A Dissertation Entitled Modulation of Microtubule Dynamics in Netrin

A Dissertation

Entitled

Modulation of Microtubule Dynamics in Netrin Signaling

Huai Huang

Submitted to the Graduate Faculty as partial fulfillment of the requirements for the

Doctor of Philosophy Degree in

Biological Sciences

______Dr. Guofa Liu, Committee Chair

Dr. Bruce Bamber, Committee Member

Dr. Donald Ronning, Committee Member

Dr. Rafael Garcia-Mata, Committee Member

Dr. Scott Molitor, Committee Member

______Dr. Amanda Bryant-Friedrich, Dean

College of Graduate Studies

The University of Toledo

December 2017

This document is copyrighted material. Under copyright law, no parts of this document may be reproduced without the expressed permission of the author. An Abstract of Abstract Modulation of Microtubule Dynamics in Netrin Signaling.

Huai Huang

Submitted to the Graduate Faculty as partial fulfillment of the requirements for the Doctor of Philosophy Degree in Biological Sciences

The University of Toledo December 2017

Neuronal development proceeds through several stages, such as axon and dendrite differentiation, elongation, branching, and pathfinding. Extracellular guidance cues play an essential role in these processes. Activation of downstream signaling of guidance receptors eventually leads to the cytoskeleton rearrangement. Microtubules (MTs), as one form of the cytoskeleton, play an important role in axon and dendrite outgrowth, elongation and branching. Netrin-1, a canonical guidance molecule, binds to its receptors Deleted in

Colorectal Cancer (DCC), Down Syndrome Cell Adhesion Molecule (DSCAM) and uncoordinated-5 (UNC5) mediating neuronal development. Our recent studies have shown that TUBB3, a neuronal β-tubulin isotype III, directly binds to DCC and Netrin-1 induces this interaction. Results from multiple function assays indicate that TUBB3 is specifically involved in Netrin-1-induced axon outgrowth and guidance.

Heterozygous missense mutations in human TUBB3 gene result in a spectrum of brain malformations associated with defects in axon guidance, neuronal migration, and differentiation. However, the molecular mechanisms underlying mutation-related axon

iii guidance abnormalities are unclear. Here, we provide evidence that TUBB3 mutations impair Netrin/DCC signaling in the developing nervous system. The interaction of DCC with most of TUBB3 mutants (eight out of twelve) is significantly reduced compared to the wild type TUBB3. TUBB3 mutants R262C and A302V exhibit decreased subcellular colocalization with DCC in the growth cones of primary neurons. Netrin-1 enhances the interaction of endogenous DCC with wild type human TUBB3, but not with R262C or

A302V, in primary neurons. Netrin-1 also increases the co-sedimentation of DCC with polymerized MTs in primary neurons expressing wild type TUBB3, but not R262C or

A302V. Expression of either R262C or A302V not only suppresses Netrin-1-induced neurite outgrowth, branching and attraction in vitro, but also causes defects in spinal cord commissural axon projection and pathfinding in ovo. Our study reveals that missense

TUBB3 mutations specifically disrupt Netrin/DCC-mediated attractive signaling.

MT dynamics play an important role in Netrin-1-promoted axon outgrowth, branching, and axon pathfinding. However, the mechanism by which Netrin-1 regulates this process is not clear. The MT-associated protein (MAP) tau regulates MT stability and dynamics, which are important for neuronal development in the nervous system. Our study shows that tau interacts with the Netrin receptor DCC, and Netrin-1 induces this interaction in primary neurons. Tau colocalizes with DCC in the growth cone of primary neurons and

Netrin-1 induces this colocalization. Activation of JNK, GSK-3 and Src family kinases are important for Netrin-1-induced DCC/tau interaction. Knockdown of tau inhibits Netrin-1- induced axon outgrowth, branching and commissural axon attraction in vitro and leads to defects in commissural axon projection in the chick spinal cord in vivo. These findings

iv suggest that tau is involved in Netrin-1 signaling and essential for Netrin-1-promoted neuronal development.

In general, these studies are focusing on the role of MT component protein TUBB3 and MT-associated protein tau in the Netrin-1 signaling. The study of TUBB3 mutants further validates the essential role of TUBB3 in Netrin-1-mediated neuronal development by showing that TUBB3 mutants A302V and R262C found in patients disrupt the function of TUBB3 in Netrin-1-mediated neurite outgrowth, axon branching and attraction. The study of tau reveals that tau is involved in Netrin-1-mediated neuronal development.

However, the questions regarding the relationship between TUBB3 and tau in Netrin signaling need to be further addressed. For instance, whether Netrin-1 regulates the interaction between tau and TUBB3, and whether the interaction between DCC and tau is dependent upon the presence of TUBB3 need to be clarified.

Acknowledgements

Firstly, I would like to express my gratitude to my advisor Dr. Guofa Liu for the tremendous support of my Ph.D study and related research, for his patience, motivation, and his knowledge. His guidance helped me in all the time of research and writing of this thesis. Besides my advisor, I would like to thank the rest of my thesis committee: Dr. Bruce

Bamber, Dr. Donald Ronning, and Dr. Rafael Garcia-Mata and Dr. Scott Molitor for their insightful comments and the questions which widen my research from various perspectives. I also would like to thank my fellow labmates Qiangqiang Shao and Tao

Yang for helping me set up new assays and for great cooperation between us, as well as all the fun we have had in the last five and half years. Last but not the least, I would like to thank my parents for supporting me spiritually throughout my Ph.D. and my life in general.

My parents always stand by me, no matter how hard it is for them economically and emotionally.

Contents

Abstract ...... iii

Acknowledgements ...... vi

List of Tables ...... xi

List of Figures ...... xii

List of Abbreviations ...... xiv

Chapter 1 Introduction ...... 1

1.1 Neuronal Development ...... 1

1.2 Axon Guidance ...... 4

1.3 Guidance Cues ...... 5

1.4 Netrin-1 Receptors ...... 7

1.4.1 Deleted in Colorectal Cancer (DCC) ...... 7

1.4.2 Down Syndrome Cell Adhesion Molecule (DSCAM) ...... 10

1.4.3 Uncoordinated-5 (UNC5) ...... 11

1.5 Signal Transduction Cascades Underlying Netrin-1 Attraction ...... 11

1.6 Cytoskeleton ...... 13

1.6.1 Actin ...... 14

1.6.2 MTs...... 15 vii

1.7 β-Tubulin Isotype III (TUBB3) ...... 17

1.8 MT-Associated Proteins (MAPs) ...... 19

1.8.1 MT-Associated Proteins (MAPs) ...... 19

1.8.2 Tau ...... 20

1.9 Tau Phosphorylation and Involved Kinases ...... 22

1.9.1 Tau Phosphorylation ...... 22

1.9.2 c-Jun N-terminal Kinases (JNK) ...... 23

1.9.3 Glycogen Synthase Kinase 3 (GSK-3) ...... 24

1.9.4 Src Family Kinases ...... 25

Chapter 2 Significanc ...... 27

Chapter 3 Materials and Methods ...... 29

3.1 Plasmids and Constructs ...... 29

3.2 Reagents and Antibodies ...... 31

3.3 Cell Transfection ...... 31

3.4 Co-Immunoprecipitation (Co-IP) ...... 32

3.5 Primary Neuron Culture ...... 32

3.6 MT Co-Sedimentation Assay ...... 33

3.7 Immunostaining and Colocalization ...... 33

3.8 Neurite Outgrowth ...... 34

3.9 Axon Branching ...... 34

3.10 Chick Spinal Cord Commissural Axon Projection in vivo ...... 35

3.11 Chick Spinal Cord Axon Turning in vitro ...... 36

Chapter 4 Results ...... 37

viii

4.1 Human TUBB3 Mutations Perturb Netrin-1 Signaling ...... 37

4.1.1 TUBB3 Mutants Show Reduction in Interaction with DCC ...... 37

4.1.2 TUBB3 Mutations Disrupt the Overlap of DCC and TUBB3 in the Growth

Cone of Primary E15 Cortical Neurons ...... 40

4.1.3 TUBB3 Mutations Inhibit Netrin-1-Promted DCC/ TUBB3 Interaction ...... 43

4.1.4 TUBB3 Mutations Disrupt Netrin-1-Induced Interaction of DCC with

Polymerized TUBB3 ...... 46

4.1.5 TUBB3 Mutations Disrupt Netrin-1-Induced Neurite Outgrowth ...... 49

4.1.6 TUBB3 Mutations Affect Netrin-1-Induced Axon Branching ...... 53

4.1.7 TUBB3 Mutations Disrupt Axon Attraction Induced by Netrin-1 ...... 56

4.1.8 TUBB3 Mutations Disrupt Spinal Commissural Axon Projection in vivo ...... 59

4.2 The Role of Tau in Netrin-1 Signaling ...... 62

4.2.1 Interaction of Tau with DCC ...... 62

4.2.2 Netrin-1 Induces Overlap of Tau with DCC in Primary Neurons ...... 65

4.2.3 JNK, GSK-3 and Src family Kinases Are Involved in Netrin-1 Induced

Phosphorylation ...... 67

4.2.4 Activities of JNK, GSK-3 and Src Are Required for the Interaction of DCC

with Tau ...... 70

4.2.5 Tau Is Required for Netrin-1-Induced Neurite Outgrowth...... 72

4.2.6 Tau Is Required for Netrin-1-Induced Branching ...... 75

4.2.7 Tau Is Required for Netrin-1-Mediated Attraction of Spinal Commissural

Axons ...... 78

4.2.8 Tau Is Required for Spinal Cord Commissural Axon Projection in vivo ...... 81

Chapter 5 Discussion ...... 83

5.1 TUBB3 Mutations Disrupt Netrin Signaling ...... 83

5.1.1 TUBB3 Missense Mutations Interfere with the Interaction of DCC with

Polymerized TUBB3 in Netrin-1 Signaling ...... 83

5.1.2 TUBB3 Mutations Impair Netrin-1-Mediated Axon Outgrowth, Branching and

Attraction in vitro and in vivo...... 84

5.1.3. Potential Roles of TUBB3 Mutations in the Signaling Pathways Downstream

of Netrin-1 and Other Guidance Cues ...... 85

5.2 Tau Is Involved in Netrin-1 Signaling ...... 86

5.2.1 The Interaction of Tau with Netrin-1 Receptor DCC ...... 86

5.2.2 Tau Phosphorylation Is Involved in Netrin-1 Signaling ...... 87

5.2.3 Tau Is Required in Netrin-1-Mediated Axon Outgrowth, Branching and Axon

Guidance ...... 88

Hypothesized Models...... 89

References...... ……………………………………………………………………………92

List of Tables

Table 1. Primers used for cloning TUBB3 mutants constructs………………………...30

Table 2. Targeted sequences of shRNAs…………………………………………….…30

List of Figures

Figure 1 Neuronal Development...... 3

Figure 2 Netrin Receptors...... 9

Figure 3 Netrin-1 Attractive Signaling Mediated by DCC...... 13

Figure 4 MT Dynamics...... 16

Figure 5 Tau Isoforms and Domains...... 21

Figure 6 Interaction of DCC with TUBB3 Mutants in HeLa Cells...... 38

Figure 7 The Reduced Overlap of DCC and TUBB3 Mutants in the Growth Cone of

Primary Neurons...... 40

Figure 8 Interaction of DCC and TUBB3 Mutants in Neurons treated with Netrin-1 .... 43

Figure 9 Interaction of DCC with TUBB3 Mutants-Containing MTs ...... 46

Figure 10 TUBB3 Mutations Affect Neurite Outgrowth of Cortical Neurons...... 50

Figure11 TUBB3 Mutations Affect Axon Branching of Cortical Neurons Induced by

Netrin-1...... 53

Figure12 TUBB3 Mutations Disrupt Netrin-1-Mediated Attraction of Spinal Cord

Commissural Axons...... 56

Figure 13 The Expressions of TUBB3 Mutants Impair Spinal Cord Commissural Axon

Pathfinding in vivo...... 59

xii

Figure 14 Interaction of Tau with DCC ...... 62

Figure 15 The Overlap of Tau with DCC in Primary Neurons...... 65

Figure 16 The Involvement of JNK, GSK-3 and Src family Kinases in Netrin-1 Induced

Phosphorylation ...... 68

Figure 17 JNK, GSK-3 and Src Inhibitors Affect Interaction of DCC with Tau ...... 70

Figure 18 The Involvement of Tau in Netrin-1-Induced Neurite Outgrowth ...... 73

Figure 19 The Involvement of Tau in Netrin-1-Induced Axon Branching ...... 76

Figure 20 The Involvement of Tau in Netrin-1-Mediated Spinal Commissural Axons

Turning ...... 79

Figure 21 Tau Is Required for Spinal Cord Commissural Axon Projection in vivo ...... 81

Figure 22 Hypothesized Model for TUBB3 Mutations Disrupting Netrin-1-Mediated

Neuronal Development...... 90

Figure 23 Hypothesized Model for the Involvement of Tau in Netrin Signaling ...... 91

xiii

List of Abbreviations

12-HPETE ...... 12-Hydroperoxy-5, 8, 10, 14-Eicosatetraenoic Acid

Aβ ...... Amyloid-β AD ...... Alzheimer’s Disease ANOVA ...... Analysis of Variance ATP ...... Adenosine Triphosphate

BDNF ...... Brain-Derived Neurotrophic Factor

CNS ...... Central Nervous System

DAPI ...... 4',6-diamidino-2-phenylindole DBD ...... DCC Binding Domain DCC ...... Deleted in Colorectal Cancer DD ...... Death Domain DMEM ...... Dulbecco's Modified Eagle's medium DSCAM ...... Down Syndrome Cell Adhesion Molecule

E15 ...... Embryonic day 15 EDTA ...... Ethylenediaminetetraacetic Acid EGTA ...... Ethylene Glycol Tetraacetic Acid ERK...... Extracellular Signal-regulated Kinase

FAK...... Focal Adhesion Kinase FBS ...... Fetal Bovine Serum FNIII ...... Fibronectin III Repeats FTD ...... Frontotemporal Dementia

GAP...... GTPase-Activating Proteins GDP...... Guanosine Diphosphate GEF ...... Guanine Nucleotide Exchange Factor GTP ...... Guanosine Triphosphate GSK-3 ...... Glycogen Synthase Kinase 3 xiv

HBSS...... Hank's Balanced Salt Solution HEK ...... Human Embryonic Kidney HEPES ...... 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid HH stage...... Hamburger and Hamilton stage

Ig ...... Immunoglobulin IP ...... Immunoprecipitation

JNK ...... c-Jun N-terminal Kinase

LCC ...... L-type Calcium Channels LSB ...... Laemmli Sample Buffer

MAP ...... Microtubule-Associated Protein MBD ...... MT Binding Domain MLB ...... Mild Lysis Buffer MKK ...... Mitogen-Activated Protein Kinase MT...... Microtubule

NCBI ...... National Center for Biotechnology Information NCK1 ...... Non-Catalytic Region of Tyrosine Kinase Adaptor Protein 1 NT ...... Neurotrophin

PAGE ...... Polyacrylamide Gel Electrophoresis PAK...... P21 Activated Kinases PBS ...... Phosphate Buffered Saline PCR ...... Polymerase Chain Reaction PDL ...... Poly-D-Lysine PDPK ...... Proline Directed Protin Kinase PEI...... Polyethylenimine PFA ...... Paraformaldehyde PIPES ...... Piperazine-N, N-bis PIP3 ...... Phosphatidylinositol (3,4,5)-trisphosphate PLC ...... Phospholipase C PLL ...... Poly-L-lysine PNS ...... Peripheral Nervous System

RGC ...... Retina Ganglion Cell ROBO ...... Roundabout Receptors

SDS ...... Sodium Dodecyl Sulfate SFK ...... Src Family Kinase SH2 ...... Src Homology 2

TUBB3 ...... Tubulin Beta Class III

UNC5 ...... Uncoordinated-5 UNC6 ...... Uncoordinated-6

WT ...... Wild Type

xvi

Chapter 1 Introduction

Introduction

1.1 Neuronal Development

A typical differentiated neuron is a highly polarized cell which consists of a cell body, one axon and multiple dendrites. At the tip of the axon, there is a highly dynamic structure called growth cone which detects and responds to extracellular stimuli (Fig. 1).

Before differentiation, any projection from the cell body of a neuron is called a neurite, which can be an axon or a dendrite (Flynn, 2013). To develop into a mature neuron, a neuronal progenitor has to go through several stages of development such as neurite outgrowth, branching and pathfinding (Fig. 1).

Neurite Outgrowth: Neuronal progenitors possess the ability to differentiate into specific types of neurons. Neuronal progenitors sprout neurites, a process called neurite outgrowth. Neurotrophins promote the outgrowth and support survival of developing neurons. Several neurotrophins have been identified such as nerve growth factor (NGF),

1 brain-derived neurotrophin factor (BDNF), neurotrophin-3 (NT-3), NT-4, NT-6, and NT-

7 (Huang & Reichardt, 2001). Many guidance cues are secreted proteins in the extracellular environment that attract or repel axons to direct them along a specific tract. Guidance cues can also promote or inhibit neurite outgrowth. For instance, guidance cue Netrin-1 promotes neurite outgrowth of cortical neurons (Kennedy et al., 1994). Guidance cue

Ephrin-A2 and A5 also promote neurite outgrowth of sympathetic neurons (Gao et al.,

2000). Different subtypes of guidance cue semaphorin play different roles: semaphorin

3Aderiving from meninges inhibits neurite outgrowth of embryonic dorsal root ganglion neurons, while semaphorin 7A promotes neurite outgrowth of cortical neurons and dorsal root ganglia neurons (Niclou et al., 2003; Pasterkamp et al., 2003).

Axon Branching: As neurons develop, axon divides into many branches, a process called axon branching which allows neurons to transmit electrochemical signals simultaneously to multiple target cells and establish unique patterns of connectivity.

Several molecules involved in branching have been identified. The neurotrophin BDNF promotes the branching of retinal axon, whereas application of BDNF neutralizing antibodies reduces axon branching in live Xenopus laevis tadpoles (Cohen-Cory & Fraser,

1995). Fibroblast growth factors (FGFs) promote neurite branching of hippocampal neurons in rat (Shitaka et al., 1996). The mammalian slit 2N stimulates collateral axon branching on rat dorsal root ganglion neurons (Wang et al., 1999). Netrin-1 also dramatically increases cortical axon branching and complexity (Tang & Kalil, 2005).

Sema3A inhibits cortical axon branching through actin filament and MT depolymerization

(Dent et al., 2004).

Axon Pathfinding: Axon pathfinding is a process by which axons find their targets.

Commissural neurons refer to neurons projecting axons toward the opposite side of the brain or spinal cord. Here are two examples of commissural axon pathfinding. 1. The corpus callosum is a wide commissure (a bundle of commissural axons) connecting the left and right cerebral hemispheres, and allowing communication between two cerebral hemispheres. The formation of the corpus callosum involves commissural axon projection across the midline to reach their final targets in the contralateral hemisphere (Paul et al.,

2007). 2. The spinal cord commissure connects two sides of the spinal cord, allowing coordination and synchronization of information between the left and right spinal cord.

Commissural axon projection in the developing nervous system is a precisely regulated process involving multiple guidance cues such as Netrins and slits (Serafini et al., 1996).

Figure 1 Neuronal Development. Neurite outgrowth is a process that neuronal progenitor sprouts neurites including one axon and multiple dendrites. Axon branching allows axon to reach multiple targets simultaneously. The growth cone, a dynamic structure, explores its environment to find its target neurons.

1.2 Axon Guidance

Axon guidance is a developmental process by which neurons send out axons to find their destined targets via dynamic growth cone sensing extracellular signals. These signals attract or repel growth cones. The growth cone responds to various stimuli in the surrounding environment by rapidly extending and shrinking membrane protrusions (Dent

& Gertler, 2003). In response to guidance cues, receptors in the growth cone recruit downstream signals, which finally lead to the reorganization of cytoskeleton. Cytoskeleton serves as scaffolding and underlies axon and growth cone reshaping. MT, microfilament

(actin) and intermediate filament are three major forms of cytoskeleton.

Growth cones display various shapes and appear to explore their environment continuously by altering membrane protrusions (Dent & Gertler, 2003). The growth cone could be microscopically divided into three regions: the peripheral region, the transitional region, and the central region (Liu & Dwyer, 2014).The central region of the growth cone is relatively stable, but there is a lot of molecular motion within this region, including the constant shuttling of organelles and vesicles (Dent et al., 2011). The peripheral region protrusions consist of two forms: filopodia (tapered finger-like projections) and lamellipodia (flat sheet-like protrusions). Filopodia and lamellipodia are often highly dynamic: They can extend and withdraw within minutes. Previously, it is reported that actin normally polymerizes at the leading edge, while MTs are restricted to the neurite shaft and a central region of the growth cone (Forscher & Smith, 1998). However, MTs can also extend into the lamellar region, often reach the peripheral area (Forscher & Smith, 1998).

