DOCSLIB.ORG

Mouse Surf6 Conditional Knockout Project (CRISPR/Cas9)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mouse Surf6 Conditional Knockout Project (CRISPR/Cas9) https://www.alphaknockout.com Mouse Surf6 Conditional Knockout Project (CRISPR/Cas9) Objective: To create a Surf6 conditional knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Surf6 gene (NCBI Reference Sequence: NM_009298 ; Ensembl: ENSMUSG00000036160 ) is located on Mouse chromosome 2. 5 exons are identified, with the ATG start codon in exon 1 and the TGA stop codon in exon 5 (Transcript: ENSMUST00000047632). Exon 2~3 will be selected as conditional knockout region (cKO region). Deletion of this region should result in the loss of function of the Mouse Surf6 gene. To engineer the targeting vector, homologous arms and cKO region will be generated by PCR using BAC clone RP23-356J14 as template. Cas9, gRNA and targeting vector will be co-injected into fertilized eggs for cKO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Exon 2 starts from about 8.92% of the coding region. The knockout of Exon 2~3 will result in frameshift of the gene. The size of intron 1 for 5'-loxP site insertion: 2761 bp, and the size of intron 3 for 3'-loxP site insertion: 6269 bp. The size of effective cKO region: ~1096 bp. The cKO region does not have any other known gene. Page 1 of 8 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele gRNA region 5' gRNA region 3' 1 2 3 5 Targeting vector Targeted allele Constitutive KO allele (After Cre recombination) Legends Exon of mouse Surf6 Homology arm cKO region loxP site Page 2 of 8 https://www.alphaknockout.com Overview of the Dot Plot Window size: 10 bp Forward Reverse Complement Sequence 12 Note: The sequence of homologous arms and cKO region is aligned with itself to determine if there are tandem repeats. No significant tandem repeat is found in the dot plot matrix. So this region is suitable for PCR screening or sequencing analysis. Overview of the GC Content Distribution Window size: 300 bp Sequence 12 Summary: Full Length(7596bp) | A(23.22% 1764) | C(24.5% 1861) | T(28.3% 2150) | G(23.97% 1821) Note: The sequence of homologous arms and cKO region is analyzed to determine the GC content. No significant high GC-content region is found. So this region is suitable for PCR screening or sequencing analysis. Page 3 of 8 https://www.alphaknockout.com BLAT Search Results (up) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 3000 1 3000 3000 100.0% chr2 - 26900183 26903182 3000 browser details YourSeq 246 1334 2784 3000 91.4% chr1 + 60184521 60660651 476131 browser details YourSeq 222 1346 2781 3000 90.9% chr1 + 138670391 138981600 311210 browser details YourSeq 117 2014 2526 3000 89.8% chr19 + 25274469 25275201 733 browser details YourSeq 109 2600 2785 3000 89.2% chr9 - 15289738 15290228 491 browser details YourSeq 104 2602 2785 3000 83.4% chr18 - 23458931 23459107 177 browser details YourSeq 104 1371 2741 3000 90.0% chr18 + 67618324 67626908 8585 browser details YourSeq 103 2648 2781 3000 89.9% chr12 + 69612048 69612184 137 browser details YourSeq 101 2660 2785 3000 88.0% chr1 + 86209730 86209853 124 browser details YourSeq 98 2332 2561 3000 87.2% chr1 - 86692676 86693005 330 browser details YourSeq 97 2332 2526 3000 87.2% chrX + 102226450 102226756 307 browser details YourSeq 95 2660 2779 3000 87.3% chr4 + 126347465 126347582 118 browser details YourSeq 94 1988 2414 3000 88.8% chr8 - 27719305 27719780 476 browser details YourSeq 92 2660 2789 3000 90.4% chr6 - 38361862 38362000 139 browser details YourSeq 92 2332 2526 3000 89.8% chr13 - 38970960 38971274 315 browser details YourSeq 92 2622 2778 3000 87.0% chr1 + 86409923 86410105 183 browser details YourSeq 91 2600 2768 3000 88.3% chr4 + 130221021 130221316 296 browser details YourSeq 89 1342 1462 3000 95.1% chrX + 152790153 152790523 371 browser details YourSeq 89 2660 2781 3000 88.8% chr4 + 116648719 116648838 120 browser details YourSeq 88 2660 2779 3000 86.7% chr8 + 111116407 111116526 120 Note: The 3000 bp section upstream of Exon 2 is BLAT searched against the genome. No significant similarity is found. BLAT Search Results (down) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN -------------------------------------------------------------------------------------------------------------- browser details YourSeq 3000 1 3000 3000 100.0% chr2 - 26896087 26899086 3000 browser details YourSeq 808 1078 2788 3000 88.5% chr19 + 58475007 58686430 211424 browser details YourSeq 714 1034 2441 3000 85.7% chr7 - 16539607 16540904 1298 browser details YourSeq 708 1164 2684 3000 84.6% chr7 + 118016396 118017787 1392 browser details YourSeq 703 1307 2593 3000 86.1% chr2 - 127629866 127631007 1142 browser details YourSeq 701 1095 2536 3000 85.0% chr11 - 94552496 94553757 1262 browser details YourSeq 699 1128 2788 3000 83.9% chr12 + 57558537 57560134 1598 browser details YourSeq 697 1078 2536 3000 85.0% chr13 + 110371695 110372990 1296 browser details YourSeq 670 1034 2399 3000 84.9% chr2 - 157359289 157360523 1235 browser details YourSeq 670 1034 2441 3000 85.3% chr2 - 136421287 136422581 1295 browser details YourSeq 669 1052 2398 3000 85.2% chr5 + 41954605 41955836 1232 browser details YourSeq 663 1097 2399 3000 84.8% chr1 - 34698700 34699854 1155 browser details YourSeq 660 1078 2769 3000 86.7% chr4 - 54995311 54996864 1554 browser details YourSeq 652 1094 2439 3000 86.2% chr9 - 48631337 48632573 1237 browser details YourSeq 649 1089 2430 3000 86.7% chr13 + 18726062 18727275 1214 browser details YourSeq 639 1034 2365 3000 85.1% chr8 - 124999981 125001204 1224 browser details YourSeq 631 1034 2398 3000 85.6% chr3 - 41890161 41891401 1241 browser details YourSeq 623 1073 2399 3000 84.6% chr2 + 27660413 27661584 1172 browser details YourSeq 620 1053 2500 3000 85.7% chr14 + 65769805 65771120 1316 browser details YourSeq 616 1034 2403 3000 84.0% chrX + 104935293 104936524 1232 Note: The 3000 bp section downstream of Exon 3 is BLAT searched against the genome. No significant similarity is found. Page 4 of 8 https://www.alphaknockout.com Gene and protein information: Surf6 surfeit gene 6 [ Mus musculus (house mouse) ] Gene ID: 20935, updated on 10-Oct-2019 Gene summary Official Symbol Surf6 provided by MGI Official Full Name surfeit gene 6 provided by MGI Primary source MGI:MGI:98447 See related Ensembl:ENSMUSG00000036160 Gene type protein coding RefSeq status VALIDATED Organism Mus musculus Lineage Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus Also known as Surf-6; D2Wsu129e Expression Ubiquitous expression in CNS E11.5 (RPKM 11.1), CNS E14 (RPKM 7.6) and 28 other tissues See more Orthologs human all Genomic context Location: 2 A3; 2 19.08 cM See Surf6 in Genome Data Viewer Exon count: 5 Annotation release Status Assembly Chr Location 108 current GRCm38.p6 (GCF_000001635.26) 2 NC_000068.7 (26890418..26902887, complement) Build 37.2 previous assembly MGSCv37 (GCF_000001635.18) 2 NC_000068.6 (26746292..26758333, complement) Chromosome 2 - NC_000068.7 Page 5 of 8 