DOCSLIB.ORG

Molecular Phylogeny of Acipenseridae: Nonmonophyly of Scaphirhynchinae

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Molecular Phylogeny of Acipenseridae: Nonmonophyly of Scaphirhynchinae Copeia, 2002(2), pp. 287±301 Molecular Phylogeny of Acipenseridae: Nonmonophyly of Scaphirhynchinae VADIM J. BIRSTEIN,P.DOUKAKIS, AND R. DESALLE A phylogenetic hypothesis is presented illustrating relationships among 23 extant sturgeon species based on nucleotide data from ®ve mitochondrial genes (cyto- chrome b, NADH5, control region, 16S, and 12S). The tree supports our previous hypotheses regarding relationships among species of Acipenser and Huso. The intro- duction of Scaphirhynchus and Pseudoscaphirhynchus to the analysis does not change these main relationships. The genera Scaphirhynchus and Pseudoscaphirhynchus do not form a monophyletic group corresponding to the subfamily Scaphirhynchinae or the tribe Scaphirhynchini. The genus Scaphirhynchus may be basal within the family Aci- penseridae, whereas Pseudoscaphirhynchus appears to be embedded within Acipenser clustering with the stellate sturgeon, Acipenser stellatus. The morphological similarity between Scaphirhynchus and Pseudoscaphirhynchus could be a result of convergent evolution of different ancestral sturgeon forms in similar environmental conditions of distant river systems of North America and Central Asia. CCORDING to traditional classi®cation, the Ohio River (Ra®nesque, 1820). This ``shovel®sh A Order Acipenseriformes (sturgeons and (currently shovelnose) sturgeon Accipenser pla- paddle®shes) consists of two families, the Aci- torynchus'' was later placed in a new separate ge- penseridae, with genera Acipenser, Huso, Scaphir- nus Scaphirhynchus as Scaphirhynchus platorynchus hynchus, and Pseudoscaphirhynchus, and the Po- (Heckel, 1835). The pallid sturgeon, Parasca- lyodontidae, represented by two extant species, phirhynchus albus, was subsequently described Polyodon spathula and Psephurus gladius (Berg, from the same river system (Forbes and Rich- 1904, 1940). Recent studies con®rm that the ardson, 1905) and eventually recognized as Sca- two families are monophyletic, sister taxa phirhynchus albus (Bailey and Cross, 1954). The (Grande and Bemis, 1991, 1996; Bemis et al., third species, the Alabama sturgeon Scaphirhyn- 1997; but see Gardiner, 1984). Two subfamilies chus suttkusi, was discovered in the Mobile River are further recognized within Acipenseridae: system and described much later (Williams and the Acipenserinae consisting of Acipenser and Clemmer, 1991). Huso and the Scaphirhynchinae, which includes The ®rst description of a species of Pseudos- Scaphirhynchus and Pseudoscaphirhynchus (Berg, caphirhynchus, Scaphirhynchus fedtschenkoi, was 1911, 1940). Currently, the Scaphirhynchinae is based on a specimen caught in 1871 in the Syr regarded as monophyletic (Mayden and Kuhaj- Darya River in Central Asia (former Turkestan, da, 1996) with some authors suggesting the currently Kazakhstan; Kessler, 1872). This spec- group is more appropriately recognized as the imen was originally de®ned as a member of the tribe Scaphirhynchini within the subfamily Aci- genus Scaphirhynchus because of its morpholog- penserinae (Grande and Bemis, 1996; Bemis et ical similarity (e.g. shovel-shaped head and long al., 1997; Findeis, 1997). The Scaphirhynchinae caudal rod) to published drawings of S. platoryn- is generally believed to be the sister group of all chus (Kessler, 1872, 1873). Scaphirhynchus her- other sturgeons (Berg, 1911; Mayden and Ku- manni and Scaphirhynchus kaufmanni were later hajda, 1996) and the most basal lineage within described based on specimens caught in the the Acipenseridae (Bogdanov, 1882:106±110; Amu Darya River in Central Asia (former Tur- Zograf, 1887; Schmalhausen, 1991). Other au- kestan, currently