sign in sign up
<<
Home , Amphibian, Neil Shubin, Ted Daeschler, Tiktaalik, Transitional fossil

13/07/17 11:28 AM a transitional , and what role a , and what role TiktaalikTiktaalikTiktaalik

do these types of fossil play in the fossil record? evolutionary changes? evolutionary

Copyright Freeman Publishers. ©2018 W.H. Distributed by W.H. Freeman Publishers. Not for redistribution. and DNA reveal about ? What can What features make How does the fossil record reveal information about 3. 2. DRIVING QUESTIONS 1.

Evidence for Evolution 15 21_SHU_31905_ch15_346_367.indd 346 21_SHU_31905_ch15_346_367.indd 347

Photo used with permission from Tangled Bank Studios, LLC. Copyright 2014. All rights reserved. F Daeschler, ashotgun whofor protection. carried charging herds ofmuskoxen are known hazards ofworking intheArctic,says those that domake for dangerous working conditions:hungry and polarbears and where thesun never sets.Only ahandfulofwildanimalssurvive here, but more where thanafew tall, inches sleet andsnow fallinthemiddleofJuly, forbidding awindswept, place: frozen where sparse vegetation grows no Arc Copyright ©2018 W.H. Freeman Publishers. Distributed by W.H. Freeman Publishers. Not forredistribution. by W.H.FreemanPublishers. Distributed ©2018 W.H. Freeman Publishers. Copyright A Fishwith tic, aboutfrom 600miles pole. Even thenorth insummer, They were fossil hunting onremote , inthe their summers trekking through one of the most desolate regions on Earth. OR 5 , AND Fingers? A transitionalfossilfills a gap inourknowledgeof evolution ­ Ellesmere a is ­ Canadian spent

347

13/07/17 11:29 AM 13/07/17 11:29 AM - - at ­ Philadelphia. “In Philadelphia. streams. How made the jump the made life How streams. Chicago and the Field Museum of N Field Museum and the ­Chicago ­water sense, it is a wonderful transitional fossil transitional isit sense, wonderful a Today, of course, four-legged four-legged course, of Today, “splits the difference between the difference “splits is the most compelling Tiktaalik History, ural cusp the at lived of an that yet example between two major groups of .” of vertebrates.” between two groups major land. But 400 mil- far and wide over roam was Life story. a different it was ago lion years then, restricted and to aquatic mostly fresh — vertebrates land-dwelling of four-legged, including . think of as a and something something we Daeschler, says of as a limbed animal,” think we - the Acad at of a curator Sciences in of Natural emy that that sity of from water to land is a question that has long has land is that to a question water from biologists. intriguedevolutionary fact,In sci - of evidence for searching been entists have Darwin since Charles first this ever milestone isplanet the on life all related that proposed to of . a tree According by of biologyUniver the at a professor Shubin, When not looking over their , shoulders, their When not looking over the researchers drilled, chiseled, and ham- the researchers looking for rocks through their way mered but ones and , rocks Not just any fossils. ani- when ago, years million 375 from dating on steps taking their first tentative mals were the scoured they summers, three land. For streambed once an active was of what site in 2004, Then, little of interest. but found the a tantalizingthe team made discovery: - protrud creature of a curious-looking snout - Further of pink rock. excava a slab ing from of remains well-preserved the revealed tion animals between flat-headed 4 and 9 several - the animals resem long.feet In some ways, fins and scales. had bled giant fish—they But those of resembled traits that also had they a neck, —notably, land-dwelling - bones. The research wrists, and fingerlike ; roseae speciesers named the new Tiktaalik is a native tic-TAH-lick) (pronounced tiktaalik This fish.” freshwater meaning “large word but exists, animal no longer ancient a critical it represents phase in the evolution Copyright Freeman Publishers. ©2018 W.H. Distributed by W.H. Freeman Publishers. Not for redistribution. VERTEBRATE cartilaginous backbone. cartilaginous

