DOCSLIB.ORG

Using Sludge Fermentation Liquid to Improve Wastewater Short-Cut

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Using Sludge Fermentation Liquid to Improve Wastewater Short-Cut Using sludge fermentation liquid to improve wastewater short-cut nitrification-denitrification and denitrifying phosphorus removal via nitrite Zhouying Ji, Yinguang Chen* (State Key Laboratory of Pollution Control and Resources Reuse, School of Environmental Science and Engineering, Tongji University, 1239 Siping Road, Shanghai 200092, China) *Corresponding author E-mail: [email protected] Tel: 86-21-65981263 Fax: 86-21-65986313 Supporting Information: 8 pages, 2 tables and 7 figures S1 TABLE S1. Oligonucleotide Probes Used in This Study Probe Specificity Sequence (5 ′-3′) DFA (%) d Reference EUB338 a Domain Bacteria GCTGCCTCCCGTAGGAGT 35 (15 ) Planctomycetales and other Bacteria not detected EUB338-II a GCAGCCACCCGTAGGTGT 35 (15 ) by EUB338 Verrucomicrobiales and other Bacteria not detected EUB338-III a GCTGCCACCCGTAGGTGT 35 (15 ) by EUB338 GAOQ989 b Candidatus Competibacter Phosphatis TTCCCCGGATGTCAAGGC 35 (3) GB_G2 b Candidatus Competibacter Phosphatis TTCCCCAGATGTCAAGGC 35 (3) GAOQ431 b Candidatus Competibacter Phosphatis TCCCCGCCTAAAGGGCTT 35 (3) PAO462 c Rhodocyclus -related PAO in Betaproteobacteria CCGTCATCTACWCAGGGTATTAAC 35 (15 ) PAO651 c Rhodocyclus -related PAO in Betaproteobacteria CCCTCTGCCAAACTCCAG 35 (15) PAO846 c Rhodocyclus -related PAO in Betaproteobacteria GTTAGCTACGGCACTAAAAGG 35 (15) Nso1225 Ammonia-oxidizing Betaproteobacteria CGCGATTGTATTACGTGTGA 35 (16) Nso190 Ammonia-oxidizing Betaproteobacteria CGATCCCCTGCTTTTCTCC 20 (16) NIT3 Nitrobacter spp. CCTGTGCTCCATGCTCCG 40 (16) Ntspa662 Nitrospira genus GGAATTCCGCGCTCCTCT 20 (16) a EUB338, EUB338-II, and EUB-III were used in the mixture called EUBmix. b GAOQ989, GB_G2, and GAOQ431 were used in the mixture called GAOmix. c PAO462, PAO651, and PAO846 were used in the mixture called PAOmix. d Deionized formamide concentration in the hybridization buffer. S2 a TABLE S2. Ratios of P O, P ON and P ONn Accounting for Total PAOs in Two SBRs PO/PAOs (%) PON /PAOs (%) DNPAOs/PAOs (%) A-SBR 90.8±2.7 2.6±0.1 6.6±0.3 F-SBR 27.0±1.2 12.3±0.5 60.7±1.7 a The data are the averages and their standard deviations in duplicate tests. 80.0 Acetic acid (F-SBR) Propionic acid (F-SBR) Total SCFA (F-SBR) 60.0 Acetic acid (A-SBR) 40.0 SCFA (mgCOD/g-MLVSS) SCFA 20.0 0.0 0 10 20 30 40 50 60 70 80 90 100 Time (min) FIGURE S1. Changes of SCFA in the anaerobic period. Error bars represent standard deviations of duplicate tests. S3 100 80 60 NAR (%) NAR Ace 40 Ace + Prop Ace + Prop + Prot Ace + Prop + Prot + Carb 20 Fermentation liquid 0 0 10 20 30 40 50 60 Time (min) FIGURE S 2. Effects of the main organic composition of sludge fermentation liquid on nitrite accumulation ratio in the synthetic wastewater batch tests under aerobic conditions (Ace (acetic acid), Prop (propionic acid), Prot (protein), and Carb (carbohydrate)). Error bars represent standard deviations of duplicate tests. 