic morphine exposure on opioid inhibition of adenylate cyclase in 7315~ cell membranes: a useful model for the study of tolerance at n opioid receptors. Mol. Pharmacol. 33,520-527. Roche, P. C., Ryan, R. J., and McCormick, D. J. (1992). Identifica- tion of hormone-binding regions of the luteinizing hormone/ human chorionic gonadotropin receptor using synthetic pep-