An animal with a bony or Ted Daeschler/Academy of Natural Sciences/VIREO Natural of Daeschler/Academy Ted Fossil hunting in the vast wilderness of Ellesmere Island in the Canadian Arctic. Arctic. the Canadian Island in of Ellesmere wilderness hunting in the vast Fossil

UNIT 3 • HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY 15 348 21_SHU_31905_ch15_346_367.indd 348 349 15 EVIDENCE FOR EVOLUTION 13/07/17 11:29 AM DESCENT WITH WITH DESCENT MODIFICATION Darwin’s term for evolution, combining the ideas that all living things are related and changed have that organisms time. over FOSSILS The preserved remains or impressions of once-living organisms. FOSSIL RECORD An assemblage of fossils age, of arranged in of evidence providing changes in over time. PALEONTOLOGIST A scientist who studies ancient life by examining the fossil record. A Tiktaalik roseae fossil. - - Ted Daeschler/Academy of Natural Sciences/VIREO Ted ore aling ­reve gists, scien- ­organisms, and sh before amphibi- before sh ­Paleontolo ­single-celled organisms bef - studied exam well xceptionally dwelling ones, fi ­dwelling is not a complete record isrecord complete a not record fossil Moreover, we would expect to see changes changes see to expect would we Moreover, Because not all organisms are preserved, preserved, Because all organisms not are de organismsall if have example, For ple ishorses. Comparisons of modern-day ancestors of horse boneshorse fossils with ans, before , and so on. birds, before ans, reptiles of time within a over One e do. we the fossil the existing Nevertheless, of past life. rich a and offers is remarkably record the past. into window uncovered ancient have life, tists study who throughout of fossils of thousands hundreds peri time - evolutionary many from the world, of in order arranged are ods. When fossils a tangible history on of life provide they age, biologists also allows Earth. record The fossil theory. test certainto of Darwin’s tenets a single common ancestor that scended from as the theory of ago, billions of years lived would did, then we concludes they evolution an ordered show to record the fossil expect as organisms stages succession of evolutionary is And, indeed, that and diversified. evolved be appear see: prokaryotes we what exactly eukaryotes, fore organisms ones, water-dwelling multicellular land- before - - - Copyright Freeman Publishers. ©2018 W.H. Distributed by W.H. Freeman Publishers. Not for redistribution. Fossils are formed in a number of ways: of ways: number in a formed are Fossils of this important does it Not only transition. also the discovery knowledge, in our fill a gap of in support evidence persuasive provides theory. Darwin’s The theory of evolution—what Darwin called The theory of evolution—what two modificationdescent with —draws on Earth: life about main conclusions all that the differ and that related, are things living Reading the Fossil the Fossil Reading Record ent species we see today have emerged over over emerged have see today ent species we selection - natural of operat result a as time lines- of evi Many millions of years. ing over in this that dence support theory (remember a “theory” a is by an idea supported and which of evidence amount tremendous 1). see Chapter been disproved; has never One of the most compelling lines of evidence the pre fossils, comes from evolution for of once-living or impressions remains served of past snapshots like are organisms. Fossils particular at like was capturing life life, what moments in time. an in ice, be frozen animal or plant may sap), or tree in (hardened trapped entombed The of mud. buried in a thick layer being from protected organism is thereby decomposed or rapidly scavengers by eaten right— bacteria. time, if conditions are by Over encasing the speci if the mud - example, for undisturbed for long enough men remains is shape organism’s occur—the to hardening likely equally all organisms Not are preserved. animals with bones however: fossils, form to be preserved to likely more are or shells hard such without animals than or jel- parts (think earthworms quickly. decay that lyfish) conditions per And mitting fossilization - the organ rare: are ism be in has to just the right place rightthe just time at (INFOGRAPHIC 15.1). 21_SHU_31905_ch15_346_367.indd 349 13/07/17 11:29 AM No Fossil Forms Organism is slowly broken down by bacteria, and water contributes to erosion. The soft mud in which a dead organism is buried hardens into rock around the organism. Over time the organism decays, leaving a space in the surrounding rock. The space has the same shape as the exterior of the organism.

