Using Sludge Fermentation Liquid to Improve Wastewater Short-Cut

Using sludge fermentation liquid to improve wastewater short-cut

nitrification-denitrification and denitrifying phosphorus removal via nitrite

Zhouying Ji, Yinguang Chen*

(State Key Laboratory of Pollution Control and Resources Reuse, School of Environmental Science and

Engineering, Tongji University, 1239 Siping Road, Shanghai 200092, China)

*Corresponding author

E-mail: [email protected]

Tel: 86-21-65981263

Fax: 86-21-65986313

Supporting Information: 8 pages, 2 tables and 7 figures

TABLE S1. Oligonucleotide Probes Used in This Study

Probe Specificity Sequence (5 ′-3′) DFA (%) d Reference

EUB338 a Domain Bacteria GCTGCCTCCCGTAGGAGT 35 (15 )

Planctomycetales and other Bacteria not detected EUB338-II a GCAGCCACCCGTAGGTGT 35 (15 ) by EUB338

Verrucomicrobiales and other Bacteria not detected EUB338-III a GCTGCCACCCGTAGGTGT 35 (15 ) by EUB338

GAOQ989 b Candidatus Competibacter Phosphatis TTCCCCGGATGTCAAGGC 35 (3)

GB_G2 b Candidatus Competibacter Phosphatis TTCCCCAGATGTCAAGGC 35 (3)

GAOQ431 b Candidatus Competibacter Phosphatis TCCCCGCCTAAAGGGCTT 35 (3)

PAO462 c Rhodocyclus -related PAO in Betaproteobacteria CCGTCATCTACWCAGGGTATTAAC 35 (15 )

PAO651 c Rhodocyclus -related PAO in Betaproteobacteria CCCTCTGCCAAACTCCAG 35 (15)

PAO846 c Rhodocyclus -related PAO in Betaproteobacteria GTTAGCTACGGCACTAAAAGG 35 (15)

Nso1225 Ammonia-oxidizing Betaproteobacteria CGCGATTGTATTACGTGTGA 35 (16)

Nso190 Ammonia-oxidizing Betaproteobacteria CGATCCCCTGCTTTTCTCC 20 (16)

NIT3 Nitrobacter spp. CCTGTGCTCCATGCTCCG 40 (16)

Ntspa662 Nitrospira genus GGAATTCCGCGCTCCTCT 20 (16) a EUB338, EUB338-II, and EUB-III were used in the mixture called EUBmix. b GAOQ989, GB_G2, and GAOQ431 were used in the mixture called GAOmix. c PAO462, PAO651, and PAO846 were used in the mixture called PAOmix. d Deionized formamide concentration in the hybridization buffer.

a TABLE S2. Ratios of P O, P ON and P ONn Accounting for Total PAOs in Two SBRs

PO/PAOs (%) PON /PAOs (%) DNPAOs/PAOs (%)

A-SBR 90.8±2.7 2.6±0.1 6.6±0.3

F-SBR 27.0±1.2 12.3±0.5 60.7±1.7 a The data are the averages and their standard deviations in duplicate tests.

80.0 Acetic acid (F-SBR) Propionic acid (F-SBR) Total SCFA (F-SBR) 60.0 Acetic acid (A-SBR)

40.0

SCFA (mgCOD/g-MLVSS) SCFA 20.0

0.0 0 10 20 30 40 50 60 70 80 90 100 Time (min)

FIGURE S1. Changes of SCFA in the anaerobic period. Error bars represent standard deviations of duplicate tests.

S3 100

NAR (%) NAR Ace 40 Ace + Prop Ace + Prop + Prot Ace + Prop + Prot + Carb 20 Fermentation liquid

0 0 10 20 30 40 50 60 Time (min)

FIGURE S 2. Effects of the main organic composition of sludge fermentation liquid on nitrite accumulation ratio in the synthetic wastewater batch tests under aerobic conditions

(Ace (acetic acid), Prop (propionic acid), Prot (protein), and Carb (carbohydrate)). Error bars represent standard deviations of duplicate tests.

