DOCSLIB.ORG

Genomics and Diversity of the Common Marmoset Monkey NK Complex1,2

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Genomics and Diversity of the Common Marmoset Monkey NK Complex1,2 The Journal of Immunology Genomics and Diversity of the Common Marmoset Monkey NK Complex1,2 Anne Averdam,* Heiner Kuhl,‡ Mario Sontag,‡ Tamara Becker,† Austin L. Hughes,§ Richard Reinhardt,3‡ and Lutz Walter3,4* The common marmoset monkey (Callithrix jacchus) is a New World primate that is increasingly used in biomedical research as a model organism. Due to the occurrence of natural bone marrow chimerism, it represents a particularly useful primate model in immunological research. In this study, we describe the genomic organization of the CD94, NKG2, and LY49L genes in the NK complex (NKC) of the common marmoset based on complete sequencing of a bacterial artificial chromosome clonal contig. This region of the marmoset NKC is 1.5 times smaller than its human counterpart, but the genes are colinear and orthologous. One exception is the activating NKG2CE gene, which is probably an ancestral form of the NKG2C- and NKG2E-activating receptor genes of humans and great apes. The two completely sequenced marmoset bacterial artificial chromosome clones are derived from distinct haplotypes, which differ by 200 sites in the overlapping sequence. Analyses of NKC genes in nine additional marmoset individuals revealed a moderate degree of polymorphism of the CD94, NKG2A, NKG2CE, and NKG2D genes. Furthermore, expression analyses identified several alternatively spliced transcripts, particularly of the CD94 gene. Several products of alter- native splicing of NKC genes are highly conserved among primates. Alternative transcriptional start sites were found, but these probably do not lead to a change of the translational start site or result in longer or shorter cytoplasmic regions of these type II membrane receptors. The Journal of Immunology, 2007, 178: 7151–7161. atural killer cells are large granular lymphocytes that are mapping to the NKC include CD94 and the families of Ly49 and part of the innate immune system. Upon triggering, NK NK group (NKG) 2 genes (4, 11). Whereas LY49 and NKG2D N cells are able to release cytokines and to kill target cells, molecules form homodimers, CD94 and NKG2 molecules are ex- usually virally-infected cells or tumor cells (1–3). Expressing a pressed as heterodimers at the cell surface. The Ly49 gene family diverse array of activating and inhibitory receptors on their cell is expanded and diverse in rodents (12) and includes activating and surface (4, 5), NK cells scan target cells for the presence of inter- inhibitory receptors that are characterized by presence of a posi- acting ligands (6), which are in most cases members of the family tively charged residue in the transmembrane region and ITIM in of MHC class I molecules. The integration of such activating and the cytoplasmic region, respectively (13). The ITIM-containing inhibitory signals determines the functional outcome of the NK inhibitory receptor NKG2A and the activating receptor NKG2C cell (7). form heterodimers with the CD94 molecule, which exhibits neither Almost all NK cell receptors are encoded in two gene clusters, an activating nor an inhibitory motif. The CD94/NKG2A and the the leukocyte receptor complex (LRC)5 and the NK complex (NKC), which map to human chromosomes 19q13.4 (8) and 12p13 CD94/NKG2C molecules interact with the nonclassical MHC (9), respectively. LRC-encoded receptors contain Ig-like domains, class I ligand HLA-E (14). Recently, binding of CD94 and the whereas the NKC encodes C-type lectin-like receptors (10). Genes activating receptor NKG2E has been demonstrated (15), while the function of NKG2F, which has a truncated extracellular lectin-like domain and binds intracellularly to DAP12, is still unknown (16). *Department of Primate Genetics and †Primate Husbandry, German Primate