Uzbekistan and Turkmenistan; thors, however, suggest the group may be de- Bogdanov, 1874; Kessler, 1877). The three spe- rived (Kessler, 1877; Berg, 1905; Findeis, 1993, cies were elevated to a separate genus Pseudos- 1997). caphirhynchus by Nikolsky (1900). The con®r- Two species of Scaphirhynchus and three spe- mation of the species of Pseudoscaphirhynchus cies of Pseudoscaphirhynchus were originally de- and the uni®cation of the subfamily Scaphirhyn- scribed in the 19th century, with the two genera chinae was later accomplished by the Russian placed in the separate subfamily Scaphirhynchi- ichthyologist Berg (1904, 1905, 1911). nae at the turn of the 20th century. The ®rst In their review of the subfamily Scaphirhyn- species of Scaphirhynchinae was described by C. chinae, Bailey and Cross (1954:172) wrote Ra®nesque in his monograph on ®shes of the ``...wewere uncertain whether the two genera q 2002 by the American Society of Ichthyologists and Herpetologists 288 COPEIA, 2002, NO. 2 TABLE 1. PRIMERS AND CONDITIONS USED FOR PCR AMPLIFICATION OF GENE REGIONS. Forward primers are given ®rst followed by reverse primers. All sequences are listed in 59 to 39 direction. Gene regiona Primer sequence Primer name/reference 18Sb TACCTGGTTGATCCTGCCAGTAG 1F/Giribet et al., 1996 AGGGTCCCTCTCCGGAATCGAAC 3R/Giribet et al., 1996 CCAGCAGCCGCGCTAATTC 4F/Giribet et al., 1996 CTTGGCAAATGCTTTCGC 5R/Giribet et al., 1996 GCAATAACAGGTCTGTGATGCCC 7F/Giribet et al., 1996 GATCCTTCCGCAGGTTCACCTAC 9R/Giribet et al., 1996 12S GGTGGCATTTTATTTTATTAGAGG 12Sa/Kocher et al., 1989 CCGGTCTGAACTCAGATCACGT 12Sb/Hedges et al., 1993 16S CGCCTGTTTACCAAAACAT 16Sa/Palumbi et al., 1991 CCGGTCTGAACTCAGATCACGT 16Sb/Palumbi et al., 1991 Control regionc TAACTGCAGAAGGCTAGGACCAAACCT mod H00651/Kocher et al., 1989 GCACCCAAAGCTGARRTTCTA dlp 1.5/Baker et al., 1993 CAGTCCTGATTTTGGGGTTTGAC HF400/P. Doukakis, unpubl. TGTCAAACCCCAAAAGCAGG HB400/P. Doukakis, unpubl. TTCTYGGCATGTGGGGWCAT HF100/P. Doukakis, unpubl. NADH5d AATAGTTTATCCAGTTGGTCTTAG ND5/Bembo et al., 1995 TAACAACGGTGGTTTTTCAAGTCA ND5/6a/Nielsen et al., 1998 AAGCCCATGAGTGGTAGG RND5-3/Doukakis et al., 1999 Cyt b CCATCCAACATCTCTGCTTGATGAAA B1/J. Groth, pers. comm. CCTCCAATTCATGTGAGTACT S2A/Birstein et al., 1997 a Conditions for PCR ampli®cation were 18S: 948 0:15, 558 0:15, 728 0:15, 30 cycles; 12S and 16S: 948 1:00, 558 1:00, 728 1:30, 33 cycles; control region and cyt b:948 1:00, 468 1:00, 728 1:50, 33 cycles; NADH5: 948 1:00, 488 1:00, 728 1:30, 33 cycles. b 18S primers are listed sequentially as pairs for ampli®cation purposes with forward (F) and reverse (R) primers. c The modi®ed H00651 and dlp 1.5 were used to amplify the entire control region. HF400, HB400, HF100 are internal sequencing primers. d ND5 and ND5/6a are forward primers while RND5-3 is the reverse primer. of `shovelnose' sturgeons (Scaphirhynchus and for species designations and relationships with- Pseudoscaphirhynchus) owed their close resem- in the Acipenseriformes. We further assess our blance to common ancestry or to conver- results in light of available morphological char- gence....Itispremature to deny categorically acter information and historic biogeography. that the striking agreement in several features We studied only two of three species of Pseudos- may be due to parallel modi®cations in animals caphirhynchus: currently, small populations of that inhabit the channels of large silty rivers.'' Pseudoscaphirhynchus hermanni and Pseudoscaphir- The Mississippi-Missouri and Amu Darya/Syr hynchus kaufmanni still survive in the Turkmen- Darya rivers inhabited by Scaphirhynchus and ian part of the Amu Darya River (Salnikov et Pseudoscaphirhynchus, respectively, have strong al., 1996), whereas P. fedtschenkoi is practicaly ex- currents and extremely muddy and silty water tinct (Birstein, 1997). (Nikolsky, 1938; Hurley et al., 1987; Burke and Ramsey, 1995). These conditions differ consid- MATERIALS AND METHODS erably from the clear waters inhabited by Aci- penser and Huso (Bemis and Kynard, 1997). Our DNA extraction and sequencing.