Posted on Authorea 26 Feb 2020 | CC BY 4.0 | https://doi.org/10.22541/au.158274414.44612584 | This a preprint and has not been peer reviewed. Data may be preliminary. ABSTRACT [email protected] e-mail: Ruiz, B. Micaela [email protected] e-mail: Sahade, Ricardo authors Corresponding Germany. Bremerhaven, Macroecology, Evolutionary c Ecolog´ıa, Biol´ogica C´ordoba, Ecolog´ıa y Argentina. Diversidad Marina, b of a one within Ruiz species B. different Micaela two of species well evidence ascidian be morphological conspicuous to and most needs molecular the Antarctica: still in boundaries diversity species Hidden of between permeability differentiation the of patterns where to sympatry, insights in new been give has distributed results genotypes that are these research the understood. also, that large of But the species laboratory. one to and related in due field closely surprising the disc in are basal species results a distinguish These to of species. conspicuous the presence the differentiate with the to out species, carried trait defined nominal morphological the a genetically genetic within be between species the bimodal could distributed two distinguish the studied of populations to where existence We fifteen traits the characterized, of Namuncur´a) suggested was phylogeography morphological Bank/MPA ocean. distance the (Burdwood genetic polar 18S), species America the and ascidian this of South (COI studied distribution of and gene and Peninsula abundant nuclear assembly Antarctic distributed a the the widely and of along most mitochondrial and the a understanding diversity, of Using current endemism, one patterns Antarctica. our lato, of evolutionary in sensu improve the levels verrucosa recording to high thus Cnemidocarpa by crucial assemblages, within characterized benthic variation is Antarctic ecosystems, group in marine groups this isolated dominant of the most among the are of Ascidians one biomass. is Ocean Southern The Abstract 2020 5, May 2 1 Ruiz Micaela most the of species one ascidian within conspicuous species different morphological two and of molecular evidence Antarctica: in diversity Hidden lrdWgnrIsiuefrPlradMrn Research Marine and Polar for Institute Alfred-Wegener Cordoba de Nacional Universidad lrdWgnrIsiueHlhlzZnrmfu oa-udMeefrcug eto ucinlEcology, Functional Section Meeresforschung, und f¨ur Polar- Helmholtz-Zentrum Institute Wegener Alfred nttt eDvria clgı nml(DA OIE,C´ordoba, Argentina. CONICET, (IDEA) Ecolog´ıa Animal y Diversidad de Instituto nvria ainld ´roa autdd inisEatsFıia auae,Dpraet de Departamento Naturales, F´ısicas y Exactas Ciencias de C´ordoba, Facultad de Nacional Universidad 1 nbl Taverna Anabela , a,b nbl Taverna Anabela , .verrucosa C. a,b 1 aai Servetto Natalia , ihn ieetainbtenseis utemr,i rvdsiprattools important provides it Furthermore, species. between differentiation no with aai Servetto Natalia , 1 a,b 1 iad Sahade Ricardo , iad Sahade Ricardo , a,b .verrucosa C. 1 hitp Held Christoph , n hitp Held Christoph and , hnre-evaluating When . c 2 Posted on Authorea 26 Feb 2020 | CC BY 4.0 | https://doi.org/10.22541/au.158274414.44612584 | This a preprint and has not been peer reviewed. Data may be preliminary. ffflue,&Lnh 00 uisene l,21;Stue l,20) utemr,i a endemons- been has ascidians it related Delsuc Furthermore, closely 2002; 2008). the al., al., among et place et take Satou (Dehal introgression and 2013; this Kalles and evolution al., hybridization that Ganot, protein et that evidence 2010; Rubinstein and trated 2010; circumstantial al., molecular Lynch, et is of & Denoeud there Pfaffelhuber, rate 2018; elevated also al., an operons), splicing by et organization, 5’-genes characterized intron-exon single-exon is order, geno- of (small group gene organisms prevalence physical model stock, and from divergent gene patterns, be developmental diversity, to demonstrated transposon been me, has architecture Tati´an, genome 2006). Sahade, ascidian Marsh, 2009; The & Peck, Kendall, & (Ramos-espl´a, C´arcel, Clarke, Strathmann, deep & (Bowden, 2004; m reproduction Esnal, 500 in & than seasonality strong more and to larvae 1998). can (Kott five lecithotrophic Esnal, It America between L´opez-Legentil, & waters South 2016). P´erez-Portela, Doucet, & Tati´an, of and Turon, it Sahade, 2005; south bottoms Pineda, Varela, Ocean, the hard 1983; Antarctic in to Monniot, the distributed muddy & also in inhabit Monniot Styelidae is 1969; abundant and Antarctic et Mather, most 2015). the & (Gili and al., in assemblages largest distribution et the some circumpolar an Sahade is in shows are Tunicata) dominant 1998; Ascidians (Chordata, even Esnal, 2007). 1830) Mar- being K¨uhne, Halanych, & Tati´an,(Lesson, & Kowalke, communities, & Sahade, Broyer, benthic Lockhart, De 2006; Antarctic Hunter, Sonet, al., the Wilson, Nagy, (D¨omel et in 2015; Havermans, biodiversity than Avila, group 2017; of higher & Halanych, important portion Taboada, be & important Riesgo, would Mahon, an 2011; Antarctica 2006; Santos, represent al., tin, in Sands, et undescribed number Galaska, (Bickford yet species 2015; phenotypes species real similar al., and their the today, species to Therefore, distinct registered due Mahon, 2003). genetically the species even Held, & i.e. single W¨agele, endemism, Halanych region, 2005; a of & this as 2012; level in Held classified Strugnell, discovered high previously were & a been species presents have (Allcock cryptic which that environments Numerous ecosystems tropical Southern 2007). marine and the Rogers, rich consequence, 2018; temperate and In diverse with 2017). most Arango, comparison He- the & 2012; in Miller, Lohmann, of & Linse, a one Soler-Membrives, Butzin, suffered is Grosfeld, 1999; Ocean Ocean (Cristini, al., its biota et and marine Petit Antarctica its 2004; Eoce- this, fragmented disperser witt, that with the as Together cycles role since glaciation 2003). a Ocean of Pollard, playing series & been Southern (DeConto has the Antarctica (ACC) Current isolated around Circumpolar force that Antarctic the barrier while oceanographic boundary, CO ne/Oligocene and atmospheric thermal in climatic, decline geographic, steep a by Triggered Introduction 1. well be Namuncur´a. to Bank/MPA needs wood still boundaries species KEYWORDS: related of closely permeability between field the differentiation the where of sympatry, in patterns in to species understood. insights distributed distinguish results new are These conspicuous to give that the species. results tools species with the these important out differentiate also, provides carried But to laboratory. been it trait and has Furthermore, morphological that a species. of research be between large presence could differentiation the the genotypes to nominal species, the due the of defined surprising within one genetically are in species between two disc distinguish basal of bimodal to a existence traits the the morphological Antarctic where suggested re-evaluating the characterized, distance along When Namuncur´a) was genetic distributed Bank/MPA the populations the (Burdwood fifteen of of of distribution America phylogeography mitochondrial understanding South the a Using 18S), current and Antarctica. and in Peninsula our (COI species within gene ascidian improve variation studied nuclear genetic thus and to a abundant the and assemblages, distributed crucial widely studied benthic most is We the Antarctic of group ocean. one in polar this groups this endemism, of dominant of of patterns levels assembly the high evolutionary by among characterized the are ecosystems, recording marine Ascidians isolated biomass. most the and of diversity, one is Ocean Southern The in robusta Ciona nmdcraverrucosa Cnemidocarpa yrdzto a bevdudrfil n a odtos(oceose ihp & Bishop, (Bouchemousse, conditions lab and field under observed was Hybridization . nacia eoye,mrhtps pce eiiain Burd- delimitation, species morphotypes, genotypes, Antarctica, , 2 h naci oa rn AF a enwriga a as working been has (APF) Front Polar Antarctic the , ø ,Rihrt huru,&Topo,20;Haubold, 2004; Thompson, & Chourrout, Reinhardt, e, 2 nmdcraverrucosa Cnemidocarpa nmdcravruoasnulato sensu verrucosa Cnemidocarpa shrahoii,possesses hermaphroditic, is nmdcraverrucosa Cnemidocarpa .verrucosa C. in intestinalis Ciona .verrucosa. C. ihno with , Posted on Authorea 26 Feb 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158274414.44612584 — This a preprint and has not been peer reviewed. Data may be preliminary. 09 eeue o mlfiain ecin eecridoti 25 in out carried were Reactions amplification. for used PCR. were rDNA) 2009) (18S Gene RNA Ribosomal Nuclear good on 94 based at 0.5 and 46 min DNA, 25 at 2012), of 2 in al., ng was out 30 et protocol carried Polymerase, (Kearse amplification were DNA Stefaniak-primer, R8 Reactions Flexi the version G2 work. GoTaq with Geneious this Promega software obtained from the sequences sequences amplification. forward forward using peaks, for quality (double chromatograms) designed used quality was the were bad 2017) of primer in consequence Rinkevich, our peaks as & study garbled Katzir, this or Paz, within designed ill-defined Douek, was (Reem, (Fwd) Cve-CO1-F54 (Rev) primer R2 The COI Deg and 5 (Fwd) (Fwd) (Qiagen, Cve-CO1-F54 mantle PCR. Kit and the (COI) tunic. Mini 2009) isolating I and subunit scalpels, DNeasy intestine oxidase and as the c such forceps 100 Cytochrome using sterilized tissues to using the tissue volume out of elution muscle carried rest final mantle was the the dissection reducing from mg tissue, but 25 mantle protocol obtain tissue to to standard up the to from according extracted Germany) was ethanol DNA animals denatured Zoolog´ıa,Total sequencing the de in and Museo response PCR fixed the a extraction, of were still DNA collection animals was the 2.2 in the there stored If relaxation C´ordoba, is Argentina. de response analyses complete inserted morphological Nacional no was after for Universidad absolutely probe hour, material a was examined another hours The there two for 96%. if after there check trays, kept to the and and were siphon inside trays 20m placed open big Twenty-three were between in an Antarctica). placed crystals into diving Island, were menthol animals George SCUBA seawater, Argentina), King (TodoDroga, in by Station, crystals submerged (Carlini 2018 menthol Cove using January Potter relaxed at denatured were in the substrate specimens in collected soft of conserved on were base depth were the analyses 30m in samples morphological done Burdwood The for was extraction. 