9.6

9.0 A-SBR F-SBR

8.4

pH 7.8

7.2

6.6

6.0 0 100 160 205 235 280 310 355 440 Time (min)

Figure S 3. Variations of pH in one typical cycle of two SBRs.

4.0 100

3.2 80

2.4 60

1.6 40 (%) NAR -N (mg/g-MLVSS) - 2 NO ₂⁻-N (HA addition) NO 0.8 NO ₂⁻-N (no HA addition) 20 NAR (HA addition) NAR (no HA addition) 0.0 0 0 10 20 30 40 50 60 Time (min)

- FIGURE S 4. Influence of humic acids on NO 2 -N accumulation in the synthetic wastewater batch test under aerobic conditions. Error bars represent standard deviations of duplicate tests.

S5 87 Uncultured Candidatus Accumulibacter sp. clone EMB clone_7 (HM046420.1) 99 OTU13 94 Uncultured beta proteobacterium clone Skagenf18 (DQ640677.1) 99 OTU2 Rhodocyclus sp. (AJ224937.1) 93 Rhodocyclus sp. HOD 5 (AY691423.1) Dechloromonas denitrificans (AJ318917.1) OTU16 100 99 Uncultured bacterium PHOS-HE23 (AF314420.1) 89 Uncultured Rhodocyclaceae bacterium (FM207944.1) 100 OTU7 Beta proteobacteria Uncultured Rhodocyclaceae bacterium (FM207908.1) 84 Thauera sp. R5 (AB287434.1) OTU14 100 99 Thauera sp. DNT-1 gene (AB066262.1) 100 Nitrosospira sp. EnI299 (EF175101.1) OTU3 100 100 Nitrosospira sp. Nsp41 (AY123788.1) 100 OTU15 Hydrogenophaga sp. EMB 7 (DQ413143.1) 100 100 OTU12 50 Uncultured Acidovorax sp. clone MFC-B162-E05 (FJ393107.1) 99 OTU11 uncultured proteobacterium clone SBRL2_40 (AY098900.1) 70 OTU6 Uncultured gamma proteobacterium clone Skagenf41 (DQ640661.1) 100 Uncultured proteobacterium clone SBRL1_8 (AY098896.1) Gamma proteobacteria 92 OTU8 58 Uncultured gamma proteobacterium clone Skagenf98 (DQ640660.1) 52 OTU4 Uncultured bacterium clone SBRQ157 (AF361092.1) 73 100 OTU9 Uncultured Saprospiraceae bacterium (EU177732.1) 100 OTU1 Delta proteobacteria Uncultured delta proteobacterium clone Skagenf81 (DQ640659.1) Nitrospira sp. (Y14639.1) OTU5 Nitrospirae 98 100 Uncultured Acidobacterium sp. (EF125937.1) Uncultured candidate division TM7 bacterium clone IAFpp7233 (GU214151.1) OTU10 Candidate division TM7 100 90 Uncultured TM7 bacterium (CU918643.1)

0.02

FIGURE S5. Unrooted phylogenetic tree of the OTUs ( ●) based on 16S rRNA gene sequences presented in the parent A-SBR. The tree was constructed using the neighbor-joining algorithm with the Jukes-Cantor distance in MEGA 4.0. Bootstrap values

(only those >50% are shown) were calculated on the basis of 1000 resamplings. The scale bar represents one substitution per 50 nucleotides. Closely related sequences from

GenBank are shown as references. The relative abundance of each OTU is given in the parenthesis. The scale bar represents 0.02 substitution per nucleotide position.