1.3 Guidance Cues

Guidance cues in the extracellular environment attract or repel axons to direct them along specific tract. Conventional guidance cues include Netrins, ephrins, slit, semaphorins. The non-conventional guidance cues include morphogens of the Hedgehog, transforming growth factor β (TGF-β) /bone morphogenetic protein (BMP), sonic hedgehog (Shh), Draxin and Wnt (Patricia & Frédéric, 2013).

These guidance cues function through interacting with receptors expressed in different types of neurons. Netrin-1 receptors include Deleted in Colorectal Cancer (DCC),

Down Syndrome Cell Adhesion Molecule (DSCAM), Uncoordinated 5 (UNC5) and Netrin

G ligands (NGLs) (Lai et al., 2011); Slits receptors mainly include Robo-1, Robo-2 and

Robo-3 (Marillat et al., 2004); Classical receptors of ephrins are Ephs (Wang et al., 2017); semaphorins receptor are Plexins and Neuropilins (Tamagnone et al., 2000).

Netrins are a family of proteins functioning as attractive or repulsive signals for migrating neurons or axons during neural development. UNC-6 was first found as a guidance cue in nematode Caenorhabditis elegans (Hedgecock et al., 1990), and its mammalian homologue Netrin was discovered as diffusible chemotropic factors for commissural axons (Kennedy et al., 1994). Five netrins have been identified including three secreted Netrins, Netrin 1, 3 and 4, and two membrane-tethered glycophosphatidylinositol-linked Netrins, Netrin G1 and G2 in mammals. Netrins belong to the superfamily of laminin-related extracellular matrix, a major component of basal lamina. The N-terminal of Netrin proteins is similar to the N-terminal of laminin proteins

(Chen & Wadsworth, 2004).

Netrin-1 is expressed in both the developing and adult nervous systems such as the optic disc, cerebrum, the cerebellum and the spinal cord (Lai et al., 2011). Netrin-1 forms a gradient in the physiological conditions to attract or repel axons and growth cones. For instance, retinal ganglion cells (RGCs) transmit messages from retina to brain by projecting their axons towards the optic disc and then form a bundle (optic nerves). Netrin-1 expressed in the optic nerve head attracts RGC growth cones and guide axons out of eyes towards the cortex. Mice with a targeted deletion of Netrin-1 in the optic disc show that RGC axons failed to find the optic disc (Erskinea & Herrera, 2007). Also, Netrin-1 acts as a diffusible factor attracting commissural axons in the spinal cord (Kennedy et al., 1994). Additionally,

Netrin-DCC signaling attracts callosal pioneering axons to cross the midline and form the corpus callosum (Fothergill et al., 2014). Netrin-1 is also expressed in other tissues besides the nervous system such as the intestine, the heart and the lung (Nguyen & Cai, 2006). In these tissues, Netrin-1 binds to its receptors to induce cell differentiation, proliferation or migration (Mehlen & Llambi, 2005). Netrin-1 is also involved in regulation of apoptosis and functions as a tumor-suppressing protein (Arakawa, 2004). Netrin-1 improves post- injury cardiac function via nitric oxide production (Bouhidel et al., 2015).

Netrin-1 functions in multiple biological processes such as neuron migration, neurite outgrowth, axon innervation and axon guidance (Lai et al., 2011). Netrin-1 was found to promote commissural axon outgrowth in chick (Serafini et al., 1994). Netrin-1 was found to promote axon branching through cytoskeleton reorganization (Dent et al.,

2004). Netrin-1 functions as an axon guidance cue attracting or repelling axons, also functions as a factor promoting neuronal survival. Netrin-1 knockout mice exhibit

6 embryonic lethality and impaired commissural axons crossing the midline in the spinal cord (Yung et al., 2015).

1.4 Netrin-1 Receptors

Netrin-1 is a bifunctional guidance cue that attracts or repels axons, achieving these functions through interaction with its receptors. There are three major Netrin-1 receptors:

DCC, DSCAM and UNC-5. Netrin-1 can also bind to integrins, a family of transmembrane receptors that connect the actin cytoskeleton to extracellular matrix, which is involved in cell migration (Nikolopoulos & Giancotti, 2005). Either DCC or DSCAM could form a homodimer with itself or a heterodimer to mediate attraction. UNC-5 could form a homodimer with itself, or a heterodimer with DCC or DSCAM to mediate Netrin-1 repulsion (Lai et al., 2011).

1.4.1 Deleted in Colorectal Cancer (DCC)

DCC was first found as a tumor suppressor gene involved in an allelic deletion of chromosome 18 in colorectal cancer (Fearon et al., 1990). UNC-40, a homolog of DCC and neogenin in C. elegans, was found to be expressed on motile cells. UNC-40 direct motile cells to move toward UNC-6 sources (homolog of Netrin-1) (Chan et al., 1996).

Later studies indicate that DCC mediates the chemoattractive effect of Netrin-1 on spinal commissural axons (Keino-Masu et al., 1996). Frazzled, a homologue of DCC gene family in Drosophila, was aslo identified in 1996 (Kolodziej et al., 1996 ). Frazzled is found to be expressed on axons in the central nervous system and on motor axons in the peripheral nervous system. Null mutants in frazzled showed defects in axon guidance in the central nervous system (Kolodziej et al., 1996 ).

DCC is a transmembrane receptor that belongs to the immunoglobulin superfamily proteins. Both Frazzled and DCC contain four Ig domains and six fibronectin type III domains (FNIII) in its extracellular domain and one intracellular domain. Studies have already suggested that Netrin-1 binds to the fourth and fifth repeats of FNIII (Kruger et al.,

2004). DCC contains highly conserved motif P1, P2 and P3 motifs in its intracellular domain (Fig. 2). P1, P2 and P3 motifs are essential for downstream signal transduction upon Netrin-1 binding (Xu et al., 2014). The heterodimerization of DCC and UNC5 via the P1 motif of DCC and the DCC-binding domain (DBD) of UNC5 mediates repulsion signaling (Hong et al., 1999). MAPK family member ERK2 phosphorylates DCC facilitated by the docking of ERK2 onto P1 domain of DCC (Ma et al., 2010). DCC P1 motif interacts with ribosomal protein L5 and mediate translation process, as deletion of the P1 motif completely abolished the ability of DCC to promote translation (Tcherkezian et al., 2010). The P3 domain of DCC mediates the constitutive interaction of the DCC and

Robo1 (Stein et al., 2001). DCC homodimerization via its P3 motif mediates attraction signaling (Stein et al., 2001).

Functionally, DCC not only mediates chemoattraction induced by Netrin-1, but also cooperates with UNC5C to mediate chemorepellent signaling (Hong et al., 1999; Kennedy et al., 1994). In addition, DCC is essential for Netrin-1-induced axon outgrowth and branching (Li et al., 2002; Plooster et al., 2017). Treatment with an anti-DCC function- blocking antibodies impaired axon outgrowth and branching in developing cerebral cortical neurons (Matsumoto & Nagashima, 2017).

Defects in axonal projections observed in DCC-/- mice are similar to those observed in Netrin-1 deficient mice. The hippocampal commissure and the corpus callosum were

8 completely absent, and the anterior commissure was severely decreased in DCC-/- mice.

Guidance of RGC axons to the optic disc was also disrupted in DCC-/- mice, which is similar to the defects observed in the Netrin-1-deficient mice (Fazeli et al., 1997).

Figure 2 Netrin Receptors. The Netrin receptors are single-pass transmembrane proteins, and they belong to the Ig superfamily. In the extracellular region, DCC contains four immunoglobulin domains (Ig) and six fibronectin type III domains (FNIII). DSCAM contains ten Ig domains and six FNIII domains. UNC-5 contains two Ig domains and two thrombospondin type 1 (TSP-1) motifs. The intracellular domain of DCC contains three

9 conserved P1, P2 and P3 domain. Intracellular domain of UNC-5 contains a zona occludens

5 (ZU-5) domain, DCC-binding domain (DBD) and death domain (DD). No functional domain in DCSAM intracellular region has been identified.

1.4.2 Down Syndrome Cell Adhesion Molecule (DSCAM)

Human DSCAM was initially discovered as a gene that is duplicated in Down syndrome (Yamakawa et al., 1998). Dscam1, the Drosophila homolog of DSCAM, could potentially have 38,016 forms originating from alternative splicing of four variable exon clusters (Schmucker et al., 2000). DSCAM contains ten Ig domains and six FNIII repeats, a single-pass transmembrane domain and an intracellular domain (Lai et al., 2011) (Fig. 2).

DSCAM is expressed in embryonic spinal commissural neuron of the neural tubes (Lai et al., 2011). At the cellular level, DSCAM is detected in the cell body, axons and growth cones. DSCAM functions as a Netrin-1 receptor, which is validated by direct interaction between DSACM and Netrin-1 on the cell surface (Liu et al., 2008). DSCAM is required for Netrin-1-induced axon outgrowth and commissural axon projection (Liu et al., 2008).

DSCAM collaborates with DCC to mediate Netrin-1-induced axon turning (Ly et al.,

2008). DSCAM is expressed in the retinal ganglion cells and plays a role in self-avoidance

(Fuerst et al., 2009). The selective knockout of Dscam from projection neurons causes clumped dendrites and notable reduction in their dendritic field size, suggesting that

DSCAM is also involved in dendritic arborization (Zhu et al., 2006). DSCAM promotes axons to cross the midline in response to Netrin-A in Drosophila (Andrews et al., 2008).

DSCAM interacts with UNC5C to mediate Netrin-1-induced growth cone collapse

(Purohit et al., 2012). We also found that DSCAM was required for Netrin-1-induced axon branching in mouse E15 cortical neurons (Huang et al., 2015).

1.4.3 Uncoordinated-5 (UNC5)

The Unc5 gene was discovered in Caenorhabditis elegans at the same time as Unc6

(Fearon et al., 1990). The UNC5 contains two Ig domains and two thrombospondin (Tsp) domains, one single-pass transmembrane region, and the intracellular domain (Fig. 2).

Some studies showed that Netrin-1 binds to two Tsp domains of UNC5 (Geisbrecht et al.,

2003). The intracellular domain mediates downstream signaling via its ZU-5, DCC binding domain (DBD), and death domain (DD) (Fig. 2) (Leung-Hagesteijn et al., 1992). UNC5 mediates Netrin-1-induced repulsion of axons and cell migration. Study in our lab showed that UNC5 subtype UNC5C is required for Netrin-1-induced growth cone collapse and repulsion of P4 mouse cerebellar EGL neuron (Shao et al., 2017).

1.5 Signal Transduction Cascades Underlying Netrin-1

Attraction

Previous studies showed that Netrin-1 activated various downstream signal transduction cascades which regulate cytoskeleton dynamics such as Src family kinases

(SFK), the Rho GTPase family, and MAPK family, etc (Lai et al., 2011).

The binding of Netrin-1 and DCC gives rise to DCC dimerization through its intracellular P3 domain interaction (Stein et al., 2001), accompanied by focal adhesion kinase (FAK) phosphorylation and tyrosine phosphorylation of DCC. This triggers non- catalytic region of tyrosine kinase adaptor protein 1 (NCK1) to form a complex of DCC-

NCK1-FAK, which modulates SFK signaling, Rho GTPase activation, the release of Ca 2+ stores and consequent rearrangements of the cytoskeleton (Lai et al., 2011). The binding of Netrin-1 and DCC recruits and activates Fyn (Li et al., 2004), which further activates the Rho GTPases RAC1 and CDC42 (Shekarabi & Kennedy, 2002). PAK1 is a downstream effector of CDC42 and RAC1 and serves as an adaptor that connects NCK1 to CDC42 or

RAC (Bagrodia & Cerione, 1999). Also It has been shown that Netrin-1 activates kinase

PAK1 (Shekarabi et al., 2005). Netrin-1 has also been shown to activate guanine nucleotide exchange factors for Rho GTPases DOCK180. Inhibition of DOCK180 blocks

Rac1activity which is required for Netrin-1-induced axon outgrowth and attraction (Li et al., 2008). The mitogen-activated protein kinase (MAPK) cascade are also involved in

Netrin-1/DCC signaling. The extracellular signal-regulated kinases 1 and 2 (ERK1 and

ERK2) are phosphorylated by Netrin-1, which activates transcription factors ELK1 (Forcet et al., 2002). Another MAPK family JNK is also involved in Netrin-1 signaling. It has been shown that JNK1, but not JNK2 or JNK3, is vital in the coordination of DCC and DSCAM in Netrin-mediated attractive signaling (Qu et al., 2013). MAPK p38 is also found to be activated by Netrin-1 stimulation and mediate Netrin-1-induced the migration of Schwann cells (Lv et al., 2015). Netrin-1/DCC signaling could alter cAMP/cGMP ratio and consequent intracellular Ca 2+ signals (Nishiyama et al., 2003). Netrin stimulation also inhibits TRIM9-dependent ubiquitination of DCC (Plooster et al., 2017) (Fig. 3).

Figure 3 Netrin-1 Attractive Signaling Mediated by DCC. Netrin-1/DCC binding induces DCC homodimerization through the P3 domains. This triggers the recruitment of intracellular signalling molecules that activate MAPK JNK, p38, ERK, Rho GTPases, Src family kinases, the release of Ca2+, and the cytoskeleton rearrangement.

1.6 Cytoskeleton

The cytoskeleton is composed of MTs, actin filaments, and intermediate filaments.

The cytoskeleton supports cell shape and structure. Moreover, it provides a structural basis

13 for cell migration and cell division. The signaling transduction of extracellular guidance cues finally converge on the reorganization of cytoskeleton (Liu & Dwyer, 2014).

1.6.1 Actin

Actin is a family of globular proteins that form microfilaments. It can exist as either a free monomer called G-actin or as polymerized microfilament called F-actin, both of which are important for cell mobility and contraction. Dynamically forming microfilaments allow cells to rapidly remodel themselves in response to its environment or to internal signals (Lodish et al., 2000). Actin dynamics are necessary for directing axonal projection, especially important for growth cone exploration of the environment, as neurons with inhibition of F-actin dynamics lose their ability to respond to guidance cues and to change growth cone’s direction (Dent & Kalil, 2001).

Growth cones assume many shapes and explore their environment constantly by protruding and shrinking filopodia and lamellipodia (Dent & Gertler, 2003). To achieve axon outgrowth, growth cones go through three steps: protrusion, engorgement, and consolidation (Goldberg & Burmeister, 1986). Protrusion refers to the extension of new cell membrane on the growth cone, resulting from filamentous actin polymerization.

Engorgement refers to that MTs transport organelles into the cell membrane. Consolidation refers to that contraction of the growth cone into a cylindrical axon shaft (Goldberg &

Burmeister, 1986). Growth cone protrusion is driven primarily by the polymerization of actin filaments, and actin dynamics are necessary for growth cone turning, as application of agents that depolymerize F-actin deprives of neuron’s ability to respond to guidance cues both in culture and in model organism (Marsh & Letourneau, 1984; Dent & Kalil,

2001; Kaufmann et al., 1998). In addition, dorsal root ganglia (DRG) neurons treated with

Netrin-1 show more protrusion and accumulated F-actin on the side of the growth cone close to the source of Netrin-1 (Marsick et al., 2010).

By labeling actin filaments with enhanced green fluorescence protein (EGFP)- actin, F-actins within living growth cones are found to move steadily from the periphery to the center of the growth cone (Lin et al., 1996). Later studies have shown that this retrograde F-actin flow results from myosin-II-driven actin transport (Medeiros et al.,

2006). The balance between actin filament polymerization and retrograde flow determines the status of growth cone protrusions: If the polymerization rate is higher than retrograde, then the growth cone protrudes. If the polymerization rate is lower than retrograde flow, then the growth cone shrinks (Medeiros et al., 2006).

1.6.2 MTs

MTs are nucleated at a MT-organizing center (MTOC), in which γ-tubulin combines with several other associated proteins to build a structure called the "γ-tubulin ring complex". This γ-tubulin ring complex serves as a scaffold for α/β tubulin dimers to initiate polymerization; it acts as a cap of the minus end of polymerizing MT (Brinkley,

1985). Interestingly, there are no MTOC in mature neurons. The mechanism of MT nucleation in neurons is still not clear. Some studies suggest thatGolgi outposts could locally nucleate MTs in Drosophila dendrites of dopamine neurons (Ori-McKenney et al.,

2012).

After α- and β-tubulin form a dimer, α/β-tubulin dimers polymerize head-to-tail into linear protofilaments and then 11-16 of protofilaments by parallel association form a tubular MT (Fig. 4). MTs have two polarized ends: a relatively stable minus end and a relatively dynamic plus end. Addition or removal of α/β-tubulin dimers on the plus end

15 underlie the structure basis of MT dynamics. The plus end can dynamically switch between extending and shrinking. During polymerization, both α- and β-subunits are bound to GTP.

GTP-bound α-tubulin is relatively stable, while GTP-bound β-tubulin hydrolyzes to GDP after its assembly on MTs. Tubulin bound to GDP is easily to depolymerize. GTP hydrolysis at the plus end of the MT promotes depolymerization. Tubulins bound to GTP begin adding to the plus end of the MT again, protecting the MT from depolymerization

(Akhmanova & Steinmetz, 2008) (Fig. 4).

Figure 4 MT Dynamics. GTP-bound α-tubulin and GTP-bound β –tubulin form a heterodimer. These dimers are aligned to form protofilament. Certain numbers of protofilaments form a tube-like MT. MT dynamics refers to α/β-tubulin dimers assembling or dissembling on the plus end of MTs.

Initial studies show that MTs are involved in growth cone pathfinding: fluorescently labeled MTs are found to explore the growth cone periphery, and more importantly, the orientation of MTs often lead the direction of outgrowth in living neurons

(Sabry et al., 1991; Tanaka & Kirschner, 1995). Later studies have confirmed MTs indeed play an instructive role in growth cone steering by locally altering MT dynamics within the growth cone (Buck & Zheng, 2002).

Dynamic interactions between MTs and actin filaments are vital for growth cone steering (Rodriguez et al., 2003). MTs mostly stay in the C-domain in the growth cone, and

F-actin and a few MT protrude into the P-domain of the growth cone (Liu & Dwyer, 2014;

Geraldo & Gordon-Weeks, 2009). Some studies support that MTs extend into P-domain by showing that MT plus-end assembly happens in the P-domain of the growth cone (Zhou et al., 2002; Schaefer et al., 2002; Myers et al., 2006). In addition, coordination of actin filament and MTs contributes to axon branching: F-actin filament polymerization creates a protrusion on cell membrane, followed by MT extension to consolidate this protrusion

(Gallo, 2011).

1.7 β-Tubulin Isotype III (TUBB3)

β-tubulin isotype III (TUBB3) is primarily expressed in neurons (Katsetos et al.,

2003). MTs composed of TUBB3 are more dynamic than those consisting of other β- tubulin isotypes (Panda et al., 1994).TUBB3 is strongly expressed during periods of axon guidance and maturation in the developing neurons; Expression levels decrease in the adult central nervous system (CNS) (Jiang & Oblinger, 1992). Together, the unique

17 characteristics of TUBB3 suggest that TUBB3 could have a special function in nervous system development.

Among β-tubulin isotypes, the region 384-426 is highly conserved. Regions of 140-

146, 178-181 and 240-244 have been proposed as GTP-binding sites (Linse & Mandelkow,

1988). The carboxyl-terminal region of β -tubulin varies greatly among the different isotypes. These regions are rich in glutamates and the MT-associated proteins (MAPS) appear to interact with these regions (Littauer et al., 1986). Among all these isotypes, β- tubulin isotype III possesses unique characteristics. In Drosophila, among four β-tubulin isotypes, β-tubulin isotype III shares only 72% homology with the other isotypes (Kimble et al., 1990). β-tubulin isotype III is expressed in differentiated cells and not in mitotic neuroblasts (Hoyle & Raff, 1990). Some study demonstrates that the tubulin dimers containing isotype III bind anti-mitotic drug colchicine weaker than the other isotypes, suggesting that β-tubulin isotype III is not involved in mitotic cell division (Lee et al.,

1990). The carboxyl terminus of β-tubulin isotype III is very negative, but it is less negative than the other isotypes, as it possesses the positive charge on Lys450 (Alexander et al.,

1991).