9.6 9.0 A-SBR F-SBR 8.4 pH 7.8 7.2 6.6 6.0 0 100 160 205 235 280 310 355 440 Time (min) Figure S 3. Variations of pH in one typical cycle of two SBRs. S4 4.0 100 3.2 80 2.4 60 1.6 40 (%) NAR -N (mg/g-MLVSS) - 2 NO ₂⁻-N (HA addition) NO 0.8 NO ₂⁻-N (no HA addition) 20 NAR (HA addition) NAR (no HA addition) 0.0 0 0 10 20 30 40 50 60 Time (min) - FIGURE S 4. Influence of humic acids on NO 2 -N accumulation in the synthetic wastewater batch test under aerobic conditions. Error bars represent standard deviations of duplicate tests. S5 87 Uncultured Candidatus Accumulibacter sp. clone EMB clone_7 (HM046420.1) 99 OTU13 94 Uncultured beta proteobacterium clone Skagenf18 (DQ640677.1) 99 OTU2 Rhodocyclus sp. (AJ224937.1) 93 Rhodocyclus sp. HOD 5 (AY691423.1) Dechloromonas denitrificans (AJ318917.1) OTU16 100 99 Uncultured bacterium PHOS-HE23 (AF314420.1) 89 Uncultured Rhodocyclaceae bacterium (FM207944.1) 100 OTU7 Beta proteobacteria Uncultured Rhodocyclaceae bacterium (FM207908.1) 84 Thauera sp. R5 (AB287434.1) OTU14 100 99 Thauera sp. DNT-1 gene (AB066262.1) 100 Nitrosospira sp. EnI299 (EF175101.1) OTU3 100 100 Nitrosospira sp. Nsp41 (AY123788.1) 100 OTU15 Hydrogenophaga sp. EMB 7 (DQ413143.1) 100 100 OTU12 50 Uncultured Acidovorax sp. clone MFC-B162-E05 (FJ393107.1) 99 OTU11 uncultured proteobacterium clone SBRL2_40 (AY098900.1) 70 OTU6 Uncultured gamma proteobacterium clone Skagenf41 (DQ640661.1) 100 Uncultured proteobacterium clone SBRL1_8 (AY098896.1) Gamma proteobacteria 92 OTU8 58 Uncultured gamma proteobacterium clone Skagenf98 (DQ640660.1) 52 OTU4 Uncultured bacterium clone SBRQ157 (AF361092.1) 73 100 OTU9 Uncultured Saprospiraceae bacterium (EU177732.1) 100 OTU1 Delta proteobacteria Uncultured delta proteobacterium clone Skagenf81 (DQ640659.1) Nitrospira sp. (Y14639.1) OTU5 Nitrospirae 98 100 Uncultured Acidobacterium sp. (EF125937.1) Uncultured candidate division TM7 bacterium clone IAFpp7233 (GU214151.1) OTU10 Candidate division TM7 100 90 Uncultured TM7 bacterium (CU918643.1) 0.02 FIGURE S5. Unrooted phylogenetic tree of the OTUs ( ●) based on 16S rRNA gene sequences presented in the parent A-SBR. The tree was constructed using the neighbor-joining algorithm with the Jukes-Cantor distance in MEGA 4.0. Bootstrap values (only those >50% are shown) were calculated on the basis of 1000 resamplings. The scale bar represents one substitution per 50 nucleotides. Closely related sequences from GenBank are shown as references. The relative abundance of each OTU is given in the parenthesis. The scale bar represents 0.02 substitution per nucleotide position. S6 91 OTU1 57 Rhodocyclus sp. (AJ224937.1) 96 Uncultured Candidatus Accumulibacter sp. clone EMB clone_12 (HM046425.1) OTU2 99 OTU3 100 Uncultured Rhodocylaceae bacterium clone TDNP_Wbc97_146_1_49 (FJ517018.1) Rhodocyclus sp. HOD 5 (AY691423.1) 92 Uncultured Azospira sp. clone MFC-B162-C02 (FJ393084.1) Uncultured bacterium PHOS-HE23 (AF314420.1) OTU4 57 93 75 Uncultured Dechloromonas sp. clone 4y-107 (FJ444762.1) 99 OTU14 Candidatus Nitrotoga arctica clone 6680 (DQ839562.1) 67 83 Nitrosomonas sp. Is32 (AJ621027.1) Nitrosomonas ureae (AF272414.1) 100 70 OTU13 OTU8 50 Beta proteobacterium 100 Zoogloea sp. A5 (DQ342276.1) OTU10 100 Uncultured Betaproteobacteria bacterium (CU927667.1) 100 OTU11 Uncultured beta proteobacterium clone Z4MB29 (FJ484828.1) 65 OTU12 100 Uncultured beta proteobacterium clone MVS-8 (DQ676335.1) 100 71 OTU5 100 Acidovorax caeni (AM084011.1) Uncultured Burkholderiales bacterium clone T1IITR15 (FJ422479.1) 71 OTU6 100 Beta proteobacterium HS5/S24542 (AY337603.1) 100 99 OTU7 100 Uncultured beta proteobacterium clone HAVOmat12 (EF032746.1) Uncultured beta proteobacterium clone XME11 (EF061948.1) OTU9 93 100 76 Uncultured Burkholderiales bacterium clone Plot21-2H02 (EU193045.1) OTU15 Gamma proteobacteria 100 Uncultured bacterium clone SBRQ185 (AF361090.1) 54 Sphingomonadaceae bacterium Gsoil 690 gene (AB245348.1) OTU16 Alpha proteobacteria 100 67 99 Sphingobium sp. JEM-15 gene (AB330997.1) OTU19 Verrucomicrobia 100 Uncultured Verrucomicrobia subdivision 3 bacterium clone EB1106 (AY395425.1) OTU18 Alpha proteobacteria 100 Uncultured alpha proteobacterium clone HB125 (EF648106.1) 100 OTU17 Chlorobi Uncultured bacterium PHOS-HE36 (AF314435.1) 100 OTU23 Uncultured Bacteroidetes bacterium clone Skagenf71 (DQ640686.1) 82 OTU21 100 Uncultured Saprospiraceae bacterium clone Epr33 (EU177727.1) Uncultured Bacteroidetes bacterium (AJ318154.1) 100 OTU22 100 Sphingobacterium sp. P-38 partial (AM411962.1) 100 OTU26 82 Uncultured Bacteroidetes bacterium clone IRD18D04 (AY947930.1) Bacteroidetes 55 Uncultured Bacteroidetes bacterium clone Skagenf4 (DQ640656.1) 100 OTU20 88 Uncultured Bacteroidetes bacterium clone Skagenf93 (DQ640676.1) 100 OTU24 64 Uncultured Bacteroidetes bacterium clone Skagen124 (DQ640731.1) 100 OTU25 Uncultured Bacteroidetes bacterium clone Z32M54B (FJ484389.1) 97 Uncultured Bacteroidetes bacterium clone TDNP_USbc97_208_1_82 (FJ516920.1) 0.02 FIGURE S6. Unrooted phylogenetic tree of the OTUs ( ●) based on 16S rRNA gene sequences presented in the parent F-SBR. The tree was constructed using the neighbor-joining algorithm with the Jukes-Cantor distance in MEGA 4.0. Bootstrap values (only those >50% are shown) were calculated on the basis of 1000 resamplings. The scale bar represents one substitution per 50 nucleotides. Closely related sequences from GenBank are shown as references. The relative abundance of each OTU is given in the parenthesis. The scale bar represents 0.02 substitution per nucleotide position. S7 A1 A2 A3 A-SBR F1 F2 F3 F-SBR FIGURE S7. Microscopes of sludges from A-SBR (A1-A3) and F-SBR (F1-F3) as visualized by FISH. Rhodocyclus -related PAO in β-proteobacteria was hybridized with AMCA-labeled PAOmix (blue), Candidatus Competibacter Phosphatis was hybridized with TAMARA-labeled GAOmix (red), and probe EUBmix specially stained domain Bacteria labeled with 6-FAM (green). Further images analysis showed that Rhodocyclus -related PAO, and Candidatus Competibacter Phosphatis were 58.5 and 3.1% in F-SBR, and 37.2 and 10.5% in A-SBR. S8 .
