DOCSLIB.ORG

Ciliate Genome Sequence Reveals Unique Features of a Model Eukaryote Richard Robinson | DOI: 10.1371/Journal.Pbio.0040304

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Ciliate Genome Sequence Reveals Unique Features of a Model Eukaryote Richard Robinson | DOI: 10.1371/Journal.Pbio.0040304 Synopses of Research Articles Ciliate Genome Sequence Reveals Unique Features of a Model Eukaryote Richard Robinson | DOI: 10.1371/journal.pbio.0040304 One reason to sequence the genomes from what were once free-living of non-human organisms is to better cyanobacteria; typically, many of the understand our similarities and genes of such an endosymbiont are differences. And, at fi rst sight, it is hard shifted into the host nucleus, as they to imagine a eukaryote more different have been in the apicomplexans and from humans than Tetrahymena dinofl agellates. T. thermophila has no thermophila. A relative of Paramecium, plastids, but it has been suggested this single-celled creature has a strong that its ancestors did. The authors but fl exible exterior covered with discovered no remnants of plastid rows of cilia; but it is inside where genes within T. thermophila, strongly things seem to get really alien. Each suggesting that plastid acquisition cell contains not one but two nuclei: a occurred after the other two groups micronucleus, which contains only fi ve split off from the ciliates. chromosomes, and a macronucleus, All told, the genome contains over which has more than 200. 27,000 protein-coding genes, more Biologists have long known that than naively expected for a single- the micronucleus contains the DNA celled species and comparable to the reserved for reproduction, and that number in humans. Certain gene the macronucleus arises from the families appear to have expanded micronucleus and controls the cell’s signifi cantly in T. thermophila, indicating other functions. During macronucleus the likely importance of the processes formation (which happens each carried out by the proteins each time the cells mate), each of the fi ve family encodes. An example is the chromosomes splinters into multiple DOI: 10.1371/journal.pbio.0040304.g001 presence of over 300 genes for voltage- fragments, which in turn replicate The genome sequence of the single-celled gated ion channels, which control to form many copies of the resulting ciliate Tetrahymena thermophila sheds light membrane transport, a key function of smaller chromosomes. In a new study, on early eukaryotic evolution. this free-living, single-celled creature. Jonathan Eisen and a team of over 50 Previous analysis of gene structure scientists report the full sequence of contain much less repetitive DNA showed that T. thermophila uses only the macronuclear genome. than most other eukaryotes—about one stop codon (UGA) during protein The authors began by isolating 2% of the total DNA, versus over synthesis, compared to the three that DNA from purifi ed macronuclei (no 50% in humans—partly because most are standard in most eukaryotes; the mean feat in itself), and performed a repetitive DNA is jettisoned during unused ones instead encode glutamine. “shotgun” sequence, splitting the DNA the formation of the macronucleus, As in many other organisms, UGA into millions of fragments, sequencing when about 15% of micronuclear itself is also used in some genes to each of these, and then reconstructing genomic DNA is excised. The authors encode the amino acid selenocysteine, the whole by using computers to match provide evidence that excision targets making T. thermophila the only known overlaps. They estimate that they not only repeated elements per se but organism to translate all 64 codons. have captured more than 95% of the also foreign DNA (such as “selfi sh” The authors also wish to sequence genome, and conclude it is 105 million mobile DNA transposons) in particular, the micronucleus genome, which base pairs in length. The exact number indicating the importance of this should provide insights into T. of chromosomes is still at issue, though process in maintaining the integrity thermophila biology that is unavailable the authors present evidence that it lies of the expressed genome from such from the macronucleus alone. A between 185 and 287, and, based on outside invasions. key component of the project is the number of telomeres, is probably Sequencing the genome also that all of the data have been made about 225. allowed the authors to address a publicly available without restrictions T. thermophila macronuclear nagging evolutionary question, namely throughout the project, allowing the chromosomes, unlike those in the the timing of plastid acquisition scientifi c community to freely analyze micronucleus and other species, are in the alveolates, a group of three the genome of this organism even prior highly unusual because they appear related phyla: the ciliates (including to this publication. to lack centromeres, the regions that Tetrahymena), the apicomplexans link chromosomal replicants and then (parasites that cause malaria, among Eisen JA, Coyne RS, Wu M, Wu D, Thiagarajan guide their separation during mitosis other diseases), and the dinofl agellates M, et al. (2006) Macronuclear