No Ralf Hettler/iStockphoto Ralf (INFOGRAPHIC 15.2). Descent with modification also predicts No Fossil Forms Organism is eaten or broken down by aerobic microbes. There are several branches and lineages of branches and lineages several are There died that horse ancestors, including many a family share out, all clearly but the fossils resemblance that the fossil record should contain evidence should record the fossil that Organism is fossilized by imprint or mold. Quick burial in sediment (for example, by a mudslide or volcanic eruption) protects the body from rapid decay. No Yes buried organism?

for fossilization of this

Are the conditions right choicegraphx/iStockphoto

Organism is preserved by rapid burial Organism is preserved by rapid burial in sediment layers.

Hard parts of the body such as teeth and bones do not decay rapidly. Over time minerals in water are deposited in the spaces within bones or replace the bone as it breaks down. The result is a mineralized fossil. Arpad Benedek/Getty Images Benedek/Getty Arpad Yes preserved quickly? Organism dies. Is the dead organism Fossils Form Only in Certain Circumstances Only in Certain Form Fossils reveal how, in the course of evolution, horses of evolution, in the course how, reveal show lost most of their . The fossils have in bone structureover a series of changes being the fossils time, with the most recent modern organisms,most similar to and the ancient being the most different. fossils more

In these cases, organisms are preserved largely in their original state. Colin Keates/Getty Images Keates/Getty Colin Copyright Freeman Publishers. ©2018 W.H. Distributed by W.H. Freeman Publishers. Not for redistribution. Organism is fossilized by mineralization. In addition, shells. In addition, skeletons or hard if they have bony are more likely to fossilize a fossil. Organisms that dies forms Not every organism Therefore, the fossil record mineralization or mud hardening occurs. preserved quickly and kept undisturbed while the organism must be body of evidence for evolution. of past life, but it has supplied an impressive is not a complete record Why are amber in more common than fossilized flies? Spider in amber Organism is preserved by rapid freezing, desiccation, or burial in amber (hardened tree sap). INFOGRAPHIC 15.1 INFOGRAPHIC ?

UNIT 3 • HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY 15 350 21_SHU_31905_ch15_346_367.indd 350 351 15 EVIDENCE FOR EVOLUTION 13/07/17 11:29 AM ? lived in open plains center bearing most of the weight 30 inches high 51 inches high 42 inches high Three toes Lived in Four padded toes Lived in forests Modern horse Single toe is a hoof Before domestication, 52 inches high Single toe is a hoof Lived in open plains Three toes, with Lived in open plains Three toes Lived in forests 42 inches high • • • • • • • • • • • • • • • • • • Hyracotherium Equus Pliohippus Merychippus Hypohippus Miohippus and three-toed Merychippus ppus pus chi ery ohip M Pli and most obvious of all the many objections of all the many and most obvious Yet views.” against my be urged may which cor- Darwin if his were that knew hypothesis eventually would fossils rect,intermediate then Scien-been. have many indeed And found. be animals with mixtures discovered tists have uus Eq pus Fossils Reveal Changes in Species over Time in Species Changes Reveal Fossils iohippus yracotherium M pohip H Hy Common Ancestor Copyright Freeman Publishers. ©2018 W.H. Distributed by W.H. Freeman Publishers. Not for redistribution. how changes over time to one another, but show changes fossils are similar with modification. Forelimb the theory of descent of horses supports The fossil record we can observe over time a from a common ancestor. In the fossil record ancestors to modern-day horses as species diverged from the earliest horse environments. horses to move more rapidly in new prairielike as the central toe became dominant, allowing reduction in toe number, 5 0 15 10