Load more

Recommended publications
  • Core Bacterial Taxon from Municipal Wastewater Treatment Plants
    ENVIRONMENTAL MICROBIOLOGY crossm Casimicrobium huifangae gen. nov., sp. nov., a Ubiquitous “Most-Wanted” Core Bacterial Taxon from Municipal Wastewater Treatment Plants Yang Song,a,b,c,d,g Cheng-Ying Jiang,a,b,c,d Zong-Lin Liang,a,b,c,g Bao-Jun Wang,a Yong Jiang,e Ye Yin,f Hai-Zhen Zhu,a,b,c,g Ya-Ling Qin,a,b,c,g Rui-Xue Cheng,a Zhi-Pei Liu,a,b,c,d Yao Liu,e Tao Jin,f Philippe F.-X. Corvini,h Korneel Rabaey,i Downloaded from Ai-Jie Wang,a,d,g Shuang-Jiang Liua,b,c,d,g aKey Laboratory of Environmental Biotechnology at Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences, Beijing, China bState Key Laboratory of Microbial Resources at Institute of Microbiology, Chinese Academy of Sciences, Beijing, China cEnvironmental Microbiology Research Center at Institute of Microbiology, Chinese Academy of Sciences, Beijing, China dRCEES-IMCAS-UCAS Joint-Lab of Microbial Technology for Environmental Science, Beijing, China eBeijing Drainage Group Co., Ltd., Beijing, China f BGI-Qingdao, Qingdao, China http://aem.asm.org/ gUniversity of Chinese Academy of Sciences, Beijing, China hUniversity of Applied Sciences and Arts Northwestern Switzerland, Muttenz, Switzerland iCenter for Microbial Ecology and Technology (CMET), Ghent University, Ghent, Belgium Yang Song and Cheng-Ying Jiang contributed equally to this work. Author order was determined by drawing straws. ABSTRACT Microorganisms in wastewater treatment plants (WWTPs) play a key role in the removal of pollutants from municipal and industrial wastewaters. A recent study estimated that activated sludge from global municipal WWTPs har- on June 19, 2020 by guest bors 1 ϫ 109 to 2 ϫ 109 microbial species, the majority of which have not yet been cultivated, and 28 core taxa were identified as “most-wanted” ones (L.
    [Show full text]
  • Photosynthesis Is Widely Distributed Among Proteobacteria As Demonstrated by the Phylogeny of Puflm Reaction Center Proteins
    fmicb-08-02679 January 20, 2018 Time: 16:46 # 1 ORIGINAL RESEARCH published: 23 January 2018 doi: 10.3389/fmicb.2017.02679 Photosynthesis Is Widely Distributed among Proteobacteria as Demonstrated by the Phylogeny of PufLM Reaction Center Proteins Johannes F. Imhoff1*, Tanja Rahn1, Sven Künzel2 and Sven C. Neulinger3 1 Research Unit Marine Microbiology, GEOMAR Helmholtz Centre for Ocean Research, Kiel, Germany, 2 Max Planck Institute for Evolutionary Biology, Plön, Germany, 3 omics2view.consulting GbR, Kiel, Germany Two different photosystems for performing bacteriochlorophyll-mediated photosynthetic energy conversion are employed in different bacterial phyla. Those bacteria employing a photosystem II type of photosynthetic apparatus include the phototrophic purple bacteria (Proteobacteria), Gemmatimonas and Chloroflexus with their photosynthetic relatives. The proteins of the photosynthetic reaction center PufL and PufM are essential components and are common to all bacteria with a type-II photosynthetic apparatus, including the anaerobic as well as the aerobic phototrophic Proteobacteria. Edited by: Therefore, PufL and PufM proteins and their genes are perfect tools to evaluate the Marina G. Kalyuzhanaya, phylogeny of the photosynthetic apparatus and to study the diversity of the bacteria San Diego State University, United States employing this photosystem in nature. Almost complete pufLM gene sequences and Reviewed by: the derived protein sequences from 152 type strains and 45 additional strains of Nikolai Ravin, phototrophic Proteobacteria employing photosystem II were compared. The results Research Center for Biotechnology (RAS), Russia give interesting and comprehensive insights into the phylogeny of the photosynthetic Ivan A. Berg, apparatus and clearly define Chromatiales, Rhodobacterales, Sphingomonadales as Universität Münster, Germany major groups distinct from other Alphaproteobacteria, from Betaproteobacteria and from *Correspondence: Caulobacterales (Brevundimonas subvibrioides).