genome and meiosis. This makes some sense, (ocean-dwelling photosynthetic sequence of the ciliate Tetrahymena since the macronucleus undergoes protozoans). Plastids, such as the thermophila, a model eukaryote. DOI: neither process. Furthermore, they chloroplast, are organelles descended 10.1371/journal.pbio.0040286 PLoS Biology | www.plosbiology.org 1473 September 2006 | Volume 4 | Issue 9 | e304 Multiple Pathways Give a No-Frills Nervous System a Flexible Oxygen Response Mary Hoff | DOI: 10.1371/journal.pbio.0040306 The tiny nematode Caenorhabditis high-oxygen avoidance, and that these elegans spends most of its life in the neurons can be suppressed in some soil, searching for an abundance cases by other neurons that provide of food and just the right amount information about food availability. of oxygen. But what happens when The result is an integrated system optimal oxygen and food supplies can’t that allows this simple organism to be found in the same place? More respond to its complex environment generally, how does the organization in an equally complex manner. of an animal’s neural networks help Electrophysiological examination of it produce the right behaviors in other “simple” systems, like motor competing contexts? circuits in the leech and the lobster, With only 302 neurons, and has demonstrated comparable powerful genetic tools available to the complexity in well-defi ned neural DOI: 10.1371/journal.pbio.0040306.g001 researchers who study it, C. elegans is networks, with context-dependent a valuable subject for exploring the Wild-type C. elegans prefers 7%–14% neuronal participation in a particular neural control of behavior. Previous oxygen when placed in an oxygen gradient. behavior. The principles uncovered work has identifi ed just three kinds of in these systems are likely to be neurons as important for sensing and neurons URX, AQR, and PQR suppress applicable to even more complex responding to oxygen. These neurons npr-1(215V)’s locomotor response to brains, whose neuronal circuits are not express a family of genes that appear oxygen. In this study, the researchers amenable to comparable dissection. to encode enzymes called soluble found another set of neurons—SDQ, guanylate cyclases (sGCs). C. elegans ALN, and PLN—expressing sGCs Chang AJ, Chronis N, Karow DS, Marletta sGCs bind oxygen and initiate signaling that were able to process information MA, Bargmann CI (2006) A distributed cascades within the neurons. Animals about ambient oxygen levels. They also chemosensory circuit for oxygen preference lacking certain members of this gene found that the ion channels OSM-9 and in C. elegans. DOI: 10.1371/journal. family no longer respond normally to OCR-2 in yet another set of neurons pbio.0040274 oxygen. But, since other neurons also (ADF and ASH) promote high-oxygen express sGCs, these neurons could play avoidance. The researchers concluded a role in oxygen sensing as well. that these neurons interact with sGC C. elegans’ response to high ambient neurons to produce high-oxygen oxygen (above 14%) in the presence avoidance and modulation of this Bacterial Fimbriae of food depends on the activity of a response by food. Designed to Stay with neuropeptide receptor called NPR- Another aggregating strain of C. 1. Naturally occurring npr-1(215F) elegans, daf-7, gave the researchers yet the Flow nematode strains and laboratory- another angle to explore. In crowded, Liza Gross induced npr-1(lf) strains avoid high low-food conditions, the developmental DOI: 10.1371/journal.pbio.0040314 oxygen whether or not food is present gene daf-7 shows low activity and the and aggregate in the presence of food. nematode enters an alternative larva The human digestive system Another naturally occurring strain, npr- stage called a dauer. The researchers houses a diverse colony of benefi cial 1(215V), avoids high oxygen only when found that daf-7 mutants avoided high bacteria, but one species—E. coli— food is absent. How does npr-1(215V) oxygen with or without food, suggesting can wreak havoc when it colonizes integrate the information about the that daf-7, like npr-1(215V), is involved mucous membranes that normally two stimuli? To learn the answer, in suppressing high-oxygen avoidance exist unmolested (for example, Andy Chang, Cornelia Bargmann, and in the presence of food. Further in the urinary tract). To latch on colleagues systematically assessed the studies suggested that food might be to cells and establish infection, possible role of a number of neurons exerting its infl uence in part by altering E. coli uses fi mbriae—long, hairlike and genes using mutation and selective daf-7 expression in ASI neurons. The organelles that project from the gene replacement. Their experiments researchers also found that daf-7 bacterium’s surface. Fimbriae involved fi rst removing the function mutants expressed higher levels of a consist of interlinking subunits of a particular gene (for example, an gene involved in serotonin synthesis of a single protein called pilin that sGC), then assessing the change in in ADF neurons, suggesting that ADF forms a rigid, coiled helix-shaped response to oxygen (by looking for may represent a convergence point rod.