Recent researches have revealed that human TUBB3 mutations cause various levels of neuronal development defects. For instance, TUBB3 mutations in R62Q, R262C,

R262H, A302T, E410K, D417H and D417N lead to congenital oculomotor nerve hypoplasia, commissural axon and basal ganglia malformations, dysgenesis of the corpus callosum and anterior commissure (Tischfield et al., 2010).. Neuroimaging showed that

R262C knock-in mice exhibits similar defects observed in human patients (Tischfield et al., 2010). In addition, mutations in G82R, T178M, E205K, A302V and M388V result in

18 malformation of cortical development associated with neuronal migration and differentiation defects, axonal guidance and tract organization impairments (Poirier K. et al., 2010). These phenotypes are related to disrupted axon guidance, impaired neuron migration and differentiation. The mechanisms by which TUBB3 mutations cause these phenotypes are worth studying.

1.8 MT-Associated Proteins (MAPs)

1.8.1 MT-Associated Proteins (MAPs)

MT-associated proteins (MAPs) are proteins that interact with the MTs. MAPs bind to MTs to regulate MT dynamics and stability: stabilize or destabilize MTs, crosslink MTs, guide MTs to specific cellular positions and regulate interaction of MTs with other proteins. A variety of MAPs have been identified. Classical MAPs, which bind to entire length of MTs, include MAP1A and MAP1B MAP2, MAP4, MAP6, MAP7 and tau

(Cooper, 2004; Maccioni & Cambiazo, 1995). Plus-end-binding proteins (EBs), which interact with the MT growing plus-ends and modulate MT dynamics (Tirnauer & Bierer,

2000). EB family includes EB1, EB2 and EB3 (Liu & Dwyer, 2014). EB3 is majorly expressed in neurons, and involved in neurite outgrowth (Nakagawa et al., 2000). Motor proteins also binds to MTs and transport cargos along MTs. Kinesin, one family of motor proteins, transports cargos such as organelles and vesicles from the center of a cell to its periphery. Dynein, another family of motor proteins, slides on MTs, transports various cargos, and drives the beat of cilia and flagella (Berg et al., 2002).

1.8.2 Tau

It is well known that tau forming neurofibrillary tangles are involved in neurodegenerative diseases such as Alzheimer’s disease (AD) and frontotemporal dementia (FTD) (Li & Götz, 2017). Tau, the major neuronal MAPs, promotes MT assembly and stabilizes the MTs.

Tau could be divided into two major domains: a projection domain on the N- terminal and a MT-binding domain on the C-terminal. The projection domain extending away from the MT is responsible for interacting with the plasma membrane in a phosphorylation dependent manner (Brandt et al., 1995) (Fig. 5). The MT-binding domain contains three or four repeats binding to MTs. Results from NMR spectroscopy and mass spectrometry further clarify that tau binds to MTs via small groups of residues (208-324) and stabilizes a straight protofilament conformation by binding to a hydrophobic pocket between tubulin heterodimers (Kadavatha et al., 2015). The middle region is a proline-rich domain that contains multiple Thr-Pro or Ser-Pro motifs that could be phosphorylated by proline-directed kinases such as GSK3β, CDK5, MAPK and JNK (Wang & Mandelkow,

2016).

The human tau gene, located on the human chromosome 17q21 (Neve et al., 1986) possesses at least 16 exons. By mRNA alternative splicing of exons 2, 3 and 10, six tau protein isoforms have been identified (Goedert et al., 1989), resulting in isoforms that possess 0, 1 or 2 N-terminal inserts (0N, 1N and 2N), and either three (3R) or four (4R)

MT-binding domains (Goedert et al., 1989) (Fig. 5). In human adult brain, there is an equal amount of 3R and 4R isoforms. In mouse brains, expression levels of tau isoforms are regulated as the brain develops: 4R is the major isoform in the adult mouse brain; in

20 contrast, 0N3R is the major isoform in the early embryos (McMillan et al., 2008). 4R-tau interacts with MTs more strongly and is more efficient at promoting MT assembly than

3R-tau. Also 4R-tau slows down the shortening rate of MTs, whereas 3R-tau exhibits little effect (Panda et al., 2003).Tau knockout mice are viable and macroscopically normal.

Immunohistochemical results do not show dramatic changes, and electron microscopical analysis shows reduced MT density in axons (Harada et al., 1994).

Figure 5 Tau Isoforms and Domains. Originating from alternative splicing of tau mRNA, six isoforms can be generated. 2N4R-tau is the longest isoform, and 0N3R is the shortest

21 isoform which is the dominant isoform in mouse fetal brain. The MT binding region contains three or four repeats of the MT binding domain. Proline-rich domain contains a number of Thr Pro or Ser-Pro motifs. The projection region projects away from the MT and interacts with other proteins.

1.9 Tau Phosphorylation and Involved Kinases

1.9.1 Tau Phosphorylation

Many sites on tau that could be phosphorylated by different kinases at tyrosine, threonine and serine residues (Zhao et al., 2017). The proline-rich domain and MT-binding domain contain 80 serine/threonine residues (Avila et al., 2004). Tau is more heavily phosphorylated in the fetal than in the adult brain (Yu et al., 2009). Moreover, tau hyperphosphorylation associates with subsequent neurodegenerative diseases such as AD

(Iqbal et al., 2010). It has been shown that tau could be phosphorylated by various kinases, including GSK-3β, CDK5, MAPKs, PKA, PKB/Akt, PKC, PKN, and CaMKII (Medina et al., 2011).

Tau tyrosine phosphorylation: a surface plasmon resonance study reveals a 20-fold stronger interaction of the SH3 domain of Fyn with 3R-tau than 4R-tau (Bhaskar et al.,

2008). Tau interacts with the SH3 domain of Fyn and other Src kinases mainly through its seventh PXXP motif located in the N-terminal (Ittner et al., 2000; Lee et al., 1998); tau phosphorylation at Tyr18 facilitate its interaction with the SH2 domain of Fyn (Lee et al.,

2004).Tau phosphorylation is well known for its involvement in pathological neurodegeneration disease such as AD. However, a protective role of tau phosphorylation

22 has also been demonstrated. For instance, phosphorylation at Thr 181 could mediate its localization to exosomes and subsequent release of excess tau (Saman et al., 2012; Simon et al., 2012). Also phosphorylation at Ser 202 blocks the tau proteolysis by calpain

(Johnson et al., 1989).

1.9.2 c-Jun N-terminal Kinases (JNK)

c-Jun N-terminal Kinases (JNK) were first identified as kinases that phosphorylate c-Jun (Hibi et al., 1993). JNKs kinases belong to the mitogen-activated protein kinase

(MAPK) super family, which are involved in various biological processes such as apoptosis and cell proliferation (Dhanasekaran & Reddy, 2008). Moreover, JNKs are also implicated in neural development such as neuronal migration, polarity, neuronal regeneration (Coffey et al., 2014).

JNKs are composed of ten isoforms originating from three genes: JNK1 (four isoforms), JNK2 (four isoforms) and JNK3 (two isoforms) (Waetzig & Herdegen, 2005).

JNK1 and JNK2 exist in all cells and tissues, whereas JNK3 is found mainly in the brain, but is also found in the heart and the testes (Bode & Dong, 2007).

JNKs, activated by upstream MAPK kinases like MKK4 and MKK7 (Lopez-

Bergami et al., 2008), phosphorylate and activate its various downstream substrate proteins: c-Jun, p53, signal transducer and activator of transcription 3 (STAT3), heat shock factor 1 (HSF1), mothers against decapentaplegic homolog 4 (SMAD4) and MT associated protein tau (Cheng et al. , 2008; Kucinski et al.; 2017; Yarza et al., 2016).

Examination of JNK1 knockout mice reveals disrupted anterior commissure tract formation, altered dendritic architecture and a progressive loss of MTs within axons and dendrites, suggesting that JNK1 is required for maintaining the cytoskeletal integrity of

23 neuronal cells. Phosphorylated tau was more easily detected in 8-month-old Jnk1−/− brains than age-matched WT brains, accompanying with progressive neurodegeneration such as reduced learning and memory ability in Jnk1−/− mice (Chang et al., 2003). However, it is not clear how tau phosphorylation is altered in the early development stage. It is documented that JNKs phosphorylate tau at Ser202/Thr205 and Ser422, two established target sites of JNK in Alzheimer’s disease model (Ploia et al., 2011).

1.9.3 Glycogen Synthase Kinase 3 (GSK-3)

GSK- 3 is a serine/threonine protein kinase, which is encoded by two known genes,

GSK-3 alpha (GSK3A) and GSK-3 beta (GSK3β). GSK-3 is implicated in tau hyperphosphorylation and subsequent neurofibrillary tangle formation in the pathological progress of Alzheimer's disease (AD). Moreover, GSK-3 directly promotes the buildup of amyloid-β (Aβ) deposits. These two features make GSK-3 an important target for AD treatment (Jope & Johnson, 2004; Jope et al., 2007).

It has been reported that Netrin-1 induced MT-associated protein MAP1B phosphorylation depends on activation of GSK-3. Similar to tau, MAP1B destabilizes MTs and maintains them in a dynamic state. The dynamic property of MTs allows neurons to efficiently respond to extracellular guidance cues (Del Río et al., 2004).

GSK3 could modify multiple sites in tau molecule. (Hanger et al., 2009). GSK-3β has been shown to phosphorylate tau at Ser199, Ser202, Ser235, Ser396 and Ser404 in vitro

(Sperber et al., 1995). In addition, phosphorylation of tau by GSK-3 alters its ability to organize MTs into ordered arrays and a reduction in MT bundling (Wagner et al., 1996).

1.9.4 Src Family Kinases

Src family kinases, a family of non-receptor tyrosine kinases, consist of SrcA ( Src,

Yes, Fyn and Fgr) and SrcB (Lck, Hck, Blk, and Lyn). Src family kinases contain six conserved domains: an N-terminal myristoylated segment, a SH2 domain, a SH3 domain, a linker region, a tyrosine kinase domain, and a C-terminal tail (Parsons & Parsons, 2004).

Src family kinases are implicated in many cellular activities via modifying a variety of proteins by phosphorylation of tyrosine residues. SH2 domains have been shown to possess a high affinity to phosphorylated tyrosine residue within a peptide motif. SH3 domain is thought to recognize the proline-rich domains and mediate subsequent protein-protein interaction.

Src family kinases are implicated in the Netrin-1 induced neuronal development

(Liu et al., 2004). Netrin stimulation activates Src family kinases (Li et al., 2004). Src family member Fyn phosphorylate Netrin-1 receptor DCC in Netrin-1 signaling (Meriane et al., 2004).

In vitro phosphorylation showed that tyr18 on tau was phosphorylated by Fyn in human COS cell line (Lee et al., 2004). Later studies also support the hypothesis that Tyr18 is the primary site phosphorylated by Fyn in transfected CHO cells, and Tyr394 could be phosphorylated to a less extent (Derkinderen et al., 2005). What is more relevant to our study is that phospho-specific antibodies indicated that Tyr18 was phosphorylated in developing neurons but not in the adult mouse brain (Williamson et al., 2002). Tau tyrosine phosphorylation has been documented in human fetal brain as well (Williamson et al.,

2002). Src and Fyn are expressed in growth cones (Maness et al., 1998), and neurons cultured from src or fyn deficient mice were defective in neurite outgrowth (Beggs et al.,

1994). These researches suggest that tau tyrosine phosphorylation play a particular role in the neuronal development.

Lipid rafts containing high concentration of cholesterol and sphingolipids in plasma membrane are thought to serve as platforms for signal transduction. Tau–Fyn complexes have been identified in lipid rafts in oligodendrocytes (Klein et al., 2002), implicating the role of tau in cell membrane-mediated signal transduction. In addition, tau in the lipid raft fraction was phosphorylated at ser262 and tau in lipid rafts associate poorly with MTs (Lee et al., 2005).

Fyn can activate GSK3β (Lesort et al., 1999), which is known to phosphorylate tau under a pathological condition. Together, these data validate the role for Fyn in the Netrin-

1-induced tau phosphorylation.

Chapter 2 Significanc

Significance

Modulation of MTs is implicated in a variety of neuronal development processes including neurite outgrowth, branching, axon projection and pathfinding. In developing neurons, extracellular guidance cues interact with their receptors to directly or indirectly regulate MT distribution, stability and dynamics through activating downstream signal transduction cascades. Understanding the functions and regulation of MT dynamics in developing neurons will provide new insights into the molecular mechanisms of axon guidance.

TUBB3, a highly dynamic β tubulin isoform in neurons, interacts directly with the

Netrin-1 receptor DCC, coupling with Netrin-1 signaling to MT dynamics in axon outgrowth, branching and guidance (Qu et al., 2013). Mutations in TUBB3 result in commissural axon malformation in human patients with defects on dysgenesis of the corpus callosum, anterior commissure, cortical disorganization, pontocerebellar hypoplasia

(Poirier et al., 2010; Tischfield et al., 2010), suggesting that TUBB3 is essential for axon guidance and neuronal development. It is worth to study whether TUBB3 mutations

27 specifically disrupt Netrin-1 signaling, and the mechanism involved in TUBB3 mutations- caused defects. Understanding these mechanisms could potentially provide a clue to find the treatment to cure these patients. Our studies indicate that TUBB3 mutants possess reduced ability of interaction with DCC, and more importantly Netrin-1 does not induce the interaction of DCC and TUBB3 mutants. DCC does not interact with TUBB3 mutants- containing MTs as well. Functionally, TUBB3 mutants disrupt Netrin-1-induced axon outgrowth and branching of E15 mouse cortical neurons, and attraction of chick commissural neurons in vitro. In addition, expression of TUBB3 mutants in chick spinal cord commissural neurons disrupt commissural axon projection in vivo, which normally follow its specific trajectory guided by Netrin-1. All these results support the hypothesis that TUBB3 mutations specifically disrupt Netrin-1 signaling.

MAPs are required for modulating MT dynamics to influence neuronal development. Tau, a neuron-specific MAPs, binds to MTs and stabilizes MT stability.

Since MT dynamics is precisely regulated when extracellular guidance cues exert their effect on developing neurons, it is important to determine the role of tau in Netrin-MT signaling. The role of tau in Netrin-MT signaling has not been elaborated. Here, our study shows that tau interacts with DCC and that Netrin-1 promotes this interaction. Our study also indicates that inhibition of JNK, GSK-3 and Src family kinases blocks the interaction of tau with DCC, suggesting that these kinases activities are required for the tau/DCC interaction. Knockdown of tau using shRNA specifically inhibits the Netrin-1-induced axon outgrowth, branching, and attraction in vitro and chick commissural axon projection in vivo, indicating that tau is essential for Netrin-mediated neuronal development.

Chapter 3 Materials and Methods

Materials and Methods

3.1 Plasmids and Constructs

The full-length human DCC, and DCC truncation ΔP1 (Δ1147-1170), ΔP2 (Δ1335-

1356), and ΔP3 (Δ1412-1447) have been described by Dr. Li (Li et al., 2004). Using

0N4R-tau-GFP as template, 3R-tau-HA was cloned in pcDNA3.1 vector. Plasmids encoding the full-length human TUBB3 and TUBB3 mutants (G82R, T178M, E205K,

M388V and A302V were gifted from Dr. Chelly’s Lab (Universite´ Paris-Descartes).

Using wild type human TUBB3 as a template, site-directed mutagenesis was used to create missense mutations in TUBB3 and verified by sequencing. The oligonucleotide primers used are listed in table 1. TUBB3 shRNAs were designed to target the 3' untranslated region

(UTR) of human and mouse TUBB3. Tau shRNAs were designed to target the 3' untranslated region (UTR) of mouse and chick tau. The oligonucleotide templates were inserted into the mU6pro vector between the Xba I and the EcoR I sites and verified by

29 sequencing. Human 0N4R-tau-GFP was purchased from Addgene. The targeted sequences of shRNA are listed in table 2.

Table 1. Primers used for cloning TUBB3 mutants constructs

5’forward primer 3’ reverse primer

R62Q 5’-GTGCCCTTCCCGCAACTGCACTTCTTC-3’ 3’-GAAGAAGTGCAGTTGCGGGAAGGGCAC-5’

R262C 5’- GTGCCCTTCCCGTGCCTGCACTTCTTC-3’ 3’-GAAGAAGTGCAGGCACGGGAAGGGCAC-5’

A302T 5’-AACATGATGGCCACCTGCGACCCGCGC-3’ 3’ GCGCGGGTCGCAGGTGGCCATCATGTT-5’

M323V 5’-GGCCGCATGTCCGTTAAGGAGGTGGAC-3’ 3’- GTCCACCTCCTTAACGGACATGCGGCC-5’

E410K 5’-ATGGAGTTCACCAAAGCCGAGAGCAAC3’ 3’- GTTGCT CTCGGCTTTGGTGAACTCCAT-5’

D417H 5’-AGCAACATGAACCACCTGGTGTCCGAG-3’ 3’- CTCGGACACCAGGTGGTTCATGTTGCT-5’

D417N 5’-AGCAACATGAACAACCTGGTGTCCGAG-3’ 3’- CTCGGACACCAGGTTGTTCATGTTGCT -5’

Table 2. Targeted sequences of shRNAs

Targeted sequence of shRNA Location

TUBB3 Control shRNA 5’-CCCCCACTCCATGTGAGTT-3’ 3’UTR

TUBB3 shRNA #1 5’-AGGTTAAAGTCCTTCAGTG-3’ 3’UTR

TUBB3 shRNA #4 5’-GCAGCCAGGGCCAAGACAG-3’ 3’UTR

DCC Control shRNA 5′-AATGCATCTCTGCAAGAGGTA-3′ CDS

DCC shRNA 5′-CATCCGATGTGCGACTGTA-3′ CDS

DSCAM shRNA 5′-AAAGAGTTTAGCTGAAATGCT-3′ CDS

Tau Control shRNA 5′-TGGCCAAGCAGGGTTTGTG-3′ 3’UTR

Tau shRNA 5′-GGCAGCATCGACATGGTGGACT-3′ 3’UTR

3.2 Reagents and Antibodies

Primary Antibodies: mouse anti-Myc(9E10) (Cat. #2276s), anti-tau (Tau 46) (Cat.

#4019), rabbit anti-phosphorylated tyrosine (Cat. #9411), anti-phosphorylated threonine

(Cat. #8954), and rabbit anti-HA (Cat. #3724s) antibodies were purchased from Cell

Signaling Technology (Danvers, MA); Mouse anti-HA (Cat. sc-7392) and goat anti- DCC

(Cat. sc-6535) antibodies were from Santa Cruz Biotechnology (Dallas, TX); Rabbit anti-

FLAG (Cat. ab1162), rabbit anti-TUBB3 (Cat. ab18207), anti-phosphorylated serine (Cat.

Ab9332) and rabbit anti-DCC (Cat. ab201260) antibodies were from Abcam (Cambridge,

United Kingdom); Mouse anti-DCC antibody (Cat. #554223) was from BD Biosciences

(San Jose, CA); Mouse anti-Tuj-1 antibody (Cat. #801202) was from Covance Inc.(

Princeton, NJ). Secondary Antibodies: Alexa Fluor® 488 donkey anti-mouse IgG, Alexa

Fluor® 647 goat anti-rabbit IgG, and Alexa Fluor® 633 goat anti-mouse IgG were purchased from Invitrogen (Carlsbad, CA). Reagents: Alexa Fluor® 555 phalloidin, PP2 and PP3 from Calbiochem (Burlington,MA), taxol from Cayman Chemicals, B27, HBSS,

SP600125 and DAPI from Invitrogen (Carlsbad, CA). Purified chick Netrin-1 protein from

R&D systems (Minneapolis, MN), Protein A/G beads from Repligen Bio Processing

(Waltham, MA), Protease inhibitor cocktail and DNaseI from Roche (Basel, Switzerland),

Fluorogel from Electron Microscopy Sciences (Hatfield, PA). Taxol and nocodazole were obtained from Cayman Chemical (Ann Arbor, MI, USA).

3.3 Cell Transfection

HeLa cells were transfected using PEI method: 2- 4 µg of DNA constructs (3 µg of DCC, 2 µg of WT or TUBB3 mutants, 3 µg of tau or tau mutant constructs were mixed

31 with 10 µL PEI (250 µg/ml) and 200 µL NaCl (150 mM) for 20 min, and then the mixture were added to cell culture medium. 4X106 of dissociated mouse E15 cortical neurons or mouse E13 spinal cord neurons were transfected with 4 µg shRNA using a Amaxa nucleofector (program number: O-005). The cell culture medium was changed 2 h after nucleofection to reduce the toxicity of nucleofection solution.