35 25 55 45 30 20

50 40 What changes can be observed between three-toed Miohippus INFOGRAPHIC 15.2 INFOGRAPHIC (mya) ago years of Millions ? of intermediate organisms—those with a mix- and “new” traits. Darwin acknowl- of “old” ture the fossil that in The Origin of Species edged exam- many did not provide of his day record organisms—a of state ples intermediate of such the gravest affairs he described as “probably 21_SHU_31905_ch15_346_367.indd 351 13/07/17 11:29 AM Knowing exactly where to look for fos- look for to where exactly Knowing exposures these rocky while It was in 2004 Ellesmere to The team returned the like looked found they The fossils Ellesmere Island is one of only three places is three one of only Island Ellesmere of this time period are rocks on Earth where knowl- Daeschler’s and Shubin To exposed. no other paleontologists explored had edge, fossil a potential meantwas it which area, the mine. cov- Island since Ellesmere tricky, sils was locate the most miles. To square ers 75,000 the scientists dig site, promising first studied the aerial photographs. Once on the ground, scientists up and spent and their team split the first two seasons the rocky just walking pieces bits and for prospecting exposures, the rock. from out eroded had that of fossils on something interesting found When they start dig. to would they the surface, Daeschler and his that team found in 2002 be a to turn out would the first piece of what fossil—“basicallyTiktaalik part of the snout,” of the think much first, didn’t they At he says. along with other find, but collected it anyway pieces. research- fossil Back in Philadelphia, the remaining removing cleaneders fossil, the clear it wasn’t then, Daeschler says, Even rock. Not until a visiting to. belonged snout the what on the resemblance student remarked graduate the earliest known one from to of the what realize amphibians did the researchers “lightbulb” a was there ever If found. had they this it. was But, hadmoment, alas, they he says, one small piece of the creature. only and digging. of hunting another round for be to their patience long for take It didn’t Daeschler says, inches,” “Literally rewarded: before, been excavating they’d where from dirt. hit pay they the team had creature intermediate elusive be they could how But for. hunting been fossils Logically, the right it was age? sure encase that leastold as the rocks at as are of the rocks, the age know them, so if you too. of the fossils, the age know then you Some types by can directly of rocks be dated the propor- dating, in which radiometric isotopestion of certain in rock radioactive Why was this was period so importantWhy to Field site Island Island EllesmereEllesmere The Fossil Hunt Fossil The for and Daeschler began their hunt Shubin Arctic in 1999 after in the Canadian fossils text- geology old an in map upon a stumbling con- the region that book. The map showed dating rock exposed of swaths tainedlarge the period of years—just million back 375–380 in. interested were time the researchers there that knew They and Daeschler? Shubin the fossil in vertebrates land-dwelling no are 365 By ago. million years 385 before record organisms recogniz- easily ago, million years in documented well able as amphibians are The scientists hypothesized record. the fossil in sandwiched rocks at looked if they that between these two time periods—those around ofone find might old—they years million 375 Moreover, “intermediates.” elusive Darwin’s of and characteristicsof reptile and bird and animals charac- and reptile of mixtures with teristics. But the transition between fish and obscure. more far remained amphibians has so Copyright Freeman Publishers. ©2018 W.H. Distributed by W.H. Freeman Publishers. Not for redistribution. or fossil. DATING RADIOMETRIC RADIOMETRIC The use of radioactive isotopes as a measure for determining the age of a rock Ellesmere Island, nearly as large as Great Britain, contains Canada’s most contains Canada’s Britain, as Great as large nearly Island, Ellesmere point. northern

UNIT 3 • HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY 15 352 21_SHU_31905_ch15_346_367.indd 352 353 15 EVIDENCE FOR EVOLUTION