Center, Although similarly named, the NKG2D molecule is only distantly ‡ Go¨ttingen, Germany; Max Planck Institute for Molecular Genetics, Berlin, Germany; related to the other members of the NKG2 family. NKG2D ho- and §Department of Biological Sciences, University of South Carolina, Columbia, SC 29208 modimers interact with stress-inducible MHC class I ligands Received for publication December 8, 2006. Accepted for publication March 7, 2007. MICA, MICB, ULBP1, ULBP2, ULBP3, and ULBP4 in hu- The costs of publication of this article were defrayed in part by the payment of page mans (17–19) and RAET1A, RAET1B, RAET1G, RAET1E, charges. This article must therefore be hereby marked advertisement in accordance H60, and MULT1 in mice (20, 21). NKG2D signaling involves with 18 U.S.C. Section 1734 solely to indicate this fact. the ITAM-containing adaptor molecules DAP10 and DAP12. 1 This work was supported by the German Primate Center (to A.A., T.B., and L.W.), the Max Planck Society (to H.K., M.S., and R.R.), and the German National Genome Notably, distinct splice products of NKG2D associate with Research Net. DAP10 and DAP12 in mice (22, 23), but not in humans, where 2 Sequences have been submitted to DDBJ/GenBank/European Molecular Biological the NKG2D gene is not differentially spliced and its product Laboratory database and have been assigned accession numbers EF050432–EF050450. associates with DAP10 only (24). 3 R.R. and L.W. share senior authorship. The CD94 gene is monomorphic and the NKG2 genes are mod- 4 Address correspondence and reprint requests to Dr. Lutz Walter, Forschergruppe erately polymorphic in humans and common chimpanzees, and all Primatengenetik, Deutsches Primatenzentrum, Kellnerweg 4, Go¨ttingen, Germany. E-mail address: [email protected] genes are subject to alternative splicing (25, 26). In this study, we 5 Abbreviations used in this paper: LRC, leukocyte receptor complex; BAC, bacterial show the complete sequence and organization of the CD94-LY49L artificial chromosome; NKC, NK complex; NKG, NK group; SNP, single nucleotide genomic interval in a New World monkey species, the common polymorphism; CRD, carbohydrate recognition domain. marmoset (Callithrix jacchus). The NKC of the common marmoset Copyright © 2007 by The American Association of Immunologists, Inc. 0022-1767/07/$2.00 monkey encodes only a single activating CD94/NKG2 receptor, www.jimmunol.org 7152 MARMOSET MONKEY NKC Table I. Primers used for RT-PCR analysis and 5ЈRACE Annealing Primer Sequence Temperature (°C) cjCD94-fw TCTCTACATTGCTCTTGGAAC 54 cjCD94-rev TCTACTCTCCACCTTCTCTG 54 cjNKG2A-fw ACTAACCTGGCCTCTCCACTA 58 cjNKG2A-rev ATGTGCTGCCAACTCAGATGC 58 cjNKG2CE-fw CAGTTATCACAGAGCACAGTC 56 cjNKG2CE-rev TGTCAGACTGCAAACTCAAATG 56 cjNKG2F-fw AGTCCCTGACATCACACAG 50 cjNKG2F-rev TCAGAATTCTTCAAAGCACAGG 50 cjNKG2E-rev CTACATGAGCACTGGAGCAC 56 cjNKG2D-fw GTGGATTGAAGACTTCAGATTC 54 cjNKG2D-rev CAGTGTTTCCGCTGGTATAG 54 Caja-CD94-5ЈRACE-rev TGTTGGGTCCTGGAGTAAATGCTGAC 63 Caja-NKG2A-5ЈRACE-rev CTTAGGTGTTCGTTGCTGCCTCTTTG 63 Caja-NKG2D-5ЈRACE-rev TGCCATCGTGTCGAAAAGTCACCT 61 Caja-NKG2CE-5ЈRACE-rev TTAGGTCTCCTTTGCTGCCTCTTTGG 63 Ly49-ex2fwd1 TGATCAGGGAGAGATTTATTCAAC 56 Caja-Ly49-ex3rev CACCAACATTGTGACTATCATCAG 56 which most likely represents an ancestral form of primate-activat- chemistry and analyzed in Applied Biosystems 3730 sequencers (Applied ing receptors CD94/NKG2C and CD94/NKG2E. Compared with Biosystems). Raw sequences were processed by Phred (available from Phil humans, the NKG2 and CD94 genes of the marmoset are more Green, University of Washington (www.phrap.org)) and assembled into a contiguous sequence by Phrap (available from Phil Green, University of variable. Washington (www.phrap.org)) (29). BLAST and FGENESH-2 algorithms (http://www.ncbi.nlm.nih.gov/BLAST/; http://www.softberry.com/all.htm) Materials and Methods identified exons and introns of genes in finished BAC clone sequences and Blood samples and RNA preparation