https://www.alphaknockout.com Transcript information: This gene has 7 transcripts Gene: Surf6 ENSMUSG00000036160 Description surfeit gene 6 [Source:MGI Symbol;Acc:MGI:98447] Gene Synonyms D2Wsu129e, Surf-6 Location Chromosome 2: 26,888,628-26,902,879 reverse strand. GRCm38:CM000995.2 About this gene This gene has 7 transcripts (splice variants), 181 orthologues and is a member of 1 Ensembl protein family. Transcripts Name Transcript ID bp Protein Translation ID Biotype CCDS UniProt Flags Surf6-201 ENSMUST00000047632.13 2971 355aa ENSMUSP00000048457.7 Protein coding CCDS15812 P70279 Q3V1X4 TSL:1 GENCODE basic APPRIS P1 Surf6-202 ENSMUST00000114043.1 894 208aa ENSMUSP00000109677.1 Protein coding - A2ALA0 TSL:5 GENCODE basic Surf6-206 ENSMUST00000140392.1 1372 No protein - lncRNA - - TSL:1 Surf6-207 ENSMUST00000142131.1 748 No protein - lncRNA - - TSL:2 Surf6-205 ENSMUST00000137904.7 680 No protein - lncRNA - - TSL:3 Surf6-204 ENSMUST00000129554.1 653 No protein - lncRNA - - TSL:1 Surf6-203 ENSMUST00000127691.1 372 No protein - lncRNA - - TSL:3 Page 6 of 8 https://www.alphaknockout.com 34.25 kb Forward strand 26.88Mb 26.89Mb 26.90Mb 26.91Mb Genes Rpl7a-201 >protein coding (Comprehensive set... Gm23969-201 >snoRNA Gm22879-201 >snoRNA Gm24134-201 >snoRNA Rpl7a-203 >lncRNA Rpl7a-204 >lncRNA Rpl7a-205 >lncRNA Rpl7a-202 >lncRNA Rpl7a-206 >lncRNA Rpl7a-207 >lncRNA Contigs AL773563.12 > Genes (Comprehensive set... < Surf6-206lncRNA < Surf6-207lncRNA < Med22-202protein coding < Surf6-204lncRNA < Surf6-203lncRNA < Med22-201protein coding < Surf6-205lncRNA < Med22-203protein coding < Surf6-201protein coding < Surf6-202protein coding Regulatory Build 26.88Mb 26.89Mb 26.90Mb 26.91Mb Reverse strand 34.25 kb Regulation Legend CTCF Open Chromatin Promoter Promoter Flank Gene Legend Protein Coding Ensembl protein coding merged Ensembl/Havana Non-Protein Coding RNA gene Page 7 of 8 https://www.alphaknockout.com Transcript: ENSMUST00000047632 < Surf6-201protein coding Reverse strand 12.45 kb ENSMUSP00000048... MobiDB lite Low complexity (Seg) Coiled-coils (Ncoils) Pfam Ribosomal RNA-processing protein 14/surfeit locus protein 6, C-terminal domain PANTHER Surfeit locus 6 All sequence SNPs/i... Sequence variants (dbSNP and all other sources) Variant Legend missense variant synonymous variant Scale bar 0 40 80 120 160 200 240 280 355 We wish to acknowledge the following valuable scientific information resources: Ensembl, MGI, NCBI, UCSC. Page 8 of 8.
Load more

Recommended publications
  • Nucleolin and Its Role in Ribosomal Biogenesis
    NUCLEOLIN: A NUCLEOLAR RNA-BINDING PROTEIN INVOLVED IN RIBOSOME BIOGENESIS Inaugural-Dissertation zur Erlangung des Doktorgrades der Mathematisch-Naturwissenschaftlichen Fakultät der Heinrich-Heine-Universität Düsseldorf vorgelegt von Julia Fremerey aus Hamburg Düsseldorf, April 2016 2 Gedruckt mit der Genehmigung der Mathematisch-Naturwissenschaftlichen Fakultät der Heinrich-Heine-Universität Düsseldorf Referent: Prof. Dr. A. Borkhardt Korreferent: Prof. Dr. H. Schwender Tag der mündlichen Prüfung: 20.07.2016 3 Die vorgelegte Arbeit wurde von Juli 2012 bis März 2016 in der Klinik für Kinder- Onkologie, -Hämatologie und Klinische Immunologie des Universitätsklinikums Düsseldorf unter Anleitung von Prof. Dr. A. Borkhardt und in Kooperation mit dem ‚Laboratory of RNA Molecular Biology‘ an der Rockefeller Universität unter Anleitung von Prof. Dr. T. Tuschl angefertigt. 