3.4 Co-Immunoprecipitation (Co-IP)

Cells were harvested and lysed using MLB buffer (1% NP-40, 50 mM Tris, 150 mM NaCl, pH7.4, and protease inhibitor cocktail). The extract were centrifuged at 14,000 rpm for 15 min, and the supernatant was incubated with a specific primary antibody and protein A/G beads overnight on a slowly rotating stand. After centrifugation at 2,000 rpm for 2 min to precipitate protein beads, the sample was resuspended with MLB buffer and repeated for 3 times. After mixing with 2X LSB, the precipitates were separated by 7.5%

SDS-PAGE and detected by specific antibodies.

3.5 Primary Neuron Culture

The E15 (the day of vaginal plug counted as E1) mouse cortex and E13 mouse spinal cord were dissected in cold HBSS. After dissection, the tissue was transferred into

15ml centrifuge tube and was triturated several times. The tissues were then centrifuged at

1,000 rpm for 5 min, incubated with 0.25% Trypsin at 37 ºC for 10 min, later were digested with 20 U/ml DNaseI for 5 min. After neutralizing trypsin activities with same volume of

DMEM with 10% FBS, neurons were centrifuged and washed 3 times using DMEM with

10% FBS. 4 x106cells of neurons were plated on each PLL-precoated 35 mm culture dish and cultured at 37ºC, 5% CO2. Before Netrin-1 stimulation, neurons were starved for 6 h

32 as follows: If Netrin-1 conditioned medium was used, then neurons were deprived of

DMEM with FBS medium and replaced by DMEM with 10% BSA; if purified Netrin-1 was used, then neurons were replaced DMEM with FBS medium with DMEM with B27.

3.6 MT Co-Sedimentation Assay

Primary cortical neurons or HeLa cells were treated with purified Netrin-1 (250 ng/ml) or control for 20 min before lysing on cold ice with MLB buffer mixed with protease inhibitor. Cell extracts were then centrifuged at 10,000 × g at 4°C for 15 min and the supernatant was incubated with 40 μM taxol or DMSO in PEMG buffer (100 mM PIPES,

1 mM EGTA, 1 mM MgSO4, 1 mM GTP, pH 6.8) at room temperature for 30 min to 1 h.

MT pellets were obtained by ultra-centrifugation at 50,000 × g at 20 °C for 30 min in a

10% sucrose cushion solution. Both supernatant and pellet were collected , and the pellets were then resuspended in tubulin buffer (50 mM HEPES, 1 mM MgCl2, 1mM EGTA, 10% glycerol, 150 mM KCl, 40 μM taxol, 1 mM GTP, 5 mM Mg-ATP, 1 mM PMSF, 1× protease inhibitor mixture). Proteins in the supernatant and the pellet were separated by

7.5% Acrylamide/Bis SDS-PAGE and detected by Western blotting.

3.7 Immunostaining and Colocalization

Dissociated E15 cortical neurons were fixed in pre-warmed 4% PFA in DMEM medium with 10% FBS, and then cells were permeabilized and blocked with 3% BSA in

PBS containing 0.3% Triton at room temperature for 1h before incubation with specific primary antibodies (mouse anti-DCC, 1:1000, and rabbit anti-FLAG, 1:5000) at 4 °C overnight. Neurons were incubated with secondary antibodies (anti-mouse-488 and anti- rabbit-647) at 37 ºC for 2 h. Coverslips were mounted on glass slides with Fluorogel after

33 staining with DAPI. Images were taken using a Leica SP8 confocal microscope with HyD detector in photon counting mode. Analysis of Pearson Correlation Coefficient (PCC) in

ROI of the growth cone was assessed in NIH Image J software and values were analyzed with the one-way ANOVA with Tukey’s posthoc test (GraphPad Software Inc., La Jolla,

CA).

3.8 Neurite Outgrowth

To analyze axon outgrowth, primary cortical neurons from E15 mice were dissociated and nucleofected with specific plasmids before plating them on the PLL-coated coverslips. The culture medium was replaced by DMEM with B27 2 h after the nucleofection. Purified Netrin-1 (250 ng/ml) or sham control were then added into the culture medium, and then cells were cultured at 37 °C for 20 h before fixing with 4% PFA in DMEM medium at room temperature for 30 min, permeabilized and blocked with 3%

BSA in PBS containing 0.3% Triton at room temperature for 1h. The neurons were then stained with DAPI (1:1000 in PBS) at room temperature for 10 min before staining with

BODIPY® 558/568 Phalloidin (1:100 in PBS) at 37 °C for 2 h. The coverslips were mounted on glass slides with Fluorogel. Images were taken with a Leica SP8 confocal microscope, and then analyzed with NIH Image J software.

3.9 Axon Branching

Dissociated cortical neurons from E15 mice were nucleofected with specific DNA constructs (4 μg TUBB3 shRNA, 2 μg WT TUBB3 or 2 μg mutant TUBB3, 1μg Venus

YFP) and plated on the PLL (200 ng/ml)-coated coverslips in the culture of DMEM with

10% FBS and penicillin/streptomycin for 6 h before replacing the culture medium with

DMEM plus B27 and penicillin/streptomycin. PBS or purified chick Netrin-1 (250 ng/ml) was applied directly into the new medium 12 h later. The neurons were cultured for 72 h before fixing with pre-warmed 4% PFA at 37 °C for 30min, permeabilized and blocked with 3% BSA in PBS containing 0.3% Triton at room temperature for 1 h. The neurons were then stained with DAPI (1:1000 in PBS) at room temperature for 10 min before staining with BODIPY® 558/568 Phalloidin (1:100 in PBS) at 37 °C for 2 h. The coverslips were mounted on glass slides with Fluorogel. Images were taken with a Leica SP8 confocal microscope, and then analyzed with NIH Image J software. A branch longer than 10um was counted as a branch point. Total branching numbers were analyzed with a one-way

ANOVA using GraphPad Prism software.

3.10 Chick Spinal Cord Commissural Axon Projection in vivo

The stages of developing chick were defined according to Hamburger and Hamilton method (Hamburger & Hamilton, 1951). DNA plasmids (WT TUBB3, TUBB3 mutant, tau mutant or Venus-YFP) were mixed with fast green were injected into the neural tubes of chick embryo at HH stage 12-15 using a sterile glass needle. For electroporation, electric voltage of 25 V was applied for 5 ms on the both sides of the neural tubes using a BTX

ECM830 instrument. The embryos were collected at stage 22-23 when commissural axons cross the midline. Spinal cords with YFP fluorescence were chosen and transversely cut with a thickness of 200 μm before mounting on glass slides with Fluorogel. Images were then taken with a confocal microscope (Leica TCS SP8). The percentage of commissural axons crossing the midline was counted and analyzed for quantification.

3.11 Chick Spinal Cord Axon Turning in vitro

The electroporation was performed as described above. Embryos were dissected at the stage 18-20, and the YFP- fluorescence labeled half spinal cords were isolated, cut into

200 um long segments, co-cultured with an aggregate of either control cells or Netrin-1 secreting HEK cells for 40 hours. After fixing with 4% PFA, images were then taken with a confocal microscope (Leica TCS SP8). An axon turning more than 5 degrees towards the aggregate was considered as a turning axons. The percentage of turning axon was determined by the numbers of turning axons divided by the total axons within 300 μm distance from the cell aggregate.

Chapter 4 Results

Results

4.1 Human TUBB3 Mutations Perturb Netrin-1 Signaling

4.1.1 TUBB3 Mutants Show Reduction in Interaction with DCC

Figure 6 Interaction of DCC with TUBB3 Mutants in HeLa Cells. (A-F) Interaction of DCC with TUBB3 mutants in HeLa cells. HeLa cells were transfected with human full-length DCC-Myc plus either TUBB3 WT-FLAG, or FLAG-tagged

TUBB3 mutants (G82R, T178M, E205K and A302V in A, A302T, M388V, R262C and

R62Q in C, M323V, E410K, D417H and D417N in E), respectively. Immunoprecipitation was performed with anti-DCC antibody and the blot was analyzed with anti-DCC and anti-

FLAG antibodies (B, D and F). Quantification from three independent experiments. Data are mean ± S.E.M. The y-axis shows relative binding of DCC with WT or mutants in

38 arbitrary units. * indicates p<0.05, ** indicates p<0.01, *** indicates p<0.001, ns indicates no significant difference (one-way ANOVA and Tukey’s Multiple Comparisons Test for post-hoc comparisons).

Our previous studies showed that TUBB3 directly interacted with DCC and this interaction could be further induced by Netrin-1 stimulation (Qu et al., 2013). To examine whether TUBB3 mutations affect the interaction with DCC, plasmids expressing human full-length DCC tagged with Myc, plus either WT human TUBB3-FLAG or TUBB3 mutants (G82R, T178M, E205K, A302V, A302T, M388V, R262C, R62Q, M323V,

E410K, D417H, and D417N) tagged with FLAG were co-transfected into HeLa cells in which DCC and TUBB3 showed undetectable levels. A Co-IP assay was performed with anti-DCC antibody. The results showed that eight out of twelve (G82R, T178M, A302V,

A302T, R262C, M323V, D417H and D417N) mutants exhibited reduced interaction with

DCC (Fig. 6A-F).

4.1.2 TUBB3 Mutations Disrupt the Overlap of DCC and TUBB3 in the Growth Cone of Primary E15 Cortical Neurons

Figure 7 The Reduced Overlap of DCC and TUBB3 Mutants in the Growth Cone of

Primary Neurons.

(A-I) E15 cortical neuron transfected with TUBB3 WT (A-C) or mutant R262C (D-F) or

A302V(G-I), together with TUBB3 shRNA, were cultured for 2 days, immunostained with primary anti-DCC and anti-FLAG antibodies, followed by secondary antibodies anti- mouse-488 and anti-rabbit-647 secondary antibodies. Images were taken using Leica SP8 confocal microscope with a HyD detector in photon counting mode. (J) PCC in the ROI of growth cone area was analyzed using NIH Image J software. (K) Analysis of PCC in ROI of the growth cone area after 90 degree rotation of the red fluorescence channel. *** indicates p<0.001, ns indicates no significant difference (one-way ANOVA and Tukey’s

Multiple Comparisons Test for post-hoc comparisons). Scale bar: 10 μm.

DCC directly interacts with TUBB3, and DCC colocalizes with TUBB3 in the growth cone of primary cortical neurons (Qu et al., 2013). Both A302V and R262C are found to be associated with congenital fibrosis of the extraocular muscles type 3 (CFEOM3) and malformations of cortical development (MCD) (Poirier et al.; Tischfield et al., 2010). So these two mutations were selected to test whether they could affect Netrin-1-induced

DCC/TUBB3 colocalization. To determine whether TUBB3 mutations affect their subcellular colocalization, E15 mouse cortical neurons were nucleofected with TUBB3 shRNAs, plus WT or mutants A302V or R262C. Quantitative colocalization analysis of confocal fluorescence microscopy images showed partial overlap of immunofluorescent signals of DCC (green) and WT TUBB3(red) in the peripheral region of GCs (Fig. 7A-C, quantification in J). However, expressions of A302V or R262C showed much lower level of colocalization with DCC (Fig. 7D-F, quantification in J). To rule out the potential overlaps of random signals, PCC value was obtained after rotating one fluorescent channel

41 by 90 degrees. PCC values of rotated images are distributing around 0 in all three groups, suggesting that the red and green fluorescence are specifically correlated (Fig. 7K). These results suggest that TUBB3 mutants reduce the colocalization with DCC, which is consistent with co-IP results. It is worth noting that R262C and A302V mainly localize in the core region of the growth cone, whereas WT TUBB3 widely distributes in the peripheral region of the growth cone. This suggests that mutants-containing MTs are less active than WT-containing MT which can extend into the peripheral region.

4.1.3 TUBB3 Mutations Inhibit Netrin-1-Promted DCC/ TUBB3

Interaction

Figure 8 Interaction of DCC and TUBB3 Mutants in Neurons Treated with Netrin

(A) Knockdown of endogenous TUBB3 in primary neurons by TUBB3 shRNA. Several shRNAs targeting mouse endogenous TUBB3 3’ UTR were designed and the knockdown effect was examined in primary cortical neurons from E15 mice. Expression of #1 and #4 shRNA showed significant knockdown of endogenous TUBB3 protein. (B) WT, R262C and A302V recovered TUBB3 protein levels after knockdown of endogenous TUBB3 by the combination of #1 and #4 shRNA. (C-F) TUBB3 shRNAs together with TUBB3 WT, mutant R262C (C) or A302V(E) were transfected into mouse E15 cortical neurons, and primary neurons were then cultured overnight. The culture medium was replaced with

DMEM plus B27 for 6 h before neurons were treated with purified Netrin-1 or sham- purified control for 20 min. A co-immunoprecipitation assay was performed using anti-

DCC antibody. Western blot shows the detection of FLAG tag and DCC. Quantification shows the relative binding of DCC with TUBB3-FLAG (D and F). The Y axis shows the normalized ratio of mean intensity of FLAG to DCC. Data are mean ± S.E.M from three independent experiments. ** indicates p<0.01, *** indicates p<0.001, ns indicates no significant difference (one-way ANOVA and Tukey’s Multiple Comparisons Test for post- hoc comparisons).

To minimize the interference of endogenous TUBB3 in E15 cortical neurons, we designed multiple shRNAs targeting 3’ UTR of mouse TUBB3, which affected endogenous mRNA, but not coding sequence of transfected TUBB3 constructs. Since shRNA #1 and #4 showed significant knockdown effect, a combination of these two shRNAs were used in the following experiments. The shRNA #6 showing no knockdown effect served as control shRNA (Fig. 8A). Protein expression levels of transfected

44 constructs in neurons were then determined by Western blot. TUBB3 shRNA showed significant knockdown, and expression of either A302V or R262C recovered TUBB3 protein levels after knockdown of endogenous TUBB3 (Fig. 8B). In order to examine whether TUBB3 mutants affect Netrin-1-induced interaction of DCC and TUBB3, primary cortical neurons were transfected with TUBB3 shRNAs, plus WT TUBB3, A302V or

R262C constructs. Co-IP results showed that Netrin-1 induced the interaction of DCC with

WT TUBB3, but not mutants R262C or A302V (Fig. 8C-F). Quantification showed relative binding of DCC to TUBB3. These data demonstrate that these two mutations impair the interaction with DCC induced by Netrin-1 stimulation. Mutants-containing MTs extended into the cell membrane to a less extent than WT (Fig. 7E and H), which probably reduces the chance of interaction between TUBB3 mutants and DCC located on cell membrane.

The reduced interaction between TUBB3 mutants and DCC also could result from impaired

MT polymerization, as the interaction between DCC and WT TUBB3 is dependent upon

MT dynamics (Qu et al., 2013). To resolve that, we then perform the co-sedimentation assay.

4.1.4 TUBB3 Mutations Disrupt Netrin-1-Induced Interaction of

DCC with Polymerized TUBB3

Figure 9 Interaction of DCC with TUBB3 Mutants-Containing MTs

(A) FLAG-tagged WT TUBB3, mutant R262C or A302V, together with DCC-Myc constructs were transfected into HeLa cells, and a co-sedimentation assay was performed.

DCC and TUBB3 proteins in the pellet (P) and supernatant (S) fractions were analyzed by immunoblotting. (B) Quantification of P/S ratio of DCC and TUBB3. Both A302V and

R262C disrupted the interaction of DCC with polymerized MT. (C-F) WT TUBB3, mutant

R262C or A302V, together with TUBB3 shRNA were transfected into mouse E15 cortical neurons, which were stimulated with Netrin-1 or sham-purified control, and a co- sedimentation assay of cell lysates was conducted. DCC and FLAG in the pellet (P) and supernatant (S) fractions were examined by western blot. Quantification of three independent experiments show P/S ratio of DCC and FLAG. Netrin-1 stimulation increased interaction of DCC with polymerized MTs in WT-transfected neurons, but not in R262C-transfected neurons (D) or A302V-transfected neurons (F). * indicates p<0.05,

** indicates p<0.01, *** indicates p<0.001, ns indicates no significant difference (one-way

ANOVA and Tukey’s Multiple Comparisons Test for post-hoc comparisons).

Modulation of MT dynamics is vital in axon guidance (Dent et al., 2011). Previous work showed that Netrin-1 induced the interaction of DCC with polymerized MT (Qu et al., 2013). To investigate whether TUBB3 mutants affect their interaction with MTs, cDNAs expressing DCC-Myc and FLAG-tagged WT TUBB3 or mutants were co- transfected into HeLa cells. A co-sedimentation assay was then performed. The ratios of

TUBB3 in pellet (P) to supernatant (S) shows no significant difference between WT and the two mutants, suggesting that these two mutants can be properly incorporated into MTs.

In contrast, the ratio of DCC in pellet (P) to supernatant (S) is reduced in A302V and

R262C compared to the WT, indicating that both A302V and R262C affect interaction of

DCC with mutants-containing MTs (Fig. 11A, B).

Subsequently, to determine whether TUBB3 mutants interfere with Netrin-1- induced interaction of DCC with MTs, primary E15 cortical neurons were transfected with

TUBB3 shRNA plus WT TUBB3, A302V or R262C constructs and treated with purified

Netrin-1 or control solution. The co-sedimentation assay shows that both A302V and

R262C can be incorporated into MTs at the same level as WT indicated by P/S of FLAG levels (Fig. 11C-F). As expected, the DCC P/S ratios of two mutants show lower degree than WT on the basal level. More importantly, Netrin-1 induces more DCC binding to WT- containing MTs (a higher P/S ratio), but not in mutants-containing MTs (Fig. 11D and F), indicating that mutants affect Netrin-1-induced interaction of DCC and MTs. These data indicate that A302V and R262C disrupt Netrin-1-induced interaction of DCC with polymerized TUBB3 in MTs.

4.1.5 TUBB3 Mutations Disrupt Netrin-1-Induced Neurite Outgrowth

Figure 10 TUBB3 Mutations Affect Neurite Outgrowth of Cortical Neurons. (A-D) E15 mouse cortical neurons were transfected with control shRNA (A, B) or TUBB3 shRNAs (C, D) together with Venus YFP, and then stimulated with Netrin-1 or sham- purified control for 20h as indicated. Netrin-1 induced neurite outgrowth in the control shRNA, but not TUBB3 shRNAs. (E-J) E15 mouse cortical neurons were transfected with

Venus YFP and TUBB3 shRNA plus WT (E, F), R262C (G, H) or A302V (I, J). Neurons

50 labeled by YFP fluorescence were randomly selected and the length of longest neurite of selected neurons was measured. Netrin-1 induces neurite outgrowth in WT, but not in the mutants group. (K) Quantification of longest neurite length. * indicates p<0.05, ** indicates p<0.01, *** indicates p<0.001, ns indicates no significant difference (one-way

ANOVA and Tukey’s Multiple Comparisons Test for post-hoc comparisons). Scale bar:

10 μm.

Neurite outgrowth is an important developmental process, which can be induced by the guidance cue Netrin-1 (Kennedy et al, 1994). TUBB3 is essential for Netrin-1-induced neurite outgrowth (Qu et al., 2013). To determine whether TUBB3 mutants affect Netrin-

1-induced neurite outgrowth, primary cortical neurons from E15 mice were transfected with Venus yellow fluorescent protein (Venus YFP) constructs plus control shRNA (Fig.

10A and B), TUBB3shRNAs (Fig. 10C and D) or TUBB3shRNAs together with WT (Fig.

10E and F), A302V (Fig. 10G and H) or R262C constructs (Fig. 10I and J). These neurons were then stimulated with Netrin-1 or sham-purified control for 20 hours. After being stained with phalloidin, only neurons successfully transfected with Venus-YFP were randomly selected and neurite length was measured. As expected, Netrin-1 promoted neurite outgrowth in the control shRNA-transfected neurons, but not in the TUBB3 shRNAs-transfected neurons (Fig. 10A-D and L). Netrin-1 stimulation promoted neurite outgrowth in WT-transfected neuron (Fig. 10E, F and L). However, Netrin-1 did not induce neurite outgrowth in either R262C or A302V-transfected neurons (Fig. 10G-J, and L).

Notably, there was no significant difference between WT and mutants-transfected neurons in the absence of Netrin-1 treatment, suggesting that TUBB3 mutants did not affect the

51 basal level of axon outgrowth (Fig. 10K). But there was a significant difference between

WT and mutants-transfected neurons under Netrin-1 treatment, indicating that TUBB3 mutants disrupted Netrin-1-induced neurite outgrowth. Neurite outgrowth requires the coordination of actin filaments and MTs (Goldberg & Burmeister, 1986). Netrin-1-induced outgrowth relies on the extension of MT (Marsick et al., 2010). TUBB3 mutants may disrupt MT dynamics and impair Netrin-1-induced outgrowth.