annotations of genes were done manually. All BAC clone sequences have “finished sequencing” quality (1 putative mistake/100,000 bases) and the Blood samples (1 ml each) were obtained from nine healthy unrelated data have Phred values of Ͼ90. No gaps are present in the sequence. common marmoset monkeys (C. jacchus) that are maintained in the Ger- man Primate Centre breeding colony. Samples were brought to 15 ml with RT-PCR analysis and 5ЈRACE erythrocyte lysis buffer (155 mM NH4Cl, 10 mM KHCO3, and 0.1 mM EDTA) and were incubated at room temperature for 20 min. The remaining Two micrograms of total RNA was reverse transcribed for1hat42°C ϫ using oligo(dT) primer and 200 U of Moloney mouse leukemia virus re- blood cells were centrifuged for 10 min at 200 g and 7°C, washed in 15 ␮ ␮ ml of lysis buffer, and subjected to preparation of total RNA according to verse transcriptase (Promega) in a total volume of 25 l. For PCR, 1 lof standard methods (27). cDNA was used in standard PCR according to the different primers (Table I) and expected lengths of the amplificates. PCR products were separated Bacterial artificial chromosome (BAC) library screening and in 1% agarose gels and visualized with ethidium bromide staining. Bands probes were excised under UV light and DNA was recovered using standard silica adsorption. Isolated DNA was sequenced with respective PCR primers and High-density colony filters of BAC library CHORI-259 were obtained Applied Biosystems BigDye terminator chemistry. Alternatively, RT-PCR from Children’s Hospital Oakland Research Institute (http://bacpac.chori. products were cloned in a pGEM-T Easy PCR cloning vector according to org/home.htm). Filters were hybridized with probes of the human CD94, the supplier’s manual (Promega) and single clones were sequenced. NKG2A, and LY49L genes according to recommendations in filter-accom- The 5Ј ends of cDNAs were
Load more

Recommended publications
  • Brazil North-Eastern Mega Birding Tour 21St September to 12Th October 2017 (22 Days) Trip Report
    Brazil North-eastern Mega Birding Tour 21st September to 12th October 2017 (22 Days) Trip Report Grey-breasted Parakeet by Colin Valentine Trip Report Compiled by Tour Leader, Keith Valentine Rockjumper Birding Tours | Brazil www.rockjumperbirding.com Trip Report – RBL Brazil - North-eastern Mega 2017 2 Simply put, our recently-completed tour of NE Brazil was phenomenal! Our success rate with the region’s most wanted birds was particularly good, and we also amassed an exceptional 103 endemics in the process, which few tours have ever been able to replicate in the past. This was all achieved in just 22 days, which gives an excellent indication of just how good our itinerary is. There are few other tours on the planet that offer the number of threatened, endangered and critically endangered species as NE Brazil. We were sublimely successful in our quest for these, as we enjoyed magnificent encounters with Araripe Manakin, Lear’s Macaw, Grey-breasted, White-eared, Golden-capped and Ochre- marked Parakeets, White-collared Kite, Pink-legged Graveteiro, Hooded Visorbearer, Banded and White-winged Cotingas, White- browed Guan, Red-browed Amazon, Alagoas, Orange-bellied, Pectoral, Sincora, Bahia, Band-tailed and Narrow-billed Antwrens, Slender, Rio de Janeiro and Scalloped Antbirds, Seven-colored Tanager, Minas Gerais, Alagoas and Bahia Tyrannulets, Buff- breasted and Fork-tailed Tody-Tyrants, Bahia Spinetail, Fringe- backed Fire-eye, Hook-billed Hermit, Striated Softtail, Plumbeous Antvireo, White-browed Antpitta, Black-headed Berryeater, Wied’s Tyrant-Manakin, Diamantina Tapaculo, Buff-throated Purpletuft, Black-headed Berryeater by Serra Finch and many others. Colin Valentine Our 22-day adventure began with a short drive east of Fortaleza to the coastal region of Icapui, where our target birds – Little Wood and Mangrove Rails – gave themselves up easily and provided saturation views.