13/07/17 11:29 AM Ted Daeschler/Academy of Natural Sciences/VIREO Natural of Daeschler/Academy Ted RELATIVE DATING RELATIVE Determining the age of a fossil from its position relative to layers of rock or fossils of known age. Radiometric Dating Rock layers formed from volcanic eruptions can be directly dated by measuring the products of decay of radioactive elements in those layers. Fossils found in these layers are the same age as the dated rock. In this example, fossil B is 510 million years old. Paleontologists uncover Tiktaalik fossils and determine their age to be 375 million years old. Fossil C Tiktaalik Fossil A Fossil B Generally speaking, speaking, Generally dating. relative sediments layer on top. are either deeper or shallower, a technique a technique or shallower, either deeper are called are. they the older the deeper the fossils, methods, scien- of both a combination Using where the rocks that determined tists have million years 375 are found was Tiktaalik is old as well means that Tiktaalik old, which . (INFOGRAPHIC 15.3) 375 million years ago an organism 375 mya 495 mya 510 mya 512 mya 520 mya such as Tiktaalik dies and is buried. Tiktaalik remains are fossilized and How Fossils Are Dated How Fossils Copyright Freeman Publishers. ©2018 W.H. Distributed by W.H. Freeman Publishers. Not for redistribution. Relative Dating When an organism dies and is preserved, its remains may in time become fossilized and buried under layers of sediment, which remains may in time become fossilized and buried under layers of sediment, which When an organism dies and is preserved, its main When a fossilized organism is uncovered, its age can be determined by two accumulate on top of even older layers of sediment. forms of dating: radiometric and relative. What is the approximate age of fossil a found the in blue-gray layer immediately below fossil B? Dating relative to other fossils: Fossils can be dated relative to one another. Fossils found in sediment layers that are deeper in the Earth are generally older than those found in layers closer to the Earth’s surface. In this example, fossil C is older than fossil B. Dating relative to surrounding rock layers: Fossils in layers of rock that cannot be dated directly may be dated relative to the age of the rock layers that bracket them. In this example, fossil A is 495–510 million years old. INFOGRAPHIC 15.3 INFOGRAPHIC ? crystals (isotopes clock serves as a geologic described are fur- dating and radiometric near in or found 16). in Chapter ther Fossils If precisely. can quite dated be theselayers cannot that layers in rock found are fossils radiometric dating, they by dated be directly with position their by canindirectly dated be that age of known or fossils rocks respect to 21_SHU_31905_ch15_346_367.indd 353 13/07/17 11:29 AM While having limbs While having pairs of limbs, defin- ing them as for the Greek (from “four-footed”). distin- feature is a key guishing tetrapods one small fish, from lobe- of fish—the group fish—seemsfinned to blur this distinction. First appearing in the about record fossil ago, 400 million years ” Of the many features that distinguish that features many the Of have to Lobe-finned thought are fish —Neil Shubin on land have to cope with gravity. Air doesn’t Air doesn’t cope with gravity. to on land have so their bodies land animals, a need support structure. land can Animals on also sturdier because them for dry is out, dangerous which function. to course, And, of cells need water on land and in is different taking in oxygen water. - sin biologists fish, land animals from have milestone: evolutionary one as a key gled out limbs, in the sense of have limbs. Fish do not and with fingers appendages bony jointed, fins. In most webbed have they toes. Instead, away out fan and thin ,bonesfin the are These so-called ray-finned each other. from trout, perch, fishesmodern-day the include contrast, amphibians, birds, and bass. By two have and all most reptiles, by fins supported fleshy lobe-finned fish have limb a stalk primitive of bones resemble that bones. rich plant where streams, in shallow evolved small fish and other creatures lured material The lobe-finned edge. water’s the close to the touch fins to their sturdy used fish likely maneuvering while streambed the of bottom was it As Daeschler explains, catch prey. to ecologicalunique the opportunityafforded enabled ancient that fish streams shallow by that lobed fins, like features, startto evolving - nat Through water. shallow in adaptive were become have selection,ural these traits would But common in the fish population. more