ÐDNA was ex- preliminary molecular studies including exem- tracted from all tissue specimens (see Materials plars from the two subfamilies found Scaphir- Examined) using standard phenol chloroform hynchinae to be paraphyletic, with S. albus oc- techniques (see DeSalle et al., 1993) after over- cupying a basal position sister to P. kaufmanni, night Proteinase K incubation. Generally, only which was sister to Acipenser plus Huso (Birstein one individual per species was considered. Five et al., 1997). Further molecular studies exam- mitochondrial gene regions [12S, 16S, NADH5, ining all extant species of Acipenser used only S. control region, cytochrome b (cyt b)] and sev- albus as a representative of the Scaphirhynchi- eral regions within the nuclear 18S region were nae and did not consider any species of Pseu- examined using the primers and conditions list- doscaphirhynchus (Birstein and DeSalle, 1998). ed in Table 1. Low variability was found for 18S Here, we use an additional DNA sequence anal- fragments between representative sequences of ysis and further taxon sampling to address the A. baerii, S. albus, P. kaufmanni, and Polyodon spa- monophyly of the Scaphirhynchinae and Aci- thula; hence, this region was not sequenced for penserinae subfamilies and provide clari®cation all taxa nor included in the analysis. Sequenced BIRSTEIN ET AL.ÐMOLECULAR PHYLOGENY OF ACIPENSERIDAE 289 regions for all taxa consisted of 337 bp 12S, 523 approach was used in analyzing all gene regions bp 16S, 643 bp NADH5, 846 bp control region, simultaneously (Nixon and Carpenter, 1995). A and 526 bp cyt b. The cyt b gene sequences con- combined evidence approach (molecules plus sisted of the three noncontiguous fragments as morphology) was also adopted for assessing the detailed in Birstein and DeSalle (1998). In some species relationships among the subset of spe-
Load more

Recommended publications
  • Life History and Population Dynamics of Lake Sturgeon
    LIFE HISTORY AND POPULATION DYNAMICS OF LAKE STURGEON, Acipenser fulvescens, IN THE MUSKEGON RIVER, MICHIGAN by Paul Joseph Vecsei (Under the direction of Douglas L. Peterson) ABSTRACT The lake sturgeon was once abundant throughout Lake Michigan with an estimated 11 million fish prior to human exploitation. By the early 1900s, however, most populations had been decimated by severe over-fishing and habitat degradation. Despite recent interests in restoring the species in Lake Michigan, little is known about the current status of remnant populations. The primary objectives of this study were to estimate annual spawning stock abundance and to identify potential spawning habitat for lake sturgeon on the Muskegon River, Michigan. To capture adult lake sturgeon, I used large-mesh, bottom-set gill nets deployed at the mouth of the Muskegon River from mid- March through May, 2002-2005. Radio telemetry was used to monitor seasonal movements and to identify likely spawning habitats. Sampling for larval lake sturgeon was conducted in May of each year using D-frame drift nets anchored in the mainstream of the river channel. During the 4 years of the study, I expended more than 5000 gill-net hours and captured 59 individual adult lake sturgeon. Larval lake sturgeon were captured in 2 years, suggesting that at least some natural reproduction still occurs. Habitat analysis revealed that the lower Muskegon River likely contains extensive reaches of potential spawning habitat for lake sturgeon. INDEX WORDS: Biology, population dynamics, habitat, lake
    [Show full text]
  • Pallid Sturgeon Recovery Plan (Recovery Plan)