4 Dedicated to my family TABLE OF CONTENTS 5 TABLE OF CONTENTS TABLE OF CONTENTS ............................................................................................... 5 LIST OF FIGURES ......................................................................................................10 LIST OF TABLES .......................................................................................................12 ABBREVIATION .........................................................................................................13 ABSTRACT ................................................................................................................19 ZUSAMMENFASSUNG
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name surfeit 6 Gene Symbol SURF6 Organism Human Gene Summary This gene is located in the surfeit gene cluster a group of very tightly linked genes that do not share sequence similarity. The gene demonstrates features of a housekeeping gene being ubiquitously expressed and the encoded protein has been localized to the nucleolus. The protein includes motifs found in both the mouse and fish orthologs which suggests a putative function as a nucleolar-matrix protein with nucleic acid-binding properties based on characteristics determined in mouse. Gene Aliases FLJ30322, RRP14 RefSeq Accession No. NC_000009.11, NG_000837.1, NT_035014.4, NW_003315925.1 UniGene ID Hs.274430 Ensembl Gene ID ENSG00000148296 Entrez Gene ID 6838 Assay Information Unique Assay ID qHsaCID0013709 Assay Type SYBR® Green Detected Coding Transcript(s) ENST00000372022 Amplicon Context Sequence CTGGCCCCGGGCCTCCTGGATCTTCTCATGCAGTCGCTGTCGCAGAACATCCAG AGCAAAGACAGACTCAGGCTCAGTGGCCAGGCCATCTGCAGGGTTCCCTGCTG AGCTGGAAGCCCAAGCTGCTTCCTCTTTGGCTGCCTCAGGCCTCCTGGCCCCAG AGGCTGCTGGAGATTTCTCCCCCAAGGACTTGGCCTTGTGCTCAGCAGCCTTCT CTTCTCGC Amplicon Length (bp) 193 Chromosome Location 9:136200554-136201361 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 99 R2 0.9986 cDNA Cq 20.2 Page 1/5 PrimePCR™Assay Validation Report cDNA Tm (Celsius) 88.5 gDNA Cq 33.11 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 2/5 PrimePCR™Assay Validation Report SURF6,
    [Show full text]
  • Nº Ref Uniprot Proteína Péptidos Identificados Por MS/MS 1 P01024
    Document downloaded from http://www.elsevier.es, day 26/09/2021. This copy is for personal use. Any transmission of this document by any media or format is strictly prohibited. Nº Ref Uniprot Proteína Péptidos identificados 1 P01024 CO3_HUMAN Complement C3 OS=Homo sapiens GN=C3 PE=1 SV=2 por 162MS/MS 2 P02751 FINC_HUMAN Fibronectin OS=Homo sapiens GN=FN1 PE=1 SV=4 131 3 P01023 A2MG_HUMAN Alpha-2-macroglobulin OS=Homo sapiens GN=A2M PE=1 SV=3 128 4 P0C0L4 CO4A_HUMAN Complement C4-A OS=Homo sapiens GN=C4A PE=1 SV=1 95 5 P04275 VWF_HUMAN von Willebrand factor OS=Homo sapiens GN=VWF PE=1 SV=4 81 6 P02675 FIBB_HUMAN Fibrinogen beta chain OS=Homo sapiens GN=FGB PE=1 SV=2 78 7 P01031 CO5_HUMAN Complement C5 OS=Homo sapiens GN=C5 PE=1 SV=4 66 8 P02768 ALBU_HUMAN Serum albumin OS=Homo sapiens GN=ALB PE=1 SV=2 66 9 P00450 CERU_HUMAN Ceruloplasmin OS=Homo sapiens GN=CP PE=1 SV=1 64 10 P02671 FIBA_HUMAN Fibrinogen alpha chain OS=Homo sapiens GN=FGA PE=1 SV=2 58 11 P08603 CFAH_HUMAN Complement factor H OS=Homo sapiens GN=CFH PE=1 SV=4 56 12 P02787 TRFE_HUMAN Serotransferrin OS=Homo sapiens GN=TF PE=1 SV=3 54 13 P00747 PLMN_HUMAN Plasminogen OS=Homo sapiens GN=PLG PE=1 SV=2 48 14 P02679 FIBG_HUMAN Fibrinogen gamma chain OS=Homo sapiens GN=FGG PE=1 SV=3 47 15 P01871 IGHM_HUMAN Ig mu chain C region OS=Homo sapiens GN=IGHM PE=1 SV=3 41 16 P04003 C4BPA_HUMAN C4b-binding protein alpha chain OS=Homo sapiens GN=C4BPA PE=1 SV=2 37 17 Q9Y6R7 FCGBP_HUMAN IgGFc-binding protein OS=Homo sapiens GN=FCGBP PE=1 SV=3 30 18 O43866 CD5L_HUMAN CD5 antigen-like OS=Homo