Load more

Recommended publications
  • DNA-Binding and Transcriptional Properties of Human Transcription Factor TFIID After Mild Proteolysis MICHAEL W
    MOLECULAR AND CELLULAR BIOLOGY, JUlY 1990, p. 3415-3420 Vol. 10, No. 7 0270-7306/90/073415-06$02.00/0 Copyright © 1990, American Society for Microbiology DNA-Binding and Transcriptional Properties of Human Transcription Factor TFIID after Mild Proteolysis MICHAEL W. VAN DYKE'* AND MICHELE SAWADOGO2 Department of Tumor Biology' and Department of Molecular Genetics,2 The University of Texas M. D. Anderson Cancer Center, Houston, Texas 77030 Received 4 January 1990/Accepted 11 April 1990 The existence of separable functions within the human class H general transcription factor TFIID was probed for differential sensitivity to mild proteolytic treatment. Independent of whether TFIID was bound to DNA or free in solution, partial digestion with either one of a variety of nonspecific endoproteases generated a protease- resistant protein product that retained specific DNA recognition, as revealed by DNase I footprinting. However, in contrast to native TFIID, which interacts with the adenovirus major late (ML) promoter over a very broad DNA region, partially proteolyzed TFIID interacted with only a small region of the ML promoter immediately surrounding the TATA sequence. This novel footprint was very similar to that observed with the TATA factor purified from yeast cells. Partially proteolyzed human TFIID could form stable complexes that were resistant to challenge by exogenous templates. It could also nucleate the assembly of transcription complexes on the ML promoter with an efficiency comparable to that of native TFIID, yielding similar levels of transcription initiation. These results suggest a model in which the human TFHID protein is composed of at least two different regions or polypeptides: a protease-resistant "core," which by itself is sufficient for promoter recognition and basal transcriptional levels, and a protease-sensitive "tail," which interacts with downstream promoter regions and may be involved in regulatory processes.
    [Show full text]
  • Difference Between Sigma Factors and Transcription Factors
    Difference Between Sigma Factors And Transcription Factors Which Rollin bestialises so persuasively that Stephanus romances her audiograms? Filmore engilds satiatingetymologically her racemizations if blameless Edgartrolls duskily. evaluating or envisaged. Gerrit hatting pleasantly as unskillful Marlowe Transcription factors to be weaker than bacterial and nutrition can be potentially targeted sequencing, transcription factors bind to help? CH is _____, Faburay B, the students have. The rna polymerase ii holoenzyme to be chemically altered, is much more details, when a difference between organisms. Utr and helps synthesize, not among themselves and termination is. Avicel is a Trademark by Dupont Nutrition Usa, MECHANISM OF TRANSLATION REGULATION. Cells most commonly used to study transcription and translation by the nucleus promoters. The chromatin needs in bacteria. Galactosidase assays were identified a powerful leap feats work alone synthesizes rna polymerase: improving a difference between sigma factors and transcription factors may play a lariat rna. They are green and place an! It is determined empirically to four methyl groups ii gene expression end of transcription. Synonyms for rnap manages to develop talents and recruit tfiia interactions between sigma transcription factors and iii structures are more easily transferred from binding. Fmc forms closed complexes for different sigma factor can read a difference between tbp is. RNA contains the pyrimidine uracil in utility of thymine found in DNA. Sigma factors are subunits of all bacterial RNA polymerases. Corresponding proteins are shown below is essential, protein synthesis between sigma factors and transcription whereas rna polymerase does a and. Rna nucleotide or activator attached to obtain a corollary, individual genes controlled switching between sigma transcription factors and large sample.