    PALLID STURGEON coRE VERYPMN Recovery Plan for the Pallid Sturgeon (Scaphirhynchus a/bus) Prepared by the Pallid Sturgeon Recovery Team Principal Authors Mark P. Dryer, Leader U.S. Fish and Wildlife Service Ecological Services 1500 Capitol Avenue Bismarck, ND 58501 and Alan J. Sandvol U.S. Fish and Wildlife Service Fisheries and Federal Aid 1500 Capitol Avenue Bismarck, ND 58501 for Region 6 U.S. Fish and Wildlife Service Denver, Colorado / Approved: Re~5l i rector Date TABLE OF CONTENTS TITLE PAGE RECOVERY BACKGROUND AND STRATEGY iii PALLID STURGEON RECOVERY TEAM iv DISCLAIMER V ACKNOWLEDGEMENTS vi EXECUTIVE SUMMARY vii Part I INTRODUCTION 1 History 1 General Description 1 Historical Distribution and Abundance 3 Present Distribution and Abundance 5 Habitat Preference 5 Current Velocity 7 Turbidity 8 Water Depth 8 Substrate 8 Temperature 8 Life History 8 Reproductive Biology 8 Food and Feeding Habits 9 Age and Growth 10 Reasons for Decline 10 Habitat Loss 10 Commercial Harvest 13 Pall uti on/Contami nants 14 Hybridization 14 Part II RECOVERY 16 Recovery Objectives and Criteria 16 Recovery—Priority Management Areas 16 Recovery Outline 19 24 Recovery Outline Narrative . LITERATURE CITED 42 Part III IMPLEMENTATION SCHEDULE 46 FIGURES NO. PAGE 1. Comparative Diagrams of the Ventral Surface of the Head of Shovelnose Sturgeon and Pallid Sturgeon, Showing Several Measurement Ratios of Value for Identification 2 2. Historic Range of Pallid Sturgeon 4 3. Recent Occurrence of Pallid Sturgeon 6 4. Recovery—Priority Management Areas 18 RECOVERY BACKGROUND AND STRATEGY The pallid sturgeon (Scaphirhynchus albus Forbes and Richardson) was listed as an endangered species on September 6, 1990 (55 FR 36641) pursuant to the Endangered Species Act (Act) of 1973 (16 U.S.C.
    [Show full text]
  • 2012 Wildearth Guardians and Friends of Animals Petition to List
    PETITION TO LIST Fifteen Species of Sturgeon UNDER THE U.S. ENDANGERED SPECIES ACT Submitted to the U.S. Secretary of Commerce, Acting through the National Oceanic and Atmospheric Administration and the National Marine Fisheries Service March 8, 2012 Petitioners WildEarth Guardians Friends of Animals 1536 Wynkoop Street, Suite 301 777 Post Road, Suite 205 Denver, Colorado 80202 Darien, Connecticut 06820 303.573.4898 203.656.1522 INTRODUCTION WildEarth Guardians and Friends of Animals hereby petitions the Secretary of Commerce, acting through the National Marine Fisheries Service (NMFS)1 and the National Oceanic and Atmospheric Administration (NOAA) (hereinafter referred as the Secretary), to list fifteen critically endangered sturgeon species as “threatened” or “endangered” under the Endangered Species Act (ESA) (16 U.S.C. § 1531 et seq.). The fifteen petitioned sturgeon species, grouped by geographic region, are: I. Western Europe (1) Acipenser naccarii (Adriatic Sturgeon) (2) Acipenser sturio (Atlantic Sturgeon/Baltic Sturgeon/Common Sturgeon) II. Caspian Sea/Black Sea/Sea of Azov (3) Acipenser gueldenstaedtii (Russian Sturgeon) (4) Acipenser nudiventris (Ship Sturgeon/Bastard Sturgeon/Fringebarbel Sturgeon/Spiny Sturgeon/Thorn Sturgeon) (5) Acipenser persicus (Persian Sturgeon) (6) Acipenser stellatus (Stellate Sturgeon/Star Sturgeon) III. Aral Sea and Tributaries (endemics) (7) Pseudoscaphirhynchus fedtschenkoi (Syr-darya Shovelnose Sturgeon/Syr Darya Sturgeon) (8) Pseudoscaphirhynchus hermanni (Dwarf Sturgeon/Little Amu-Darya Shovelnose/Little Shovelnose Sturgeon/Small Amu-dar Shovelnose Sturgeon) (9) Pseudoscaphirhynchus kaufmanni (False Shovelnose Sturgeon/Amu Darya Shovelnose Sturgeon/Amu Darya Sturgeon/Big Amu Darya Shovelnose/Large Amu-dar Shovelnose Sturgeon/Shovelfish) IV. Amur River Basin/Sea of Japan/Sea of Okhotsk (10) Acipenser mikadoi (Sakhalin Sturgeon) (11) Acipenser schrenckii (Amur Sturgeon) (12) Huso dauricus (Kaluga) V.