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name surfeit 6 Gene Symbol SURF6 Organism Human Gene Summary This gene is located in the surfeit gene cluster a group of very tightly linked genes that do not share sequence similarity. The gene demonstrates features of a housekeeping gene being ubiquitously expressed and the encoded protein has been localized to the nucleolus. The protein includes motifs found in both the mouse and fish orthologs which suggests a putative function as a nucleolar-matrix protein with nucleic acid-binding properties based on characteristics determined in mouse. Gene Aliases FLJ30322, RRP14 RefSeq Accession No. NC_000009.11, NG_000837.1, NT_035014.4, NW_003315925.1 UniGene ID Hs.274430 Ensembl Gene ID ENSG00000148296 Entrez Gene ID 6838 Assay Information Unique Assay ID qHsaCIP0029002 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENST00000372022 Amplicon Context Sequence CTGGCCCCGGGCCTCCTGGATCTTCTCATGCAGTCGCTGTCGCAGAACATCCAG AGCAAAGACAGACTCAGGCTCAGTGGCCAGGCCATCTGCAGGGTTCCCTGCTG AGCTGGAAGCCCAAGCTGCTTCCTCTTTGGCTGCCTCAGGCCTCCTGGCCCCAG AGGCTGCTGGAGATTTCTCCCCCAAGGACTTGGCCTTGTGCTCAGCAGCCTTCT CTTCTCGC Amplicon Length (bp) 193 Chromosome Location 9:136200554-136201361 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 99 R2 0.9986 cDNA Cq 20.2 Page 1/5 PrimePCR™Assay Validation Report cDNA Tm (Celsius) 88.5 gDNA Cq 33.11 Specificity (%) 100 Information to assist with data interpretation is provided at
    [Show full text]
  • A Cell-Specific Regulatory Region of the Human ABO Blood Group Gene
    www.nature.com/scientificreports OPEN A cell‑specifc regulatory region of the human ABO blood group gene regulates the neighborhood gene encoding odorant binding protein 2B Rie Sano1*, Yoichiro Takahashi1, Haruki Fukuda1, Megumi Harada1, Akira Hayakawa1, Takafumi Okawa1, Rieko Kubo1, Haruo Takeshita2, Junichi Tsukada3 & Yoshihiko Kominato1 The human ABO blood group system is of great importance in blood transfusion and organ transplantation. ABO transcription is known to be regulated by a constitutive promoter in a CpG island and regions for regulation of cell‑specifc expression such as the downstream + 22.6‑kb site for epithelial cells and a site in intron 1 for erythroid cells. Here we investigated whether the + 22.6‑kb site might play a role in transcriptional regulation of the gene encoding odorant binding protein 2B (OBP2B), which is located on the centromere side 43.4 kb from the + 22.6‑kb site. In the gastric cancer cell line KATOIII, quantitative PCR analysis demonstrated signifcantly reduced amounts of OBP2B and ABO transcripts in mutant cells with biallelic deletions of the site created using the CRISPR/Cas9 system, relative to those in the wild‑type cells, and Western blotting demonstrated a corresponding reduction of OBP2B protein in the mutant cells. Moreover, single‑molecule fuorescence in situ hybridization assays indicated that the amounts of both transcripts were correlated in individual cells. These fndings suggest that OBP2B could be co‑regulated by the + 22.6‑kb site of ABO. Te human ABO blood group system is of great importance in blood transfusion and organ transplantation. Te carbohydrate structures of ABO blood group antigens are produced by the A- and B-transferases encoded by the A and B alleles, respectively1.