    [Show full text]
  • Anaerobic Degradation of Steroid Hormones by Novel Denitrifying Bacteria
    Anaerobic degradation of steroid hormones by novel denitrifying bacteria Von der Fakultät für Mathematik, Informatik und Naturwissenschaften der Rheinisch- Westfälischen Technischen Hochschule Aachen zur Erlangung des akademischen Grades eines Doktors der Naturwissenschaften genehmigte Dissertation vorgelegt von Diplom-Biologe Michael Fahrbach aus Bad Mergentheim (Baden-Württemberg) Berichter: Professor Dr. Juliane Hollender Professor Dr. Andreas Schäffer Tag der mündlichen Prüfung: 12. Dezember 2006 Diese Dissertation ist auf den Internetseiten der Hochschulbibliothek online verfügbar. Table of Contents 1 Introduction.....................................................................................................................1 1.1 General information on steroids ...............................................................................1 1.2 Steroid hormones in the environment.......................................................................2 1.2.1 Natural and anthropogenic sources and deposits ............................................2 1.2.2 Potential impact on the environment ................................................................3 1.2.3 Fate of steroid hormones..................................................................................4 1.3 Microbial degradation of steroid hormones and sterols............................................5 1.3.1 Aerobic degradation..........................................................................................5 1.3.2 Anaerobic degradation......................................................................................7
    [Show full text]
  • Distribution of Rhodoquinone Rhodospirillaceae and Its Taxonomic
    J. Gen. Appl. Microbiol., 30, 435-448 (1984) DISTRIBUTION OF RHODOQUINONE IN RHODOSPIRILLACEAE AND ITS TAXONOMIC IMPLICATIONS AKIRA HIRAISHI ANDYASUO HOSHINO Department of Biology, Faculty of Science, Tokyo Metropolitan University, Setagaya-ku, Tokyo 158, Japan (Received November 27, 1984) The rhodoquinone (RQ) composition was studied in representatives of 20 species of Rhodospirillaceae. Thin-layer chromatography, ultraviolet spectrophotometry, mass spectrometry, and high-performance liquid chromatography revealed that six of the 20 test species contained RQ as a major quinone in average amounts of 0.28 to 2.22 umol per g dry weight of cells. The predominant homologue of RQ in the six species was as follows: RQ-8-Rhodospirillum photometricum and an unknown species resembling Rhodocyclus gelatinosus; RQ-9+ RQ-10-Rhodopila globi- formis; RQ-l0-Rhodospirillum rubrum, Rhodopseudomonas acidophila, and Rhodomicrobium vannielii. The taxonomic significance of RQ and other isoprenoid quinones is discussed in comparison with the new clas- sification system for the phototrophic bacteria recently proposed by IMHOFFet al. Isoprenoid quinones in eubacteria can be divided into two major structural groups, the benzoquinones and naphtoquinones represented by ubiquinone (Q) and menaquinone (MK), respectively. Some derivatives of Q and MK also occur in certain species. These lipoquinones play important roles in respiratory or photosynthetic electron transport in bacterial plasma membranes, and have been extensively studied not only from biochemical viewpoints but also in their taxo- nomic aspects (1, 2). Rhodoquinone (RQ) is a derivative of Q in which one of the methoxyl groups is replaced by an amino group (3, 4). This compound was first isolated from Rhodospirillum rubrum by GLOVERand THRELFALL(5).