    [Show full text]
  • Species and Subject Index*
    Species and subject index* 12SrDNA(mitochondrialgene) 141-144 life history 324-328, 331-332, 348-353 Acipenser gueldenstaedtii (Russian sturgeon) I6S rDNA(mitochondrial gene) 141-144 in MerrimackRiver 324-325 208, 220 I8SrDNA(nucleargene) 141-142, 146 migration323-325,328-330,349, in the Caspian Sea 209, 214 Acipenser 351-353 in the Danube River 185,193, 208 biogeography 41, 43, 128, 158, 169, palatquadrate shape 47 fishery 193,210,214 174 inthe PeeDeeRiver 323, 330 reproduction 214–215 in the Caspian Sea 215-216 phylogeny 45 status 203, 206 feedingadaptations 119 population size321-323, 330 taxonomy 158 fossil forms 174 in the Potomac River 322 in the Volga River 209, 214–215 locomotion adaptation 121 predation on 331 Acipenser kikuchii (=A. sinensis), taxonomy molecular phylogeny 147-148 quadratojugal bone 47 159 molecular variation in 159 reproduction 324-327, 352-353 Acipenser medirostris (green sturgeon) morphological characters 78, 81, 83, in the Saint John River 322, 324-325, fishery 412 86-7.89-91.93.95-6,99, 101, 104, 331 spawning rivers169 106-7,114-6 inthe Santee-Cooper River323-324 systematics 41 osteological methods 77 in the Savannah River 322-324, 330 taxonomy158 -159 phylogeny 43, 64, 116, 128, 145, spawning 324-326, 328-331, 350, 352 in the Tumnin River 158 147-149, 171, 180 status 319,322,356 Acipensermikadoi (Sakhalin sturgeon) 406 polyploidy in 136 stocking 323 in the Amur River 231–232 range31 inthe SusquehannaRiver 322 spawningrivers 169 rostralexpansion 120 taxonomy 159 systematics41 speciation 128, 148 Acipenser dabryanus (Dabry’s sturgeon) taxonomy 158 systematics 26, 39, 41-44, 147 artificial reproduction 262 Acipenser multiscutatus (=A.
    [Show full text]
  • Copyrighted Material
    06_250317 part1-3.qxd 12/13/05 7:32 PM Page 15 Phylum Chordata Chordates are placed in the superphylum Deuterostomia. The possible rela- tionships of the chordates and deuterostomes to other metazoans are dis- cussed in Halanych (2004). He restricts the taxon of deuterostomes to the chordates and their proposed immediate sister group, a taxon comprising the hemichordates, echinoderms, and the wormlike Xenoturbella. The phylum Chordata has been used by most recent workers to encompass members of the subphyla Urochordata (tunicates or sea-squirts), Cephalochordata (lancelets), and Craniata (fishes, amphibians, reptiles, birds, and mammals). The Cephalochordata and Craniata form a mono- phyletic group (e.g., Cameron et al., 2000; Halanych, 2004). Much disagree- ment exists concerning the interrelationships and classification of the Chordata, and the inclusion of the urochordates as sister to the cephalochor- dates and craniates is not as broadly held as the sister-group relationship of cephalochordates and craniates (Halanych, 2004). Many excitingCOPYRIGHTED fossil finds in recent years MATERIAL reveal what the first fishes may have looked like, and these finds push the fossil record of fishes back into the early Cambrian, far further back than previously known. There is still much difference of opinion on the phylogenetic position of these new Cambrian species, and many new discoveries and changes in early fish systematics may be expected over the next decade. As noted by Halanych (2004), D.-G. (D.) Shu and collaborators have discovered fossil ascidians (e.g., Cheungkongella), cephalochordate-like yunnanozoans (Haikouella and Yunnanozoon), and jaw- less craniates (Myllokunmingia, and its junior synonym Haikouichthys) over the 15 06_250317 part1-3.qxd 12/13/05 7:32 PM Page 16 16 Fishes of the World last few years that push the origins of these three major taxa at least into the Lower Cambrian (approximately 530–540 million years ago).