2014). in Samples stations DNA and update sampling Deseado until Peninsula of (last Argentina) Puerto Antarctic naming (Sigma-Aldrich, Antarctica A.R.A. the the 96% depths of 3), ethanol along R/V at Gazetteer (Fig. distributed the nets NMPA/BB Composite were in trawls board SCAR stations America bottom on sampling South by Fourteen in 17, in obtained 138m. one April depth; were and BB 30m 120m samples PD and between the XXIX/3 20m ANT campaign (BB/MPAN), campaign between Namuncur´a 2017 the the diving Bank/MPA Hesp´erides” (2006), and “Bio SCUBA the 2013, by of 2007/2008, in Project in Antarctic BENTART-06, Campaigns campaign Antarctic the campaign Summer the the during and collected were Specimens studies. experimental at Sampling and also 2.1. biodiversity and in laboratory Methods especially the and fields, is at research Materials introgression species many 2. discriminate and in to recognize hybridization, implications able to potential have able being sympatry, may Furthermore, be variation, work. field To ACC. this the morphological the of high by goal of drifting ultimate and the face contact one the secondary than in by more explained species are within be there species can if if co-occurrence determine test their to to a) c) were, distinguishable; work nominal morphologically this the of within goals species divergent the genetically mentioned, gene above to permeable. barriers the be since all to interesting Considering expected is Nydam it be 2017a; ascidians would Stephenson, in species nuclear delimitation & between with Giesbrecht, species flow zones, studying (Nydam, sympatry Hereafter, introgressed in 2011). genes detected Harrison, (COI) was & introgression mitochondrial and also 2014), and Bishop, (Jade) & Shimeld, Sato, 2016; Viard, ° ,5 t72 at s 50 C, ° ,adafia lnainse f8mna 72 at min 8 of step elongation final a and C, ´ GGTTATGAAA3 AGTGTTTTAATTCGAACAGA ° o nta eauainfloe y3 ylso 0sa 94 at s 60 of cycles 36 by followed denaturation initial for C h uiaepiespi Tun pair primers tunicate The .verrucosa; C. iso Antarctique, Mission rmr 81(w)ad1S Rv Takgog tal., et (Tsagkogeorga (Rev) 18S4 and (Fwd) 18S1 Primers 3 .verrucosa C. )t eov ftepeual pce r also are species presumable the if resolve to b) μ ° fec rmrad2m fMgCl of mM 2 and primer each of M C. μ oue,uig00 U/ 0.03 using volumes, l nbadteRVSdaI n2006, in IV Sedna R/V the board on ´ n h rmr arDgCIF2 COI Deg pair primers the and , oocr n fs,t etwhether test to so, if and co-occur; ees2(e)(tfna tal., et (Stefaniak (Rev) reverse2 μ oue,uig005U/ 0.025 using volumes, l μ fTaKaRa of l μ .I order In l. ° ,5 s 50 C, 2 The . μ of l Posted on Authorea 26 Feb 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158274414.44612584 — This a preprint and has not been peer reviewed. Data may be preliminary. ac n eei itnewspromdi .Tegntcdsacsaogppltoswr xrse as expressed were dis- populations among geographical distances of genetic plot The Scatter R. 2002). in (Bohonak, performed 1.52 was F distance v. signifi- genetic application The and Macintosh tance in IBD 2005). distance using Schneider, by performed Isolation & was F Laval, test F pairwise To (Excoffier, and Pair-wise 3.5.2.2 components replicates. variance parameters. the v. default of ARLEQUIN using cance using (Nh), Stephens, DnaSP 2003; calculated haplotypes Donnelly, in & were of (Stephens 2001) AMOVA algorithm number Donnelly, v2.1.1 PHASE & the the with Smith, calculating phased were ( population rDNA diversity 18S for each of nucleotide Sequences screen for and the and (h) run on diversity quality was based haplotype sequencing analysis sequences improve polymorphism acid further Genetic amino to into codons. 13) stop translated table and amplification were mutations for (translation sequences frameshift the used code COI sequences within primers 2004) analysis, mitochondrial Corporation), (Edgar, the Ascidian Code plugin from Codon Muscle 5.1.5, excluded the (v. were using Aligner aligned Code and Codon assembled program edited, were amplification. sequences for on used Nucleotide (Germany) Analysis primers Phylogenetic Operon two and MWG the Alignment of under Eurofins Sequence Stain) either to 2.3. Gel using sequencing Acid sequencer, (Nucleic for DNA GelRed outsourced with automatic stained were ABI3730XL gel an products agarose TAE PCR % 1 illumination. a UV on 72 visualized were at products min PCR 10 of step elongation final a 0.5 94 DNA, at of min 1 ng 30 HS, Taq LA eern rtoeuigsrc lc oe ihasbttto aeo .1 usiuin e ie/million analyses / independent site Two per substitutions 0.016 years. of million rate / substitution a site with per model urchins), clock substitutions shrimp, strict 0.026 (crabs, using to taxa of one Nydam invertebrate first lack 0.016 bibliography. a marine to the of run, other due in were range on since exist proxy rate based COI a data mutation for as from ascidians a used estimated for were (2011) rates BEAUti invertebrates mutation Harrison using marine calibrated and generated other no were from analyse records, files to Data xml fossil used BEAST. First, adequate was in package 2012). software them Rambaut, 1.8.0 execute & BEAST to Xie, the Suchard, speciation, (Drummond, since sequences time of tree. COI divergence posterior total consensus estimate Bayesian a the to infer order with produce to In 18S and used while were nodes sampled (split=0.04), the trees generations at remaining (BPP) MCMC Mitochondrial The probabilities 500000 likelihoods 0.05. sampling (split=0.02). using of the below generations 2012), total was run whether MCMC al., a frequencies checked 200000 was split with et were analysis of stationarity (Ronquist parameters deviation reached BI 3.2 model standard COI (Guindon Bayes the substitution independently. weather 3.0 the Mr. and markers Maximum PhyML stationarity, of in reaching both using in samples simulations run for generations, applied (MCMC) was 100 replicates were Carlo I, every analysis Monte bootstrap models HKY85+G+ ML Chain was 1000 substitutions Markov COI using these analysis. sing for 2010) (BI) HKY85+G+I, model al., Inference was best-fit Bayesian 2.1.9 et model The and jModeltest best-fit software (ML) models. the the Likelihood candidate with 18S 88 determined for with the was and and v.3.0 using model replicates Phyml fitting constructed bootstrap using best was 500 v20160115, the that using reconstruction, tree 2018) phylogenetic Tamura, joining For & neighbour Knyaz, haplotype a Li, on The Stecher, and p-distance. (Kumar, 2012). sequences 7.0.21 Achaz, the MEGA based & of software www.cibiv.at/˜greg/haploviewer), at alignments Brouillet, (available multiple application Lambert, Haploviewer on ABGD the (Puillandre, Discovery, in with differences Gap created gap” was Barcode pairwise “barcode network Automatic a of of delimits distribution version ABGD online the p-distance. the Kimura using using out (http://wwwabi.snv.jussieu.fr/public/abgd/) carried was delimitation Species distance. coastline ST ariedffrne.Tegorpia itne ewe ouain eerpeetdb h shortest the by represented were populations between distances geographical The differences. pairwise ° o nta eauainfloe y3 ylso 0sa 98 at s 10 of cycles 30 by followed denaturation initial for C μ fec rmrad00 Mo ean.Teapicto rtclwas protocol amplification The Betaine. of mM 0.05 and primer each of M ° C. .verrucosa C. ST π sn nS eso .00 Lbao&Rzs 2009). Rozas, & (Librado 5.10.01 version DnaSP using ) auswr sesdb emtto etwt 10,000 with test permutation a by assessed were values 4 ouain,Mne etwt 00permutations 1000 with test Mantel populations, ° ,5 t50 at s 50 C, ST mn l ouain and populations all among ° ,2mna 72 at min 2 C, ° ,and C, Posted on Authorea 26 Feb 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158274414.44612584 — This a preprint and has not been peer reviewed. Data may be preliminary. e87b og nttl32idvdaswr eune,teainetcnandn as(htt- gaps no contained alignment the we- sequenced, segment, were expansion individuals ribosomal and 312 informative, V4 parsimony total the all sites, containing In polymorphic fragment, 70 long. found 18S We bp there location. ps://doi.org/10.1594/PANGAEA.909707). the addition, single 877 from In a from Station. re sequences individuals Palmer two in aligned or present dominant one The mainly Rothera two by and are shows represented Bay, haplotypes, that and Paradise Station, rare Peninsula haplotypes Palmer 18 Antarctic common Cove, are the two Potter Sea, along with Weddell all again in distributed separated Station, distributed polymorphic groups is is were distinct B A sites sharply frameshifts Group two Group 70 haplotypes, showed no haplotypes, steps. 1) revealed 28 mutational (Fig. sequences identified network 50 sequences haplotype acid by The the amino informative. of parsimony to analysis 56 sequences The and of codons. translation indivi- stop 253 or gaps, total mutations contain in primers, not amplification successfully the does excluding sequenced alignment long were bp stations 503 fourteen was from gene duals COI the of fragment aligned The rDNA) (18S Gene RNA and Ribosomal (COI) Nuclear I subunit oxidase & c Harper, Cytochrome (Hammer, 3.1. permutations. analyses 9999 data using morphological Results tested the 3. was all analysis for the used differences of was Gower 2001). assess software term Ryan, and each statistical to NMDS, free dimensions used in 3.16 was three PAST (PERMANOVA) obtained using variance groupings performed of the between analysis was used the were multivariate (NMDS) rest analyses and Nonparametric Multivariate the scaling animal shown). distance. and multidimensional not the of characters (data Nonmetric of specimens two found nature was between matrix. these relation among elastic affinities the significant this tested determine the no of for was and to to used folds correlation ones, not due the studied Nevertheless, were variable the contains. between of width highly of and it vessels number height are water longitudinal The tentacles, characters of folds). of two oral amount stomach number analysis, of these of number sac, multivariate because and (number For branchial analysis gonads variables the analysed. of number quantitative of characters sac, folds for morphological branchial in all made vessels with was longitudinal created transformation was logarithmic matrix relationship a data the folds. test stomach mixed to of A order number in 5) analysis individuals and data these right); Morphological for and 2.5. between out (left vessels grouping. carried gonads longitudinal morphological were of of and markers number number genetic 18S total total between total and 4) 3) 2) COI sac; tentacles; sac; of height, oral branchial branchial presence Sequencing 4) of the the 2) endings), number of of side), spine-like 1) folds folds multiple one noted: in towards with the were vessels oriented conical structures longitudinal or them internal following of smooth, of dissection, and number one After (rounded or warts width. part, of 5) distal shape and (both the 3) siphons Ca˜nete, on Sellanes, the disc, Turon, line of basal same 1983; of position the 1) Monniot, on were: & measured siphons characteristics Monniot terminal We external 1960; The characters. L´opez-legentil, for (Millar, 2016). internal & characters Rocha, of procedures morphological documentation CZM4 established internal and (Labomed following and identification microscope 1830) external for stereoscopic camera principal a digital the a using analysed with photographed equipped and putative CZM6) the analysed and be dissected, to were assumed samples specimens The 23 substitution to of GTR+G v1.6.0 total Tracer The A using speciation. analysed Yule were parameters. to Results analysis Morphological of BEAST. set distribution in was 2.4. stationary executed prior a then tree were to The convergence files the xml applied. check The was % used. was 20 model of burn-in a both (10 years 7 eeain) n eodoea .2 usiuin e ie/mlinyas(10 years million / site per substitutions 0.026 at one second a and generations), nmdcraverrucosa Cnemidocarpa .verrucosa C. 5 (https://doi.org/10.1594/PANGAEA.909707 eeeaie o opooia analyses. morphological for examined were ae namrhlgclcharacter morphological a on based nmdcraverrucosa Cnemidocarpa 7 eeain) for generations), (Lesson, .The ). Posted on Authorea 26 Feb 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158274414.44612584 — This a preprint and has not been peer reviewed. Data may be preliminary. rsneo at ntetnc nti td,sm pcmn hwdruddadsot at,others warts, smooth and rounded showed specimens some study, this 25 In from tunic. specimens. body; live although the grey. the in test, yellow or of in or The brown part brown warts yellowish, disc. anterior colour, was of orange basal the tunic of a presence in flexible, the had and located specimens, soft specimens were not fixed somewhat Ten Siphons and cm In is height. thin 17.3 it width. different quite and usually Usually, with of cm is siphons cm hard, 5.8 ellipsoidal. had 9.6 between or eight