    [Show full text]
  • Unsuspected Diversity Among Marine Aerobic Anoxygenic Phototrophs
    letters to nature 29. Houghton, R. A. & Hackler, J. L. Emissions of carbon from forestry and land-use change in tropical a BAC 56B12 Asia. Glob. Change Biol. 5, 481±492 (1999). BAC 60D04 30. Kauppi, P. E., Mielikainen, K. & Kuusela, K. Biomass and carbon budget of European forests, 1971 to 0.1 BAC 30G07 1990. Science 256, 70±74 (1992). 100 cDNA 0m13 cDNA 20m11 Supplementary Information accompanies the paper on Nature's website env20m1 (http://www.nature.com). 76 env20m5 cDNA 20m22 99 env0m2 Acknowledgements cDNA 20m8 R2A84* We thank B. Stephens for comments and suggestions on earlier versions of the manuscript. 72 R2A62* R2A163* This work was supported by the NSF, NOAA and the International Geosphere Biosphere 100 Program/Global Analysis, Interpretation, and Modeling Project. S.F. and J.S. were Rhodobacter capsulatus Rhodobacter sphaeroides α-3 supported by NOAA's Of®ce of Global Programs for the Carbon Modeling Consortium. Rhodovulum sulfidophilum* Correspondence and requests for materials should be addressed to A.S.D. 100 Roseobacter denitrificans* 73 Roseobacter litoralis* (e-mail: [email protected]). MBIC3951* 61 82 cDNA 0m1 100 cDNA 20m21 99 env0m1 envHOT1 100 Erythrobacter longus* Erythromicrobium ramosum ................................................................. 100 96 Erythrobacter litoralis* α-4 98 MBIC3019* Unsuspected diversity among marine Sphingomonas natatoria cDNA 0m20 aerobic anoxygenic phototrophs 96 Thiocystisge latinosa γ Allochromatium vinosum Rhodopseudomonas palustris Oded BeÂjaÁ*², Marcelino T. Suzuki*,
    [Show full text]
  • Suppl. Figure 1 (.Pdf)
    Supplementary web Figure 1. 16S rRNA-based phylogenetic trees showing the affiliation of all cultured and uncultured members of the nine “Rhodocyclales” lineages. The consensus tree is based on maximum-likelihood analysis (AxML) of full- length sequences (>1,300 nucleotides) performed with a 50% conservation filter for the “Betaproteobacteria”. Named type species are indicated by boldface type. Bar indicates 10% estimated sequence divergence. Polytomic nodes connect branches for which a relative order could not be determined unambiguously by applying neighbor- joining, maximum-parsimony, and maximum-likelihood treeing methods. Numbers at branches indicate parsimony bootstrap values in percent. Branches without numbers had bootstrap values of less than 75%. The minimum 16S rRNA sequence similarity for each “Rhodocyclales” lineage is shown. P+ sludge clone SBR1021, AF204250 P+ sludge clone GC152, AF204242 Kraftisried wwtp clone KRA42, AY689087 Kraftisried wwtp clone S28, AF072922 Kraftisried wwtp clone A13, AF072927 Kraftisried wwtp clone H23, AF072926 Kraftisried wwtp clone S40, AF234757 Sterolibacterium lineage 100 Kraftisried wwtp clone H12, AF072923 100 Kraftisried wwtp clone H20, AF072920 92.5% 89 rape root clone RRA12, AY687926 100 P+ sludge clone SBR1001, AF204252 P- sludge clone SBR2080, AF204251 P+ sludge clone GC24, AF204243 mine water clone I12, AY187895 100 93 denitrifying cholesterol-degrading bacterium 72Chol, Y09967 Sterolibacterium denitrificans, AJ306683 Kraftisried wwtp clone KRZ64, AY689092 Kraftisried wwtp clone KRZ70,
    [Show full text]
  • International Journal of Systematic and Evolutionary Microbiology
    University of Plymouth PEARL https://pearl.plymouth.ac.uk 01 University of Plymouth Research Outputs University of Plymouth Research Outputs 2017-05-01 Reclassification of Thiobacillus aquaesulis (Wood & Kelly, 1995) as Annwoodia aquaesulis gen. nov., comb. nov., transfer of Thiobacillus (Beijerinck, 1904) from the Hydrogenophilales to the Nitrosomonadales, proposal of Hydrogenophilalia class. nov. within the 'Proteobacteria', and four new families within the orders Nitrosomonadales and Rhodocyclales Boden, R http://hdl.handle.net/10026.1/8740 10.1099/ijsem.0.001927 International Journal of Systematic and Evolutionary Microbiology All content in PEARL is protected by copyright law. Author manuscripts are made available in accordance with publisher policies. Please cite only the published version using the details provided on the item record or document. In the absence of an open licence (e.g. Creative Commons), permissions for further reuse of content should be sought from the publisher or author. International Journal of Systematic and Evolutionary Microbiology Reclassification of Thiobacillus aquaesulis (Wood & Kelly, 1995) as Annwoodia aquaesulis gen. nov., comb. nov. Transfer of Thiobacillus (Beijerinck, 1904) from the Hydrogenophilales to the Nitrosomonadales, proposal of Hydrogenophilalia class. nov. within the 'Proteobacteria', and 4 new families within the orders Nitrosomonadales and Rhodocyclales. --Manuscript Draft-- Manuscript Number: IJSEM-D-16-00980R2 Full Title: Reclassification of Thiobacillus aquaesulis (Wood & Kelly,
    [Show full text]
  • Phytoremediation and Bioremediation of Perchlorate at the Longhorn Army Ammunition Plant
    Jerald L. Schnoor Department of Civil and Gene F. Parkin Craig L. Just Environmental Benoit van Aken Joshua D.Shrout Engineering The University of Iowa 4112 Seamans Center Iowa City, IA 52242 Phone (319) 335-5649 Fax (319) 335-5660 Phytoremediation and Bioremediation of Perchlorate at the Longhorn Army Ammunition Plant Final Report Submitted: May 2002 Table of Contents Executive Summary......................................................................................................................... 1 Introduction ...................................................................................................................................... 2 General Background and Bioremediation Potential of Perchlorate ............................................. 2 Phytoremediation of Contaminated Soils and Waters ................................................................. 4 Methods ............................................................................................................................................ 8 Hybrid Poplar Trees ..................................................................................................................... 8 In Vivo Degradation Experiments ................................................................................................ 8 Production of Nodules.................................................................................................................. 9 In Vitro Degradation Experiments ...............................................................................................