4.1.6 TUBB3 Mutations Affect Netrin-1-Induced Axon Branching

Figure 11 TUBB3 Mutations Affect Axon Branching of Cortical Neurons Induced by Netrin-1.

(A-D) E15 mouse cortical neurons were transfected with control shRNA (A, B) or TUBB3 shRNAs (C, D) together with Venus YFP, and then cultured with Netrin-1 or sham-purified control for 72 h. Netrin-1 induced axon branching in the control shRNA, but not TUBB3 shRNA group. (E-J) E15 mouse cortical neurons were transfected with Venus YFP and

TUBB3 shRNAs plus WT (E, F), R262C (G, H), or A302V (I, J). Neurons labeled by YFP fluorescence were randomly selected and axon branching numbers were counted. (K)

Quantification of total branching numbers. The branching point with a branch longer than

10 μm was selected. 100 neurons from three independent experiments are counted. Data are mean ± S.E.M. * indicates p<0.05, ** indicates p<0.01, *** indicates p<0.001, ns indicates no significant difference (one-way ANOVA Tukey’s Multiple Comparisons

Test). Scale bar: 10 μm.

Axon branching is a vital part of functional neural circuits that allow neurons to interact with multiple synaptic targets. MT extension is the basis of axon branch formation

(Dent et al., 2001; Tang and Kalil, 2005). Our previous work showed that TUBB3 was required for Netrin-1-induced axon branching (Huang et al., 2015). So we wonder if

TUBB3 mutation disrupt this process. Mouse E15 cortical neurons were dissociated and transfected with Venus YFP plus control shRNA (Fig. 11A and B), TUBB3shRNA construct (Fig. 11C and D), or TUBB3shRNA together with WT (Fig. 11E and F), A302V

(Fig. 11G and H) or R262C constructs (Fig. 11I and J). Neurons were then cultured with

Netrin-1 or sham-purified control for 72 h. To determine the effect of TUBB3 shRNA, control shRNA-transfected and TUBB3 shRNA-transfected neurons were analyzed.

Netrin-1 promoted axon branching in the control shRNA-transfected neurons, but not in

54 the TUBB3 shRNAs-transfected neurons, which was consistent with our previous study

(Fig. 11A-D, K) (Huang et al, 2015). More importantly, Netrin-1 stimulation significantly increased total branching numbers in WT-transfected neurons from 13.19 ± 0.49 to 20.39

± 0.72 (Fig. 11E, F and K). However, Netrin-1 promoted axon branching in R262C- transfected neurons to a less extent, and Netrin-1-did not induce axon branching in A302V- transfected neurons (Fig. 11G-K). Significant difference could be observed between WT and R262C in the presence of Netrin-1 (Fig. 11K). Together, TUBB3 mutants disrupted

Netrin-1-induced axon branching. Axon branching requires dynamic MT extension into the newly formed membrane protrusion (Kalil & Dent, 2014). Netrin-1-induced axon branching requires the activation of CaMKII and MAPKs (Tang & Kalil, 2005). CaMKII regulates MT dynamics via MT-associated protein (MAPs) MAP2 and tau (McVicker et al., 2015). MAPKs also regulates MAP2 and tau which regulate MT dynamics (Ploia et al.,

2011; Zhu et al., 2000; Qu et al., 2013). So TUBB3 mutants could disrupt the effect of

MAPs on MTs, thus affects CaMKII and MAPKs-mediated axon branching induced by

Netrin-1.

4.1.7 TUBB3 Mutations Disrupt Axon Attraction Induced by Netrin-1

Figure 12 TUBB3 Mutations Disrupt Netrin-1-Mediated Attraction of Spinal Cord

Commissural Axons.

(A) Schematic diagram showing in ovo electroporation and an open-book based co-culture assay. (B-G) Electroporation in chick neural tubes were performed with Venus YFP plus

WT (B, C), A302V (D, E), or R262C (F, G) at stage 12-15. The chick spinal cord was dissected at stage 18-20. Venus YFP allows recognition of transfected axons. Explants of spinal cord slices were co-cultured with either control HEK cell aggregates (B, D, and F) or with HEK cell aggregates stably secreting Netrin-1 (C, E and G) as indicated. The commissural axons were attracted to Netrin-1 source in neurons transfected with WT

TUBB3, but not R262C or A302V. (L) Quantification of axon turning. Axons turning more than 5 degree towards the cell aggregate were counted as turning axons. Data are mean ±

S.E.M. * indicates p<0.05, ** indicates p<0.01, *** indicates p<0.001, ns indicates no significant difference (one-way ANOVA Tukey’s Multiple Comparisons Test). Scale bar:

100 μm.

It has been long established that Netrin-1 attracts commissural axon projection

(Kennedy et al., 1994; Serafini et al., 1996). In order to find out whether TUBB3 mutants disrupt commissural axon projection towards Netrin-1, an open-book assay using commissural neurons from chick embryos was performed as illustrated in Fig. 11A (Liu et al, 2004; Liu et al., 2007; Liu et al., 2009; Chao et al., 2013). The Venus YFP together with

WT, A302V or R262C constructs were electroporated into the chick neural tubes at stages

HH12-15 and then the YFP-labeled neural tubes were isolated at stage 18-20. After being cut into rectangular pieces, neural tubes explants were laid next to an aggregate of HEK293 cells or HEK293 cells that stably secreted Netrin-1 and co-cultured for 24 h (Fig. 12A).

Our results showed that 88.8% ± 2.0% of WT-electroporated commissural axons turned towards cell aggregates of Netrin-1 source (Fig.12C and L), whereas 3.2% ± 0.5% of axons turned towards control cell aggregate of HEK293 cells (Fig.12B and L), suggesting that Netrin-1 attracted WT-transfected commissural axons. However, TUBB3 mutants disrupted the turning process: 17.6% ± 2.0% of R262C- and 17.4% ± 1.9% of

A302V-electroporated axons turn towards Netrin-1 aggregate (Fig. 12E and G, and L).

These results demonstrate that TUBB3 mutants impair Netrin-1-induced commissural axon attraction.

Turning to the Netrin-1 gradients relies on the growth cone navigation and the interaction of receptors located on the growth cone and extracellular guidance cues. The interaction of DCC or Neogenin (homolog of DCC in chick) with Netrin recruits downstream signaling and eventually alters cytoskeleton dynamics. TUBB3 mutants may alter MT dynamics, which in turn abolishes turning process.

4.1.8 TUBB3 Mutations Disrupt Spinal Commissural Axon Projection in vivo

Figure 13 The Expressions of TUBB3 Mutants Impair Spinal Cord Commissural

Axon Pathfinding in vivo.

(A) Schematic diagram of the transverse section of the chick spinal cord after electroporation. (B-E) The chick neural tubes were electroporated with Venus YFP only

(B), Venus YFP plus WT (C), Venus YFP plus A302V (D), or Venus YFP plus R262C

(E). Venus only or WT-transfected neurons showed that the commissural axons were attracted to the floor plate, however mutants showed misguided or shorten axons. The red arrows point to misguided axons. (F) Quantification of the percentage of axons reaching the midline of the spinal cord. (G) Quantification of the average distance of axons away from the midline. (H) The percentage of embryos with misguided axons. ***, p<0.001

(One-way ANOVA Tukey’s Multiple Comparisons Test). Scale bar: 100 μm.

To further investigate whether TUBB3 mutants interfere with axon attraction in vivo, we examined commissural axon projection in the developing chick spinal cord (Liu et al., 2007; Liu et al., 2009). The Venus YFP only or together with WT, A302V or R262C were electroporated into the chick neural tubes at stages HH12-15. Chick spinal cords with

YFP fluorescence were collected at stage 23 and transverse sections of the spinal cord were prepared (Fig. 13A). Our results showed that 96.7 ± 0.77% of Veus only-transfected (Fig.

13B and F), 95.5% ± 1.02% of WT-transfected (Fig. 13C and F) commissural axons reached the floor plate, whereas only 41.2% ± 3.7% of R262C-transfected(Fig. 13D and F) and 49.8% ± 3.4% of A302V-transfected (Fig. 13E and F) commissural axons reached the floor plate. The average distance from axon to the midline was also measured (Fig. 13G).

The percentage of embryos with misguided axons were counted and shown (Fig. 13H).

These data demonstrated that mutants disrupted the commissural axons pathfinding in vivo in the developing spinal cord. The proper projection of commissural axons to midline requires the presence of Netrin gradient around the midline (Serafini et al., 1996).

Specifically Netrin-1 in the ventricular zone around the midline is required for commissural

60 axons projection (Dominici C. et al., 2017). This in vivo assay further validated that Netrin-

1-mediated attraction was disrupted by TUBB3 mutations.

4.2 The Role of Tau in Netrin-1 Signaling

4.2.1 Interaction of Tau with DCC

Figure 14 Interaction of Tau with DCC

(A, B) Interaction of endogenous tau with DCC in E15 cortical neurons. (B) Quantification from three independent experiments. Data are mean ± S.E.M. The y-axis shows relative binding of tau with DCC in arbitrary units. *** indicates p<0.001 (student’s T test).

Neurons were treated with conditioned medium from HEK cell stably secreting Netrin-1.

(C) Netrin-1 increased the interaction of endogenous tau with DCC in a time-dependent manner. (D) Interaction of endogenous tau with DCC in E15 cortical neurons treated with purified Netrin-1. (E) Netrin-1 increased the interaction of endogenous tau with DCC in a dose-dependent manner. E15 cortical neurons were treated with purified Netrin-1 at 62.5,

125, 250 ng/ml. (F) Interaction of 3R-tau with DCC in HeLa cells. 3R-Tau-HA and DCC-

Myc were co-transfected into HeLa cells. Anti-DCC antibody was used to immunoprecipitate DCC. (G) Full-length 3R-tau or the 3R tau MT binding domain (198-

441) were co-tranfected with DCC-Myc into HeLa cells. Co-IP is performed with anti-Myc antibody. (H) Tau-HA was co-transfected with truncated DCC (ΔP1, ΔP2 and ΔP3) tagged with Myc in HeLa cells. Co-IP was performed with anti-Myc antibody. (I) Tau-HA was co-transfected with truncated DCC (ΔP1, ΔP2 and ΔP3) tagged with Myc in HeLa cells.

Co-IP was performed with anti-HA antibody.

To examine the potential interaction of tau with DCC in the developing brain, cortical neurons from the embryonic day 15 (E15) mice were dissociated, cultured and treated with conditioned medium from control HEK cells or HEK cells stably secreting

Netrin-1. Co-IP with anti-DCC antibody was then performed before analyzing with anti- tau antibody. Immunoblotting showed that tau could interact with DCC and more importantly, Netrin-1 stimulation enhanced their interaction (Fig. 14A). Tau exists in two

63 isoforms (4R and 3R) in E15 mouse cortexes and 3R is the major isoform interacting with

DCC. Netrin-1 increased the interaction of tau with DCC in a time-dependent manner (Fig.

14B). To further confirm whether Netrin-1 specifically promotes the interaction, commercially purified chick Netrin-1 was used to stimulate neurons. Interaction of tau with

DCC was induced by purified Netrin-1 (Fig. 14C) in a dose-dependent manner (Fig. 14D).

To find out whether tau could interact directly with DCC, cDNAs expressing HA- tagged human 0N3R-tau and DCC-Myc were co-transfected into HeLa cells. Co-IP showed that anti-Myc antibody immunoprecipitated tau, suggesting that tau interacted with DCC

(Fig. 14E). To further characterize this interaction, plasmids encoding a tau MT-binding domain (198-441) was co-transfected with DCC-Myc into HeLa cells. Co-IP results showed tau MT-binding domain failed to bind with DCC, suggesting that tau projection domain mediates the interaction with DCC (Fig. 14F). DCC intracellular domains (P1, P2 and P3) are responsible for mediating Netrin-1 signaling. To find out which domain of

DCC mediates the interaction, Hela cells were transfected with tau-HA constructs plus

Myc-tagged DCC constructs with truncation of P1, P2 or P3 respectively. IP with anti-Myc antibody showed that deletion of the P1 domain fails to bind with tau, suggesting that P1 domain was required for the interaction of DCC with tau (Fig. 14G). Results from the reverse IP with anti-HA antibody also supported that the DCC P1 domain mediated the

DCC/tau interaction (Fig. 14H). These data suggests that Netrin-1 stimulation recruits tau to interact with DCC via P1 domain.

4.2.2 Netrin-1 Induces Overlap of Tau with DCC in Primary Neurons

Figure 15 The Overlap of Tau with DCC in Primary Neurons. (A-F) Primary neurons were cultured for 2 days and immunostained with anti-DCC and anti-tau antibodies. C and F are the merged images of A and B, D and E, respectively. Scale bar: 10 μm. (G) Quantitative analysis of PCC in the ROI of the growth cone. 30 growth

65 cones in each group are analyzed. (H) Analysis of PCC in the ROI of the GC after 90 degree counterclockwise rotation of the red fluorescence channel. *** indicates p<0.001. ns indicates no significant difference (one-way ANOVA and Tukey’s test for post-hoc comparison).

The axon growth cone explore its environment, detecting and responding to extracellular guidance cues in the developing nervous system. To find out whether tau colocalizes with DCC in the growth cone of primary neurons, cortical neurons from E15 mouse cortex were dissociated and cultured for 2 days, neurons were immunostained with anti-DCC and anti-tau antibodies. Confocal microscope counting model was adopted to take images, quantitative analysis showed that Netrin-1 inudced colocalization of DCC and tau (Fig. 15G). To rule out the potential colocalization of one protein with the background noise, PCC value was regained using 90 degree-rotated FLAG-staining images and original

DCC-staining images. PCC values of rotated images are distributing around 0 among three groups, suggesting that there is no obvious interference of unspecific signals (Fig. 15H).

4.2.3 JNK, GSK-3 and Src family Kinases Are Involved in Netrin-1

Induced Phosphorylation

Figure 16 The Involvement of JNK, GSK-3 and Src family Kinases in Netrin-1

Induced Phosphorylation

(A-C) Cortical neurons were treated with purified Netrin-1 for 20 min, and then co-IP was performed using an anti-phosphorylated serine antibody (pS) (A), an anti-phosphorylated threonine antibody (pT) (B), and an anti-phosphorylated tyrosine antibody (pY) (C), respectively. Western blot showed detection of tau. (D-I) Cortical neurons were pretreated with JNK inhibitor SP600125 (D, F), GSK-3 inhibitor LiCl (E, G), Src family inbibitor

PP2, or control drug PP3 (H, I) for 6 h before stimulation with purified Netrin-1 for 20 min. Co-IP was performed using an anti-phosphorylated serine antibody (pS) (D, E), an anti-phosphorylated threonine antibody (pT) (F, G), and an anti-phosphorylated tyrosine antibody (pY) (H, I), respectively. Western blot showed detection of tau protein.

Tau is well established protein with substantial sites that could be phosphorylated.

To test if tau phosphorylation is involved in Netrin-1 signaling, immunoprecipitation was performed with an anti-phosphorylated serine antibody (pS) (Fig. 16A), an anti- phosphorylated threonine antibody (pT) (Fig. 16B), and an anti-phosphorylated tyrosine antibody (pY), respectively (Fig. 16C). Immunoblotting indicated that Netrin-1induced phosphorylation of tau at serine, threonine and tyrosine sites. It is also possible that Netrin-

1 induced phosphorylation of other proteins which are interacting with tau. Using specific phosphor-tau antibodies can help clarify whether Netrin-1 induces tau phosphorylation. It has been documented that Netrin-1 activates JNK, GSK and Src (Qu et al., 2013; Li et al.,

2004; Liu et al., 2004; Del Río et al., 2004). To examine whether these kinases are involved in Netrin-1-induced tau phosphorylation, we pretreated neurons with the following inhibitors: 3 µM of JNK inhibitor SP600125 (Fig. 16A, B), 10 mM of GSK-3 inhibitor

LiCl (Fig. 16C, D), or 5 µM of Src family inbibitor PP2 (Fig. 16E, F) for 6 h, followed by

Netrin-1 stimulation for 20 min. Inhibition of JNK, GSK-3 and Src family kinases could decrease Netrin-1-induced phosphorylation, suggesting that JNK, GSK-3 and Src family kinases are involved in Netrin-1-induced phosphorylation, or that Netrin-1 induced phosphorylation of other proteins which are interacting with tau. Using specific phosphor- tau antibodies can help determine whether JNK, GSK-3 and Src family kinases directly phosphorylate tau.

4.2.4 Activities of JNK, GSK-3 and Src Are Required for the

Interaction of DCC with Tau

Figure 17 JNK, GSK-3 and Src Inhibitors Affect the Interaction of DCC with Tau (A-C) Cortical neurons were pretreated with JNK inhibitor SP000125 (A), GSK-3 inhibitor LiCl (B), or Src family inbibitor PP2 (C) for 6 h before stimulation with purified

Netrin-1 for 20 min. Co-IP was performed using anti-DCC antibody (A, B, C) and analyzed with the tau antibody.

To find out whether tau phosphorylation is required for the interaction of DCC and tau, cortical neurons were pretreated with the following inhibitors: JNK inhibitor

SP000125 (Fig. 17A), GSK-3 inhibitor LiCl (Fig. 17B), or Src family inbibitor PP2 (Fig.

17C). IP with an anti-DCC antibody was then performed before analyzing with anti-tau antibody. IP results indicated that blocking the activities of JNK, GSK3, or Src family kinases inhibited the interaction between DCC and tau, suggesting that the DCC/tau interaction is dependent upon the activities of JNK, GSK3 and Src family kinases. These kinases could contribute to the interaction of DCC with tau through phosphorylation of tau and/or DCC, or through affecting some related proteins. For instance, Fyn, a member of

Src family kinases, has shown to phosphorylate DCC at Tyr-1418 (Meriane et al., 2004).

JNK phosphorylates TUBB3, which may be important for the DCC/tau interaction (Qu et al., 2013). Once the specific phosphorylation sites on tau are found to be directly phosphorylated by these three kinases, mutations of those specific residues can contribute to clarify if phosphorylation of tau is required for the DCC/tau interaction.

4.2.5 Tau Is Required for Netrin-1-Induced Neurite Outgrowth

Figure 18 The Involvement of Tau in Netrin-1-Induced Neurite Outgrowth (A) The knockdown effect of tau shRNA. (B-G) mouse E15 cortical neurons were transfected with Venus YFP plus control shRNA (B, C), Venus YFP plus tau shRNA (D,

E) or Venus YFP plus tau shRNA and wild type RNAi-resistant 3R-tau (F, G). These neurons were then treated with purified Netrin-1 (C, E, and G) or sham control solution (B,

D, F). (H) Quantification of neurite length. YFP-positive neurons were randomly selected and assessed in term of neurite length. Data are mean ± s.e.m. from three separate

73 experiments. *** indicates p<0.001, ns indicates no significant difference (one way

ANOVA with Tukey’s for post-hoc comparisons). Scale bar: 10 μm.

To knock down the endogenous tau, shRNA targeting a common sequence in

3’UTRof mouse and chick tau were first designed and transfected into E15 mouse cortical neurons. #2 shRNA constructs significantly knocked down endogenous 3R and 4R tau and were used for the following research, while #3 shRNA showing no knockdown effect was used as control shRNA (Fig. 18A).

To examine whether tau is involved in Netrin-1 induced neurite outgrowth, E15 mouse cortical neurons were transfected with Venus YFP plus control shRNA (Fig.

18B,C), Venus YFP plus tau shRNA (Fig. 18D,E) or Venus YFP plus tau shRNA and wild type RNAi-resistant 3R-tau (Fig. 18F,G), respectively. These neurons were stimulated with purified Netrin-1 or sham-purified control for 20 h. Netrin-1 promoted neurite outgrowth in neurons transfected with control shRNA from 14.3 ± 0.6 μm to 30.2 ± 1.2 μm (Fig. 18B,

C, quantification in Fig. 15H). However, Netrin-1 failed to promote neurite outgrowth in neurons transfected with tau shRNA (Fig. 18D, E, quantification in Fig. 18H). To rule out the possibility of tau shRNA off-target effect, 3R-tau was co-transfected with tau shRNA into E15 cortical neurons. 3R-tau, the major isoforms in fetal stage, successfully rescued tau shRNA-caused effect on netrin-induced neurite outgrowth (Fig. 18F, G, quantification in Fig. 18H). These results indicate that tau is required in Netrin-1-induced neurite outgrowth. Tau stabilizes MTs and promotes MT polymerization. Upon Netrin stimulation, tau could further promote MT polymerization which then contributes to neurite outgrowth.