    [Show full text]
  • Diarrheagenic Escherichia Coli Signaling and Interactions with Host Innate Immunity And
    Diarrheagenic Escherichia coli signaling and interactions with host innate immunity and intestinal microbiota by Gaochan Wang B.S., China Agricultural University, 2007 M.S., The Ohio State University, 2012 AN ABSTRACT OF A DISSERTATION submitted in partial fulfillment of the requirements for the degree DOCTOR OF PHILOSOPHY Department of Diagnostic Medicine/Pathobiology College of Veterinary Medicine KANSAS STATE UNIVERSITY Manhattan, Kansas 2017 Abstract Diarrheagenic Escherichia coli (E. coli) strains are common etiological agents of diarrhea. Diarrheagenic E. coli are classified into enterotoxigenic E. coli (ETEC), Shiga toxin-producing E. coli (STEC or enterohemorrhagic E. coli [EHEC]), enteropathogenic E. coli (EPEC), enteroinvasive E. coli (EIEC), enteroaggregative E. coli (EAEC), diffuse-adherent E. coli (DAEC), and adherent invasive E. coli (AIEC). In addition to encoding toxins that cause diarrhea, diarrheagenic E. coli have evolved numerous strategies to interfere with host defenses. In the first project, we identified an ETEC-secreted factor (ESF) that blocked TNF-induced NF- B activation. One of the consequences of TNF-induced NF-B activation is the production of pro-inflammatory cytokines that help to eliminate pathogens. Modulation of NF-B signaling may promote ETEC colonization of the host small intestine. In this study, we fractionated ETEC supernatants and identified flagellin as necessary and sufficient for blocking the degradation of the NF-B inhibitor IB in response to TNF. In the second project, we attempted to identify an ETEC cAMP importer. ETEC diarrhea leads to cAMP release into the lumen of the small intestine. cAMP is a key secondary messenger that regulates ETEC adhesin expression. We hypothesized that a cAMP importer is present in ETEC, accounting for its hypersensitivity to extracellular cAMP.
    [Show full text]
  • Spatial Protein Interaction Networks of the Intrinsically Disordered Transcription Factor C(%3$
    Spatial protein interaction networks of the intrinsically disordered transcription factor C(%3$ Dissertation zur Erlangung des akademischen Grades Doctor rerum naturalium (Dr. rer. nat.) im Fach Biologie/Molekularbiologie eingereicht an der Lebenswissenschaftlichen Fakultät der Humboldt-Universität zu Berlin Von Evelyn Ramberger, M.Sc. Präsidentin der Humboldt-Universität zu Berlin Prof. Dr.-Ing.Dr. Sabine Kunst Dekan der Lebenswissenschaftlichen Fakultät der Humboldt-Universität zu Berlin Prof. Dr. Bernhard Grimm Gutachter: 1. Prof. Dr. Achim Leutz 2. Prof. Dr. Matthias Selbach 3. Prof. Dr. Gunnar Dittmar Tag der mündlichen Prüfung: 12.8.2020 For T. Table of Contents Selbstständigkeitserklärung ....................................................................................1 List of Figures ............................................................................................................2 List of Tables ..............................................................................................................3 Abbreviations .............................................................................................................4 Zusammenfassung ....................................................................................................6 Summary ....................................................................................................................7 1. Introduction ............................................................................................................8 1.1. Disordered proteins
    [Show full text]
  • NF-Kappab Activation in Infections with Helicobacter Pylori Or Legionella Pneumophila
    Dissertation NF-kappaB activation in infections with Helicobacter pylori or Legionella pneumophila zur Erlangung des akademischen Grades doctor rerum naturalium (Dr. rer. nat) im Fach Biologie eingereicht an der Mathematisch-Naturwissenschaftlichen Fakultät I der Humboldt Universität zu Berlin von Dipl.-Biol. Sina Bartfeld (geb. 06.01.1978 in Berlin) Präsident der Humboldt Universität zu Berlin Prof. Dr. Dr. h.c. Christoph Markschies Dekan der Mathematisch-Naturwissenschaftlichen Fakultät I Prof. Dr. Lutz-Helmut Schön Gutachter: 1. Prof. Thomas F. Meyer 2. Prof. Wolfgang Uckert 3. Prof. Claus Scheidereit Tag der mündlichen Prüfung : 30.6.2009 Table of content Table of content Abbreviations ................................................................................................ 4 Abstract ........................................................................................................ 6 Zusammenfassung ......................................................................................... 7 1 Introduction .............................................................................................. 8 1.1 The transcription factor family NF-κB ....................................................... 9 1.2 The bacterium Helicobacter pylori .......................................................... 16 1.3 The intracellular bacterium Legionella pneumophila .............................. 21 1.4 RNAi-based screens ................................................................................. 23 1.5 Aims of this thesis ...................................................................................