varied and ovate only and cm body, specimens mature, 4.1 robust sexually and large, all length, were of characteristic: analysed is Specimens species laterally. Densitycompressed this Posterior of High appearance (95% between The Ma calculated 2.20 was and analysis sequences, Ma) Morphological COI 4.935 3.4. using - 2.331 B, 3.028Ma). [HPD]: and - Density A 1.423 Posterior groups [HPD]: High among (95% (see time Ma below diversification divergence 3.58 discussed congruent of are with species result estimation 18S incompatible this The B in for is group B explanations pattern group to hypothetical crossed to section). but some assigned This 4.4 delimitation, genes, was discussion COI. species nuclear Station for Palmer 18S and hand, from A mitochondrial in one 116 of group A individual were On to group the individuals nuclear. to but hand, two or assigned other delimitation, However, mitochondrial the was used, On Cove, network. was COI. Potter haplotype the marker for from the which grouping 291 and on were individual analysis trees depending the ABGD phylogenetic groups different mitochondrial as to way and nuclear assigned same the the group by in fourth defined a sequences 99). clusters and BP Namuncura, congruent 1, Bank/MPA two (PP (PP Burdwood Cove The from Potter Sea from sample from Scotia one samples individuals from only two exclusively samples with with comprises by branch group constituted 2). cluster third second a phylogeny one a 98), 100), the groups; (Fig. BP Moreover, BP extra 1, 99) 1, distributed Station. four (PP = was Rothera separated Namuncura “B” Bank/MPA BP and gene Bay, group Burdwood probability, nuclear Paradise whereas the bootstrap Station, Peninsula, with Palmer Antarctic 0.99; Cove, built the Potter along Sea, [?] con- distributed Weddell and PP widely in monophyletic probability, more Maximum was reciprocally the (posterior “A” using well-supported, samples Group two mitochondrial), of and show groups (nuclear approach markers gruent Inference molecular Bayesian both and on Likelihood based trees phylogenetic identical. The time were divergence methods and these analysis of Phylogenetic groups either 3.3. between using distance delimited genetic groups distance and The genetic revealed observed. 0.00%, genetic sequences distances of The 18S for groups differences. analysis within pairwise ABGD observed. between sequences distances was 18S pairwise COI intermediate and no for COI with group in each distribution within bimodal distance a showed analysis ABGD 4.1). successful Folmer, (section no 2013; delimitation later with al., Species 2011) discussed et and, 3.2. Ameziane, are (Bishop & this tested Sea Cruaud, of were for Eleaume, Scotia primers Sequencing reasons Dettai, of the 1). possible Monniot, pairs Table amplification, 1994; Cove, several Vrijenhoek, information, individuals, Potter & (Supplemental some Black, values also for Hoeh, haplotype diversity possible Namuncur´a, but highest high not the high Bank/MPA presented was hand, presented COI other Burdwood L46 populations the and the in On L45 all Sea. was Scotia Shetland almost the 18S but and Cove, for Island nucleoti- Potter (see Livingston diversity in hybrid for both was except or showed diversity COI heterozygous of 291) for values being diversity code 291 haplotype the (collection as highest among interpreted The individual division be the single can with A 4.4). this congruent 1). section respectively), were discussion cytosine, that (Fig. variants and B two informative (thymine and contained polymorphic des 444 A 70 position the groups From at mitochondrial recognized. site were single haplotypes a 10 sites, reconstruction, haplotype phase after < .0 hra h eei itneaoggop was groups among distance genetic the whereas 1.00% 6 nmdcraverrucosa Cnemidocarpa > .0 gi ihn intermediate no with again 3.00% scaatrzdb the by characterized is > 10.20% Posted on Authorea 26 Feb 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158274414.44612584 — This a preprint and has not been peer reviewed. Data may be preliminary. 03.I hswr ohmressoe h aeseito atr,wihipista ohmolecules both that implies which inference pattern, al., of the et speciation lakes in (Seehausen same in marker bias the radiations of showed systematic fish type markers cichlid a one both of to only work case lead using this the addressed can is In were marker, Such patterns 2003). of speciation 2004). type different Whitlock, one where & Africa, only (Ballard studying processes population effective evolutionary Thus, and of mechanisms 2015). repair rate, (Hill, mutation number, size introns recombination, of amount ploidy, within species divergent two genetically B two distinguished lato recognising gene) sensu for 18S verrucosa nuclear evidence and strong C. was COI there mitochondrial (the therefore work groups, this congruent in studied markers molecular Both species divergent genetically Two character morphological 4.1. a be species. could disc two basal ascidian the the Antarctic differentiate that suggest the to populations in Cove Potter widespread from and results Moreover, conspicuous the that show verrucosa we study, present F the In (COI: COI for index Discussion Fixation 4. overall structure. AMOVA genetic no haplotype. showed same also 0.05) the all presented gene F pairwise for index fixation overall The of to species correspond delimited that each characters likely for morphological highly separately and is called mitochondrial it be nuclear, nominal above), will inside in (see species identified delimitations isolated were reproductively species two that morphological other groups and the majority two genetic of the the from None while results wart, smooth). the and of Given (conical informative. type phylogenetically warts single be structure of a to Population types had appeared both 3.5. study A had this group B in genetic group analysed from characters genetic morphological individuals from groups individuals all genetic analysis two the the Almost NMDS in The of in B did. and conformed A S1). A groups group group the as between Fig. identified differences genetically information, ( significant specimens (Supplemental revealed with the PERMANOVA end with samples distal coincided analyses. among The NMDS on side. the groups one right in https://doi.org/10.1594/PANGAEA.909707). two and the identified in side in showed data right gonads NMDS two (raw the cv25 gonads siphon on The and two atrial two were side the general, presented each gonads toward cv16 in on The directed showed, and gonad was folds. cv12 one Specimens stomach gonoducts showed specimens 30 cv23 mantle. nevertheless, to side, the body, left 19 on the the from were of was are oral intestine side and The The there each membrane, body, 5. 38. at enclosing the to to 22 1 an of from from side with ranged from ranged left number ranged tubular, sac the middle-ventral sac branchial long), branchial the the Internal and the of on (short of folds warts. size located folds the in of in between alternating vessels vessels types filiform, longitudinal longitudinal are of both of had tentacles number number found sac the the branchial body, we 21, the to species: specimens of 7 this side analysed for each ways the in described diverse folds within previously in four variation pattern, distributed intraspecific types clear the both no represented showed characteristics with some and tunic warts, the ends on spine-like multiple with conic presented nteohrside, Antarctic other all the among structure On strong a and F diversity information). pairwise high Supplemental from a (results toward sites pointed Peninsula AMOVA, by computed 0.001) F ula n iohnra ee vleidpnetybcuete ie ntemd finheritance, of mode the in differ they because independently evolve genes mitochondrial and Nuclear . 17.17; = opie w eeial iegn pce itiue nsmar ln h naci Peninsula. Antarctic the along sympatry in distributed species divergent genetically two comprises ST p eei itneaayi Splmna nomto,Tbe3,adsqecsfo 8 nuclear 18S from sequences and 3), Table information, (Supplemental analysis distance genetic .verrucosa C. .01.Alseiesfo ru hwdbslds,wienn fteseiesfrom specimens the of none while disc, basal showed B group from specimens All 0.0001). = .verrucosa C. ouain rmteAtrtcPeninsula: Antarctic the from populations p and A sp. .verrucosa C. p hwdn eei tutr mn ouain nCOI-sequences in populations among structure genetic no showed B sp. .verrucosa C. ST .vruoasnustricto. sensu verrucosa C. eei itneaayi o O n 8 r hw nTbe2, Table in shown are 18S and COI for analysis distance genetic p CI F (COI: A sp. nmdcraverrucosa Cnemidocarpa 7 out carried were analyses following the Hence, B. sp. ST 002 p =0.072; .vruoas.A sp. verrucosa C. es ao hc ntefollowing the in which lato, sensu < .5 8:F 18S: 0.05; and ST ST .vruoasp. verrucosa C. Cnemidocarpa .5;p 0.154; = .0;p 0.003; = > < Posted on Authorea 26 Feb 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158274414.44612584 — This a preprint and has not been peer reviewed. Data may be preliminary. h eu n ftems sdcaatrsisi h ubro oasa ahsd ftebd,however, body, the of side within each and species at membrane the gonads distinguish of a To number within the 2012). is contained Moreno, characteristics mass & used Zanata, most compact the verrucosa Rocha, a of 1985; one (Kott, in genus wall the united body The always the to ramified, 1991). attached Laboute, occasionally & and Monniot, tubular (Monniot, characters morphological variable Cnemidocarpa highly presents which 2020) ascidians genera other The nuclear and species as family distinguishable well morphologically as same the different Two mitochondrial the here, on genetically 4.2. studied in based and samples species species divergent morphological the other genetic two within two in that, as define found indicates evidence. can (2015) we this those therefore All to al. pairs, %. species similar et five 12.4 was Brunetti studied to differentiation by (2010) 3.5 Harrison genetic defined of from and forms (recently range Nydam distinct divergences B two hand, species) of Type other existence the the vs. On Reem unravel A to 2017b; 2015). order Stephenson, Johnson, in & & loci Giesbrecht, Collins, nuclear Nydam, Yund, 2011; 2017; Cristescu, al., & et MacIsaac, within Therriault, Bock, species (Lejeusne, cryptic therefore evidence, of found morphological of (2012) definition and/or species Cristescu genetic cryptic the putative and on among Macisaac, gene exists 18S Bock, samples discussion in 10.1%) among 2006). - divergence (2.3 Hirose, nucleotide divergences & larger 0.58% Maruyama, - 2012; Neilan, 0 Kurabayashi, al., found (Yokobori, et been (Lacoursiere-Roussel has 2008), 16.5% it Turon, Diplosoma gene, to & 18S 10.8% Perez-Portela genera Regarding 2007; from from Harrison, range 2017). & al., family Nydam Styelidae et 2009; Reem within Hirose, species & 2014; Oka, between pairs, al., (Hirose, and 21.7% et between species to (Griggio distance undisputed 8.7% level genetic from interspecific related the robust at with study, homogeneous a and this distances Moreover, quite COI, In genetic is the 2012). rate compare 2003). than al., substitution smaller Held, to et nucleotide is the is (Puillandre species that species same delimitation given the different species to to belong for belong that deWaard,approach that organisms found & organisms putative between was the Ball, divergence values, among of intermediate Cywinska, the divergence individuals no when between (Hebert, with observed differences barcode-gap, groups genetic is a the unstudied gap 18S of and characterize distribution COI frequency to in the method helpful in markers, ABGD are molecular applying widely-adopted Here, 18S, species, 2003). and differentiated COI genetic as