S6 91 OTU1 57 Rhodocyclus sp. (AJ224937.1) 96 Uncultured Candidatus Accumulibacter sp. clone EMB clone_12 (HM046425.1) OTU2 99 OTU3 100 Uncultured Rhodocylaceae bacterium clone TDNP_Wbc97_146_1_49 (FJ517018.1) Rhodocyclus sp. HOD 5 (AY691423.1) 92 Uncultured Azospira sp. clone MFC-B162-C02 (FJ393084.1) Uncultured bacterium PHOS-HE23 (AF314420.1) OTU4 57 93 75 Uncultured Dechloromonas sp. clone 4y-107 (FJ444762.1) 99 OTU14 Candidatus Nitrotoga arctica clone 6680 (DQ839562.1) 67 83 Nitrosomonas sp. Is32 (AJ621027.1) Nitrosomonas ureae (AF272414.1) 100 70 OTU13 OTU8 50 Beta proteobacterium 100 Zoogloea sp. A5 (DQ342276.1) OTU10 100 Uncultured Betaproteobacteria bacterium (CU927667.1) 100 OTU11 Uncultured beta proteobacterium clone Z4MB29 (FJ484828.1) 65 OTU12 100 Uncultured beta proteobacterium clone MVS-8 (DQ676335.1) 100 71 OTU5 100 Acidovorax caeni (AM084011.1) Uncultured Burkholderiales bacterium clone T1IITR15 (FJ422479.1) 71 OTU6 100 Beta proteobacterium HS5/S24542 (AY337603.1) 100 99 OTU7 100 Uncultured beta proteobacterium clone HAVOmat12 (EF032746.1) Uncultured beta proteobacterium clone XME11 (EF061948.1) OTU9 93 100 76 Uncultured Burkholderiales bacterium clone Plot21-2H02 (EU193045.1) OTU15 Gamma proteobacteria 100 Uncultured bacterium clone SBRQ185 (AF361090.1) 54 Sphingomonadaceae bacterium Gsoil 690 gene (AB245348.1) OTU16 Alpha proteobacteria 100 67 99 Sphingobium sp. JEM-15 gene (AB330997.1) OTU19 Verrucomicrobia 100 Uncultured Verrucomicrobia subdivision 3 bacterium clone EB1106 (AY395425.1) OTU18 Alpha proteobacteria 100 Uncultured alpha proteobacterium clone HB125 (EF648106.1) 100 OTU17 Chlorobi Uncultured bacterium PHOS-HE36 (AF314435.1) 100 OTU23 Uncultured Bacteroidetes bacterium clone Skagenf71 (DQ640686.1) 82 OTU21 100 Uncultured Saprospiraceae bacterium clone Epr33 (EU177727.1) Uncultured Bacteroidetes bacterium (AJ318154.1) 100 OTU22 100 Sphingobacterium sp. P-38 partial (AM411962.1) 100 OTU26 82 Uncultured Bacteroidetes bacterium clone IRD18D04 (AY947930.1) Bacteroidetes 55 Uncultured Bacteroidetes bacterium clone Skagenf4 (DQ640656.1) 100 OTU20 88 Uncultured Bacteroidetes bacterium clone Skagenf93 (DQ640676.1) 100 OTU24 64 Uncultured Bacteroidetes bacterium clone Skagen124 (DQ640731.1) 100 OTU25 Uncultured Bacteroidetes bacterium clone Z32M54B (FJ484389.1) 97 Uncultured Bacteroidetes bacterium clone TDNP_USbc97_208_1_82 (FJ516920.1)

0.02

FIGURE S6. Unrooted phylogenetic tree of the OTUs ( ●) based on 16S rRNA gene sequences presented in the parent F-SBR. The tree was constructed using the neighbor-joining algorithm with the Jukes-Cantor distance in MEGA 4.0. Bootstrap values

(only those >50% are shown) were calculated on the basis of 1000 resamplings. The scale bar represents one substitution per 50 nucleotides. Closely related sequences from

GenBank are shown as references. The relative abundance of each OTU is given in the parenthesis. The scale bar represents 0.02 substitution per nucleotide position.

A1 A2 A3

A-SBR

F1 F2 F3 F-SBR

FIGURE S7. Microscopes of sludges from A-SBR (A1-A3) and F-SBR (F1-F3) as visualized by FISH. Rhodocyclus -related PAO in β-proteobacteria was hybridized with

AMCA-labeled PAOmix (blue), Candidatus Competibacter Phosphatis was hybridized with

TAMARA-labeled GAOmix (red), and probe EUBmix specially stained domain Bacteria labeled with 6-FAM (green). Further images analysis showed that Rhodocyclus -related

PAO, and Candidatus Competibacter Phosphatis were 58.5 and 3.1% in F-SBR, and 37.2

and 10.5% in A-SBR.