    [Show full text]
  • Comparison of Bacterial Communities of Conventional and A-Stage
    www.nature.com/scientificreports OPEN Comparison of bacterial communities of conventional and A-stage activated sludge systems Received: 18 June 2015 Alejandro Gonzalez-Martinez1, Alejandro Rodriguez-Sanchez2, Tommaso Lotti3, Maria- Accepted: 26 November 2015 Jesus Garcia-Ruiz1, Francisco Osorio1, Jesus Gonzalez-Lopez2 & Mark C. M. van Loosdrecht3 Published: 05 January 2016 The bacterial community structure of 10 different wastewater treatment systems and their influents has been investigated through pyrosequencing, yielding a total of 283486 reads. These bioreactors had different technological configurations: conventional activated sludge (CAS) systems and very highly loaded A-stage systems. A-stage processes are proposed as the first step in an energy producing municipal wastewater treatment process. Pyrosequencing analysis indicated that bacterial community structure of all influents was similar. Also the bacterial community of all CAS bioreactors was similar. Bacterial community structure of A-stage bioreactors showed a more case-specific pattern. A core of genera was consistently found for all influents, all CAS bioreactors and all A-stage bioreactors, respectively, showing that different geographical locations in The Netherlands and Spain did not affect the functional bacterial communities in these technologies. The ecological roles of these bacteria were discussed. Influents and A-stage bioreactors shared several core genera, while none of these were shared with CAS bioreactors communities. This difference is thought to reside in the different operational conditions of the two technologies. This study shows that bacterial community structure of CAS and A-stage bioreactors are mostly driven by solids retention time (SRT) and hydraulic retention time (HRT), as suggested by multivariate redundancy analysis. The activated sludge process is the most common treatment of wastewater at municipal and industrial wastewater treatment facilities1.
    [Show full text]
  • The Presence of Nitrate Dramatically Changed the Predominant Microbial
    Stepanov et al. BMC Microbiology 2014, 14:225 http://www.biomedcentral.com/1471-2180/14/225 RESEARCH ARTICLE Open Access The presence of nitrate dramatically changed the predominant microbial community in perchlorate degrading cultures under saline conditions Victor G Stepanov2†, Yeyuan Xiao1†, Quyen Tran2, Mark Rojas3, Richard C Willson2,4,5, Yuriy Fofanov3, George E Fox2,4 and Deborah J Roberts1* Abstract Background: Perchlorate contamination has been detected in both ground water and drinking water. An attractive treatment option is the use of ion-exchange to remove and concentrate perchlorate in brine. Biological treatment can subsequently remove the perchlorate from the brine. When nitrate is present, it will also be concentrated in the brine and must also be removed by biological treatment. The primary objective was to obtain an in-depth characterization of the microbial populations of two salt-tolerant cultures each of which is capable of metabolizing perchlorate. The cultures were derived from a single ancestral culture and have been maintained in the laboratory for more than 10 years. One culture was fed perchlorate only, while the other was fed both perchlorate and nitrate. Results: A metagenomic characterization was performed using Illumina DNA sequencing technology, and the 16S rDNA of several pure strains isolated from the mixed cultures were sequenced. In the absence of nitrate, members of the Rhodobacteraceae constituted the prevailing taxonomic group. Second in abundance were the Rhodocyclaceae. In the nitrate fed culture, the Rhodobacteraceae are essentially absent. They are replaced by a major expansion of the Rhodocyclaceae and the emergence of the Alteromonadaceae as a significant community member.