distinguishing within of such species Hereafter, effort Burdwood distant the from more 2010). with represent Antarctic Following individuals al., the could et by of 3), tip Gissi composed the Fig. 2010; in sequences, see located al., lato, 18S America, (stations et Cove with South Potter Denoeud and and study 2018; Sea Peninsula Weddell this al., Sea, because in 2016). Scotia et (PCR), mitochondrial Namucura, obtained reaction Sloan, Bank/MPA (Delsuc ascidians chain branches site & polymerase for basal primer Havird standard described in the the 2017; difficulties were on cause Nabholz, mutations rearrangements to & of proposed gene the been Galtier, than and have Donega, animals, and rate genome, the (Allio, substitution of ones branches fast rest basal mitochondrial the Furthermore, resolved to with 18S divergence compared with genetic rate constructed deeper phylogeny present the among 18S would case, while divergence that COI, this of clades In obtained comprised were sequenced. for sequences that no be evidence specimens could the particular gene some strong for nuclear making here, thus obtained results mechanism, the evolutionary Within same pools. the gene by isolated way mutually same the the in impacted were n ecntttdb niiul nwihteCIpie idn iehsbe uae rrearranged. or mutated been has site binding primer COI the which in individuals by constituted be and > rsnsahg aiblt rm1t oasadi hswr osgicn aito a found was variation significant no work this in and gonads 4 to 1 from variability high a presents Plbbaci)ta mn h uodrSoiornha nwhich in Stolidobranchia, suborder the among than (Phlebobranchia) %fr1S h O uloiedvrec mn siinseisfo h aegnr range genera same the from species ascidian among divergence nucleotide COI The 18S. for 3% Cnemidocarpa Diplosoma eu nld oiayacdaswt hnbtlahr ui;gnd htcudb elongated, be could that gonads tunic; leathery but thin with ascidians solitary include genus .vruoas.A sp. verrucosa C. utemr,i a endsrbdsalrdvrec mn h uodrof suborder the among divergence smaller described been has it Furthermore, . sdsrbdwti h teia Acdae)fml WRS hna tal., et Shenkar (WoRMS, family (Ascidiacea) Styelidae the within described is and p B sp. .schlosseri B. seFg ) ula ee sal vlea slower a at evolve usually genes Nuclear 2). Fig. (see 8 .vruoas.A sp. verrucosa C. B.schlosseri scretybigtetda pce complex species a as treated being currently is in intestinalis Ciona u osuyhscnre e a yet confirmed has study no but orlu schlosseri Botryllus and .verrucosa C. p B sp. n on htType that found and , .vruoasensu verrucosa C. .verrucosa. C. was > sdescribed is important ; 02%for 10.20% This C. Posted on Authorea 26 Feb 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158274414.44612584 — This a preprint and has not been peer reviewed. Data may be preliminary. ogntcsrcuewsrgsee mn h ouain of populations the that among traits registered reproductive was or structure ecological are potential. genetic biological, they in no since dispersal differences especially different known pattern, explain significant unexpected and not could striking are a there showed and species. species sympatric these related of experiments closely structure two perform For population these The to between 2011). this, flow proteins, Swanson, to gene other incompatibility of According & gamete than patterns 2005). Vacquier complete potential to Lessios, rapidly 2014; lead between & can more Levitan, reproduction changes Levitan, evolve acid of McCartney, & amino to (Zigler, 10 (Kosman evolution only species tend pairs, plausible the selection between species they Another on urchin positive sea 2004). that studies under in al., many shown example, be et that have frequently (Levitan given proteins incompatibility, species and recognition gamete between isolation, gamete is isolation temporal like isolation reproductive of barriers, reproductive in in reproductive for role prezygotic role crucial hypothesis the important sympatry of a an in strength play playing the coexist can be thus species must occurs, both barrier fertilization Because reproductive like where spawners, sites. a Broadcast those them, species. on the among isolating obtained differences samples genetic of of Paradise maintain absence Station, number but Palmer The low L45, 3). the Shetland Cove, by (Fig. Potter explained Stations Sea, Scotia Rothera Sea, Weddell and the Bay in present are species Both Species the 2017). once sympatry Hoeksema, reduced & in 2010; Halanych, species strongly Galli, & is Two Maggioni, Janosik polymorphism Montano, 4.3. 2015; of al., 2017; et degree Picton, treated (Dietz apparent & mistakenly identified the Bakken, are correctly Martynov, that been species Turon,Korshunova, have uncommon more Roby, species not or pseudo-cryptic Viard, two is al., or (mor- when 2008; It cryptic et character polymorphic one. Solferini, Turon a be single However, & 2005; to a 2013). Silva, appear as Sahade, Chiappero, Abreu, only Tati´an, & & may Tati´an, present- Sahade, (Dias, Antacli, molecular) Wiernes, reported 1971; ascidians phological, 2019; was others (Kott, Bishop, species with size & the shared and Bouchemousse, descriptions pattern colour others a shape, and 2016), in distributed variability this are high in species ing Islands, when Malvinas/Falklands field the in in collected recognition for sympatry. especially key, in is delimitation of species genetically pattern Morphological to spatial and related morphological more genetic, be confirm the to could address Nonetheless, to disc lato necessary basal species. is the the it 2008; of of hypothesis Losos, plasticity this phenotypic presence 2003; to the Losos, than & that differentiation Larson, morphological suggest determined II, results Our time study) Schulte and Harmon, 2000). this factors 2018; Schluter, ecological/environmental diameter in Malard, on stalk & disc (Fiˇser, depends Robinson, the divergence (basal species from since of of stalk differentiation development off in morphological greater constricted that differences the literature rhizome, base reported determine of spherical the could already specimens of requirements in (1998) in fixing sort plate substrate al. a basal different that et form a that described Tatian to into she thickness expands body. in substrate, in that the development the increase extension of to structure jelly-like rest attached muscle-free this the is a stalk, all animal into the the prolongs of of coexist): where wall descriptions species basally body (1971) both expanded the Kott (where posteriorly followed Cove “stalk” we possible between Potter a disc” a discriminate specimens be in “basal to studied could A define found species disc the To were genetic basal in sp. characters of two observed described verrucosa presence/absence identifying was already C. the warts or for that new of found character other we shape diagnostic However, no and 4), species. colour different (Fig. on genetically field variability the high in A and character. this in nawdrsmln range. sampling wider a in .vruoas.A sp. verrucosa C. nmdcraverrucosa Cnemidocarpa .verrucosa C. .verrucosa C. pcmn hwdn aa ic while disc, basal no showed specimens .vruoas.A sp. verrucosa C. and and rmsf otm vrtoefo adbtos twsadesdi the in addressed was It bottoms. hard from those over bottoms soft from .vruoap B verrucosasp. C. ogl pedunculata Molgula a ecie ntal yLso 13) h yeseie was specimen type the (1830), Lesson by initially described was .vruoas.A sp. verrucosa C. and .vruoasnulato sensu verrucosa C. p B sp. r itiue nsmar ln h naci Peninsula. Antarctic the along sympatry in distributed are .vruoas.B sp. verrucosa C. 9 ol ehlflt nesadteeouinand evolution the understand to helpful be would , rmPte oe nterwr,i a suggested was it work, their In Cove. Potter from .vruoas.B sp. verrucosa C. .vruoas.B sp. verrucosa C. hwdgntcsrcue ouain while population, structured genetic showed .verrucosa C. ees aee notewtrcolumn water the into gametes release , nsm apigsain a be may stations sampling some in nhrwr,i sreported is it work, her In . Within . rsne hsstructure. this presented .vruoasensu verrucosa C. .vruoasp. verrucosa C. Posted on Authorea 26 Feb 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158274414.44612584 — This a preprint and has not been peer reviewed. Data may be preliminary. vn fitorsin nwihi ih nei leeAa O rmoeprn n leeBa 8 rmthe from 18S at B allele within and introgression parent of one evidence from is COI at there way, A same allele the inherit the represent might In may it other. 291 genomes which specimen since in study, likely introgression, this of more In event is 2002). among hybrids (Edmands, types has of parental species population between that the small than with system similar among backcrossing more reproductive occur, cross-fertilization be may a would artificial hybridization present Once Whilst spawners a) 2014). others. al., Broadcast considered: than 2017). be introgression/hybridization Liautard-Haag, intestinalis al., Hy- can of Ciona (Bouchemousse, mutation. et probability hypotheses ascidians convergent Nydam higher in some c) 2016; a proposed specimens, or Viard, already two sorting & were these lineage Bierne patterns incomplete of introgression with pattern and 291 polymorphism (nullbridization crossed specimen molecules ancestral the hand, of b) explain other group introgression, the to a On missed sequence order individuals. to and among In used of hybrid population, we group a allele that as heterozygote primers the interpreted a the of be with example, proportion a can that for a possible carries represents, only also allele that is PCR this allele) it by allele; the this, second sampled in of low-frequency we predominant top a 18S On be presents heterozygous. would time be which would same site, that 291 the different variable expected two at the under be but in explained site, can cytosine be variable it can unique This hand, the cytosine). one in and the (thymine peaks on overlapped assumptions, two section site results variable (see this sequences, groups in 18S basal While four of 4.1.). with site explaining B) section variable were and that discussion sites groups (A variable two and species into 69 the 3.3. sequences other among the then difference 18S dividing inference, or was in variability, morphological site intraspecific though and single Even mitochondrial a with 2002). only congruent Turbeville, found, by were were & ascidians sites in Stach polymorphic already Ap- 2009; 70 addressed Turon, patterns. was sequences & speciation sequences Davis different (P´erez-Portela, COI Bishop, addressing and authors were 18S other from genes phylogenies mitochondrial obtained between and and incongruence nuclear parent genes the both specimens two to re-sequenced these assigned (we was genes in- 291, two individual both to to hand markers: but for one both delimitation, group On species with individuals). same 18S performed both the was for to results delimitation assigned unchanged species not when were observed dividuals was pattern interesting An pattern for mitochondrial/nuclear traits Incongruent ecological 4.4. and biological many on variability reported lato the that sensu fact the colonizing to attention for counterpart the its capabilities than a different reported potential mainly the to dispersal Thus be of related species. two would substrates be the of all 1998) among could accumulation potential inhabiting turn, the dispersal of Reem, differential ascidians enable in capability to 2006; genomes This, for and/or Philippe, types, mitochondrial 2013). suggested & substrate Chourrout the Rinkevich, been different Brinkmann, and & has (Delsuc, while nuclear Katzir it populations flow, the isolated Douek, Indeed, relatively gene both flow. in in higher diversity