    [Show full text]
  • Sturgeons – Contemporaries of Dinosaurs
    G.M. PALATNIKOV, R.U. KASIMOV STURGEONS – CONTEMPORARIES OF DINOSAURS BAKU – 2010. INTRODUCTION TheCaspian Sea is abundant with its natural unique gems, the most famous being sturgeons and oil. But, as the old wisdom says, wealth alone will make no one happy, especially if used without thinking of future. All natural resources can be categorized as renewables and nonrenewables. Renewables are such resources that can regenerate through reproduction or through the nature renewal cycles over the time frame comparable with the pace of huuman economical activity. Examples of such resources are sturgeons. Nonrenewables are such resources that cannot regenerate over the natural cycle over the time frame comparable with the pace of human economical activity. Oil reserves are such nonrenewable resources. Oil has now been actively developed and produced. Big money is being spent for the development of hydrocarbon exploration, production and transportation technologies. But hydrocarbon reserves sooner or later will deplete. As for sturgeons, their stock is being gradually decreased because of irrational catch, reduction of feeding and spawning areas, and contamination of the water environment - and oil industry has contributed greatly to it. However, this problem has currently not been addressed properly although preservation of sturgeon reserves requires less investment but promises continuously high profits at all times. Unfortunately, not everyone, including those who live at the Caspian Sea, understands this. Most people have insufficient knowledge about sturgeons, but view sturgeons as a source of food. We will try to inform the readers about the life of this unique fish. We will tell you the following: What are these species that have left such a noticeable footprint in the history of mankind? What y interest (other than being a source of food) do they present? Will they be preserved for future generations, or disappear as did their contemporaries – the dinosaurs? 1 GOING BACK TO HISTORY Sturgeon catching has been known since ancient times.
    [Show full text]
  • Status of Knowledge of the Shovelnose Sturgeon (Scaphirhynchus Platorynchus, Rafinesque, 1820) Q
    CORE Metadata, citation and similar papers at core.ac.uk Provided by UNL | Libraries University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Papers in Natural Resources Natural Resources, School of 2016 Status of knowledge of the Shovelnose Sturgeon (Scaphirhynchus platorynchus, Rafinesque, 1820) Q. E. Phelps Missouri Department of Conservation, [email protected] S. J. Tripp Missouri Department of Conservation M. J. Hamel University of Nebraska-Lincoln, [email protected] J. Koch Kansas Department of Wildlife Parks and Tourism E. J. Heist Southern Illinois University Carbondale See next page for additional authors Follow this and additional works at: http://digitalcommons.unl.edu/natrespapers Part of the Natural Resources and Conservation Commons, Natural Resources Management and Policy Commons, and the Other Environmental Sciences Commons Phelps, Q. E.; Tripp, S. J.; Hamel, M. J.; Koch, J.; Heist, E. J.; Garvey, J. E.; Kappenman, K. M.; and Webb, M. A. H., "Status of knowledge of the Shovelnose Sturgeon (Scaphirhynchus platorynchus, Rafinesque, 1820)" (2016). Papers in Natural Resources. 599. http://digitalcommons.unl.edu/natrespapers/599 This Article is brought to you for free and open access by the Natural Resources, School of at DigitalCommons@University of Nebraska - Lincoln. It has been accepted for inclusion in Papers in Natural Resources by an authorized administrator of DigitalCommons@University of Nebraska - Lincoln. Authors Q. E. Phelps, S. J. Tripp, M. J. Hamel, J. Koch, E. J. Heist, J. E. Garvey, K. M. Kappenman, and M. A. H. Webb This article is available at DigitalCommons@University of Nebraska - Lincoln: http://digitalcommons.unl.edu/natrespapers/599 Journal of Applied Ichthyology J.