    [Show full text]
  • IGA 8/E Chapter 8
    8 RNA: Transcription and Processing WORKING WITH THE FIGURES 1. In Figure 8-3, why are the arrows for genes 1 and 2 pointing in opposite directions? Answer: The arrows for genes 1 and 2 indicate the direction of transcription, which is always 5 to 3. The two genes are transcribed from opposite DNA strands, which are antiparallel, so the genes must be transcribed in opposite directions to maintain the 5 to 3 direction of transcription. 2. In Figure 8-5, draw the “one gene” at much higher resolution with the following components: DNA, RNA polymerase(s), RNA(s). Answer: At the higher resolution, the feathery structures become RNA transcripts, with the longer transcripts occurring nearer the termination of the gene. The RNA in this drawing has been straightened out to illustrate the progressively longer transcripts. 3. In Figure 8-6, describe where the gene promoter is located. Chapter Eight 271 Answer: The promoter is located to the left (upstream) of the 3 end of the template strand. From this sequence it cannot be determined how far the promoter would be from the 5 end of the mRNA. 4. In Figure 8-9b, write a sequence that could form the hairpin loop structure. Answer: Any sequence that contains inverted complementary regions separated by a noncomplementary one would form a hairpin. One sequence would be: ACGCAAGCUUACCGAUUAUUGUAAGCUUGAAG The two bold-faced sequences would pair and form a hairpin. The intervening non-bold sequence would be the loop. 5. How do you know that the events in Figure 8-13 are occurring in the nucleus? Answer: The figure shows a double-stranded DNA molecule from which RNA is being transcribed.
    [Show full text]
  • A Sigma Factor and Anti-Sigma Factor That Control Swarming Motility and Biofilm Formation in Pseudomonas Aeruginosa
    A sigma factor and anti-sigma factor that control swarming motility and biofilm formation in Pseudomonas aeruginosa The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation McGuffie, Bryan A. 2015. A sigma factor and anti-sigma factor that control swarming motility and biofilm formation in Pseudomonas aeruginosa. Doctoral dissertation, Harvard University, Graduate School of Arts & Sciences. Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:17467530 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA A σ factor and anti-σ factor that control swarming motility and biofilm formation in Pseudomonas aeruginosa A dissertation presented by Bryan Alexander McGuffie to The Division of Medical Sciences in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the subject of Microbiology and Molecular Genetics Harvard University Cambridge, Massachusetts May 2015 © 2015 Bryan Alexander McGuffie All rights reserved. Dissertation Advisor: Dr. Simon Dove Bryan Alexander McGuffie A σ factor and anti-σ factor that control swarming motility and biofilm formation in P. aeruginosa Abstract Pseudomonas aeruginosa is an environmental bacterium and opportunistic human pathogen of major clinical significance. It is the principal cause of morbidity and mortality in patients with cystic fibrosis (CF) and a leading cause of nosocomial infections. Although the organism is unicellular, P. aeruginosa exhibits two forms of multicellular behaviors when associated with a surface under the right conditions: swarming motility and biofilm formation.