    [Show full text]
  • The Common Marmoset in Captivity and Biomedical Research 477 Copyright © 2019 Elsevier Inc
    CHAPTER 26 The Marmoset as a Model in Behavioral Neuroscience and Psychiatric Research Jeffrey A. French Neuroscience Program and Callitrichid Research Center, University of Nebraska at Omaha, NE, United States INTRODUCTION top-down as well as bottom-up regulation of affect and emotion. Finally, the changes in NHP brain struc- In its mission statement, the US National Institutes of ture and function can facilitate the mediation of chal- Health provides a clear statement of its focus: “. to seek lenges associated with group living, including fundamental knowledge about the nature and behavior aggression, affiliation, and the establishment and main- of living systems and the application of that knowledge tenance of long-term complex social relationships that to enhance health, lengthen life, and reduce illness and distinguish these species from nonprimate animals [5]. disability” [emphasis added, www.nih.gov/about-nih/ what-we-do/mission-goals, 2015). Disorders associated with brain or behavioral dysfunction represent the lead- The Utility of Marmosets in Behavioral Models ing disease burden and highest source of lifetime years in Neuroscience and Psychiatric Research living with disability on a global basis (YLD: [1]) and together these disorders represent one of the leading From the perspective of a biomedically oriented contributors to disease-associated mortality worldwide focus, research on behavioral states (both normative [2]. Clearly, then, there is a premium on understanding and atypical) is of interest to the extent that it can pro- both normative behavioral states and their relationship vide useful information regarding the developmental to brain function and the nature of brain dysfunction factors that lead to normative neuropsychological func- as is relates to pathological behavioral states.
    [Show full text]
  • Pest Risk Assessment
    PEST RISK ASSESSMENT Common Marmoset Callithrix jacchus Photo: Raimond Spekking. Image from Wikimedia Commons under a GNU Free Documentation License, Version 1.2) August 2011 Department of Primary Industries, Parks, Water and Environment Resource Management and Conservation Division Department of Primary Industries, Parks, Water and Environment 2011 Information in this publication may be reproduced provided that any extracts are acknowledged. This publication should be cited as: DPIPWE (2011) Pest Risk Assessment: Common Marmoset (Callithrix jacchus). Department of Primary Industries, Parks, Water and Environment. Hobart, Tasmania. About this Pest Risk Assessment This pest risk assessment is developed in accordance with the Policy and Procedures for the Import, Movement and Keeping of Vertebrate Wildlife in Tasmania (DPIPWE 2011). The policy and procedures set out conditions and restrictions for the importation of controlled animals pursuant to S32 of the Nature Conservation Act 2002. This pest risk assessment is prepared by DPIPWE for the use within the Department. For more information about this Pest Risk Assessment, please contact: Wildlife Management Branch Department of Primary Industries, Parks, Water and Environment Address: GPO Box 44, Hobart, TAS. 7001, Australia. Phone: 1300 386 550 Email: [email protected] Visit: www.dpipwe.tas.gov.au Disclaimer The information provided in this Pest Risk Assessment is provided in good faith. The Crown, its officers, employees and agents do not accept liability however arising, including liability for negligence, for any loss resulting from the use of or reliance upon the information in this Pest Risk Assessment and/or reliance on its availability at any time. Pest Risk Assessment: Common Marmoset Callithrix jacchus 2/17 1.