    [Show full text]
  • View/Download
    ACIPENSERIFORMES (Sturgeons and Paddlefishes) · 1 The ETYFish Project © Christopher Scharpf and Kenneth J. Lazara COMMENTS: v. 7.0 - 7 June 2021 Class ACTINOPTERI actino-, ray; pteron, fin or wing, i.e., fishes with fins of webbed skin supported by bony or horny spines (“rays”), as opposed to the fleshy, lobed fins that characterize Superclass Sarcopterygii Subclass CHONDROSTEI chondros, cartilage; osteo, bone, being primarily cartilaginous fishes that show some ossification Order ACIPENSERIFORMES 2 families · 6 genera · 32 species/subspecies Family ACIPENSERIDAE Sturgeons 4 genera · 30 species/subspecies Subfamily Acipenserinae Acipenser Linnaeus 1758 Latin for sturgeon, derived from the Greek akkipesios and perhaps equivalent to the Egyptian xipen-pennu (Thompson 1947); Kirsch & Fordice (1899) state name is a combination of the Greek akis, point, and pente, five, presumably referring to five rows of sharp scutes on body; Guasparri (2000) translates name from the Latin acus, needle, and pensum, weight (a quantity of wool given to handmaids to be woven or spun daily), i.e., a fish that “possesses a weight of needles,” referring to the “needle-shaped barbels” that hang down from its mouth Acipenser baerii baerii Brandt 1869 patronym not identified but probably in honor of Karl Ernst von Baer (1792-1876), Baltic-German Russian biologist Acipenser baerii baicalensis Nikolskii 1896 -ensis, suffix denoting place: Lake Baikal, Siberia, type locality Acipenser baerii stenorhynchus Nikolskii 1896 stenos, narrow; rhynchus, snout, referring to
    [Show full text]
  • Molecular Systematics of Scaphirhynchinae: an Assessment of North American and Central Asian Freshwater Sturgeon Species by C
    J. Appl. Ichthyol. 23 (2007), 290–296 Received: October 30, 2006 Ó 2007 The Authors Accepted: April 10, 2007 Journal compilation Ó 2007 Blackwell Verlag, Berlin doi:10.1111/j.1439-0426.2007.00919.x ISSN 0175–8659 Molecular systematics of Scaphirhynchinae: an assessment of North American and Central Asian Freshwater Sturgeon Species By C. B. Dillman1,R.M.Wood1, B. R. Kuhajda2, J. M. Ray1, V. B. Salnikov3 and R. L. Mayden1 1Department of Biology, Saint Louis University, St Louis, MO, USA; 2Department of Biological Sciences, University of Alabama, Tuscaloosa, AL, USA; 3National Institute of Deserts, Flora and Fauna, Ministry of Nature Protection of Turkmenistan, Ashgabat, Turkmenistan Summary Acipenser. The subfamily Scaphirhynchinae is comprised of six The sturgeon subfamily Scaphirhynchinae contains two genera species, three in Scaphirhynchus from North America, and of obligate freshwater sturgeon: Scaphirhynchus and Pseudo- three in Pseudoscaphirhynchus from Central Asia (Nelson, scaphirhynchus, from North America and Central Asia, 1994; Mayden and Kuhajda, 1996). Life history strategies respectively. Both genera contain morphologically variable differ between these subfamilies (Bemis and Kynard, 1997) species. A novel data set containing multiple individuals with members of Acipenserinae exhibiting variable life history representing four diagnosable morphological variants for two strategies (i.e. anadromous, amphidromous, and potamodr- species of Pseudoscaphirhynchus, P. hermanni and P. kaufman- omous; Bemis and Kynard, 1997), while members of Scaph- ni, was generated. These data were used to test taxonomic irhynchinae complete all aspects of their life history as obligate hypotheses of monophyly for the subfamily Scaphirhynchinae, freshwater river inhabitants (potamodromous; Bemis and monophyly of both Scaphirhynchus and Pseudoscaphirhynchus, Kynard, 1997).
    [Show full text]
  • Family-Group Names of Fossil Fishes
    European Journal of Taxonomy 466: 1–167 ISSN 2118-9773 https://doi.org/10.5852/ejt.2018.466 www.europeanjournaloftaxonomy.eu 2018 · Van der Laan R. This work is licensed under a Creative Commons Attribution 3.0 License. Monograph urn:lsid:zoobank.org:pub:1F74D019-D13C-426F-835A-24A9A1126C55 Family-group names of fossil fishes Richard VAN DER LAAN Grasmeent 80, 1357JJ Almere, The Netherlands. Email: [email protected] urn:lsid:zoobank.org:author:55EA63EE-63FD-49E6-A216-A6D2BEB91B82 Abstract. The family-group names of animals (superfamily, family, subfamily, supertribe, tribe and subtribe) are regulated by the International Code of Zoological Nomenclature. Particularly, the family names are very important, because they are among the most widely used of all technical animal names. A uniform name and spelling are essential for the location of information. To facilitate this, a list of family- group names for fossil fishes has been compiled. I use the concept ‘Fishes’ in the usual sense, i.e., starting with the Agnatha up to the †Osteolepidiformes. All the family-group names proposed for fossil fishes found to date are listed, together with their author(s) and year of publication. The main goal of the list is to contribute to the usage of the correct family-group names for fossil fishes with a uniform spelling and to list the author(s) and date of those names. No valid family-group name description could be located for the following family-group names currently in usage: †Brindabellaspidae, †Diabolepididae, †Dorsetichthyidae, †Erichalcidae, †Holodipteridae, †Kentuckiidae, †Lepidaspididae, †Loganelliidae and †Pituriaspididae. Keywords. Nomenclature, ICZN, Vertebrata, Agnatha, Gnathostomata.