gene rates genetic a restricted mutation allow allowing more high could current with range that more populations populations distribution of no of discrete with its populations abundance and presents that along high Therefore, hypothesized Tati´an and distances. pattern 1998; continuity large be distribution over al., the Tati´an could flow et 2011; thus it gene al., 2016), active knowledge, et an al., Monniot keeping et connectivity, 1969; Turon genetic Mather, 2010; & (Kott Lagger, continent & Antarctic the around all S2). Fig. A B nlsssoe orlto ewe eei n egahcdsac Splmna information, (Supplemental distance geographic and genetic between relation no showed analysis IBD , .vruoap B verrucosasp. C. .vruoasnulato sensu verrucosa C. a edet de hrceitc ftoseisrte oa culvraiiyo h species. the of variability actual an to rather species two of characteristics added to due be can yeAadBwsdmntae,hbisrmie netl Cpt ta. 07 aoet Sato 2007; al., et (Caputi infertile remained hybrids demonstrated, was B and A Type n1Sseisdlmtto,btto but delimitation, species 18S in .vruoaB verrucosa C. .vruoas.B sp. verrucosa C. .vruoas.B sp. verrucosa C. rsnsawd itiuinrneadwt ihrgsee abundances registered high with and range distribution wide a presents .vruoap A verrucosasp. C. .vruoas.A sp. verrucosa C. .vruoas.A sp. verrucosa C. .vruoas.A sp. verrucosa C. .vruoasnulato sensu verrucosa C. ri,adti pce ol rsn ogrlra tg and stage larval longer a present could species this and trait, a hrceie yactsn.Seie 9 presented 291 Specimen cytosine. a by characterized was o O;o h te ad niiul16 a assigned was 116, individual hand, other the on COI; for 10 and .vruoap A verrucosasp. C. .vruoas.A sp. verrucosa C. p B sp. and .vruoas.B sp. verrucosa C. ept enseuaiehptei,te drive they hypothesis, speculative been Despite . a hrceie yatyiei h unique the in thymine a by characterized was p B sp. hl pcmn16cudb h euto an of result the be could 116 specimen while , .intestinalis C. .vruoas.B sp. verrucosa C. Rmsep´ ta. 05 aine al., et Tatian 2005; al., (Ramos-espl´a et . o O.Ti en htol for only that means This COI. for scaatrzdb thymine a by characterized is rsnsamr continuous more a presents yeAadB pce that species B, and A Type hs h individual the Thus, . .vruoas.A sp. verrucosa C. .vruoas.A sp. verrucosa C. .verrucosa C. in Posted on Authorea 26 Feb 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158274414.44612584 — This a preprint and has not been peer reviewed. Data may be preliminary. rai bcrdb h xsec fto osbymr pce hthv putlnwbe itkna a as mistaken been now until up have that species distribution more species possibly the two, of extent of true existence the However, the America. disc by South basal obscured of a south is and of the area Nominal pairs, in presence species. species and the the Antarctica undisputed that distinguishing around suggests among all feature analysis morphological those Morphological a to sympatry. be of similar in could magnitude distributed was The were species demonstrated. species distinguished was both two time. delimitation the same species the between nuclear at difference within mitochondrial, morphology species and congruent two molecules obtained; delimitate of to were evolution allowed the here presented understand evidence to The specimens insights adaptive new the an provides represent work of could This versatility disc ecological basal a the of Conclusions affects development 5. the and case, substrates. evolves results. this allopatric different our trait In of colonizing with 1973). new for pattern hypothesized Liem, character similar a be 2014; a also al., speciation, can et Then, of 1953) (Givnish 2007). type (Simpson, al., opportunity this L et annelids, ecological Under Cope, Wilson to to arthropods, Linse, attributed 2015; response are be 2012; in al., taxa can al., speciation et contact Antarctic et secondary Riesgo in by Hemery 2010; followed 2011; processes speciation al., Stark, these et & of Raupach dispersal Miller, examples 2007; transoceanic (Baird, and and Some MYA; molluscs speciation 8-5 2007). and by expansion, echinoderms (Rogers, processes and MYA refugia speciation in 1 and radiation isolation by experienced patterns concentration, reported evolutionary already population studies the Antarctica of other of summary when on cycles A later, We based 2001). recent. Billups, or organisms more we & Antarctic Miocene Thomas being data, in since the Sloan, likely Pagani, time time after taxa (Zachos, of speciation place process invertebrate range actual cooling the took marine the the that speciation with other and limit that divergence on older since hypothesize an time based can be the is would overestimating time here be indicates years speciation may proposed This we million speciation the 2018). that al., per mind estimate et in substitutions can (Delsuc bear cephalochordates of On should we for than 2016). number though faster specifically Sloan, 2.08 of even not the and & terms that, but vertebrates, (Havird out than in 2010), genome faster pointing al., rate nuclear times et 6.25 ascidians the whole-genome than Denoeud evolutionary in faster 2014; ascidian calculated Alvarez-Valin, evolves average typically & been this which (Berna Using have genome, group 2011). mitochondrial rates this Harrison, of mutation & (Nydam evolution whole-genome years) rapid million of of per estimations speciation site, (mutation proxy Several the per as substitutions used obtained were 0.026 we urchins and to rates, shrimps, 0.016 crabs, of from data range speciation, rate since time estimate to to order assigned In speciation being of but mode 18S, and a in Timing Therefore, B 2006). 4.5. allele al., presents correlated et 116 that (Delsuc positively individual A evidence evolution are that circumstantial sp. molecular allele explain is verrucosa of an also There rate of elevated can 1998). an fixation mutation Doyle, by convergent the & characterized Wendel and be 1997; polymorphism may (Maddison, of ascidians divergence loss since the mind time since in with 1988), bearing Nei, Nevertheless, be 2017). & among can al., (Pamilo divergence genes et nuclear genetic (Zhou both and high hypotheses since mitochondrial evolutionary the introgression with non-exclusive from inferred these process trees evolutionary by between this explained distinguish Discrepancies to patterns. difficult similar is produce it results, among these hybridization under test cussed experimentally to interest within of B introgression be of would 2016; hypothesis it al., the circumstances, et A supports (Bouchemousse evidence sp. hybridization This verrucosa contemporary 2013). cryptic of C. Galtier, These absence & 2017). complete Bierne, al., almost Tsagkogeorga, et Roux, with Nydam flow, 2011; gene Harrison, of status: & rates species (Nydam to elevated COI newly at species, (12.4%) divergence genetic high show neta oyopimwt nopeelnaesrig(L)i nte yohssta utb dis- be must that hypothesis another is (ILS) sorting lineage incomplete with polymorphism Ancestral . o O,gvnta h hmn uae oactsn nteuiu aibesite. variable unique the in cytosine a to mutates thymine the that given COI, for and p B sp. hc rsne,i hswr,1%gntcdvrec tCI ne those Under COI. at divergence genetic 10% work, this in presented, which .vruoas.A sp. verrucosa C. .vruoap A verrucosasp. C. .intestinalis C. 11 and and and .robusta C. p B sp. p B sp. .verrucosa C. L sulkl ne eta evolution neutral under unlikely is ILS , t35 .0mlinyasao(MYA). ago years million 2.20 - 3.58 at .verrucosa C. .vruoasnulato sensu verrucosa C. Buet ta. 05 hwhistorical show 2015) al., et (Brunetti My,16) nteohrhand, other the On 1963). (Mayr, w oohltcgroups monophyletic two : .vruoas.A sp. verrucosa C. r distributed are r,&Sands, & ¨ orz, and sp. C. Posted on Authorea 26 Feb 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158274414.44612584 — This a preprint and has not been peer reviewed. Data may be preliminary. ikod . omn .J,Sdi .S,N,P .L,Mir . ikr . a,I 20) Cryptic (2006). I. Das, . . . K., Winker, conservation. R., Meier, and L., diversity K. on P. Ng, window S., https://doi.org/10.1016/j.tree.2006.11.004 a N. Sodhi, as J., tunicates. species D. evolving Lohman, fast D., of Bickford, genomics mitochondria. Evolutionary of (2014). history Evolution F. natural Alvarez-Valin, and incomplete & The and L., (2004). speciation Berna, C. ongoing biodiversity, M. hidden Whitlock, of & mit- Evidence Ecology O., mitochon- (2011). W. amphipods. of of Antarctic S. J. giant use J. Ballard, ratio in Stark, the structure the & genetic and J., of in patterns diversity K. diverse variation Miller, genetic P., Large H. for marker. Baird, (2017). Implications molecular B. animals: a Nabholz, across as ps://doi.org/10.1093/molbev/msx197 & rate DNA N., mutation ochondrial Galtier, nuclear S., to ecology. molecular drial Donega, from paradigms R., new diversity: Allio, Ocean Southern Evolution (2012). & M. Ecology J. in Strugnell, Trends & L., A. Allcock, was who work References Lagger This 8. Cristian sampling. and in analysis, photos. morphological help underwater the Mor´an for the in Gisela are provided guidance and authors and Deseado” The support scientific “Puerto the Tati´an provided History. R/V who by Natural the of supported of Museum partially crew American the the of to of Scholarship Fund grateful number: by 2019 Memorial Reference provided Grant Lerner-Gray (DAAD) Term Service and was Short Exchange 91701637], and support Academic 319718], IRSES [German staff no. financial [FP7 Austauschdienst Dallmann action Akademischer and IMCONet Scheme), Deutscher - CONICET, Logistic Exchange Jubany) (AWI), Staff work. (former Institute Research laboratory Wegener Carlini (International Alfred the in (IAA), of assistance Ant´artico Argentino members kind Instituto the for thank Eschbach particularly Andrea to want authors The Acknowledgements 7. ago years Million MYA: current circumpolar Antarctic ACC: sorting lineage Incomplete ILS: Front Polar Antarctic APF: assumed. than gap rather barcode assessed Automatic even be ABGD: identities, must scales, species abbreviations local that of small preference, emphasize List on again habitat 6. species once adaptation, well-studied results to lead and Our genetic abundant related can change. regarding highly systematically, climate patterns for elucidate Patterns to registered distribution Further to response not species. species and or 2008). help ascidian of competition underestimated would (Nosil, Antarctic misunderstanding being sampling, possible important distributed are geographical is to broadly that extended differentiation flow this proposed morphological an gene been of and has and under story it fact, loci speciation evolutionary In nuclear genome. and the the several semipermeable across employing or are time analysis space, barriers gene in to these uniform barriers be that by not as maintained may are hypotheses restrictions species different these sympatric by flow, between explained Boundaries be ILS. might or phylogenies introgression/hybridization mitochondrial-nuclear Incongruent species. single , 13 4,7974 https://doi.org/10.1046/j.1365-294X.2003.02063.x 729–744. (4), , 6 7,12–78 https://doi.org/10.1093/gbe/evu122 1724–1738. (7), raMrn rtgd aucra(e 685.Priua hn oMarcos to thank Particular 26.875). Namuncur´a (Ley Protegida Marina Area ´ , 27 9,520–528. (9), oeua ilg n Evolution and Biology Molecular 12 rnsi clg n Evolution and Ecology in Trends oeua Ecology Molecular , 34 1) 7227.htt- 2762–2772. (11), , 20 , 22 1) 3439–3454. (16), eoeBiology Genome 3,148–155. (3), Molecular Posted on Authorea 26 Feb 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158274414.44612584 — This a preprint and has not been peer reviewed. Data may be preliminary. einldffrnito