    [Show full text]
  • The Smallest Anthropoids Developments in Primatology: Progress and Prospects
    The Smallest Anthropoids Developments in Primatology: Progress and Prospects Series Editor: Russell Tuttle Department of Anthropology The University of Chicago, IL, USA For other titles published in this series, go to www.springer.com/series/5852 Susan M. Ford ● Leila M. Porter ● Lesa C. Davis Editors The Smallest Anthropoids The Marmoset/Callimico Radiation BookID 125266_ChapID FM_Proof# 1 - 26/08/2009 BookID 125266_ChapID FM_Proof# 1 - 26/08/2009 Editors Susan M. Ford Leila M. Porter Southern Illinois University Northern Illinois University Carbondale, IL DeKalb, IL USA USA [email protected] [email protected] Lesa C. Davis Northeastern Illinois University Chicago, IL USA [email protected] ISBN 978-1-4419-0292-4 e-ISBN 978-1-4419-0293-1 DOI 10.1007/978-1-4419-0293-1 Springer New York Dordrecht Heidelberg London Library of Congress Control Number: 2009927722 © Springer Science+Business Media, LLC 2009 All rights reserved. This work may not be translated or copied in whole or in part without the written permission of the publisher (Springer Science+Business Media, LLC, 233 Spring Street, New York, NY 10013, USA), except for brief excerpts in connection with reviews or scholarly analysis. Use in connection with any form of information storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now known or hereafter developed is forbidden. The use in this publication of trade names, trademarks, service marks, and similar terms, even if they are not identified as such, is not to be taken as an expression of opinion as to whether or not they are subject to proprietary rights.
    [Show full text]
  • RESEARCH ARTICLE Digestion in the Common Marmoset (Callithrix Jacchus), a Gummivore-Frugivore
    American Journal of Primatology 71:957-963 (2009) RESEARCH ARTICLE Digestion in the Common Marmoset (Callithrix jacchus), A Gummivore-Frugivore 1 2 1 8 MICHAEL L. POWER ' * AND E. WILSON MYERS ' 1 Nutrition Laboratory, Conservation and Ecology Center, Smithsonian National Zoological Park, Washington, District of Columbia 2Research Department, American College of Obstetricians and Gynecologists, Washington, District of Columbia 3Department of Biology, Colorado College, Colorado Springs, Colorado Wild common marmosets (Callithrix jacchus) feed on fruits, insects, and gums, all of which provide different digestive challenges. Much of the ingested mass of fruits consists of seeds. In general, seeds represent indigestible bulk to marmosets and could inhibit feeding if they are not eliminated rapidly. In contrast, gums are (Winked polysaccharides that require microbial fermentation. Their digestion would benefit from an extended residence time within the gut. Earlier research found that mean retention time (MRT) for a liquid digestive marker (cobalt EDTA) was significantly longer than MRT for a particulate marker (chromium-mordanted fiber), suggesting that common marmosets preferentially retain liquid digesta. We conducted two four-day-long digestion trials on 13 individually housed adult common marmosets fed a single-item, purified diet in order to examine the relations among MRT of cobalt EDTA and chromium-mordanted fiber, food dry matter intake (DMI), and apparent digestibility of dry matter (ADDM). We compared the MRT values with the data from the previous study mentioned above and a study using polystyrene beads. There were no significant correlations among MRT, ADDM, or DMI, although increases in DMI between trials were associated with decreases in MRT. ADDM was consistent within individuals between trials; but the mean values ranged from 75.0 to 83.4% among individuals.
    [Show full text]
  • Brazil I & II Trip Report
    North Eastern Brazil I & II Trip Report 20th October to 15th November 2013 Araripe Manakin by Forrest Rowland Trip report compiled by Tour leaderForrest Rowland NE Brazil I tour Top 10 birds as voted by participants: 1. Lear’s Macaw 2. Araripe Manakin 3. Jandaya Parakeet Trip Report - RBT NE Brazil I & II 2013 2 4. Fringe-backed Fire-eye 5. Great Xenops 6. Seven-coloured Tanager 7. Ash-throated Crake 8. Stripe-backed Antbird 9. Scarlet-throated Tanager 10. Blue-winged Macaw NE Brazil II tour Top 10 as voted by participants: 1. Ochre-rumped Antbird 2. Giant Snipe 3. Ruby-topaz Hummingbird (Ruby Topaz) 4. Hooded Visorbearer 5. Slender Antbird 6. Collared Crescentchest 7. White-collared Foliage-Gleaner 8. White-eared Puffbird 9. Masked Duck 10. Pygmy Nightjar NE Brazil is finally gaining the notoriety it deserves among wildlife enthusiasts, nature lovers, and, of course, birders! The variety of habitats that its vast borders encompass, hosting more than 600 bird species (including over 100 endemics), range from lush coastal rainforests, to xerophytic desert-like scrub in the north, across the vast cerrado full of microhabitats both known as well as entirely unexplored. This incredible diversity, combined with emerging infrastructure, a burgeoning economy paying more attention to eco-tourism, and a vibrant, dynamic culture makes NE Brazil one of the planet’s most unique and rewarding destinations to explore. The various destinations we visited on these tours allowed us time in all of these diverse habitat types – and some in the Lear’s Macaws by Forrest Rowland most spectacular fashion! Our List Totals of 501 birds and 15 species of mammals (including such specials as Lear’s Macaw, Araripe Manakin, Bahia Tapaculo, and Pink-legged Graveteiro) reflect not only how diverse the region is, but just how rich it can be from day to day.