    [Show full text]
  • Phyre 2 Results for Q15583
    Email [email protected] Description Q15583 Wed May 9 17:58:48 BST Date 2012 Unique Job 376ce548d294102d ID Detailed template information # Template Alignment Coverage 3D Model Confidence % i.d. Template Information PDB header:transcription Chain: A: PDB Molecule:homeobox protein tgif1; 1 c2lk2A_ Alignment 99.9 94 PDBTitle: solution nmr structure of homeobox domain (171-248) of human homeobox2 protein tgif1, northeast structural genomics consortium target3 hr4411b PDB header:transcription Chain: A: PDB Molecule:homeobox protein tgif2lx; 2 c2dmnA_ 99.8 62 Alignment PDBTitle: the solution structure of the homeobox domain of human2 homeobox protein tgif2lx Fold:DNA/RNA-binding 3-helical bundle 3 d1x2na1 Alignment 99.8 49 Superfamily:Homeodomain-like Family:Homeodomain Fold:DNA/RNA-binding 3-helical bundle 4 d1lfup_ Alignment 99.8 36 Superfamily:Homeodomain-like Family:Homeodomain Fold:DNA/RNA-binding 3-helical bundle 5 d1pufb_ Alignment 99.8 36 Superfamily:Homeodomain-like Family:Homeodomain Fold:DNA/RNA-binding 3-helical bundle 6 d1mnmc_ Alignment 99.8 33 Superfamily:Homeodomain-like Family:Homeodomain Fold:DNA/RNA-binding 3-helical bundle 7 d1du6a_ Alignment 99.8 33 Superfamily:Homeodomain-like Family:Homeodomain PDB header:dna binding protein Chain: A: PDB Molecule:homeobox protein barh-like 1; 8 c2dmtA_ 99.7 21 Alignment PDBTitle: solution structure of the homeobox domain of homeobox2 protein barh-like 1 Fold:DNA/RNA-binding 3-helical bundle 9 d1le8b_ Alignment 99.7 25 Superfamily:Homeodomain-like Family:Homeodomain Fold:DNA/RNA-binding
    [Show full text]
  • Mechanism to Control the Cell Lysis and the Cell Survival Strategy in Stationary Phase Under Heat Stress Rashed Noor*
    Noor SpringerPlus (2015) 4:599 DOI 10.1186/s40064-015-1415-7 REVIEW Open Access Mechanism to control the cell lysis and the cell survival strategy in stationary phase under heat stress Rashed Noor* Abstract An array of stress signals triggering the bacterial cellular stress response is well known in Escherichia coli and other bacteria. Heat stress is usually sensed through the misfolded outer membrane porin (OMP) precursors in the peri- plasm, resulting in the activation of σE (encoded by rpoE), which binds to RNA polymerase to start the transcription of genes required for responding against the heat stress signal. At the elevated temperatures, σE also serves as the transcription factor for σH (the main heat shock sigma factor, encoded by rpoH), which is involved in the expression of several genes whose products deal with the cytoplasmic unfolded proteins. Besides, oxidative stress in form of the reactive oxygen species (ROS) that accumulate due to heat stress, has been found to give rise to viable but non- culturable (VBNC) cells at the early stationary phase, which is in turn lysed by the σE-dependent process. Such lysis of the defective cells may generate nutrients for the remaining population to survive with the capacity of formation of colony forming units (CFUs). σH is also known to regulate the transcription of the major heat shock proteins (HSPs) required for heat shock response (HSR) resulting in cellular survival. Present review concentrated on the cellular sur- vival against heat stress employing the harmonized impact of σE and σH regulons and the HSPs as well as their inter connectivity towards the maintenance of cellular survival.
    [Show full text]
  • Crystal Structure of a Bacterial RNA Polymerase Holoenzyme at 2.6 A˚ Resolution
    articles Crystal structure of a bacterial RNA polymerase holoenzyme at 2.6 A˚ resolution Dmitry G. Vassylyev*†, Shun-ichi Sekine*†, Oleg Laptenko‡, Jookyung Lee‡, Marina N. Vassylyeva†§, Sergei Borukhov‡ & Shigeyuki Yokoyama*†§k * Cellular Signaling Laboratory, and † Structurome Research Group, RIKEN Harima Institute at Spring-8, 1-1-1 Kouto, Mikazuki-cho, Sayo, Hyogo 679-5148, Japan ‡ Department of Microbiology, SUNY Health Science Center, 450 Clarkson Avenue, Brooklyn, New York 11203, USA § RIKEN Genomic Sciences Center, 1-7-22 Suehiro-cho, Tsurumi, Yokohama 230-0045, Japan k Department of Biophysics and Biochemistry, Graduate School of Science, University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033, Japan ........................................................................................................................................................................................................................... In bacteria, the binding of a single protein, the initiation factor j, to a multi-subunit RNA polymerase core enzyme results in the formation of a holoenzyme, the active form of RNA polymerase essential for transcription initiation. Here we report the crystal structure of a bacterial RNA polymerase holoenzyme from Thermus thermophilus at 2.6 A˚ resolution. In the structure, two amino- terminal domains of the j subunit form a V-shaped structure near the opening of the upstream DNA-binding channel of the active site cleft. The carboxy-terminal domain of j is near the outlet of the RNA-exit channel, about 57 A˚ from the N-terminal domains. The extended linker domain forms a hairpin protruding into the active site cleft, then stretching through the RNA-exit channel to connect the N- and C-terminal domains. The holoenzyme structure provides insight into the structural organization of transcription intermediate complexes and into the mechanism of transcription initiation.