    [Show full text]
  • Recovery Plan for the Pallid Sturgeon (Scaphirhynchus Albus)
    University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Endangered Species Bulletins and Technical Reports (USFWS) US Fish & Wildlife Service 11-7-1993 Recovery Plan for the Pallid Sturgeon (Scaphirhynchus albus) Mark Dryer U.S. Fish and Wildlife Service Alan Sandvol U.S. Fish and Wildlife Service Follow this and additional works at: https://digitalcommons.unl.edu/endangeredspeciesbull Part of the Biodiversity Commons Dryer, Mark and Sandvol, Alan, "Recovery Plan for the Pallid Sturgeon (Scaphirhynchus albus)" (1993). Endangered Species Bulletins and Technical Reports (USFWS). 34. https://digitalcommons.unl.edu/endangeredspeciesbull/34 This Article is brought to you for free and open access by the US Fish & Wildlife Service at DigitalCommons@University of Nebraska - Lincoln. It has been accepted for inclusion in Endangered Species Bulletins and Technical Reports (USFWS) by an authorized administrator of DigitalCommons@University of Nebraska - Lincoln. PALLID STURGEON coRE VERYPMN Recovery Plan for the Pallid Sturgeon (Scaphirhynchus a/bus) Prepared by the Pallid Sturgeon Recovery Team Principal Authors Mark P. Dryer, Leader U.S. Fish and Wildlife Service Ecological Services 1500 Capitol Avenue Bismarck, ND 58501 and Alan J. Sandvol U.S. Fish and Wildlife Service Fisheries and Federal Aid 1500 Capitol Avenue Bismarck, ND 58501 for Region 6 U.S. Fish and Wildlife Service Denver, Colorado / Approved: Re~5l i rector Date TABLE OF CONTENTS TITLE PAGE RECOVERY BACKGROUND AND STRATEGY iii PALLID STURGEON RECOVERY TEAM
    [Show full text]
  • Nedoluzhko.Pdf
    www.nature.com/scientificreports OPEN Molecular phylogeny of one extinct and two critically endangered Central Asian sturgeon species (genus Pseudoscaphirhynchus) based on their mitochondrial genomes Artem V. Nedoluzhko 1*, Fedor S. Sharko2,3, Svetlana V. Tsygankova2, Eugenia S. Boulygina2, Anna E. Barmintseva4, Anna A. Krasivskaya2, Amina S. Ibragimova2, Natalia M. Gruzdeva2, Sergey M. Rastorguev2,6 & Nikolai S. Mugue4,5,6 The enigmatic and poorly studied sturgeon genus Pseudoscaphirhynchus (Scaphirhynchinae: Acipenseridae) comprises three species: the Amu Darya shovelnose sturgeon (Pseudoscaphirhynchus kaufmanni (Bogdanow)), dwarf Amu Darya shovelnose sturgeon P. hermanni (Kessler), and Syr Darya shovelnose sturgeon (P. fedtschenkoi (Bogdanow). Two species – P. hermanni and P. kaufmanni – are critically endangered due to the Aral Sea area ecological disaster, caused by massive water use for irrigation to support cotton agriculture, subsequent pesticide pollution and habitat degradation. For another species – P. fedtschenkoi – no sightings have been reported since 1960-s and it is believed to be extinct, both in nature and in captivity. In this study, complete mitochondrial (mt) genomes of these three species of Pseudoscaphirhynchus were characterized using Illumina and Sanger sequencing platforms. Phylogenetic analyses showed the signifcant divergence between Amu Darya and Syr Darya freshwater sturgeons and supported the monophyletic origin of the Pseudoscaphirhynchus species. We confrmed that two sympatric Amu Darya species P. kaufmanni and P. hermanni form a single genetic cluster, which may require further morphological and genetic study to assess possible hybridization, intraspecifc variation and taxonomic status and to develop conservation measures to protect these unique fshes. Te animal diversity and classifcation remain complex with new species being continuously discovered and described.
    [Show full text]