    [Show full text]
  • Redalyc.FAECAL ANALYSIS AS a COMPLEMENTARY APPROACH
    Mastozoología Neotropical ISSN: 0327-9383 [email protected] Sociedad Argentina para el Estudio de los Mamíferos Argentina Silvestre, Saulo M.; Dantas, José O.; da Rocha, Patrício Adriano; Beltrão-Mendes, Raone; Ferrari, Stephen F. FAECAL ANALYSIS AS A COMPLEMENTARY APPROACH TO THE STUDY OF FEEDING ECOLOGY IN THE COMMON MARMOSET (Callithrix jacchus LINNAEUS, 1758) Mastozoología Neotropical, vol. 23, núm. 1, 2016, pp. 185-191 Sociedad Argentina para el Estudio de los Mamíferos Tucumán, Argentina Available in: http://www.redalyc.org/articulo.oa?id=45746645020 How to cite Complete issue Scientific Information System More information about this article Network of Scientific Journals from Latin America, the Caribbean, Spain and Portugal Journal's homepage in redalyc.org Non-profit academic project, developed under the open access initiative Mastozoología Neotropical, 23(1):185-191, Mendoza, 2016 Copyright ©SAREM, 2016 http://www.sarem.org.ar Versión impresa ISSN 0327-9383 http://www.sbmz.com.br Versión on-line ISSN 1666-0536 Nota FAECAL ANALYSIS AS A COMPLEMENTARY APPROACH TO THE STUDY OF FEEDING ECOLOGY IN THE COMMON MARMOSET (Callithrix jacchus LINNAEUS, 1758) Saulo M. Silvestre1, José O. Dantas2, Patrício Adriano da Rocha3,4, Raone Beltrão-Mendes3, and Stephen F. Ferrari4 1 Graduate Program in Ecology and Conservation, Universidade Federal de Sergipe, São Cristóvão, Sergipe, Brazil, 49100-000. [Correspondence: Saulo M. Silvestre <[email protected]>]. 2 Instituto Federal de Educação, Ciências e Tecnologia de Sergipe, São Cristóvão, Sergipe, Brazil, 49100-000. 3 Department of Systematics and Ecology, Universidade Federal da Paraíba, João Pessoa, Paraíba, Brazil, 58059-900. 4 Department of Ecology, Universidade Federal de Sergipe, São Cristóvão, Sergipe, Brazil, 49100-000.
    [Show full text]
  • A B C D 1 Solitary Tinamou 1 2 Tinamus Solitarius 1 Little Tinamou
    Brazil Bahia Cumulative Bird List Column A: Number of tours (out of 1) this species recorded on Column B: Number of days this species was recorded on the 2019 tour Column C: Maximum daily count for this species on the 2019 tour Column D: (H) = mainly heard but seen at least once; H = heard only A B C D 1 Solitary Tinamou 1 2 Tinamus solitarius 1 Little Tinamou 2 2 H Crypturellus soui 1 Brown Tinamou 2 2 H Crypturellus obsoletus 1 Yellow-legged Tinamou 2 3 H Crypturellus noctivagus Variegated Tinamou Crypturellus variegatus 1 Small-billed Tinamou 2 2 H Crypturellus parvirostris Tataupa Tinamou Crypturellus tataupa 1 Red-winged Tinamou 3 1 H Rhynchotus rufescens 1 White-bellied Nothura 1 1 Nothura boraquira Spotted Nothura Nothura maculosa White-faced Whistling-Duck Dendrocygna viduata Comb Duck Sarkidiornis melanotos 1 White-cheeked Pintail 1 17 Anas bahamensis 1 East Brazilian Chachalaca 1 2 H Ortalis araucuan 1 Spot-winged Wood-Quail 1 2 H Odontophorus capueira Least Grebe Tachybaptus dominicus 1 Pied-billed Grebe 1 1 Podilymbus podiceps Magnificent Frigatebird Fregata magnificens Neotropic Cormorant Phalacrocorax brasilianus 1 Great Egret 4 50 Ardea alba 1 Snowy Egret 1 3 Egretta thula 1 Little Blue Heron 1 1 Egretta caerulea 1 Cattle Egret 5 50 Bubulcus ibis Yellow-crowned Night-Heron Nyctanassa violacea 1 Black Vulture 13 100s Coragyps atratus 1 Tropical Turkey Vulture 13 30+ Cathartes (aura) ruficollis 1 Lesser Yellow-headed Vulture 5 10 Cathartes burrovianus 1 King Vulture 3 4 Sarcoramphus papa Pearl Kite Gampsonyx swainsonii ________________________________________________________________________________________________________ WINGS ● 1643 N.