- -

It looks like a fish like a fish looks It in that it has scales has scales it in that when but fins, and the inside look you how see you skeleton is. really it special “ ­ - - arm, wet climate and a land- climate arm, wet reatures reatures — invertebrates By the late , things were chang things were Devonian, the late By Back then, what is now the Canadian the Canadian is now Back then, what on land living of challenges physical The spiderlike c spiderlike Life on Land Life a w ­Arctic had meandering shallow, scape by veined there Period in the Devonian Early streams. would and the world little plant growth, was fairly looked have By and empty. brown the middle of the Devo and , for example—crawling been no have would on land. Still, there this at time: noth- vertebrates land-dwelling limbs, nothing with a backbone ing with bony or skull. Setting the Stage for for the Stage Setting and Shubin time period that The geologic as the in is known interested Daeschler are million years 400–350 Devonian—roughly occurring were transformations Great ago. fishes, sharks, jawed during the Devonian: in this land plants, and insects all diversified - high world were period. Because sea levels under water, lay of the land wide, and much has been called Age Period the the Devonian of Fishes. if Daeschler, nian, says standing on were you the bank of a stream seen have would you some of the first land plants, the first for as the ests, as well first had “you Daeschler, says then, By quickly. ing this It was world.” floodplain, a green a green - ecosys rich and productive world—a green into flowing leaf litter with energy-rich tem, the for set the stage streams—that shallow land. onto of vertebrates move Water those in water. from different very are animals, sup aquatic to buoyancy provides porting keep their bodies and helping to contrast, walk them afloat. By animals that Copyright Freeman Publishers. ©2018 W.H. Distributed by W.H. Freeman Publishers. Not for redistribution. backbone. An animal without a INVERTEBRATE reptiles are tetrapods. are reptiles with digits. Mammals, amphibians, birds, and and birds, amphibians, four true limbs, that is, A vertebrate animal with jointed, bony appendages

UNIT 3 • HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY 15 354 21_SHU_31905_ch15_346_367.indd 354 355 15 EVIDENCE FOR EVOLUTION 13/07/17 11:29 AM Ulna Fin-rays Fin-rays Tiktaalik Forelimb Tiktaalik forelimbs had thick, weight-bearing and . The bones bones covered in muscle wrist bones and included a series of flexible number of bony rays. digits ending in a small

Radius Lobe Fin of rows of Lobe-finned fishes have sturdy fins that consist the tips. These thick, fleshy bones with short bony rays at the humerus, rows of bones all connect to a central bone, which attaches to the body of the fish. The bony skeleton of the lobe fin is covered with muscle and skin. Kalliopi Monoyios; Neil Shubin Lab Shubin Neil Monoyios; Kalliopi also had the full-fledged full-fledged the also had Tiktaalik was a predatory fish with sharp with sharp fish a predatory was Tiktaalik interacted and where muscles attached. muscles interacted and where these bones, determined fossil they From that scales,teeth, these to and fins. In addition reminiscent skull a flat attributes, it had fishy neck. flexible a as well as head, a of one the neck was and Daeschler, Shubin To a flexible of the most surprising finds. Having could a fish, Tiktaalik neck meant that, unlike of its body. independently its head swivel catch a enabled it to have may This feature sneaking up on it from glimpse of predators a like sideways snap its behind, or to crocodile. A Comparison of Dierent Fins of Dierent A Comparison Copyright Freeman Publishers. ©2018 W.H. Distributed by W.H. Freeman Publishers. Not for redistribution. Radius Fin-rays forelimbs were technically fins. However, they more closely resembled lobe fins than ray fins. closely resembled lobe However, they more technically fins. Tiktaalik’s forelimbs were Ray Fin Ray-finned fishes have fins that consist of webs of skin supported by a row of thin bony rays that branch from a series of bones connected to the body of the fish. Ulna A physical model of Tiktaalik’s forelimb fin, made from replicas of fossil bones fused with flexible wire. The Fish That Did Fish That The Push-Ups the fossils lucky: and Daeschler were Shubin they that preserved so well were found they anat- skeletal ’s Tiktaalik study able to were the bones seeing how in detail,even omy lobe-finned fish were still very far from being far from still very lobe-finned were fish “It is closer: a step true Tiktaalik tetrapods. it has scales a fish in that and fins,” looks like dis-the 2006in after reporters told Shubin look inside the skele- “but you when covery, is.” special it really see how you ton 21_SHU_31905_ch15_346_367.indd 355 13/07/17 11:29 AM - - Tikta is believed is believed - in evolution early very ation—evolved is thought to have had both and lungs and both had have is to thought Like other fish living at the time, the at living fish other Like no forethought of course, was, There , all its -like For