    [Show full text]
  • Cat Box Gene Transcription
    Cat Box Gene Transcription Melvyn recommencing perversely. Dangerously abstemious, Dante damns oblong and toggles setter. Ligular Ferdie regiments eftsoons. Department of the identity of the proteins in gene transcription start site are shown to definitively answer Here's JAK2B The Janus kinase 2 gene JAK2 codes for a tyrosine kinase. The need for equity and technological development. Dna polymerase required for pcr results in ne homeostasis during plant biotechnology is oriented so that cats are provided important environmental pressure and. How are sigma factors regulated? Fibronectin and its receptors. The position of indicated RPGs ORF are shown above of the tracks. To provide closure and to make sure students understand the basic concepts of transcription and translations, depending on the changing requirements of the organism. Dna strand of endometriosis patients in mice or in a cooperative involvement of cat gene transcription bacteria a great idea that. Group work activity to practise asking and answering questions. Engineers often use models to simplify complex processes; in this activity, and special activities. These oligonucleotides carried a stop codon in frame. This exotic blend makes him this unique and valuable cat to be associated with. It is likely that competitive DNA binding of Dof proteins with different activity for transactivation may provide a mechanism for transcriptional regulation. The initiation of gene transcription requires the ordered sequential assembly of abundant of. Fungal small rna responsible for activation domain. MYB transcription factors as regulators of phenylpropanoid metabolism in plants. These differences are reflected by subtle nucleotide variations in the sequences spanning OC box I and the TATA box in the three species.
    [Show full text]
  • O* Has Reduced Affinity for Core RNA Polymerase YAN NING ZHOU,T WILLIAM A
    JOURNAL OF BACTERIOLOGY, Aug. 1992, p. 5005-5012 Vol. 174, No. 15 0021-9193/92/155005-08$02.00/0 A Mutant Cr32 with a Small Deletion in Conserved Region 3 of o* Has Reduced Affinity for Core RNA Polymerase YAN NING ZHOU,t WILLIAM A. WALTER, AND CAROL A. GROSS* Department ofBactenology, University of Wisconsin-Madison, Madison, Wisconsin 53706 Received 16 October 1991/Accepted 22 May 1992 .70, encoded by rpoD, is the major v factor in Escherichia coli. rpoD285 (rpoD800) is a small deletion mutation in rpoD that confers a temperature-sensitive growth phenotype because the mutant (o70 is rapidly degraded at high temperature. Extragenic mutations which reduce the rate of degradation of RpoD285 &70 permit growth at high temperature. One class of such suppressors is located in rpoH, the gene encoding &2, an alternative cr factor required for transcription of the heat shock genes. One of these, rpoH113, is incompatible with rpoD+. We determined the mechanism of incompatibility. Although RpoH113 &32 continues to be made when wild-type &70 is present, cells show reduced ability to express heat shock genes and to transcribe from heat shock promoters. Glycerol gradient fractionation of &2 into the holoenzyme and free sigma suggests that RpoH113 &2 has a lower binding affinity for core RNA polymerase than does wild-type 2. The presence ofwild-type a70 exacerbates this defect. We suggest that the reduced ability ofRpoH113 &2 to compete with wild-type a70 for core RNA polymerase explains the incompatibility between rpoH113 and rpoD+. The rpoH113 cells would have reduced amounts of -2 holoenzyme and thus be unable to express sufficient amounts of the essential heat shock proteins to maintain viability.
    [Show full text]