    [Show full text]
  • 2008 Survey on Mixed Species Housing of Neotropical Primates
    2008 SURVEY ON MIXED SPECIES HOUSING OF NEOTROPICAL PRIMATES INTRODUCTION In early 2008, on behalf of the New World Monkey Taxon Advisory Group (TAG), a short questionnaire was sent to 185 AZA institutions to attempt to gather information pertaining to current trends in mixed species housing and exhibition of neotropical primates. A total of 65 institutions responded to the survey. Of these, forty-five institutions reported experiences with mixed species exhibits. The remaining 20 institutions responded that they had had no experience with mixed species exhibits. The questionnaire was identical to one that had been sent to AZA institutions in 1995. The results of the 1995 survey became the basis for a chapter on Housing and Exhibiting Mixed Species of Neotropical Primates (Sodaro, 1999) in the Callitrichid Husbandry Manual (Sodaro and Saunders, eds., 1999). The questionnaire consisted of the following four questions: 1. List the neotropical primate species that you have successfully mixed with each other in exhibits or off exhibit holding enclosures. Please describe the number of animals of each species as well as the age and sex composition of each species’ group. Briefly describe the method of introduction. 2. List the neotropical primate species that were not successfully mixed with each other. Please describe the number of animals of each species as well as the age and sex composition of each species’ group. Briefly explain why the combination was not successful, as well as the method of introduction. 3. List other species of animals that you have successfully mixed with neotropical primates. Briefly describe the method of introduction.
    [Show full text]
  • Breathing Behaviors in Common Marmoset (Callithrix Jacchus)
    bioRxiv preprint doi: https://doi.org/10.1101/2020.07.27.223990; this version posted July 29, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Breathing Behaviors in Common Marmoset (Callithrix jacchus) Mitchell Bishop, Ariana Z. Turk, and CAShahriar SheikhBahaei Running title: Breathing Behaviors in Common Marmoset Neuron-Glia Signaling and Circuits Unit, National Institute of Neurological Disorders and Stroke (NINDS), National Institutes of Health (NIH), Bethesda, 20892 MD, USA Keywords: apnea, breathing behavior, common marmoset, Callithrix jacchus, hypoxia, hypercapnia, sigh, sniffing CACorresponding author: Shahriar SheikhBahaei, PhD; Neuron-Glia Signaling and Circuits Unit, National Institute of Neurological Disorders and Stroke, National Institutes of Health, Bethesda, MD 20892, USA. Tel: +1 (301) 496-0956; Email: [email protected] Conflict of interest: The authors declare no competing financial interests. Acknowledgements: This work was supported by the Intramural Research Program (IRP) of the NIH, NINDS and in part, by the IRP of NIMH. We are grateful for invaluable supports and discussions from Drs. David Leopold, Yogita Chudasama, and Jeffrey Smith. We also thank Dr. Gregory Funk for valuable consultations. bioRxiv preprint doi: https://doi.org/10.1101/2020.07.27.223990; this version posted July 29, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract: The respiratory system maintains homeostatic levels of oxygen (O2) and carbon dioxide (CO2) in the body through rapid and efficient regulation of frequency and dept (tidal volume) of breathing.