n xesv yrdzto ewe iohnra ldso h otenOcean Southern the of clades megalonyx. mitochondrial Colossendeis between spider hybridization sea extensive giant and differentiation differentiation Microgeographical D P., (2008). Regional C. N. Arango, V. Brazil. L., Solferini, Southeastern Dietz, & in M., Ascidiacea) O. (Tunicata: D. de orbiculatum Chourrout, F. Biology Trididemnum Silva, of . G., . . morphotypes A. tunicate. between H., Abreu, pelagic Brinkmann, M., a G. C., of evolution Dias, Silva, rapid Da by M., unmasked J. architecture Aury, genome , animal S., of Mungpakdee, Plasticity S., (2010). (2018). P. Henriet, J. F., E. Douzery, Denoeud, tunicates. . of . . studies X., comparative Turon, K., for M. timescale https://doi.org/10.1186/s12915-018-0499-2 Tilak, and are P., framework Simion, cephalochordates phylogenomic G., not A Tsagkogeorga, and H., Tunicates Philippe, (2006). F., Delsuc, H. Philippe, vertebrates. of & relatives D., living (2002). Chourrout, closest S. the H., D. origins. Brinkmann, Rokhsar, vertebrate F., and . Delsuc, . chordate . A., into Tomaso, Insights De intestinalis: B., https://doi.org/10.1126/science.1080049 Ciona Degnan, 2157–2167. J., of Chapman, genome K., draft R. The Campbell, Y., Satou, P., Dehal, on Passage Drake approach. the of modeling opening A the Sheet: of , Influence Ice (2012). Antarctic G. Lohmann, Cenozoic & the M., Butzin, K., Grosfeld, L., Cristini, speciation Cryptic (2007). P. Sordino, chordate. & invertebrate https://doi.org/10.1073/pnas.0610158104 M., Vassillo, model P., Cirino, a robusta F., in abun- Mastrototaro, Ciona N., species: Andreakis, and L., different evidence Caputi, are diversity Morphological B (2015). type the L. and Manni, in A & https://doi.org/10.1111/jzs.12101 type intestinalis. F., variation intestinalis Ciona Gasparini, Ciona F., Seasonal and determined Caicci, molecularly (2009). R., invertebrates. the Pennati, that S. marine C., Gissi, L. Antarctic R., Brunetti, Peck, of & larvae A., pelagic https://doi.org/10.1007/s00227-009-1235-9 Clarke, of A., dance D. Ciona differentiated Bowden, strongly in hybridi- SNPs contemporary ancestry-informative Distinguishing postgenomic (2016). with F. species. introgression Viard, past & from N., zation Bierne, biologi- C., two Liautard-Haag, in S., patterns Bouchemousse, Ascidiacea). genetic (Tunicata, global species Contrasting Ciona (2016). invasive F. https://doi.org/10.1038/srep24875 and Viard, & widespread distance. D., similar, by D. cally isolation J. of Bishop, analyses S., for Bouchemousse, program a distance): by (isolation Heredity between IBD of (2002). differentiate J. analyses A. genetic ascidian. Bohonak, Multilocus model (2012). a in E. species M. Sciences cryptic Cristescu, Biological restricted & France spatially J., NW and H. in widespread The Macisaac, (2013). established G., F. widely D. Viard, Bock, but & L´evˆeque, X., unrecognised A., Turon, is C. L., Britain. Wood, humilis Great E., Asterocarpa and L. ascidian A. Yunnie, Hemisphere C., Roby, Southern D., D. J. Bishop, 330 339 60) 3118.https://doi.org/10.1126/science.1194167 1381–1385. (6009), – 341 oeua Ecology Molecular , 4 67.https://doi.org/10.1016/j.palaeo.2012.04.023 66–73. , 3,2322 https://doi.org/10.3354/ab00115 243–252. (3), , 93 2,153–154. (2), ilgclInvasions Biological , 279 ora fZooia ytmtc n vltoayResearch Evolutionary and Systematics Zoological of Journal 13) 3728.https://doi.org/10.1098/rspb.2011.2610 2377–2385. (1737), ml .S,Hlnc,K . adr .M,Hl,C,...Rue .W (2015). W. G. Rouse, . . . C., Held, M., A. Harder, M., K. Halanych, S., J. ¨ omel, , 25 2) 5754.https://doi.org/10.1111/mec.13854 5527–5542. (21), rceig fteNtoa cdm fSciences of Academy National the of Proceedings , Nature 15 oa oit pnScience Open Society Royal 2,253–260. (2), , 439 13 77) 6–6.https://doi.org/10.1038/nature04336 965–968. (7079), aaoegah,Pleciaooy Palaeoecology Palaeoclimatology, Palaeogeography, aieBiology Marine , 2 rceig fteRylSceyB: Society Royal the of Proceedings 7,140424. (7), cetfi Reports Scientific M Biology BMC , 156 , Science 104 , 1) 2033–2047. (10), 53 2) 9364–9369. (22), , 3,186–193. (3), , 16 298 , 6 1,1–14. (1), Journal (April). Aquatic Science (5601), Posted on Authorea 26 Feb 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158274414.44612584 — This a preprint and has not been peer reviewed. Data may be preliminary. amr . apr .A . yn .D 20) AT aenooia ttsissfwr akg for package software statistics paleontological PAST: (2001). D. P. Ryan, analysis. & data T., and Antarc- A. education of D. patterns Harper, biogeographic O., concerning Hammer, dogma Challenging Ocean. algo- PhyML Southern (2018). New of the R. and A. performance (2010). tica Mahon, the O. & M., Gascuel, assessing K. & Halanych, phylogenies: As- W., maximum-likelihood Hordijk, (2014). estimate M., C. to Anisimova, 3.0. Gissi, V., methods Lefort, and . ongoing . J.-F., rithms . of Dufayard, T., evidence S., provides Xavier, taxa Guindon, K., related M. closely in Tilak, (2014). rates F., events. C. evolutionary Justy, speciation A. of F., J. Comparison Bromeliaceae. Smith, Iannelli, mitogenomics: in cidian A., . diversification . Voskoboynik, . species R., F., net Horres, Griggio, K., and Schulte, evolution, R., Evolution Riina, contingent and B., Phylogenetics and Ee, Molecular of Van correlated J., Hypervariability radiation, H. M. (2010). Adaptive Barfuss, F. J., Griggio, T. stability. genome Givnish, & organelle V., deuterostome Lopez-Gonzalez, of Guida, the Myth Evolution F., the in and Iannelli, Exposing Biology . features . F., order: . archaic gene Mastrototaro, K., mitochondrial with G., ascidian P. feeders Pesole, Dayton, C., suspension A., Gissi, sessile Clarke, epibenthic C., of Orejas, assemblage https://doi.org/10.1016/j.dsr2.2005.10.021 A., unique Palanques, A E., high-Antarctic. (2006). W. Genome J. Arntz, Compact P. a M., with J. (2004). M. Gili, E. Thompson, & D., DNA Chourrout, mt R., structure +. from Reinhardt, Geographic revealed T., (2017). Kallesøe, (Ophiuridae) M. P., victoriae Ganot, K. Halanych, Ophionotus & star data. R., brittle polymorphism A. single-nucleotide circumpolar Mahon, and R., Ocean S. Southern Santos, the J., in C. Sands, P., M. amplification Galaska, PCR for primers Conserved phyla. (1994). invertebrate C. the different R. 294–299. of Vrijenhoek, from shift & DNA B., paradigm mitochondrial M. the Black, of into R., window W. a Hoeh, O., as Folmer, species Cryptic for package (2018). software F. concept. integrated Malard, species & an T., 3.0): C. (version Robinson, Fiˇser, Arlequin C., (2005). analysis. S. data Schneider, genetics & population G., Laval, L., compatibility? Excoffier, reproductive predict divergence parental Does Evolution (2002). S. Edmands, throughput. BEAUti high and with accuracy phylogenetics high with Bayesian alignment Research sequence (2012). Acids multiple MUSCLE: A. (2004). Rambaut, C. R. & Edgar, D., Xie, 1.7. A., BEAST M. the and Suchard, J., . A. megalonyx Drummond, Southern the Colossendeis of spider clades mitochondrial sea ps://doi.org/10.1098/rsos.140424 between hybridization giant extensive Ocean and differentiation Regional (2015). D ml .S,Hre,A . ezr .R,Aag,C . ed . ae,C,...Wlo,N G. N. Wilson, . . . C., Mayer, C., Held, P., C. Arango, R., R. Melzer, M., A. Harder, S., J. ¨ omel, Society ytmtcBiology Systematic , , 17 24 1) 2–2.https://doi.org/10.1016/S0169-5347(02)02585-5 520–527. (11), , 1) 7570.https://doi.org/10.1128/MCB.24.17.7795 7795–7805. (17), 32 oeua Ecology Molecular epSaRsac atI:TpclSuisi Oceanography in Studies Topical II: Part Research Deep-Sea eoeBooyadEvolution and Biology Genome 5,1792–1797. (5), oeua ilg n Evolution and Biology Molecular , , 27 59 2,2125 https://doi.org/10.1093/molbev/msp234 211–215. (2), 3,307–321. (3), nulRve fEooy vlto,adSystematics and Evolution, Ecology, of Review Annual aaotlgaElectronica Palaeontologia vltoayBioinformatics Evolutionary , 27 , 3,6365 https://doi.org/10.1111/mec.14486 613–635. (3), 71 clg n Evolution and Ecology 55–78. , , 6 14 3,5165 https://doi.org/10.1093/gbe/evu041 591–605. (3), oa oit pnScience Open Society Royal , 29 , oeua aieBooyadBiotechnology and Biology Marine Molecular 4 8,1969–1973. (8), 1,9. (1), , 1 , 7 117693430500100000. , 2,475–485. (2), , 53 rnsi clg and Ecology in Trends , , 49 2 81) 1029–1052. (8–10), 355–378. , 7,102.htt- 140424. (7), Molecular Nucleic , 3 , Posted on Authorea 26 Feb 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158274414.44612584 — This a preprint and has not been peer reviewed. Data may be preliminary. omn .T,&Lvtn .R 21) pr optto n h vlto fgmtccmaiiiyin compatibility gametic II. of Ascidiacea evolution Antarctic the and (1971). P. competition Kott, Sperm (2014). R. taxa. D. fertilizing Levitan, externally & T., E. internal (2012). by Kosman, C. restrained problem. is species Duran, diversity cryptic External the to (2017). 683–692. contributes . B. . mollusc . Picton, nudibranch analysis & new S., and T., conservatism: organization Bakken, Sturrock, A., the Martynov, M., for T., Korshunova, platform Cheung, software S., desktop extendable Stones-Havas, data. and sequence genus A., integrated of the Wilson, an of study R., Basic: case Geneious Moir, a biodiversity: M., genus Antarctic Kearse, the Unrecognized of (2010). ascidians M. Asteroidea). photosymbiotic K. (Odontasteridae; Halanych, of Odontaster gene. & species COI M., new the A. of Two Janosik, sequences (2009). partial https://doi.org/10.2108/zsj.26.362 with M. 362–368. Archipelago, Hirose, (5), Ryukyu & the T., from A. Diplosoma ecology. Oka, Mitonuclear E., Hirose, (2015). E. https://doi.org/10.1093/molbev/msv104 G. Sciences Biological Hill, B, Quaternary. Series the London. in of oscillations Society https://doi.org/10.1098/rstb.2003.1388 climatic Royal of the consequences of Genetic actions (2012). (2004). G. M. N. G. Hewitt, Wilson, (Echinodermata). kerguelensis South- . . the . Promachocrinus of D., lineages species Steinke, 2502–2518. mitochondrial C., crinoid seven Gallut, in Ocean isopod N., sympatry ern and Ameziane, circumpolarity Antarctic V., reveals Roussel, sampling M., giant Comprehensive Eleaume, crus- G., the Antarctic L. widespread Hemery, the in within speciation speciation cryptic Isopoda). , for (Crustacea, Cryptic evidence trilobitoides identifications Ceratoserolis Molecular Biological tacean (2003). Chaetiliidae). Chrostoph. (2005). Held, (2003). Valvifera: J.-W. R. J. Wagele, (Isopoda: https://doi.org/10.3989/scimar.2005.69s2175 deWaard, antarcticus & & Glyptonotus L., Christoph, S. Held, Ball, A., Cywinska, https://doi.org/10.1098/rspb.2002.2218 barcodes. N., DNA D. through P. relative determining in genomes. Hebert, expression nuclear and selection, versus mutation, mitochondrial of https://doi.org/10.1093/molbev/msw185 roles in new 3042–3053. The reveals evolution (2016). barcoding B. of Lysianas- D. DNA rates Sloan, Amphipoda: & (2011). (Crustacea: C., P. lato J. Havird, Martin, sensu Orchomene & of C., population species Broyer, Antarctic the De of soidea). G., estimating diversity Sonet, the for into T., program insights Z. A Nagy, - C., Evolutionary Havermans, MlRho of Mode (2010). https://doi.org/10.1111/j.1365-294X.2009.04482.x genomes. and diploid M. 277–284. shotgunsequenced Tempo 1), Lynch, from rates & (2003). recombination P., and B. mutation Pfaffelhuber, J. B., Losos, Haubold, & A., Larson, A., Lizards http://www.sciencemag.org/cgi/content/abstract/301/5635/961 J. Iguanian II, in Schulte Radiation J., L. Harmon, 3 Ktnr19) 3–3 338. 