    [Show full text]
  • A Genome-Wide Investigation of Food Addiction
    A genome-wide investigation of food addiction The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Cornelis, Marilyn C., Alan Flint, Alison E. Field, Peter Kraft, Jiali Han, Eric B. Rimm, and Rob M. van Dam. 2016. “A Genome-Wide Investigation of Food Addiction.” Obesity 24 (6): 1336–41. https:// doi.org/10.1002/oby.21476. Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:41246956 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Open Access Policy Articles, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#OAP HHS Public Access Author manuscript Author ManuscriptAuthor Manuscript Author Obesity Manuscript Author (Silver Spring). Manuscript Author Author manuscript; available in PMC 2017 June 01. Published in final edited form as: Obesity (Silver Spring). 2016 June ; 24(6): 1336–1341. doi:10.1002/oby.21476. A genome-wide investigation of food addiction Marilyn C. Cornelis1, Alan Flint2,3, Alison E. Field3, Peter Kraft3,4, Jiali Han5, Eric B. Rimm2,3,6, and Rob M van Dam7 1Department of Preventive Medicine, Northwestern University Feinberg School of Medicine, Chicago IL USA 2Department of Nutrition, Harvard School of Public Health, Boston MA USA 3Department of Epidemiology, Harvard School of Public Health, Boston MA USA 4Department of Biostatistics, Harvard School of Public Health, Boston MA USA 5Department of Epidemiology, Richard M. Fairbanks School of Public Health, Simon Cancer Center, Indiana University, Indianapolis, IN USA 6Channing Division of Network Medicine, Department of Medicine, Brigham and Women’s Hospital, Boston MA USA 7Saw Swee Hock School of Public Health and Department of Medicine, Yong Loo Lin School of Medicine, National University of Singapore and National University Health System, Singapore, Singapore Abstract Objective—Evidence of parallels between drug addiction and eating behavior continues to accumulate.
    [Show full text]
  • Essential Role for Endogenous Sirnas During Meiosis in Mouse Oocytes
    University of Pennsylvania ScholarlyCommons Departmental Papers (Biology) Department of Biology 2-19-2015 Essential Role for Endogenous siRNAs during Meiosis in Mouse Oocytes Paula Stein University of Pennsylvania Nikolay V. Rozhkov Cold Spring Harbor Laboratory Fan Li University of Pennsylvania Fabián L. Cárdenas University of Pennsylvania, [email protected] Olga Davydenko University of Pennsylvania, [email protected] See next page for additional authors Follow this and additional works at: https://repository.upenn.edu/biology_papers Part of the Amino Acids, Peptides, and Proteins Commons, Biology Commons, and the Cell Biology Commons Recommended Citation Stein, P., Rozhkov, N. V., Li, F., Cárdenas, F. L., Davydenko, O., Vandivier, L., Gregory, B. D., Hannon, G. J., & Schultz, R. M. (2015). Essential Role for Endogenous siRNAs during Meiosis in Mouse Oocytes. PLoS Genetics, 11 (2), http://dx.doi.org/10.1371/journal.pgen.1005013 This paper is posted at ScholarlyCommons. https://repository.upenn.edu/biology_papers/40 For more information, please contact [email protected]. Essential Role for Endogenous siRNAs during Meiosis in Mouse Oocytes Abstract In animals, the three main classes of small RNAs are microRNAs, short interfering RNAs, and PIWI- interacting RNAs. All three RNA species silence gene expression post-transcriptionally through interaction with the ARGONAUTE family of proteins. In mammals in particular, microRNAs are ubiquitously expressed, are essential for development, and perform numerous functions in a variety of cells and tissues. piRNAs are expressed almost exclusively in the germline, and are essential for male fertility and defense against transposons. Endogenous siRNAs are only expressed in germ cells and embryonic stem cells and have not been ascribed a functional role.
    [Show full text]
  • Distinct Transcriptomes Define Rostral and Caudal 5Ht Neurons
    DISTINCT TRANSCRIPTOMES DEFINE ROSTRAL AND CAUDAL 5HT NEURONS by CHRISTI JANE WYLIE Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Dissertation Advisor: Dr. Evan S. Deneris Department of Neurosciences CASE WESTERN RESERVE UNIVERSITY May, 2010 CASE WESTERN RESERVE UNIVERSITY SCHOOL OF GRADUATE STUDIES We hereby approve the thesis/dissertation of ______________________________________________________ candidate for the ________________________________degree *. (signed)_______________________________________________ (chair of the committee) ________________________________________________ ________________________________________________ ________________________________________________ ________________________________________________ ________________________________________________ (date) _______________________ *We also certify that written approval has been obtained for any proprietary material contained therein. TABLE OF CONTENTS TABLE OF CONTENTS ....................................................................................... iii LIST OF TABLES AND FIGURES ........................................................................ v ABSTRACT ..........................................................................................................vii CHAPTER 1 INTRODUCTION ............................................................................................... 1 I. Serotonin (5-hydroxytryptamine, 5HT) ....................................................... 1 A. Discovery..............................................................................................