    [Show full text]
  • Callitrichines 85
    PIPC02b 11/7/05 17:20 Page 85 Callitrichines 85 Niemitz, C. (1984). Biology of Tarsiers. Gustav Fischer, Stuttgart. Schultz, A. (1948). The number of young at a birth and the number Niemitz, C., Nietsch, A., Warter, S., and Rumpler, Y. (1991). of nipples in primates. Am. J. Phys. Anthropol. 6:1–23. Tarsius dianae: a new primate species from central Sulawesi Shekelle, M. (2003). Taxonomy and biogeography of eastern (Indonesia). Folia Primatol. 56:105–116. Tarsiers [PhD thesis]. Washington University, St. Louis. Nietsch, A. (1999). Duet vocalizations among different popu- Shekelle, M., Leksono, S., Ischwan, L., and Masala, Y. (1997). lations of Sulawesi tarsiers. Int. J. Primatol. 20:567–583. The natural history of the tarsiers of north and central Sulawesi. Nietsch, A., and Kopp, M. (1998). The role of vocalization in species Sulawesi Prim. News. 4:4–11. differentiation of Sulawesi tarsiers. Folia Primatol. 69:371–378. Sherman, P., Braude, S., and Jarvis, J. (1999). Litter sizes and Nietsch, A., and Niemitz, C. (1992). Indication for facultative poly- mammary numbers of naked mole-rats: breaking the one-half gamy in free-ranging Tarsius spectrum, supported by morpho- rule. J. Mammal. 80:720–733. metric data. In: International Primatological Society Abstracts. Simons, E., and Bown, T. (1985). Afrotarsius chatrathi, the first International Primatological Society, Strasbourg. p. 318. tarsiiform primate (Tarsiidae) from Africa. Nature 313:4750– Pallas, P. S. (1778). Novae Species quad e Glirium Ordinae cum 477. Illustrationibus Variis Complurium ex hoc Ordinae Animalium, Simpson, G. G. (1945). The principles of classification and a W. Walther, Erlangen. classification of mammals.
    [Show full text]
  • CALLITRICHIDS: NUTRITION and DIETARY Husbandrya Authors
    Fact Sheet 013 April 2003 CALLITRICHIDS: NUTRITION AND DIETARY HUSBANDRYa Authors Susan D. Crissey, PhD Mauvis Gore, PhD Barbara A. Lintzenich, MS Brookfield Zoo Royal Zoological Society, Scotland Brookfield Zoo 3300 Golf Rd Edinburgh, Scotland 3300 Golf Rd Brookfield, IL 60513 Brookfield, IL 60513 Kerri Slifka. MS Brookfield Zoo 3300 Golf Rd Brookfield, IL 60513 Reviewers Vince Sodaro Michael L. Power, PhD Duane E. Ullrey, PhD Brookfield Zoo Nutrition Laboratory Comparative Nutrition Group 3300 Golf Rd Department of Zoological Research Michigan State University Brookfield, IL 60513 National Zoological Park East Lansing, MI 48824 Washington, DC 20008 Meeting the nutritional needs of Callitrichids is essential to their survival and reproduction in captivity. Development of appropriate dietary guidelines involves information on 1) feeding ecology, 2) published nutrient requirements, often from studies of laboratory primates, 3) food preferences, and 4) foods available in zoos for diet formulation. This monograph is meant to provide a general overview of the feeding of Callitrichids. Several SSPs have published husbandry manuals for individual species, including species-specific recommendations. Please refer to these for additional and sometimes more specific information on nutrition and feeding. _____ aAdapted from the AZA Callitrichid Husbandry manual. AZA Callitrichid SSP. 1 Feeding Ecology Information on feeding ecology of Callitrichids has increased significantly in recent years. This has expanded our knowledge of food ingested in the wild, but most studies provide qualitative information rather than detailed quantitative data on amounts of food and nutrient concentrations in the foods selected. It has been reported that, in natural ecosystems, larger Callitrichid species tend to select insects and fruits whereas the smaller species tend to select insects and exudates (gums, saps, and latex).
    [Show full text]