have been a useful trait in the Devonian, Devonian, trait in the been a useful have a brutal was fish-eat-fish open water when par a predator-free land was whereas world, adise, bugs. full of nourishing alik breathe it could how explains , which these excursions. short for of water out lungs were sometimes that assume People that and , evolutionary a late mod- which came modified gills, they from But in water. breathe fish use to ern-day in fact, organs used for lungs—air-filled ­respir ago. million years than 375 more ary history, this know in ancient existed fish. We They containing fossils fish cavities because and calcified them have bonessurrounding Most mudbanks. former in discovered been their gills but lost retained modern fish have evolved time (the lungs have their lungs over structure called a balloonlike a swim into mod- Some float). fish helps which bladder, have as , however, ern fish known this retained ancestral trait. Lungfish are the lobe- to lobe-finned related fish closely Tiktaalik which finned fish from descended. have to or of limb evolution in the process involved of other suitable land traits. the emergence the purpose of limbs for Fish did not develop evolved first limbs land. Rather, on walking adaptive proved they where water, in shallow in the descendants retained thus and were them. of the organisms first developed who opportunityan was take there to when Then, tantalizing of a —land— new advantage the had already creatures amphibious the “toolkit.” skeletal its a fish because is still considered Tiktaalik and toes that limbs lack the true fingers jointed characterize limbs (in other words, tetrapod - tetra most the far by it’s But fins). still they’re to of all the ancient fishes discovered pod-like it as a to referred jokingly Scientistsdate. have (INFOGRAPHIC 15.4). “fishapod” - Source Foundation/Science Science National ’s fins that have justly justly have that fins ’s But it is Tiktaalik was was Tiktaalik anatomy, thisWith hybrid of a modern land animal, sturdy enough enough ribs sturdy land animal, of a modern water of trunk out animal’s the support to of gravity. against the force even - fea While possessing many it famous. made of a lobe-finned including a sturdy fish, tures also appears bones, Tiktaalik stalk of limblike wrist,- and fin , a jointed had have to pieces, the fossil Shubin bones. From gerlike of a model create able to and Daeschler were to relative moved have the bones would how visualized these have and they one another, that shows model The screen. on movements to enough strong the bones and joints were the of those like worked and body the support amphib early tetrapods—the earliest known ians. “Thishold its fin able to animal was what toward bend the fin out body, its below of as a wrist, think we and bend the elbow,” a it was In other words, Daeschler. explains do a push-up. could fish that It probably not galloping on land, of course. Shubin but water, in time the of most lived may and Daeschler Tiktaalik suspect that pull itself out fins to its supportive used have brief for periods. “Thisof the water is a fish make and even in the shallows canthat live said. The Shubin land,” onto short excursions certainly land would onto ability crawl to Copyright Freeman Publishers. ©2018 W.H. Distributed by W.H. Freeman Publishers. Not for redistribution. likely used its sturdy forelimb fins to pull itself out of the fins to forelimb used its sturdy Tiktaalik likely on land. excursions short for water