    [Show full text]
  • The Nucleolar Protein Nucleophosmin Undergoes Liquid-Liquid Phase Separation with Arginine-Rich Nucleolar Proteins Through Weak
    University of Tennessee Health Science Center UTHSC Digital Commons Theses and Dissertations (ETD) College of Graduate Health Sciences 12-2016 The ucleolN ar Protein Nucleophosmin Undergoes Liquid-Liquid Phase Separation with Arginine- Rich Nucleolar Proteins through Weak, Multivalent Electrostatic Interactions Jaclyn Alicia Cika University of Tennessee Health Science Center Follow this and additional works at: https://dc.uthsc.edu/dissertations Part of the Biological Phenomena, Cell Phenomena, and Immunity Commons, and the Medical Cell Biology Commons Recommended Citation Cika, Jaclyn Alicia (http://orcid.org/0000-0003-2911-5648), "The ucleN olar Protein Nucleophosmin Undergoes Liquid-Liquid Phase Separation with Arginine-Rich Nucleolar Proteins through Weak, Multivalent Electrostatic Interactions" (2016). Theses and Dissertations (ETD). Paper 411. http://dx.doi.org/10.21007/etd.cghs.2016.0414. This Thesis is brought to you for free and open access by the College of Graduate Health Sciences at UTHSC Digital Commons. It has been accepted for inclusion in Theses and Dissertations (ETD) by an authorized administrator of UTHSC Digital Commons. For more information, please contact [email protected]. The ucleolN ar Protein Nucleophosmin Undergoes Liquid-Liquid Phase Separation with Arginine-Rich Nucleolar Proteins through Weak, Multivalent Electrostatic Interactions Document Type Thesis Degree Name Master of Science (MS) Program Biomedical Sciences Track Cancer and Developmental Biology Research Advisor Richard Kriwacki, Ph.D. Committee Tanja
    [Show full text]
  • The Human Homologue of the Mouse Surf5 Gene Encodes Multiple
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Archivio della ricerca - Università degli studi di Napoli Federico II Gene 284 (2002) 169–178 www.elsevier.com/locate/gene The human homologue of the mouse Surf5 gene encodes multiple alternatively spliced transcripts Antonietta Angiolilloa,1, Giulia Russoa,1, Antonio Porcellinib,2, Silvia Smaldonea, Felicia D’Alessandroa, Concetta Pietropaoloa,* aDipartimento di Biochimica e Biotecnologie Mediche, Universita` ‘Federico II’ and CEINGE Biotecnologie Avanzate, Via Sergio Pansini 5, I-80131 Naples, Italy bDipartimento di Medicina Sperimentale e Patologia, Universita` ‘La Sapienza’, I-00185 Rome, Italy Received 18 September 2001; received in revised form 3 December 2001; accepted 21 December 2001 Received by R. Di Lauro Abstract Hu-Surf5 is included within the Surfeit locus, a cluster of six genes originally identified in mouse. In the present study, we have cloned and characterized the Hu-Surf5 gene and its mRNA multiple transcripts. Comparison of the most abundant cDNA and genomic sequence shows that the Hu-Surf5 is spread over a region of approximately 7.5 kb and consists of five exons separated by four introns. The nucleotide sequence of the genomic region flanking the 30-end of the Hu-Surf5 gene revealed the presence of a processed pseudogene of human ribosomal protein L21 followed by Hu-Surf6 gene. Only 110 bp separate the transcription start site of Hu-Surf5 and Hu-Surf3/L7a gene and the transcription direction is divergent. Earlier studies defined the 110 bp region essential for promoter activity of Hu-Surf3/L7a. Here, we show that this region stimulates transcription with a slightly different efficiency in both directions.