135–139 1998), (Kattner epSaRsac atI:TpclSuisi Oceanography in Studies Topical II: Part Research Sea Deep Bioinformatics oeua ua Reproduction Human Molecular rceig.Booia cecs/TeRylSociety Royal The / Sciences Biological Proceedings. \ r10.1126/science.1084786. , 28 1) 1647–1649. (12), ilg fteAtrtcSa IV Seas Antarctic the of Biology nertv n oprtv Biology Comparative and Integrative oeua ilg n Evolution and Biology Molecular 15 naci ilg naGoa otx,Proceedings Context, Global a in Biology Antarctic , Science 20 oeua ilg n Evolution and Biology Molecular 1) 1190–1197. (12), cetaMarina Scientia , 301 , , 359 58 53) 6–6.Rtivdfrom Retrieved 961–964. (5635), 12,230–241. (1–2), , 14) 8–9;dsuso 195. discussion 183–195; (1442), oeua Ecology Molecular 17 oeua Ecology Molecular 11–82. , , 50 olgc Scripta Zoologica , olgclScience Zoological 6,981–992. (6), , 270 , 32 hlspia Trans- Philosophical 69 11) 313–321. (1512), 8,1917–1927. (8), 2,175–181. (2), , 19 , , (SUPPL. 21 33 , 46 (10), (12), , (6), 26 Posted on Authorea 26 Feb 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158274414.44612584 — This a preprint and has not been peer reviewed. Data may be preliminary. ya,M . isrct .B,&Sehno,E .(07) rgnaddseslhsoyof history dispersal and Origin (2017a). complex. E. species E. schlosseri Stephenson, Botryllus & the in B., clades K. https://doi.org/10.1371/journal.pone.0169944 ascidian Giesbrecht, colonial L., common. two be M. could flow Nydam, gene krempfi Pteroclava with the Speciation in species (2008). cryptic P. Caribbean. A Nosil, the (2017). in W. revealed B. Cladocorynidae) Hoeksema, (Tunicata) (Hydrozoa, & complex Ascidians P., species Antarctic Galli, D., (2011). Maggioni, N. Adelie. S., Ameziane, Terre Montano, in & CEAMARC C., survey Cruaud, French-Australian M., the Eleaume, of A., Dettai, (1991). F., P. Monniot, Laboute, & F., Herdman. Monniot, clava C., Monniot, S. and Museum. Carlisle du (1983). mammiculata Editions F. Styela Kingdom . Monniot, United ascidians & the the C., of Monniot, of Association Biological identity Marine The the of (1960). Journal H. R. evolution. Millar, and species Animal trees. (1963). species E. in betweenMayr, trees Gene relationship (1997). marine the P. Antarctic and W. species. Maddison, of signal among centre phylogenetic similarity conservatism, a ecological niche Sea https://doi.org/10.1111/j.1461-0248.2008.01229.x Phylogenetic and Scotia the relatedness (2008). Is phylogenetic notorcadensis B. Lissarca J. (2007). bivalve circum-Antarctic Losos, C. the Sands, in speciation & Philobryidae). cryptic A.-N., of (Arcoidea: Lorz, evidence Some T., jaws. diversification? pharyngeal Cope, cichlid K., innovations: Linse, morphological polymorphism and DNA strategies of Evolutionary Zoology analysis M. tematic (1973). comprehensive T. F. for McGovern, software K. A Liem, . v5: . . DnaSP D., (2009). Kline, J. data. Rozas, J., & Jara, P., H., Librado, Fukami, Montastraea the A., of corals C. complex. broadcast-spawning Comparative sympatric species Swanson, among annularis isolation (2011). E., reproductive of E. K. Mechanisms M. McGhee, (2004). Cristescu, R., America. & North D. J., in Levitan, histories H. invasion MacIsaac, contrasting W., reveals T. ascidians Invasions colonial Therriault, two G., of D. phylogeography Bock, C., network. shipping-boating Lejeusne, dynamic McKindsey, & a P., in Legendre, P., processes Girard, invasion F., 21 Disentangling Guichard, E., (2012). genetics M. W. evolutionary Cristescu, C. molecular G., X: D. MEGA Bock, A., (2018). Lacoursiere-Roussel, K. Tamura, & platforms. C., computing Knyaz, across M., analysis Li, G., Stecher, S., 1947-1965 Kumar, Auspices, Government US Under (1969). Collected P. Specimens Mather, & Stolidobranchia. P., and Kott, Phlebobranchia IP, part ascidiacea Australian 23 The (1985). P. Kott, 1) 2744.https://doi.org/10.1111/j.1365-294X.2012.05702.x 4227–4241. (17), . Bioinformatics , 13 3,6560 https://doi.org/10.1007/s10530-010-9854-0 635–650. (3), , 22 4,425–441. (4), , 25 oa Biology Polar 1) 4115.https://doi.org/10.1093/bioinformatics/btp187 1451–1452. (11), Evolution naci siica oorpi con fteKonSeisBsdon Based Species Known the of Account Monographic Ascidiacea: Antarctic oeua ilg n Evolution and Biology Molecular siisatrtqe tsbnacius opooi tbiogeographie et morphologie subantarctiques: et antarctiques Ascidies , 58 , 2,3833 https://doi.org/10.1111/j.0014-3820.2004.tb01647.x 308–323. (2), 30 8,1059–1068. (8), nmlSeisadEvolution. and Species Animal oa efacdaso e Caledonia New of ascidians reef Coral 16 ytmtcBiology Systematic oeua Ecology Molecular Zootaxa Vl 3.Aeia epyia Union. Geophysical American 13). (Vol. , clg Letters Ecology , , 39 35 2817 aieBiodiversity Marine , 3,509–511. (3), 46 6,1547–1549. (6), 1,1–54. (1), 3,523–536. (3), LSONE PLoS , 17 9,2103–2106. (9), , 11 oeua Ecology Molecular R Editions. IRD . e.Q Mus. Qd Mem. , 1) 995–1003. (10), , 12 47 1,83–89. (1), 1,1–30. (1), Biological Sys- , , Posted on Authorea 26 Feb 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158274414.44612584 — This a preprint and has not been peer reviewed. Data may be preliminary. iso . aod,S,&Aia .(05.Eouinr atrsi naci aieivrerts An invertebrates: marine Antarctic in patterns Evolutionary (2015). studies. C. molecular Avila, on & popu- update S., and beyond. Taboada, biogeography and A., structure Phylogenetics, Sea Riesgo, Mediterranean (2017). genetic the B. in population Rinkevich, schlosseri Evolution & Botryllus Long-term and G., ascidian netics Katzir, the of G., (2013). genetics Paz, lation J., B. schlosseri. Douek, E., Rinkevich, Botryllus Reem, & ascidian The G., Katzir, urochordate: https://doi.org/10.1007/s10530-012-0281-2 invasive J., an Douek, antarcticus of Chorismus and E., Ocean, homogeneity Southern Genetic Reem, the (2010). of F. Leese, species lanceopes. & shrimp B., Nematocarcinus benthic Misof, and P., two Rehm, of J., distribution Dambach, ascidio- region. circum-Antarctic S., Magellan littoral Thatje, the the J., in of M. and Raupach, relationships Arc Zoogeographical Scotia the (2005). in M. https://doi.org/10.3989/scimar.2005.69s2215 , Varela, Peninsula 215–223. & Antarctic a, the around J. fauna Carcel, Discovery a, Gap A. Barcode Ramos-espla, Automatic ABGD, (2012). G. Carolina. delimitation. Achaz, 294X.2011.05239.x North species & in S., primary unstable Brouillet, plicata for in A., Styela populations Lambert, ascidian Stable N., Puillandre, introduced (2016). the S. of Lopez-Legentil, structure & Biology genetic R., and Climate Perez-Portela, temporal X., (1999). Turon, L. habitats: Antarctica. Pe, C., core, M. ice . . Vostok Pineda, . the M., from Delmotte, years C., 420,000 Ritz, past J., https://doi.org/10.1038/20859 the Chappellaz, of I., Basile, history D., atmospheric Raynaud, J., R. Petit, colonial the data. in molecular structure population from strong https://doi.org/10.1016/j.zool.2007.06.006 inferred and (Ascidiacea) divergence communis Cryptic Pycnoclavella (2008). invertebrate X. Turon, & and Rocio, Pyuridae Perez-Portela, families the sequences. of Phylogeny DNA nuclear Evolution (2009). and and X. mitochondrial Turon, Phylogenetics & from R., inferred trees. A. Ascidiacea) Davis, (Stolidobranchiata, species D., Styelidae and D. S. J. trees Marcos, Bishop, gene R., & Perez-Portela, between L., J. Relationships Peak, (1988). K., 879–890. M. G. invertebrate, Evolution Nation, Nei, marine B., & spawning K. P., broadcast Giesbrecht, Pamilo, of B., species S. two Bialik, in M., Introgression L. (2017). Yanckello, L., spawning M. broadcast a Nydam, in Ciona. divergence substantial genus despite Introgression ascidian the (2011). invertebrate. G. within marine R. Harrison, divergence & and L., M. Polymorphism of Nydam, (2010). history G. Evolution R. dispersal and Harrison, Phylogenetics Ciona and Molecular & shallow-water among L., Origin and M. within Nydam, relationships Genealogical (2017b). (2007). complex. G. E. (Ascidiacea). R. species Harrison, species E. & schlosseri L., Stephenson, M. Botryllus Nydam, & the in B., clades K. https://doi.org/10.1371/journal.pone.0169944 ascidian Giesbrecht, colonial L., two M. Nydam, , 163 , 5 5,568–583. (5), 3,11.https://doi.org/10.1007/s00227-016-2829-7 1–14. (3), Evolution , aieBiology Marine 107 2–3.https://doi.org/10.1016/j.ympev.2016.10.005 221–231. , aieGenomics Marine , 50 , 65 aieBiology Marine oeua Ecology Molecular 3,5050 https://doi.org/10.1016/j.ympev.2008.11.014 560–570. (3), 2,4942 https://doi.org/10.1111/j.1558-5646.2010.01153.x 429–442. (2), , 151 , 56 5,13–87 https://doi.org/10.1007/s00227-007-0617-0 1839–1847. (5), 2,7876 https://doi.org/10.1016/j.ympev.2010.03.042 718–726. (2), , , 23 157 –3 https://doi.org/10.1016/j.margen.2015.07.005 1–13. , 17 , 8,1783–1797. (8), 21 8,16–87 https://doi.org/10.1111/j.1365- 1864–1877. (8), ilgclInvasions Biological LSONE PLoS Zoology Nature oeua ilg and Biology Molecular cni Marina Scentia , oeua Phyloge- Molecular , 111 15 , , 399 12 1,225–241. (1), 2,163–178. (2), 1,1–30. (1), 429–413. , Molecular Marine , 69 , Posted on Authorea 26 Feb 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158274414.44612584 — This a preprint and has not been peer reviewed. Data may be preliminary. tpes . only .(03.Acmaio fbysa ehd o altp eosrcinfrom reconstruction haplotype Genetic for methods bayesian (2009). of B. comparison A R. data. genotype (2003). Whitlatch, P. population Donnelly, & & 2002. S., M., Kott, Stephens, Lin, vexillum Didemnum H., 2009.4.1.3 of Zhang, last https://doi.org/10.3391/ai. populations A., worldwide of 87–94. Gittenberger, the signature of G., conspecificity Genetic Lambert, char- L., morphological and Stefaniak, (2017). molecular from P. inferred Tunicata of Phylogeny C. (2002). acters. M. Arango, J. Turbeville, spider. & & T., sea Stach, J., circum-antarctic a K. in Miller, refugia https://doi.org/10.1098/rsos.170615 regional K., maximum Linse, glacial A., Soler-Membrives, Bills, (1953). Lake G. . the . G. . of Simpson, E., origin M. Congolese-Nilotic Knight, a A., and C. variation https://doi.org/10.1098/rspb.2002.2153 Chapman, genetic flock. J., unexpected species L. reveal cichlid Chapman, markers Victoria V., Nuclear M. (2003). Schneider, R. E., Koetsier, O., Seehausen, Radiation. Adaptive in Displacement Character 156 Ecological (2000). D. insight Schluter, New Improved intestinalis: Ciona (2008). chordate K. Inaba, the populations. for r152 . operon set . . model and K., gene intron Ueno, global into E., evidence-based Shoguchi, Y., and Sasakura, assembly M., genome Ogasawara, K., biology. Mineta, developmental Y., in and Satou, species genomics two marine of compatibility for reproductive model Symmetrical a Science complex, (2014). Cnemidocarpa Zoological D. species D. (Ascidiacea) ascidian J. intestinalis Bishop, Ciona the & the M., of S. Shimeld, ecology A., Reproductive Sato, (2004). Antarctica. https://doi.org/10.3354/meps272131 Islands, G. 131–140. Shetland associations Esnal, 1988), South faunal Cove, & Benthic Potter at M., (1998). verrucosa Antarctica. Tatian, B. Island, G. Ricardo, George assembly Esnal, King . Sahade, . & Cove, . efficient Potter S., allows at F., Kuhne, substrates J., barcodes soft Mastrototaro, Kowalke, on without M., F., Tatian, DNA Ricaerdo, Griggio, total Sahade, F., mixed genomes. of mitochondrial Botero-Castro, Ascidian sequencing N., https://doi.org/10.1093/gbe/evt081 plastic Deep Shenkar, highly T., of (2013). Feldstein, D. D., Huchon, N. hotspots Rubinstein, genomic species. barrier: intestinalis species Ciona the Crossing divergent highly (2013). 