    [Show full text]
  • Microbial Communities in Activated Sludge Performing Enhanced Biological Phosphorus Removal in a Sequencing Batch Reactor Che Ok Jeon, Dae Sung Lee, Jong Moon Park*
    Water Research 37 (2003) 2195–2205 Microbial communities in activated sludge performing enhanced biological phosphorus removal in a sequencing batch reactor Che Ok Jeon, Dae Sung Lee, Jong Moon Park* Department of Chemical Engineering, School of Environmental Science and Engineering, Pohang University of Science and Technology, Biotechnology Lab, San 31, Hyoja-dong, Nam-gu, Pohang 790-784, Kyoungbuk, South Korea Received 13 June 2002; received in revised form 25 October 2002; accepted 23 November 2002 Abstract Microbial communities ofactivated sludge in an anaerobic/aerobic sequencing batch reactor (SBR) supplied with acetate as sole carbon source were analyzed to identify the microorganisms responsible for enhanced biological phosphorus removal. Various analytical methods were used such as electron microscopy, quinone, slot hybridization, and 16S rRNA gene sequencing analyses. Electron photomicrographs showed that coccus-shaped microorganisms of about 1 mm diameter dominated the microbial communities ofthe activated sludge in the SBR, which had been operated for more than 18 months. These microorganisms contained polyphosphate granules and glycogen inclusions, which suggests that they are a type ofphosphorus-accumulating organism. Quinones, slot hybridization, and 16S rRNA sequencing analyses showed that the members ofthe Proteobacteria beta subclass were the most abundant species and were affiliated with the Rhodocyclus-like group. Phylogenetic analysis revealed that the two dominating clones ofthe beta subclass were closely related to the Rhodocyclus-like group. It was concluded that the coccus-shaped organisms related to the Rhodocyclus-like group within the Proteobacteria beta subclass were the most dominant species believed responsible for biological phosphorus removal in SBR operation with acetate. r 2003 Elsevier Science Ltd.
    [Show full text]
  • Phylogenomics of Rhodocyclales and Its Distribution in Wastewater Treatment Systems Zhongjie Wang1, Wenqing Li2, Hao Li1, Wei Zheng1 & Feng Guo1*
    www.nature.com/scientificreports OPEN Phylogenomics of Rhodocyclales and its distribution in wastewater treatment systems Zhongjie Wang1, Wenqing Li2, Hao Li1, Wei Zheng1 & Feng Guo1* Rhodocyclales is an abundant bacterial order in wastewater treatment systems and putatively plays key roles in multiple functions. Its phylogenomics, prevalence of denitrifying genes in sub-lineages and distribution in wastewater treatment plants (WWTPs) worldwide have not been well characterized. In the present study, we collected 78 Rhodocyclales genomes, including 17 from type strains, non-type strains and genome bins contributed by this study. Phylogenomics indicated that the order could be divided into fve family-level lineages. With only a few exceptions (mostly in Rhodocyclaceae), nirS- containing genomes in this order usually contained the downstream genes of norB and nosZ. Multicopy of denitrifying genes occurred frequently and events of within-order horizontal transfer of denitrifying genes were phylogenetically deduced. The distribution of Rhodocyclaceae, Zoogloeaceae and Azonexaceae in global WWTPs were signifcantly governed by temperature, mixed liquor suspended solids, etc. Metagenomic survey showed that the order generally ranked at the top or second for diferent denitrifying genes in wastewater treatment systems. Our results provided comprehensive genomic insights into the phylogeny and features of denitrifying genes of Rhodocyclales. Its contribution to the denitrifying gene pool in WWTPs was proved. Activated sludge, which is a widely utilized biological process for the treatment of municipal and industrial waste- waters around the world for over a century1,2, relies on a complex consortium of microorganisms to remove pollutants and facilitate separation of focs and water3. A key functional microbial taxon in wastewater treatment systems is Rhodocyclales, which is dominant in activated sludge samples according to the relative abundance of 16S rRNA genes and hybridization approach4,5.
    [Show full text]