4.2.6 Tau Is Required for Netrin-1-Induced Branching

Figure 19. The Involvement of Tau in Netrin-1-Induced Axon Branching (A-F) mouse E15 cortical neurons were transfected with Venus YFP plus control shRNA

(A, B), Venus YFP plus tau shRNA (C, D) or Venus YFP plus tau shRNA and 3R-tau (E,

F). These neurons were then treated with purified Netrin-1 (B, D and F) or sham control solution (A, C and E). (G) Quantification of branching points. YFP-positive neurons were randomly selected and assessed in term of branching numbers. Data are mean ± S.E.M. from three separate experiments. *** indicates p<0.001, * indicates p<0.05, ns indicates

76 no significant difference (one way ANOVA with Tukey’s for post-hoc comparisons). Scale bar: 10 μm.

To examine whether tau is involved in Netrin-1 induced axon branching, E15 mouse cortical neurons were transfected with Venus YFP plus control shRNA (Fig.

19A,B), Venus YFP plus tau shRNA (Fig. 19C,D) or Venus YFP plus tau shRNA and 3R- tau (Fig. 19E,F), respectively. Then these neurons were cultured with Netrin-1 or sham- purified control for 72 h. Netrin-1 promoted axon branching in neurons transfected with control shRNA (Fig. 19A, B, quantification in Fig. 19G). However, Netrin-1 failed to promote axon branching in neurons transfected with tau shRNA (Fig. 19C, D, quantification in Fig. 19G). To rule out the possibility of tau shRNA off-target effect, 3R- tau was co-transfected with tau shRNA into E15 cortical neurons. 3R-tau successfully rescued tau shRNA-caused effect on netrin-induced axon branching (Fig. 19E, F, quantification in Fig. 19G). These results indicate that tau is required for Netrin-1-induced axon branching. Axon branching requires MT extension into newly formed branch (Kalil

& Dent, 2014). The reason that tau is required for axon branching is that tau promotes MT extension.

4.2.7 Tau Is Required for Netrin-1-Mediated Attraction of Spinal

Commissural Axons

Figure 20 The Involvement of Tau in Netrin-1-Mediated Spinal Commissural Axons

Turning

(A) Schematic diagram showing in vivo electroporation and a commissural axon turning assay. (B-I) Venus YFP only (B,C), Venus YFP plus control shRNA (D,E), Venus YFP plus tau shRNA (F, G) or Venus YFP plus tau shRNA and 3R-tau (H, I) were electroporated into chick neural tubes at stage 18-20. The spinal cord was harvested at stage 23 and explants were co-cultured with HEK cells stably secreting Netrin-1 or control HEK cells.

(G) Quantification of percentage of axons turning to Netrin-1 source. Data are mean ±

S.E.M. from three separate experiments. (one way ANOVA with Tukey’s test for post-hoc comparisons). *** indicates p<0.001. Scale bar: 100 μm.

To determine whether tau is required for commissural axon projection towards

Netrin-1, an open-book assay was performed as illustrated in Fig. 20A. The Venus YFP construct only or together with control shRNA, tau shRNA, or tau shRNA plus 3R-tau were electroporated into the chick neural tubes at stage HH12-17 and then YFP-labeled neural tubes were isolated at stage 18-20. Neural tubes explants were cultured with an aggregate of HEK293 cells or HEK293 cells that stably secreted Netrin-1 for 24 h (Fig.

20A). For Venus only group, 80.7% ± 1.6% of commissural axons turned towards cell aggregates of Netrin-1 source (Fig. 20C, quantification in Fig. 20L), whereas 3.7% ± 0.7% of axons turned towards control cell aggregate of HEK293 cells (Fig. 20B, quantification in Fig. 20L). For control shRNA group, 80.3% ± 2.7% of commissural axons turned towards Netrin-1 cell aggregates (Fig. 20E, quantification in Fig. 20L), whereas 4.5% ±

0.7% of axons turned towards control cell aggregate of HEK293 cells (Fig. 20D, quantification in Fig. 20L). However, tau shRNA disrupted turning process: 9.7 ± 0.9% of electroporated axons turned towards the Netrin-1 aggregate (Fig. 20F, quantification in

Fig. 20L). More importantly, 78.7 ± 1.3% of 3R-tau rescued axons turning towards Netrin-

1. These results demonstrate that tau is required for Netrin-1-mediated commissural axon attraction. Axon turning requires dynamic MT extension and tau promotes MT extension, which could explain the necessity of tau in netrin-1 mediated turning.

4.2.8 Tau Is Required for Spinal Cord Commissural Axon Projection in vivo

Figure 21 Tau Is Required for Spinal Cord Commissural Axon Projection in vivo (A) Diagram shows the transverse section of the chick spinal cord after electroporation.

(B-E) The chick neural tubes were electroporated with Venus YFP only (B), Venus YFP plus control shRNA (C), Venus YFP plus tau shRNA (D), Venus YFP plus tau shRNA and

3R-tau (E), respectively. Tau shRNA inhibited commissural axons extension. 3R-tau rescued the defect caused by tau shRNA knockdown. (F) Quantification of the percentage of axons reaching the midline. The numbers of embryos tested were: 10 for Venus YFP only group, 10 for control shRNA group, 12 for tau shRNA, and 12 for 3R-tau rescue group. ***p<0.001. Scale bar: 100 μm.

To further investigate whether tau is required for axon projection in vivo, commissural axon trajectories in the developing chick spinal cord are assessed (Liu et al.,

2007; Liu et al., 2009). The Venus YFP construct only or together with control shRNA, tau shRNA, or tau shRNA plus 3R-tau constructs were electroporated into the chick neural tubes at stage HH 12-15. Chick spinal cords with YFP fluorescence were collected at stage

23 and transverse sections of the spinal cord were conducted (Fig. 21A). 96.7± 0.85% of

Venus only-transfected (Fig. 21B, quantification in Fig. 21F) and 96.8% ± 0.96% of control shRNA transfected (Fig. 21C, quantification in Fig. 21F) commissural axons reached the midline, whereas only 7.9% ± 2.1% of tau shRNA-transfected (Fig. 21D, quantification in

Fig. 21F) commissural axons reached the midline. But, 97.3%± 0.84% of tau shRNA plus

3R-tau -transfected commissural axons reached the midline, indicating expression of 3R- tau only was sufficient to rescue tau shRNA knockdown defects (Fig. 21E, quantification in Fig. 21F). These data indicates that tau is required for the projection of the commissural axons in vivo in the developing spinal cord. The projection of commissural axons to midline requires coordination of guidance cues secreted along the trajectory of axons, and Netrin gradient around the midline is required for axon projection (Serafini et al., 1996).

Specifically, Netrin-1 knockout from the ventricular zone around the midline caused the defects of commissural axons projection (Dominici C. et al., 2017). Combined with commissural axon turning in vitro (Fig. 20), this experiment further proves that tau is required for axon turning process.

Chapter 5 Discussion

Discussion

5.1 TUBB3 Mutations Disrupt Netrin Signaling

5.1.1 TUBB3 Missense Mutations Interfere with the Interaction of

DCC with Polymerized TUBB3 in Netrin-1 signaling

Netrins, as guidance cues, play a key role in the developing nervous system. Our previous results show that TUBB3 directly links Netrin-1/DCC signaling to MT dynamics and is essential for Netrin-1-induced axon outgrowth, branching and attraction in vitro and spinal cord commissural axons projection in ovo (Huang et al., 2015; Qu et al, 2013).

TUBB3 interacts directly with DCC and Netrin-1 induces this interaction in primary neurons (Qu et al., 2013). To find out whether the disease-associated missense mutations in human TUBB3 gene interfere with this interaction, a co-IP assay was performed and results demonstrated that the interaction of DCC with eight out of twelve TUBB3 mutants was reduced compared to the wild type TUBB3, suggesting that TUBB3 mutations may

83 disrupt the interaction with DCC (Fig. 6). As expected, DCC partially overlapped with

TUBB3 in the periphery region of the growth cone (Fig. 7A-C) (Qu et al., 2013). However, neither R262C nor A302V, two common mutant substitutions associated with TUBB3 syndromes (Poirier et al., 2010; Tischfield et al., 2010), colocalized with DCC. In primary neurons, Netrin-1 significantly induced the interaction of endogenous DCC with wild type

TUBB3, but not R262C and A302V (Fig. 8). MT cosedimentation assay results demonstrated that DCC failed to interact with MTs containing polymerized R262C and

A302V (Fig. 9). Expression of these mutants also blocks Netrin-1- induced interaction of

DCC with stabilized MTs compared to the wild type TUBB3 (Fig. 9). But, Netrin-1 can still promote R262C and A302V to polymerize into MTs (Fig. 9C-F). Taken together, these data imply that TUBB3 mutations may disturb the coupling of Netrin/DCC signaling with

MT dynamics in the developing neurons.

5.1.2 TUBB3 Mutations Impair Netrin-1-Mediated Axon Outgrowth,

Branching and Attraction in vitro and in vivo.

Although TUBB3 is exclusively expressed in all neurons in the developing nervous system, human TUBB3 missense mutations are related with specific axon projection defects, such as impaired commissural axon guidance (Poirier K, 2010; Tischfield, 2010).

To further clarify whether TUBB3 mutations specifically disrupt Netrin signaling, the functional roles of R262C and A302V were studied by both in vitro and in vivo experiments.

Our recent works show that TUBB3 shRNAs blocks Netrin-1-induced axon outgrowth (Fig.

10) and branching (Fig. 11) of cortical neurons. Expression of the wild-type TUBB3, but not R262C or A302V, rescues the defects of TUBB3 knockdown on Netrin-1-induced axon outgrowth and branching(Fig. 10, 11). Expression of either R262C or A302V inhibits chick

84 commissural axon turning to Netrin-1 source (Fig. 14). The in vivo studies with the chick spinal cord showed that expression of R262C or A302V, but not wild type TUBB3, caused shortened and misguided commissural axons (Fig. 13), which is similar to defects of spinal cord commissural axon projection observed in either Netrin-1-/- or DCC-/- mice (Dominici et al., 2017; Fazeli et al., 1997; Serafini et al., 1996; Varadarajan et al., 2017). These results suggest that missense TUBB3 mutations may disrupt Netrin-1-mediated axon outgrowth, branching, attraction and commissural axon projection in the developing spinal cord.

5.1.3. Potential Roles of TUBB3 Mutations in the Signaling Pathways

Downstream of Netrin-1 and Other Guidance Cues

Previous studies have shown that DCC collaborates with DSCAM to mediate

Netrin-1-induced axon outgrowth and attraction (Andrews et al., 2008; Liu et al., 2009; Ly et al., 2008), whereas interaction of UNC5 with DCC or DSCAM promotes axon repulsion

( Finger et al., 2002; Hong et al., 1999; Purohit et al., 2012). Our recent study shows that coordinated interaction of DCC and DSCAM with TUBB3 mediates axon branching induced by Netrin-1 (Huang et al., 2015). UNC5C also interacts with TUBB3 and uncoupling of UNC5C with polymerized TUBB3 in MTs mediates Netrin-1 repulsion

(Shao et al., 2017). It is essential to clarify whether TUBB3 mutations affect their binding to DSCAM and/or UNC5C, and whether these mutants disrupt the coordination of DCC,

DSCAM and UNC5C on modulation of MT dynamics in Netrin-1 signaling. It needs to be addressed whether the interaction of DCC with polymerized TUBB3 in MTs may function as a signaling platform recruiting downstream signaling molecules in Netrin-1-mediated attraction, and whether TUBB3 mutations interfere with the formation of the signaling complex downstream of Netrin/DCC signaling. Substantial extracellular guidance

85 molecules including guidance cues, growth factors, and cell adhesion molecules, are implicated in guiding growth cone navigation through modulation of cytoskeleton dynamics including filamentous actin and MTs (Dent et al., 2011; Guan & Rao, 2003;

Kolodkin & Tessier-Lavigne, 2011; Stoeckli & Zou, 2009; Vitriol & Zheng, 2012).

Commissural axon projections are guided by various guidance cues such as slits (Zou et al., 2000), Sonic hedgehog (Charron et al., 2003), Wnt4 (Lyuksyutova et al., 2003). Our data indicate that TUBB3 mutations E205K, M388V, R62Q and E410K do not affect interaction with DCC, while other eight TUBB3 mutants reveal reduced interaction with

DCC (Fig. 6). In view of the phenotypic heterogeneity of TUBB3 mutations, it is worth further investigating the roles of TUBB3 mutations in these guidance cues signaling.

5.2 Tau Is Involved in Netrin-1 signaling

Tau, the major neuronal MAPs, promotes MT assembly and stabilizes the MTs. By mRNA alternative splicing, six tau protein isoforms have been identified (Goedert et al.,

1989). In mouse brain, expression levels of tau isoforms are regulated as brain develops,

4R-tau, a four MT binding repeats-containing isoform, is the major isoform in the adult mouse brain. In contrast, 3R-tau is the major isoform in the early embryo stage (McMillan et al, 2008).Our study indicates that tau interacts with DCC and is required in Netrin-1- induced axon outgrowth, branching and turning in the developing nervous system.

5.2.1 The Interaction of Tau with Netrin-1 Receptor DCC

Recent studies demonstrate that MTs play an instructive role in responding to extracellular guidance cues. Our studies show that MT subunit component protein TUBB3 directly interacts with Netrin-1 receptor DCC and DSCAM, and their interaction could be

86 further induced by Netrin. More importantly, TUBB3 is required in Netrin-1-induced neurite outgrowth, branching and attraction. All these results suggest that MT dynamics is directly involved in Netrin-1-induced axon guidance.

Tau binds to MTs and regulates MT dynamics. However, it is not clear whether tau is directly implicated in Netrin-1 signaling. In this study, we have found that tau interacts with DCC and Netrin-1 induces this interaction in primary neurons. Specifically, the DCC

P1 domain and tau projection domain mediate their interaction. Additionally, Netrin-1 induces colocalization of tau and DCC in the growth cone of primary neurons. These data suggest that Netrin stimulation induces the interaction of tau and DCC. However, it still needs to be determined whether their interaction is dependent on the presence of TUBB3.

Also it is not determined that whether MT dynamics is required for the interaction of DCC and tau.

5.2.2 Tau Phosphorylation Is Involved in Netrin-1 Signaling

Tau protein possess multiple phosphorylation sites at tyrosine, threonine and serine residues that could be phosphorylated by different kinases. Tau is more heavily phosphorylated in fetal than in adult brains. Netrin-1 stimulation induces the phosphorylation of tau on serine, threonine and tyrosine. Previous studies showed that

Netrin-1 activated Src family kinases (Liu et al., 2004), JNK-1 (Qu et al., 2013), and GSK-

3 beta (Del Río et al., 2004). These kinases could phosphorylate tau on different sites, for instance, tau is shown to be phosphorylated by Src family kinase Fyn at Tyr 18 (Scales et al., 2011); JNK phosphorylates tau at S202/T205 and S422 (Ploia et al., 2011); GSK-3β has been shown to phosphorylate tau at sites of ser199, ser202, ser235, ser396 and ser404 in vitro (Sperber et al., 1995).GSK3 phosphorylates tau at T181, S199, T212, S396 and

S404 in neurodegenerative pathological condition (Rankin, Sun, & Gamblin, 2007). Due to the weakness of co-IP assay, we cannot conclude that Netrin-1 induces the phosphorylation of tau. Using specific phosphor-tau antibodies will determine which sites are phosphorylated under Netrin-1 stimulation and whether these kinases are involved.

Blocking the activities of JNK, GSK-3 and Src family kinases results in the reduced Netrin-

1-induced interaction of tau and DCC, suggesting that the activities of these kinases are required for the interaction between tau and DCC. These kinases could contribute to the

DCC/ tau interaction through directly phosphorylating tau, or through regulating other protein activities which impact on tau.

5.2.3 Tau Is Required in Netrin-1-Mediated Axon Outgrowth,

Branching and Axon Guidance

MTs, as a scaffolding, provides the structural basis for axon and growth cone reshaping. Netrin interacts with its receptors to directly or indirectly regulate MT dynamics.

To elaborate the functional role of tau in Netrin-1-mediated neuronal development, tau is studied in Netrin-1-mediated neurite outgrowth, branching, and attraction in vitro and in vivo. Tau shRNA inhibits axon outgrowth (Fig. 18) and branching (Fig. 19) of cortical neurons compared to the control shRNA. 3R-tau is sufficient to rescue tau shRNA-caused defects, as 3R-tau is major isoform in the developing fetal stage. Tau shRNA inhibits

Netrin-1-mediated chick commissural axon attraction in the open-book turning assay (Fig.

20). The in vivo studies of chick commissural axon projection demonstrates that tau shRNA causes the failure of commissural axons to reach the floor plate (Fig. 21), similar to the defects observed in the Netrin-1 knock out mice. These data suggest that tau is required in

Netrin-1-mediated axon outgrowth, branching and attraction, as well as commissural axons projection and pathfinding in the developing spinal cord.

Hypothesized Models

Neurite outgrowth and axon branching require MTs transporting the organelles to newly formed membrane protrusion and then consolidating the newly formed protrusion

(Goldberg & Burmeister, 1986; Gallo, 2011). Axon turning is a process that the growth cone navigates and looks for guidance cues. Once the receptors on the membrane of the growth cone encounter guidance cues, the intracellular signaling is initiated to facilitate the turning process. The turning process is realized by the formation of new lamellipodia and filopodia on one side of the cell membrane, which also depends on the MTs extension to the filopodia (Forscher & Smith, 1998). TUBB3 mutants-containing MTs hardly interact with DCC, and rarely distribute in the periphery region of the growth cone, thus disrupting the MTs-dependent formation of protrusion and filopodia, leading to the failure of Netrin-

1-induced neurite outgrowth, branching and turning (Fig. 22). Tau stabilizes MTs and promotes MTs extension. Upon Netrin-1 stimulation, the interaction of Netrin-1 and DCC recruits tau. We assume that tau could bring MTs to the cell membrane, which will contribute to the formation of neurite, branching points and filopodia in the growth cone.

Thus tau is required for Netrin-1-induced neurite outgrowth, axon branching and turning.

(Fig. 23).

Figure 22 Hypothesized Model for TUBB3 Mutations disrupting Netrin-1-Mediated

Neuronal Development. (A) Without Netrin-1 stimulation, monomer DCC is present on the cell membrane of the growth cone, and unpolymerized tubulins distribute in the growth cone. (B) Netrin-1 stimulation promotes the interaction of dimerized DCC with polymerized TUBB3 (Qu et al, 2013), and promotes MTs polymerization which then contributes to the formation of new protrusion that is essential for neurite outgrowth, branching and filopodia formation. (C) TUBB3 mutants-containing MTs lose the ability to interact with DCC, and also TUBB3 mutants-containing MTs are located in the region away from cell membrane and hardly interact with DCC. Based on the data, we postulate that TUBB3 mutants alter the MT dynamics and properties, leading to the failure of Netrin-

1-mediated neurite outgrowth, branches and pathfinding.

Figure 23 Hypothesized Model for the Involvement of Tau in Netrin Signaling (A) Without Netrin-1 stimulation, unpolymerized tubulin dimer and free tau are not recruited to the monomer DCC. (B) Netrin-1 stimulation activates JNK, GSK-3 and Src family kinases, which are important for the interaction of DCC and tau. The interaction of tau with DCC facilitates the transportation of tau-bound MTs to the cell membrane, and also tau promotes MT polymerization. The newly polymerized MTs close to the cell membrane consolidate the newly formed protrusion on cell membrane. The consolidation of a newly formed protrusion is essential for neurite outgrowth, axon branching, and growth cone turning. Whether JNK, GSK-3 and Src family kinases directly phosphorylate tau needs to be further determined.

References

Akhmanova, A., & Steinmetz, M. (2008). Tracking the ends: a dynamic protein network controls the fate of microtubule tips. Nat Rev Mol Cell Biol., 9(4):309-22.

Alexander, J. E., Hunt, D. F., Lee, M. K., Shabanowitz, J., Michel, H., Berlin, S. C., . . . Frankfurter, A. (1991). Characterization of posttranslational modifications in neuron-specific class III beta-tubulin by mass spectrometry. Proc. Nadl. Acad. Sci. USA, Vol. 88, pp. 4685-4689.

Andrews, G., Tanglao, S., Farmer, W., Morin, S., Brotman, S., Berberoglu, M., . . . Charron, F. (2008). Dscam guides embryonic axons by Netrin dependent and - independent functions. Development, 135, 3839-3848.

Anthony, P. B., Brendan, N. L., Albert, P., Lisa, J. P., & Franck, P. (2007). LKB1 and SAD Kinases Define a Pathway Required for the Polarization of Cortical Neurons. cell, Volume 129, Issue 3, Pages 549–563.