    [Show full text]
  • Knockdown of Human TCF4 Affects Multiple Signaling Pathways Involved in Cell Survival, Epithelial to Mesenchymal Transition and Neuronal Differentiation
    Knockdown of Human TCF4 Affects Multiple Signaling Pathways Involved in Cell Survival, Epithelial to Mesenchymal Transition and Neuronal Differentiation Marc P. Forrest1, Adrian J. Waite1, Enca Martin-Rendon2,3, Derek J. Blake1* 1 Institute of Psychological Medicine and Clinical Neurosciences, MRC Centre for Neuropsychiatric Genetics and Genomics, School of Medicine, Cardiff University, Cardiff, United Kingdom, 2 Nuffield Division of Clinical Laboratory Sciences, Radcliffe Department of Medicine, University of Oxford, Oxford, United Kingdom, 3 Stem Cell Research Laboratory, NHS Blood and Transplant, John Radcliffe Hospital, Oxford, United Kingdom Abstract Haploinsufficiency of TCF4 causes Pitt-Hopkins syndrome (PTHS): a severe form of mental retardation with phenotypic similarities to Angelman, Mowat-Wilson and Rett syndromes. Genome-wide association studies have also found that common variants in TCF4 are associated with an increased risk of schizophrenia. Although TCF4 is transcription factor, little is known about TCF4-regulated processes in the brain. In this study we used genome-wide expression profiling to determine the effects of acute TCF4 knockdown on gene expression in SH-SY5Y neuroblastoma cells. We identified 1204 gene expression changes (494 upregulated, 710 downregulated) in TCF4 knockdown cells. Pathway and enrichment analysis on the differentially expressed genes in TCF4-knockdown cells identified an over-representation of genes involved in TGF-β signaling, epithelial to mesenchymal transition (EMT) and apoptosis. Among the most significantly differentially expressed genes were the EMT regulators, SNAI2 and DEC1 and the proneural genes, NEUROG2 and ASCL1. Altered expression of several mental retardation genes such as UBE3A (Angelman Syndrome), ZEB2 (Mowat-Wilson Syndrome) and MEF2C was also found in TCF4-depleted cells.
    [Show full text]
  • Notchless Interacts with Multiple Signaling Pathways During Mouse Peri-Implantation Development Chiao-Ling Lo Purdue University
    Purdue University Purdue e-Pubs Open Access Dissertations Theses and Dissertations Fall 2013 Notchless Interacts with Multiple Signaling Pathways during Mouse Peri-Implantation Development Chiao-Ling Lo Purdue University Follow this and additional works at: https://docs.lib.purdue.edu/open_access_dissertations Part of the Animal Sciences Commons, and the Genetics Commons Recommended Citation Lo, Chiao-Ling, "Notchless Interacts with Multiple Signaling Pathways during Mouse Peri-Implantation Development" (2013). Open Access Dissertations. 105. https://docs.lib.purdue.edu/open_access_dissertations/105 This document has been made available through Purdue e-Pubs, a service of the Purdue University Libraries. Please contact [email protected] for additional information. Graduate School ETD Form 9 (Revised 12/07) PURDUE UNIVERSITY GRADUATE SCHOOL Thesis/Dissertation Acceptance This is to certify that the thesis/dissertation prepared By Chiao-Ling Lo Entitled Notchless Interacts with Multiple Signaling Pathways during Mouse Peri-Implantation Development Doctor of Philosophy For the degree of Is approved by the final examining committee: Amy C. Lossie Chair Ann L. Kirchmaier Shihuan Kuang Yuk Fai Leung To the best of my knowledge and as understood by the student in the Research Integrity and Copyright Disclaimer (Graduate School Form 20), this thesis/dissertation adheres to the provisions of Purdue University’s “Policy on Integrity in Research” and the use of copyrighted material. Approved by Major Professor(s): ____________________________________Amy C. Lossie ____________________________________ Approved by: Christine A. Hrycyna 11/20/2013 Head of the Graduate Program Date i NOTCHLESS INTERACTS WITH MULTIPLE SIGNALING PATHWAYS DURING MOUSE PERI-IMPLANTATION DEVELOPMENT A Dissertation Submitted to the Faculty of Purdue University by Chiao-Ling Lo In Partial Fulfillment of the Requirements for the Degree i of Doctor of Philosophy December 2013 Purdue University West Lafayette, Indiana ii ACKNOWLEDGEMENTS I would like to thank my major advisor Dr.
    [Show full text]