30 P. two N. Galtier, between J. & Huelsenbeck, introgression space. N., of model Bierne, . large G., . . Tsagkogeorga, a Perspec- C., S., across Roux, choice Hohna, Molecular model A., and Darling, A inference L., phylogenetic D. Biology Bayesian Ayres, Systematic efficient Organisms: P., 3.2: Mark, Antarctic MrBayes Der Van (2012). of M., Teslenko, Biodiversity F., Ronquist, and Evolution genera and families https://doi.org/10.1002/9781444347241.ch14 of identification (2007). the for D. tive. Keys A. (2012). R. Rogers, T. Moreno, ascidians. & water B., shallow T. Atlantic Zanata, of da, M. R. Rocha, 7,1574–1587. (7), 4,S–1.https://doi.org/https://doi.org/10.1086/303412 S4–S16. (4), oeua hlgntc n Evolution and Phylogenetics Molecular naci csses nEteeEvrneti hnigWorld Changing a in Environment Extreme An Ecosystems: Antarctic , , 31 61 6,369–374. (6), h ao etrso evolution of features major The 3,539–542. (3), h mrcnJunlo ua Genetics Human of Journal American The rceig fteRylSceyB ilgclSciences Biological B: Society Royal the of Proceedings eoeBiology Genome it Neotropica Biota , 25 3,4848 tp:/o.r/i S1055-7903(02)00305-6 https://doi.org/Pii 408–428. (3), 18 , eoeBooyadEvolution and Biology Genome , 9 12 . 1) –1 https://doi.org/10.1186/gb-2008-9-10- 1–11. (10), 1,269–303. (1), aieEooyPors Series Progress Ecology Marine oa Biology Polar oa oit pnScience Open Society Royal , 73 oeua ilg n Evolution and Biology Molecular 5,1162–1169. (5), h mrcnNaturalist American The qai Invasions Aquatic , 19 , 270 2,85–91. (2), , My,417–467. (May), , 5 11) 129–137. (1511), 6,1185–1199. (6), , 272 , (Clarke 4 , 4 (10). (1), , , Posted on Authorea 26 Feb 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158274414.44612584 — This a preprint and has not been peer reviewed. Data may be preliminary. nudtd1SrN hlgn ftnctsbsdo itr n eodr tutr models. structure secondary and mixture on based (2009). F. tunicates Delsuc, Ascidi- of . . phylogeny . (Tunicata, N., Biology rRNA Shenkar, T., Ascidians Evolutionary Feldstein, 18S M.-K., Tilak, updated R., distribution R. An species (1998). Hopcroft, X., Ascidiacea): Turon, (Tunicata, B. G., Ascidians Tsagkogeorga, G. (2005). R. Arc. Esnal, Sahade, Scotia Antarctica. & the & C., along J. Islands, E., Antacli, Marcos, Shetland Tatian, M. South Ascidi- Doucet, Cove, (Tunicata, J., Potter https://doi.org/10.1017/S0954102098000194 Ascidians R. of Sahade, acea) (1998). M, B. Tatian, G. Montt Esnal, Antarctica. Puerto Ascidiacea-Ascidians. Focus, (2010). & in Islands, C. Lagger, E., & Shetland M, Tatian, M. South cold a Doucet, Cove, of development J., Potter larval https://doi.org/10.1017/s0954102098000194 R. and of Embryonic Sahade, acea) (2006). G. M., A. Tatian, Marsh, reconstruction & haplotype R., for ascidian. L. Antarctic method Kendall, adapted statistical R., new R. A Strathmann, (2001). P. Donnelly, data. & population J., from N. Smith, M., Stephens, hleg o-nieosseissres nilsrto ihBtylie p.i h nls hne and Channel English the in errors database spp. and Botrylloides diversity with Cryptic illustration proteins (2019). Sea. an J. recognition Mediterranean Bishop, surveys: gamete & species of S., non-indigenous Bouchemousse, fauna evolution challenge X., rapid Turon, Ascidian C., the Ecol- Roby, in F., Viard, Selection for (2016). (2011). Nucleus J. S. invertebrates. W. Chile. Millenium marine Lopez-Legentil, Swanson, in (ESMOI), & Chile & D., Islands of V. M., Vacquier, Oceanic regions R. of temperate Rocha, Management and J., https://doi.org/10.11646/zootaxa.4093.2.1 Sustainable subantarctic Sellanes, invasions? and for of I., ogy cold Too J. Ascidiacea) Canete, (2016). (Tunicata, Chile. S. temperate X., Lopez-legentil, and Turon, subantarctic & in M., ascidians R. introduced Invasions Rocha, Biological and J., of native Sellanes, of I., patterns J. Contrasting Canete, X., Turon, ud .O,Clis . ono,S .(05.Eiec fantv otws tatcCIhaplo- COI atlantic northwest native a of Evidence schlosseri. (2015). Botryllus ascidian L. colonial S. cryptogenic Johnson, https://doi.org/10.1086/BBLv228n3p201 the & the in C., of clade origins Collins, type Multiple O., P. (2006). Yund, E. ascidians sequences, Hirose, colonial non-symbiotic rDNA & and 18S photosymbiotic T., from of Maruyama, phylogeny inferred Molecular A., of : B. absence symbiosis Prochloron Neilan, and ascidian- lineages Antarctica. A., Multiple of Kurabayashi, sector S., (2007). Atlantic Yokobori, M. the K. from Halanych, kerguelensis & Promachocrinus Biology J., crinoid S. Marine Shetland “circumpolar” Lockhart, the South L., in the R. panmixia Hunter, from differentiation G., Ascidiacea) and N. variability (Tunicata, Wilson, Genetic Synoicum (2013). genus B. the M. of Chiappero, Islands. & populations M., polymorphic Tatian, molecular R., among and Sahade, history P., genome M. into window Wiernes, incongruence: Phylogenetic (1998). J. In J. evolution. Doyle, & F., J. Wendel, oa Biology Polar oeua ytmtc fpat II plants of systematics Molecular , 152 rnir nMrn Science Marine in Frontiers cetaMarina Scientia , 4,8594 https://doi.org/10.1007/s00227-007-0742-9 895–904. (4), h mrcnJunlo ua Genetics Human of Journal American The , 9 , odSrn abrPrpcie nBiology in Perspectives Harbor Spring Cold . 36 7 1,17 https://doi.org/10.1186/1471-2148-9-187 187. (1), 1,7–6 https://doi.org/10.3391/mbi.2016.7.1.10 77–86. (1), 6,871–883. (6), oa Biology Polar 40 , –9 https://doi.org/10.1016/j.ympev.2005.11.025 8–19. , 69 S) 0–1.https://doi.org/10.3989/scimar.2005.69s2205 205–214. (S2), , 29 6,4551 https://doi.org/10.1007/s00300-005-0080-7 495–501. (6), p.2526.Springer. 265–296). (pp. , 6 19 615. , aieBnhcFuao hla aaoi.Nature Patagonia. Chilean of Fauna Benthic Marine naci Science Antarctic , naci Science Antarctic , 68 ilgclBulletin Biological 3 4,978–989. (4), 1) a002931. (11), Zootaxa , , , 4093 10 , 10 228 0) 147–152. (02), 2,147–152. (2), 2,151–180. (2), 3,201–216. (3), Management BMC Posted on Authorea 26 Feb 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158274414.44612584 — This a preprint and has not been peer reviewed. Data may be preliminary. newtrpoo ae yCita agr ntebnhsasmlg fPte oeweehg diversity high where Cove Potter of assemblage observed benthos is the features in morphological Lagger, of Cristian by taken photos underwater 4. Fig. size. sample represent Numbers branch). (basal not of do proportion analysis the that delimitation red species samples ABGD two 3. by defined only B Fig. the group COI. reported. blue indicate of are in network 0,86 lines A, haplotype group [?] dotted the red probability observed, and In posterior is and pattern. nuclear congruent 51 clades this the [?] branching show with value of constructed bootstrap pattern by phylogeny supported Right, Mirrored nodes COI. Only marker 18S. mitochondrial marker the steps. mutational with symbolize constructed haplotypes phylogeny between 2. dots haplotype, Fig. a represents circle Each individuals. of CH and 1. manuscript. RS final Fig. of manuscript. the discussion approved the and the wrote read Legends to MR authors contributed 11. All reagents. and morphology and advice. form the research space analysed analysis and laboratory MR morphological supervision provided and provided statistical AT analysis. CH morphological the data. for genetic data. run animals of AT morphological the analysis specimens, sampled and NS the work laboratory analysis. of genetic genetic for out PANGEA field carried from MR in samples found the obtained be RS can data contributions genetic Authors’ and with 10. traduction Morphological protein se- and https://doi.org/10.1594/PANGAEA.909707. MN714622. sequences entire doi: entire - 18S (https://www.pangaea.de/), COI (https://www.ncbi.nlm.nih.gov/genbank/), MN714370 MN700622, GenBank numbers - divergence MN700311 NCBI accession bindin numbers in urchin accession found Sea with be quences (2005). can data A. Sequence H. Lessios, & Accessibility Data R., incomplete D. 9. of Levitan, Importance pines A., compatibility. related (2017). M. gamete closely McCartney, J. predicts two S., between Liu, variation K. & genetic Zigler, O., shared Savolainen, of origin L., distributions. Aberra- the Zhang, overlapping in and with G., introgression Rhythms, and Ren, Trends, sorting L., lineage UNAM. (2001). Duvaux, para K. Y., Service Billups, Discovery Zhou, & Present: E., to Thomas, Ma 65 L., https://doi.org/10.1126/science.1059412 Climate Sloan, Global M., in Pagani, tions C., J. Zachos, altp ewr fCImtcodilgn.Aeso h ice r rprinlt h number the to proportional are circles the of Areas gene. mitochondrial COI of network Haplotype hlgntctesotie ihMxmmLklho n aeinIfrneapoce.Left, approaches. Inference Bayesian and Likelihood Maximum with obtained trees Phylogenetic pce itiuinaogteAtrtcPnnua ahcrl ersnsasmln tto,in station, sampling a represents circle Each Peninsula. Antarctic the along distribution Species hts )seie ihbslds,b pcmnwtotbslds.T h ih cadd) and (c right the To disc. basal without specimen b) disc, basal with specimen a) Photos. .vruoas.A sp. verrucosa C. Evolution Heredity nC ercs es lato. sensu verrucosa C. in , nbu h rprinof proportion the blue in , , 59 118 1) 2399–2404. (11), 3,2120 https://doi.org/10.1038/hdy.2016.72 211–220. (3), 20 .vruoas.B sp. verrucosa C. Science , 292 nge oAn B A/no no grey in , 51) 686–693. (5517), Posted on Authorea 26 Feb 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158274414.44612584 — This a preprint and has not been peer reviewed. Data may be preliminary. mtCOI 0.007 99/1 -/0.98 schlosseri Botryllus -/0.94 -/0.97 084 329 243 -/0.98 879 305 241 116 161 190 171 170 169 151 157 155 195 188 186 185 174 168 156 114 113 198 196 182 162 154 197 184 180 164 319 325 318 315 313 327 340 336 324 306 320 316 312 224 209 250 225 288 285 239 281 278 201 240 217 298 248 242 221 220 212 297 259 244 218 215 299 283 255 245 210 845 826 886 853 848 844 843 898 894 881 874 868 834 833 899 897 866 842 818 839 086 067 085 089 51/0.86 59/0.93 194 193 192 191 189 187 183 181 179 178 177 175 167 166 160 159 158 153 150 120 314 337 332 330 322 310 307 304 301 222 204 203 294 289 284 282 277 273 260 257 256 254 253 252 251 247 228 216 214 213 211 208 205 202 200 246 223 814 823 821 800 088 199 265 207 206 877 -/1 888 887 884 911 908 903 916 906 914 907 902 291 152 334 107 104 115 317 326 302 321 303 331 328 311 323 226 275 272 270 261 286 280 271 295 290 267 263 262 287 268 292 279 274 266 264 276 269 815 831 811 827 825 822 817 806 820 819 081 077 078 071 069 083 075 097 080 076 117 118 238 236 229 234 237 233 235 231 230 227 232 087 829 809 116 104 118 117 107 115 324 274 234 264 326 884 236 276 286 266 226 152 320 328 270 230 904 290 280 914 238 806 816 268 279 229 076 269 870 830 820 906 916 080 808 888 889 829 809 078 819 920 910 323 303 069 918 908 263 233 919 909 317 287 237 267 227 295 275 235 083 311 331 321 903 913 887 827 817 261 271 231 885 087 825 815 097 835 077 075 917 907 302 891 915 905 811 831 081 071 272 232 292 262 911 901 921 852 892 822 912 902 21 65/0.52 291 199 197 171 169 164 162 161 155 114 198 180 182 151 196 188 185 170 190 184 195 157 194 192 191 187 177 166 160 159 158 154 193 189 183 181 179 178 167 153 150 186 174 168 156 113 315 319 327 318 312 314 301 325 316 313 306 305 332 322 304 336 307 225 298 288 242 241 239 220 217 244 201 297 299 281 250 207 285 278 258 243 218 212 206 283 255 249 248 245 224 221 219 210 209 294 284 277 273 254 228 222 213 211 204 289 260 257 256 253 252 251 247 216 214 208 203 202 200 265 240 215 223 205 894 890 886 865 858 850 849 847 810 869 868 846 882 861 860 853 841 801 899 898 879 874 867 859 857 848 839 834 833 826 812 803 802 877 872 866 864 863 862 856 855 851 844 843 840 832 828 824 818 805 893 854 813 804 823 821 800 842 814 897 085 089 084 088 086 067 878 876 871 875 873 99/0.99 99/1 353 18S 0.0006 98/0.99 354 350 355 351 836 837 100/1 300 296 98/1 Styela plicata 87/0.99 40 20 5 10 49/0.91 Posted on Authorea 26 Feb 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158274414.44612584 — This a preprint and has not been peer reviewed. Data may be preliminary. 22 Posted on Authorea 26 Feb 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158274414.44612584 — This a preprint and has not been peer reviewed. Data may be preliminary. 23