Arakawa, H. (2004). Netrin-1 and its receptors in tumorigenesis. Nature Reviews Cancer, 978-987 .

Avila, J., Lucas, J. J., Perez, M., & Hernandez, F. (2004). Role of tau protein in both physiological and pathological conditions. Physiological Reviews, vol. 84, pp. 361– 384.

Bagrodia, S., & Cerione, R. A. (1999). Pak to the future. Trends Cell Biol., 9, 350-355.

Beggs, H., Soriano, P., & Maness, P. (1994). NCAM-dependent neurite outgrowth is inhibited in neurons from fyn-minus mice. J. Cell Biol., 127 (1994), pp. 825-833.

Berg, J., Tymoczko, J., & Stryer, L. (2002). Biochemistry. 5th edition. New York: W H Freeman.

Bhaskar, K., Yen, S., & Lee, G. (2008). Disease-related modifications in tau affect the interaction between Fyn and Tau. J Biol Chem, 280:35119-35125. doi:10.1074/jbc.M505895200.

Bode, A., & Dong, Z. (2007). The functional contrariety of JNK. Mol. Carcinog., 46 (8): 591–8.

Bouhidel, J., Wang, P., Siu, K., Li, H., Youn, J., & Cai, H. (2015). Netrin-1 improves post- injury cardiac function in vivo via DCC/NO-dependent preservation of mitochondrial integrity, while attenuating autophagy. Biochim Biophys Acta. , 1852(2):277-89. .

Brandt, R., Léger, J., & Lee, G. (1995). Interaction of tau with the neural plasma membrane mediated by tau's amino-terminal projection domain. J Cell Biol, 131: 1327-1340. doi:10.1083/jcb.131.5.1327.

Brinkley, B. (1985). Microtubule Organizing Centers. Annual Review of Cell Biology, 1: 145–172. .

Buck, K., & Zheng, J. (2002). Growth cone turning induced by direct local modification of microtubule dynamics. J Neurosci, 22: 9358–9367.

Cáceres, A., Ye, B., & Dotti, G. D. (2012). Neuronal polarity: demarcation, growth and commitment. Current Opinion in Cell Biology, Volume 24, Issue 4, August 2012, Pages 547-553.

Chan, S., Zheng, H., Su, M., Wilk, R., Killeen, M., Hedgecock, E., & Culotti, J. (1996). UNC-40, a C. elegans homolog of DCC (Deleted in Colorectal Cancer), is required in motile cells responding to UNC-6 netrin cues. Cell, 87(2):187-95.

Chang, L., Jones, Y., Ellisman, M., Goldstein, L., & Karin, M. (2003). JNK1 Is Required for Maintenance of Neuronal Microtubules and Controls Phosphorylation of Microtubule-Associated Proteins. Developmental Cell, Volume 4, Issue 4, Pages 521-533.

Charron, F., Stein, E., Jeong, J., McMahon, A., & Tessier-Lavigne, M. (2003). The morphogen sonic hedgehog is an axonal chemoattractant that collaborates with netrin-1 in midline axon guidance. Cell, 113,11-23.

Chen, Y., & Wadsworth, W. G. (2004). Assembly and tissue functions of early embryonic laminins and netrins. Curr. Opin. Cell Biol., 16, 572-579.

Cheng, Y., Qiu, F., Tashiro, S.-i., Onodera, S., & Ikejima, T. (2008). ERK and JNK mediate TNFα-induced p53 activation in apoptotic and autophagic L929 cell death.

Biochemical and Biophysical Research Communications, Volume 376, Issue 3,, Pages 483-488.

Coffey, E. (2014). Nuclear and cytosolic JNK signalling in neurons. Nat Rev Neurosci., 15(5):285-99.

Cohen-Cory, S., & Fraser, S. (1995). Effects of brain-derived neurotrophic factor on optic axon branching and remodelling in vivo. Nature , 378:192–196.

Cooper, G. M. (2004). The Cell: A Molecular Approach. Washington D.C: ASM Press.

Del Río, J., González-Billault, C., Ureña, J., Jiménez, E., Barallobre, M., Pascual, M., . . . Soriano, E. (2004). MAP1B is required for Netrin 1 signaling in neuronal migration and axonal guidance. Curr Biol. , 14(10):840-50.

Dent, E. W., Barnes, A. M., Tang, F., & Kalil, K. (2004). Netrin-1 and Semaphorin 3A Promote or Inhibit Cortical Axon Branching, Respectively, by Reorganization of the Cytoskeleton. Journal of Neuroscience , 24 (12) 3002-3012.

Dent, E. W., Gupton, S. L., & Gertler, F. B. (2011). The Growth Cone Cytoskeleton in Axon Outgrowth and Guidance. Cold Spring Harb Perspect Biol., 3(3): a001800.

Dent, E., & Gertler, F. (2003). Cytoskeletal dynamics and transport in growth cone motility and axon guidance. Neuron, 40: 209–227.

Dent, E., & Kalil, K. (2001). Axon branching requires interactions between dynamic microtubules and actin filaments. J Neurosci, 21: 9757–9769.

Dent, E., Gupton, S., & Gertler, F. (2011). The growth cone cytoskeleton in axon outgrowth and guidance. Cold Spring Harbor perspectives in biology, 3(3).

Derkinderen, P., Scales, T., Hanger, D., Leung, K., Byers, H., Ward, M., . . . Anderton, B. (2005). Tyrosine 394 is phosphorylated in Alzheimer's paired helical filament tau and in fetal tau with c-Abl as the candidate tyrosine kinase. J Neurosci., 25(28):6584-93.

Dhanasekaran, D. N., & Reddy, P. E. (2008). JNK Signaling in Apoptosis. Oncogene., 27(48): 6245–6251.

Dominici, C., Moreno-Bravo, J., Puiggros, S., Rappeneau, Q., Rama, N., Vieugue, P., . . . Chedotal, A. (2017). Floor-plate-derived netrin-1 is dispensable for commissural axon guidance. Nature, 545, 350-354.

Erskinea, L., & Herrera, E. (2007). The retinal ganglion cell axon's journey: Insights into molecular mechanisms of axon guidance. Developmental Biology, Volume 308, Issue 1, Pages 1-14.

Fazeli, A., Dickinson, S., Hermiston, M., Tighe, R., Steen, R., Small, C., . . . Weinberg, R. (1997). Phenotype of mice lacking functional Deleted in colorectal cancer (Dcc) gene. Nature, 386(6627):796-804.

Fearon, E., Cho, K., Nigro, J., Kern, S., Simons, J., Ruppert, J., . . . Preisinger, A. (1990). l. Identification of a chromosome 18q gene that is altered in colorectal cancers. Science, 247, 49–56.

Finger, J., Bronson, R., Harris, B., Johnson, K., Przyborski, S., & Ackerman, S. (2002). The netrin 1 receptors Unc5h3 and Dcc are necessary at multiple choice points for the guidance ofcorticospinal tract axons. J Neurosci, 22, 10346-10356.

Flynn, K. C. (2013). The cytoskeleton and neurite initiation. Bioarchitecture. 3 (4): 86– 109. , 3 (4): 86–109. .

Forcet, C., Stein, E., Pays, L., Corset, V., Llambi, F., Tessier-Lavigne, M., & Mehlen, P. (2002). Netrin-1-mediated axon outgrowth requires deleted in colorectal cancer- dependent MAPK activation. Nature, 417, 443-447.

Forscher, P., & Smith, S. J. (1998). Actions of cytochalasins on the organization of actin filaments and microtubules in a neuronal growth cone. JCB, 107 (4): 1505.

Fothergill, T., Donahoo, A.-L. S., Douglass, A., Zalucki, O., Yuan, J., Shu, T., . . . Richards, L. J. (2014). Netrin-DCC Signaling Regulates Corpus Callosum Formation Through Attraction of Pioneering Axons and by Modulating Slit2-Mediated Repulsion. Cerebral Cortex, Volume 24, Issue 5,Pages 1138–1151.

Fuerst, P., Bruce, F., Tian, M., Wei, W., Elstrott, J., Feller, M., . . . Burgess, R. (2009). DSCAM and DSCAML1 function in self-avoidance in multiple cell types in the developing mouse retina. Neuron, 64(4):484-97. doi: 10.1016.

Gallo, G. (2011). The cytoskeletal and signaling mechanisms of axon collateral branching. Dev Neurobiol., 71(3):201-20. .

Gao, P., Sun, C., Zhou, X., DiCicco-Bloom, E., & Zhou, R. (2000). Ephrins stimulate or inhibit neurite outgrowth and survival as a function of neuronal cell type. J Neurosci Res. , 60(4):427-36.

Geisbrecht, B., Dowd, K., Barfield, R., Longo, P., & Leahy, D. (2003). Netrin Binds Discrete Subdomains of DCC and UNC5 and Mediates Interactions between DCC and Heparin. JBC, doi: 10.1074. 95

Geraldo, S., & Gordon-Weeks, P. R. (2009). Cytoskeletal dynamics in growth-cone steering. Journal of Cell Science, 122: 3595-3604.

Goedert, M., Spillantini, M., Jakes, R., Rutherford, D., & Crowther, R. (1989). Multiple isoforms of human microtubule-associated protein tau:sequences and localization in neurofibrillary tangles of Alzheimer's disease. Neuron, 3: 519-526. doi:10.1016/0896-6273(89)90210-9.

Goedert, M., Spillantini, M., Potier, M., Ulrich, J., & Crowther, R. (1989). Cloning and sequencing of the cDNA encoding an isoform of microtubule-associated protein tau containing four tandem repeats:differential expression of tau protein mRNAs in human brain. EMBO, J8: 393-399.

Goldberg, D., & Burmeister, D. (1986). Stages in axon formation: observations of growth of Aplysia axons in culture using video-enhanced contrast-differential interference contrast microscopy. J Cell Biol, 103: 1921–1931.

Guan, K., & Rao, Y. (2003). Signalling mechanisms mediating neuronal responses to guidance cues. Nat Rev Neurosci , 4, 941-956.

Hamburger, V., & Hamilton, H. (1951). A series of normal stages in the development of the chick embryo. Journal of Morphology, 88 (1): 49–92.

Hanger, D. P., Anderton, B. H., & Noble, W. (2009). Tau phosphorylation: the therapeutic challenge for neurodegenerative disease. Trends in Molecular Medicine, vol. 15, no. 3, pp. 112–119.

Harada, A., Oguchi, K., & Okabe, S. e. (1994). Altered microtubule organization in small- calibre axons of mice lacking tau protein. Nature, vol. 369, no. 6480, pp. 488–491, 1994.

Hedgecock, E. M., Culotti, J. G., & Hall, D. H. (1990). The unc-5, unc-6, and unc-40 genes guide circumferential migrations of pioneer axons and mesodermal cells on the epidermis in C. elegans. Neuron, 4, 61-85. doi:10.1016/0896-6273(90)90444-K.

Hibi, M., Lin, A., Smeal, T., Minden, A., & Karin, M. (1993). Identification of an oncoprotein- and UV-responsive protein kinase that binds and potentiates the c-Jun activation domain. Genes Dev., 7:2135–2148. .

Hong, K., Hinck, L., Nishiyama, M., Poo, M., Tessier-Lavigne, M., & Stein, E. (1999). A ligand-gated association between cytoplasmic domains of UNC5 and DCC family receptors converts netrin-induced growth cone attraction to repulsion. Cell, 927- 941.

Hong, K., Hinck, L., Nishiyama, M., Poo, M., Tessier-Lavigne, M., & Stein, E. (1999). A ligandgated association between cytoplasmic domains of UNC5 and DCC family receptors converts netrinuced growth cone attraction to repulsion. Cell, 97, 927- 941.

Hoyle, H., & Raff, E. (1990). Two Drosophila beta tubulin isoforms are not functionally equivalent. J Cell Biol. , 111(3):1009-26.

Huang, E. J., & Reichardt, L. F. (2001). Neurotrophins: Roles in Neuronal Development and Function. Annu Rev Neurosci., 24: 677–736.

Huang, H., Shao, Q., Qu, C., Yang, T., Dwyer, T., & Liu, G. (2015). Coordinated interaction of Down syndrome cell adhesion molecule and deleted in colorectal cancer with dynamic TUBB3 mediates Netrin-1-induced axon branching. Neuroscience, 293:109-22. doi: 10.1016.

Iqbal, K., Liu, F., Gong, C.-X., & Grundke-Iqbal, I. (2010). Tau in Alzheimer Disease and Related Tauopathies. Curr Alzheimer Res. , 7(8): 656–664.

Ittner, L., Ke, Y., Delerue, F., Bi, M., & Gladbach, A. (2000). Disease:function of tau mediates amyloid-beta toxicity in Alzheimer's disease mouse models. Cell, 142: 387-397. doi:10.1016/j.cell.2010.06.036.

Jiang, Y., & Oblinger, M. (1992). Differential regulation of beta III and other tubulin genes during peripheral and central neuron development. J. Cell Sci., 103 (1992), pp. 643–651.

Johnson, G., Jope, R., & Binder, L. (1989). Proteolysis of tau by calpain. Biochemical and Biophysical Research Communications, 163(3):1505–1511.

Jope, R., & Johnson, G. (2004). The glamour and gloom of glycogen synthase kinase-3. Trends Biochem Sci., 29 (2): 95–102.doi:10.1016/j.tibs.2003.12.004.

Jope, R., Yuskaitis, C., & Beurel, E. (2007). Glycogen synthase kinase-3 (GSK3): inflammation, diseases, and therapeutics. Neurochem Res., 32 (4–5): 577– 95.doi:10.1007/s11064-006-9128-5.

Kadavatha, H., Hofelea, R. V., & Zweckstetter, M. (2015). Tau stabilizes microtubules by binding at the interface between tubulin heterodimers. PNAS, vol. 112:7501–7506.

Kalil, K., & Dent, E. W. (2014). Branch management: mechanisms of axon branching in the developing vertebrate CNS. Nat Rev Neurosci. , 15(1): 7–18.

Katsetos, C., Legido, A., Perentes, E., & Mork, S. (2003). Class III beta-tubulin isotype: a key cytoskeletal protein at the crossroads of developmental neurobiology and tumor neuropathology. J. Child Neurol., pp. 851–866.

Kaufmann, N., Wills, Z., & Van, V. D. (1998). Drosophila Rac1 controls motor axon guidance. . Development , 125: 453–461.

Keino-Masu, K., Masu, M., Hinck, L., Leonardo, E., Chan, S., Culotti, J., & Tessier- Lavigne, M. (1996). Deleted in colorectal cancer (DCC) encodes a netrin receptor. Cell, 87, 175–185.

Kennedy, T., Serafini, T., Torre, J., & Tessier-Lavigne, M. (1994). Netrins are diffusible chemotropic factors for commissural axons in the embryonic spinal cord. Cell, 78:425-435.

Kimble, M., Dettman, R., & Raff, E. (1990). The beta 3-tubulin gene of Drosophila melanogaster is essential for viability and fertility. Genetics. , 126(4):991-1005.

Klein, C., Kramer, E., Cardine, A., Schraven, B., Brandt, R., & Trotter, J. (2002). Process outgrowth of oligodendrocytes is promoted by interaction of fyn kinase with the cytoskeletal protein tau. J. Neurosci., 22 (2002), pp. 698-707.

Kolodkin, A., & Tessier-Lavigne, M. (2011). Mechanisms and molecules of neuronal wiring: a primer. Cold Spring Harbor perspectives in biology 3.

Kolodziej, P., Timpe, L., Mitchell, K., Fried, S., Goodman, C., Jan, L., & Jan, Y. (1996 ). frazzled encodes a Drosophila member of the DCC immunoglobulin subfamily and is required for CNS and motor axon guidance. Cell, 87(2):197-204.

Kruger R. P., L. J. (2004). Mapping netrin receptor binding reveals domains of Unc5 regulating its tyrosine phosphorylation. J. Neurosci. , 24, 10826-10834. .

Kucinski, I., Dinan, M., Kolahgar, G., & Piddini, E. (2017). Chronic activation of JNK JAK/STAT and oxidative stress signalling causes the loser cell status. Nature Communications, 8, Article number: 136 (2017).

Lai, K., Sun, W., Correia, J. P., & Kennedy, T. E. (2011). Netrins: versatile extracellular cues with diverse functions. Development, 138: 2153-2169.

Lee, G. (2005). Tau and src family tyrosine kinases. Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease, Volume 1739, Issues 2–3, 3 Pages 323-330.

Lee, G., Newman, S., Gard, D., Band, H., & Panchamoorthy, G. (1998). Tau interacts with src-family non-receptor tyrosine kinases. J Cell Sci, 111:3167-3177.

Lee, G., Thangavel, R., Sharma, V., Litersky, J., & Bhaskar, K. (2004). Phosphorylation of tau by fyn: implications for Alzheimer's disease. J Neurosci, 24: 2304-2312. doi:10.1523/JNEUROSCI.4162-03.2004.

Lee, M., Tuttle, J., Rebhun, L., Cleveland, D., & Frankfurter, A. (1990). The expression and posttranslational modification of a neuron-specific beta-tubulin isotype during chick embryogenesis. Cell Motil Cytoskeleton., 17(2):118-32.

Lesort, M., Jope, R., & Johnson, G. (1999). Insulin transiently increases tau phosphorylation: involvement of glycogen synthase kinase-3 beta and fyn tyrosine kinase. J. Neurochem., 72 (1999), pp. 576-584.

Leung-Hagesteijn, C., Spence, A., Stern, B., Zhou, Y., Su, E., & Culotti, J. (1992). UNC- 5, a transmembrane protein with immunoglobulin and thrombospondin type 1 domains, guides cell and pioneer axon migrations in C. elegans. Cell, 71:289–299.

Li, C., & Götz, J. (2017). Tau-based therapies in neurodegeneration: opportunities and challenges. Nat Rev Drug Discov., doi: 10.1038/nrd.2017.155.

Li, W., Lee, J., Vikis, H. G., Lee, S. H., Liu, G., Aurandt, J., . . . Han, M. (2004). Activation of FAK and Src are receptor-proximal events required for netrin signaling. Nat. Neurosci., 7, 1213-1221.

Li, W., Lee, J., Vikis, H. G., Lee, S.-H., Liu, G., Aurandt, J., . . . Guan, K.-L. (2004). Activation of FAK and Src are receptor-proximal events required for netrin signaling. Nat Neurosci. , 7(11): 1213–1221.

Li, W., Lee, J., Vikis, H., Lee, S., Liu, G., Aurandt, J., . . . Guan, K. (2004). Activation of FAK and Src are receptor-proximal events required for netrin signaling. Nat Neurosci., 7(11):1213-21. Epub 2004 Oct 17.

Li, X., Gao, X., Liu, G., Xiong, W., Wu, J., & Rao, Y. (2008). Netrin signal transduction and the guanine nucleotide exchange factor DOCK180 in attractive signaling. Nature Neuroscience , 11, 28–35.

Li, X., Saint-Cyr-Proulx, E., Aktories, K., & Lamarche-Vane, N. (2002). Rac1 and Cdc42 but not RhoA or Rho kinase activities are required for neurite outgrowth induced by the Netrin-1 receptor DCC (deleted in colorectal cancer) in N1E-115 neuroblastoma cells. J Biol Chem. , 277(17):15207-14. .

Lin, C., & Forscher, P. (1995). Growth cone advance is inversely proportional to retrograde F-actin flow. Neuron, 14: 763–771.

Lin, C., EM, E., Mooseker, M., & Forscher, P. (1996). Myosin drives retrograde F-actin flow in neuronal growth cones. Neuron, 16: 769–782. 99

Linse, K., & Mandelkow, E. (1988). The GTP-binding Peptide of Tubulin. Localization by Direct Photoaffinity Labeling and Comparison with Nucleotide-binding Proteins. J Biol Chem , 263:15205-15210. .

Littauer, U., Giveon, D., Thierauf, M., Ginzburg, I., & Ponstingl, H. (1986). Common and distinct tubulin binding sites for microtubule-associated proteins. Proc Natl Acad Sci U S A, 83(19):7162-6.

Liu, G., & Dwyer, T. (2014). Microtubule dynamics in axon guidance. Neuroscience Bulletin, Volume 30, Issue 4, pp 569–583.

Liu, G., Beggs, H., Jürgensen, C., Park, H.-T., Tang, H., Gorski, J., . . . Rao, J. W. (2004). Netrin requires focal adhesion kinase and Src family kinases for axon outgrowth and attraction. Nat Neurosci., Nov; 7(11): 1222–1232.

Liu, G., Li, W., Wang, L., Kar, A., Guan, K., Rao, Y., & Wu, J. (2009). DSCAM functions as a netrin receptor in commissural axon pathfinding. Proc Natl Acad Sci U S A, 106, 2951-2956.

Liu, G., Lib, W., Wanga, L., Kara, A., Guanb, K.-L., Rao, Y., & Wu, a. J. (2008). DSCAM functions as a netrin receptor in commissural axon pathfinding. PNAS, 2951–2956.

Lodish, H., Berk, A., & Zipursky, S. e. (2000). Molecular Cell Biology. 4th edition. New York: W. H. Freeman.

Lopez-Bergami, P., & Ronai, Z. (2008). Requirements for PKC-augmented JNK activation by MKK4/7. The International Journal of Biochemistry & Cell Biology, Volume 40, Issue 5, Pages 1055-1064.

Lu, Y., Belin, S., & He, Z. (2014). Signaling regulations of neuronal regenerative ability. Curr Opin Neurobiol., 27:135-42.

Lv, J., Sun, X., Ma, J., Ma, X.-l., Zhang, Y., Li, F., . . . Zhao, Z. (2015). Netrin-1 induces the migration of Schwann cells via p38 MAPK and PI3K-Akt signaling pathway mediated by the UNC5B receptor. Biochem Biophys Res Commun., 464(1):263- 8;464(1):263-8.

Ly, A., Nikolaev, A., Suresh, G., Zheng, Y., Tessier-Lavigne, M., & Stein, E. (2008). DSCAM is a netrin receptor that collaborates with DCC in mediating turning responses to netrin-1. Cell, 133, 1241-1254.

Lyuksyutova, A., Lu, C.-C., Milanesio, N., King, L., Guo, N., Wang, Y., . . . Zou, Y. (2003). Anterior-posterior guidance of commissural axons by Wnt-frizzled signaling. Science , 302, 1984-1988.

100

Ma, W., Shang, Y., Wei, Z., Wen, W., Wang, W., & Zhang, M. (2010). Phosphorylation of DCC by ERK2 Is Facilitated by Direct Docking of the Receptor P1 Domain to the Kinase. Structure, 1502-1511.

Maas, T., Eidenmüller, J., & Brandt, R. (2000). Interaction of tau with the neural membrane cortex is regulated by phosphorylation at sites that are modified in paired helical filaments. J Biol Chem, 275: 15733-15740.doi:10.1074/jbc.M000389200.

Maccioni, R., & Cambiazo, V. (1995). Role of microtubule-associated proteins in the control of microtubule assembly. Physiol Rev, 75(4):835-64.

Maness, P., Aubry, M., Shores, C., Frame, L., & Pfenninger, K. (1998). C-src gene product in developing rat brain is enriched in nerve growth cone membranes. Proc. Natl. Acad. Sci., 85 (1988), pp. 5001-5005.

Marillat, V., Sabatier, C., Failli, V., Matsunaga, E., Sotelo, C., Tessier-Lavigne, M., & Chédotal, A. (2004). The Slit Receptor Rig-1/Robo3 Controls Midline Crossing by Hindbrain Precerebellar Neurons and Axons. Neuron, Volume 43, Issue 1, Pages 69–79.

Marsh, L., & Letourneau, P. (1984). Growth of neurites without filopodial or lamellipodial activity in the presence of cytochalasin B. J Cell Biol, 99: 2041–2047. .

Marsick, B., Flynn, K., M, S.-M., Bamburg, J., & Letourneau, P. (2010). Activation of ADF/cofilin mediates attractive growth cone turning toward nerve growth factor and netrin-1. Dev Neurobiol , 70: 565–588.

Matsumoto, H., & Nagashima, M. (2017). Shift in the function of netrin-1 from axon outgrowth to axon branching in developing cerebral cortical neurons. BMC Neurosci. , 18(1):74.

McMillan, P., Korvatska, E., Poorkaj, P., Evstafjeva, Z., & Robinson, L. (2008). Tau isoform regulation is region- and cell-specific in mouse brain. J Comp Neurol, 511: 788-803. doi:10.1002/cne.21867.

McVicker, D. P., Millette, M. M., & Dent, E. W. (2015). Signaling to the microtubule cytoskeleton: An unconventional role for CaMKII. Dev Neurobiol. , 75(4): 423– 434.

Medeiros, N., Burnette, D., & Forscher, P. (2006). Myosin II functions in actin-bundle turnover in neuronal growth cones. . Nat Cell Biol, 8: 215–226.

Medina, M., Garrido, J., & Wandosell, F. G. (2011). Modulation of GSK-3 as a Therapeutic Strategy on Tau Pathologies. Frontiers in Molecular Neuroscience, 4, 24.

101

Mehlen, P., & Llambi, F. (2005). Role of netrin-1 and netrin-1 dependence receptors in colorectal cancers. British Journal of Cancer, 93, 1–6.

Meriane, M., Tcherkezian, J., Webber, C. A., Danek, E. I., Triki, I., & McFarlane, S. ….- V. (2004). Phosphorylation of DCC by Fyn mediates Netrin-1 signaling in growth cone guidance. J Cell Biol., 167(4): 687–698.

Myers, K. A., Tint, I., Nadar, C. V., He, Y., Black, M. M., & Baas, P. W. (2006). Antagonistic forces generated by cytoplasmic dynein and myosin-II during growth cone turning and axonal retraction. Traffic, 7, 1333-1351.

Nakagawa, H., Koyama, K., Murata, Y., Morito, M., Akiyama, T., & Nakamura, Y. (2000). EB3, a novel member of the EB1 family preferentially expressed in the central nervous system, bindsto a CNS-specific APC homologue. . Oncogene , 19:210-216.

Neve, R., Harris, P., Kosik, K., Kurnit, D., & Donlon, T. (1986). Identification of cDNA clones for the human microtubule-associated protein tau and chromosomal localization of the genes for tau and microtubule-associated protein 2. Brain Res., 271-280.

Nguyen, A., & Cai, H. (2006). Netrin-1 induces angiogenesis via a DCC-dependent ERK1/2-eNOS feed-forward mechanism. Proc Natl Acad Sci U S A, 103(17): 6530- 5.

Niclou, S., Franssen, E., Ehlert, E., Taniguchi, M., & Verhaagen, J. (2003). Meningeal cell- derived semaphorin 3A inhibits neurite outgrowth. Mol Cell Neurosci. , 24(4):902- 12.

Nikolopoulos, S. N., & Giancotti, F. G. (2005). Netrin-integrin signaling in epithelial morphogenesis, axon guidance and vascular patterning. Cell Cycle , 4, e131-e135.

Ori-McKenney, K., Jan, L., & Jan, Y. (2012). Golgi outposts shape dendrite morphology by functioning as sites of acentrosomal microtubule nucleation in neurons. Neuron, 76 (2012), pp. 921-930.

Panda, D., Miller, H., Banerjee, A., Luduena, R., & Wilson, L. (1994). Microtubule dynamics in vitro are regulated by the tubulin isotype composition. Proc. Natl. Acad. Sci., 91 (1994), pp. 11358–11362.

Panda, D., Samuel, J., Massie, M., Feinstein, S., & Wilson, L. (2003). Differential regulation of microtubule dynamics by three- and four repeat tau: implications for the onset of neurodegenerative disease. Proc Natl Acad Sci, 100: 9548-9553. doi:10.1073.

102

Parsons, S., & Parsons, J. (2004). Src family kinases, key regulators of signal transduction. Oncogene, 23 (48): 7906–9.doi:10.1038/sj.onc.1208160.

Pasterkamp, R. J., Peschon, J. J., Spriggs, M. K., & Kolodkin, A. L. (2003). Semaphorin 7A promotes axon outgrowth through integrins and MAPKs. Nature, 424, 398– 405.

Patricia, T., & Frédéric, C. (2013). Signaling mechanisms of non-conventional axon guidance cues: the Shh, BMP and Wnt morphogens. Current Opinion in Neurobiology, Pages 965-973.

Paul, L. K., Brown, W. S., Adolphs, R., Tyszka, J. M., Richards, L. J., Richards, P. M., & Sherr, E. H. (2007). Agenesis of the corpus callosum: genetic, developmental and functional aspects of connectivity. Nature Reviews Neuroscience, 8, 287-299.

Ploia, C., Antoniou, X., Sclip, A., Grande, V., Cardinetti, D., Colombo, A., . . . Borsello, T. (2011). JNK plays a key role in tau hyperphosphorylation in Alzheimer's disease models. J Alzheimers Dis., 26(2):315-29. doi: 10.3233/JAD-2011-110320.

Plooster, M., Menon, S., Winkle, C. C., Urbina, F. L., Monkiewicz, C., Phend, K. D., . . . Gupton, S. L. (2017). TRIM9-dependent ubiquitination of DCC constrains kinase signaling, exocytosis, and axon branching. Mol. Biol. Cell , 28:18 2374-2385; .

Poirier, K., Saillour, Y., Bahi-Buisson, N., Jaglin, X. H., Fallet-Bianco, C., Nabbout, R., & Chelly, J. (2010). Mutations in the neuronal β-tubulin subunit TUBB3 result in malformation of cortical development and neuronal migration defects. Hum Mol Genet., 19(22): 4462–4473.

Purohit, A., Li, W., Qu, C., Dwyer, T., Shao, Q., Guan, K., & Liu, G. (2012). Down syndrome cell adhesion molecule (DSCAM) associates with uncoordinated-5c (Unc5c) in Netrin-1-mediated growth cone collapse. J. Biol. Chem. , 27126–27138.

Qu, C., Dwyer, T., Shao, Q., Yang, T., Huang, H., & G., L. (2013). Direct binding of TUBB3 with DCC couples netrin-1 signaling to intracellular microtubule dynamics in axon outgrowth and guidance. J Cell Sci, doi: 10.1242.

Qu, C., Li, W., Shao, Q., T, D., Huang, H., Yang, T., & Liu, G. (2013). c-Jun N-terminal kinase 1 (JNK1) is required for coordination of netrin signaling in axon guidance. J Biol Chem., 288(3):1883-95.

Rankin, C. A., Sun, Q., & Gamblin, T. C. (2007). Tau phosphorylation by GSK-3β promotes tangle-like filament morphology. Molecular Neurodegeneration, 2:12.

103

Rodriguez, O. C., Schaefer, A. W., Mandato, C. A., Forscher, P., & Bement, W. M.-S. (2003). Conserved microtubule-actin interactions in cell movement and morphogenesis. Nat. Cell Biol., 5, 599-609.

Sabry, J., O'Connor, T., Evans, L., Toroian-Raymond, A., Kirschner, M., & Bentley, D. (1991). Microtubule behavior during guidance of pioneer neuron growth cones in situ. J Cell Biol, 115: 381–395.

Saman, S., Kim, W., & Raya, M. (2012). Exosome-associated tau is secreted in tauopathy models and is selectively phosphorylated in cerebrospinal fluid (CSF) in early Alzheimer's Disease. The Journal of Biological Chemistry., 287(6):3842–3849.

Scales, T., Derkinderen, P., Leung, K., Byers, H., Ward, M., Price, C., . . . Reynolds, C. (2011). Tyrosine phosphorylation of tau by the SRC family kinases lck and fyn. Molecular Neurodegeneration, 6:12.

Schaefer, A. W., Kabir, N., & Forscher, P. (2002). Filopodia and actin arcs guide the assembly and transport of two populations of microtubules with unique dynamic parameters in neuronal growth cones. J. Cell Biol., 158, 139-152.

Schmucker, D., Clemens, J., Shu, H., Worby, C., Xiao, J., Muda, M., . . . Zipursky, S. (2000). Drosophila Dscam is an axon guidance receptor exhibiting extraordinary molecular diversity. Cell, 101(6):671-84.

Serafini, T., Colamarino, S. A., Leonardo, E., Wang, H., Beddington, R., Skarnes, W. C., & Tessier-Lavigne, M. (1996). Netrin-1 Is Required for Commissural Axon Guidance in the Developing Vertebrate Nervous System. cell, Volume 87, Issue 6,Pages 1001–1014.

Serafini, T., Kennedy, T. E., Galko, M. J., Mirzayan, C., Jessell, T. M., & Tessler-Lavigne, M. (1994). The Netrins Define a Family of Axon Outgrowth-Promoting Proteins Homologous to C. elegans UNC-6. Cell, Vol. 79, 409-424.

Shao, Q., Yang, T., Huang, H., Alarmanazi, F., & Liu, G. (2017). Uncoupling of UNC5C with Polymerized TUBB3 in Microtubules Mediates Netrin-1 Repulsion. J. Neurosci, 10.1523/JNEUROSCI.2617-16.

Shekarabi, M., & Kennedy, T. E. (2002). The netrin-1 receptor DCC promotes filopodia formation and cell spreading by activating Cdc42 and Rac1. Mol. Cell. Neurosci., 19, 1-17.

Shekarabi, M., Moore, S. W., Tritsch, N. X., Morris, S. J., Bouchard, J. F., & Kennedy, T. E. (2005). Deleted in colorectal cancer binding netrin-1 mediates cell substrate adhesion and recruits Cdc42, Rac1, Pak1, and N-WASP into an intracellular

104

signaling complex that promotes growth cone expansion. J. Neurosci., 25, 3132- 3141.

Shitaka, Y., Matsuki, N., Saito, H., & Katsuki, H. (1996). Basic fibroblast growth factor increases functional L-type Ca2+ channels in fetal rat hippocampal neurons: implications for neurite morphogenesis in vitro. J Neurosci , 16:6476–6489.

Simon, D., Garcia-Garcia, E., Royo, F., Falcon-Perez, J., & Avila, J. (2012). Proteostasis of tau. Tau overexpression results in its secretion via membrane vesicles. The FEBS Letter, 586:47–54.

Sperber, B. R., Leight, S., Goedert, M., & Lee, V. (1995). Glycogen synthase kinase-3fl phosphorylates tau protein at multiple sites in intact cells. Neuroscience Letters, 197:149-153.

Stein, E., & Tessier-Lavigne, M. (2001). Hierarchical Organization of Guidance Receptors: Silencing of Netrin Attraction by Slit Through a Robo/DCC Receptor Complex. Science, Vol. 291, Issue 5510, pp. 1928-1938.

Stein, E., Zou, Y., Poo, M., & Tessier-Lavigne, M. (2001). Binding of DCC by netrin-1 to mediate axon guidance independent of adenosine A2B receptor activation. Science, 291 (2001), pp. 1976-1982.

Stoeckli, E., & Zou, Y. (2009). How are neurons wired to form functional and plastic circuits? Meeting on Axon Guidance, Synaptogenesis & Neural Plasticity. EMBO Rep, 10, 326-330.

Tamagnone, L., & M.Comoglio, P. (2000). Signalling by semaphorin receptors: cell guidance and beyond. Trends in Cell Biology, Volume 10, Issue 9, Pages 377-383.

Tanaka, E., & Kirschner, E. (1995). The role of microtubules in growth cone turning at substrate boundaries. J Cell Biol, 128: 127–137.

Tang, F., & Kalil, K. (2005). Netrin-1 induces axon branching in developing cortical neurons by frequency-dependent calcium signaling pathways. J Neurosci., 25(28):6702-15.

Tang, F., & Kalil, K. (2005). Netrin-1 Induces Axon Branching in Developing Cortical Neurons by Frequency-Dependent Calcium Signaling Pathways. Journal of Neuroscience , 25 (28) 6702-6715.

Tcherkezian, J., Brittis, P., Thomas, F., Roux, P., & Flanagan, J. (2010). Transmembrane receptor DCC associates with protein synthesis machinery and regulates translation. Cell. , 141(4):632-44.

105

Tirnauer, J. S., & Bierer, B. E. (2000). EB1 Proteins Regulate Microtubule Dynamics, Cell Polarity, and Chromosome Stability. The Journal of Cell Biology, 761–766.

Tischfield, M. A., Baris, H. N., Wu, C., Rudolph, G., Maldergem, L. V., He, w., . . . Engle, E. C. (2010). Human TUBB3 Mutations Perturb Microtubule Dynamics, Kinesin Interactions, and Axon Guidance. Cell, Volume 140, Issue 1, Pages 74–87.

Varadarajan, S., Kong, J., Phan, K., Kao, T., Panaitof, S., Cardin, J., . . . Butler, S. (2017). Netrin1 Produced by Neural Progenitors, Not Floor Plate Cells, Is Required for Axon Guidance in the Spinal Cord. Neuron, Neuron 94, 790-799 e793.

Vitriol, E., & Zheng, J. (2012). Growth cone travel in space and time: the cellular ensemble of cytoskeleton, adhesion, and membrane. Neuron , 73, 1068-1081.

Waetzig, V., & Herdegen, T. (2005). Context-specific inhibition of JNKs: overcoming the dilemma of protection and damage. Br. J. Pharmacol., 26 (9): 455–61.

Wagner, U., Utton, M., Gallo, J., & Miller, C. (1996). Cellular phosphorylation of tau by GSK-3 beta influences tau binding to microtubules and microtubule organisation. Journal of Cell Science, 109: 1537-1543.

Wang, K., Brose, K., Arnott, D., Kidd, T., Goodman, C., Henzel, W., & Tessier-Lavigne, M. (1999). Biochemical purification of a mammalian slit protein as a positive regulator of sensory axon elongation and branching. Cell , 96:771–784.

Wang, Y., & Mandelkow, E. (2016). Tau in physiology and pathology. Nature Reviews Neuroscience, 17, 22–35.

Wang, Z., Cohen, K., Shao, Y., Mole, P., & Dombkowski, D. (2017). Ephrin receptor, EphB4, regulates ES cell differentiation of primitive mammalian. Blood, 2004 103:100-109.

Williamson, R., Scales, T., Clark, B., Gibb, G., Reynolds, C., Kellie, S., . . . Anderton, B. (2002). Rapid tyrosine phosphorylation of neuronal proteins including tau and focal adhesion kinase in response to amyloid-β peptide exposure: involvement of src family protein kinases. J. Neurosci., 22 (2002), pp. 10-20.

Williamson, T., Gordon-Weeks, P., Schachner, M., & Taylor, J. (1996). Microtubule reorganization is obligatory for growth cone turning. Proc Natl Acad Sci U S A, 93: 15221–15226.

Xu, K., Wu, Z., Renier, N., Antipenko, A., Tzvetkova-Robev, D., Xu, Y., . . . al., e. (2014). Structures of netrin-1 bound to two receptors provide insight into its axon guidance mechanism. Science, 344, 1275–1279.

106

Yamakawa, K., Huot, Y., Haendelt, M., Hubert, R., Chen, X., Lyons, G., & Korenberg, J. (1998). Dscam: A novel member of the immunoglobulin superfamily maps in a down syndrome region and is involved in the development of the nervous system. Hum. Mol. Genet. , 227–237.

Yarza, R., Vela, S., Solas, M., & Ramirez, M. J. (2016). c-Jun N-terminal Kinase (JNK) Signaling as a Therapeutic Target for Alzheimer’s Disease. Front. Pharmacol., 6: 321.

Yu, Y., Run, X., Liang, Z., Li, Y., Liu, F., Liu, Y., . . . Gong, C. (2009). Developmental regulation of tau phosphorylation, tau kinases, and tau phosphatases. J Neurochem. , 108(6):1480-94. .

Yung, A., Nishitani, A., & Goodrich, L. (2015). Phenotypic analysis of mice completely lacking netrin 1. Development, 142(21):3686-91. doi: 10.1242/dev.128942.

Zhao, J., Yue, D., Zhou, Y., Jia, L., Wang, H., & X. L. (2017). The Role of MicroRNAs in Aβ Deposition and Tau Phosphorylation in Alzheimer's Disease. Front Neurol. , 8:342.

Zhou, F. Q., Waterman-Storer, C. M., & Cohan, C. S. (2002). Focal loss of actin bundles causes microtubule redistribution and growth cone turning. J. Cell Biol., 157, 839- 849.

Zhu, H., Hummel, T., Clemens, J., Berdnik, D., L., Z., & Luo, L. (2006). Dendritic patterning by Dscam and synaptic partner matching in the Drosophila antennal lobe. Nat Neurosci., 349–355.

Zhu, X., Rottkamp, C., Boux, H., Takeda, A., Perry, G., & Smith, M. (2000). Activation of p38 kinase links tau phosphorylation, oxidative stress, and cell cycle-related events in Alzheimer disease. J Neuropathol Exp Neurol. , 59(10):880-8.

Zou, Y., Stoeckli, E., Chen, H., & Tessier-Lavigne, M. (2000). Squeezing axons out of the gray matter: a role for slit and semaphorin proteins from midline and ventral spinal cord. Cell , 102, 363-375.

107