UNIT 3 • HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY 15 356 21_SHU_31905_ch15_346_367.indd 356 357 15 EVIDENCE FOR EVOLUTION 13/07/17 11:29 AM Tiktaalik is still Tiktaalik Small pelvic fins are present. Ribs are long and sturdy to support the body on land. ? Lobe-finned fish Acanthostega Early tetrapod species Pectoral fins are weight bearing with distinct, jointed wrist and finger-like bones. Scales are present. or transitional, fossils document importantor transitional, fossils on Earth. of life They in the evolution steps of help biologists groups understand how selec- natural through organisms evolved, they And another. into form one from tion, theory of descent with Darwin’s confirm that , an Intermediate Fossilized Organism Fossilized , an Intermediate Fish-like Traits for Life in Water Lungs are present. Tetrapod-like Traits for Life on Land Tetrapod-like Traits Tiktaalik Neck is mobile, not fused to .

Copyright Freeman Publishers. ©2018 W.H. Distributed by W.H. Freeman Publishers. Not for redistribution. Head is long and flat. Forelimbs are fins with webbing and no distinct external digits. Gills are present. technically a fish because its limbs lack true jointed fingers and toes, a defining feature of tetrapods. its limbs lack true jointed fingers and technically a fish because possesses adaptations of both fish and tetrapods. The fish-like traits would have been useful when in water, while the in water, while the have been useful when fish-like traits would and tetrapods. The of both fish Tiktaalik possesses adaptations all its amphibian-like characteristics, have been useful when Tiktaalik ventured onto land. For tetrapod-like traits would Why would weight-bearing forelimbs be an advantage for Tiktaalik such such Tiktaalik makes what And that’s INFOGRAPHIC 15.4 INFOGRAPHIC ? an importantan occupiesit find: a midpoint fits much between “It very fish and tetrapods. typically between area things we gray in that call typically fish and things we call limbed intermediate, Such Daeschler. says animals,” 21_SHU_31905_ch15_346_367.indd 357 13/07/17 11:29 AM , Darwin asked, “What “What , Darwin asked, The Origin of Species became increasingly adapted to an aquatic an aquatic to became adapted increasingly existence. Is an Arm A Fin Is a Paw Is a Wing In a of hand the that than curious canmore be of a mole for that grasping, for man, formed digging, the leg of of the horse, the paddle the porpoise, and the wing of the bat, should all be constructed and on the same pattern, include similar bones, in the same should Darwin, this uncanny To positions?” relative similarity all these that organ- evidence was a common share they related—that isms were ancestor in the ancient past. Another famous transitional fossil is transitional fossil Another famous modification—which predicts such intermedi- predicts such modification—which forms—is correct.ate tetrapods, Unlike whale. , an early and then spread first in water evolved which even- creatures land-dwelling land, some to the sea, back to adapt- way their tually made group That once more. life an aquatic ing to porpoises, includes cetaceans—whales, and dolphins. The ancestor of cetaceans a was lived mammal that land-dwelling wolf-size this Although animal, ago. 50 million years of a land animal, the body , had Pakicetus its head had legsincluding four and paws, of a whale’s. reminiscent shape the long skull the period since the from dating Fossils whales how show lived Pakicetus time that Copyright Freeman Publishers. ©2018 W.H. Distributed by W.H. Freeman Publishers. Not for redistribution. for an increasingly aquatic existence, including specializations of the and neck and almost complete loss of the . the ear and neck and almost complete loss existence, including specializations of for an increasingly aquatic Another Evolutionary Transition: Land-dwelling mammals to -dwelling whales to ocean-dwelling mammals Transition: Land-dwelling Evolutionary Another , was also terrestrial. Transitional fossils illustrate adaptations fossils illustrate adaptations Transitional , was also terrestrial. early whale, Pakicetus mammals. A very whales were terrestrial Ancestors of 15–18 meters long only in water Has vestigial hindlimbs Lived only in water Had reduced hindlimbs Spent time on land and in water Had hindlimbs 6 meters long Spent time on land and in water Spent time on land and Had hindlimbs 3 meters long 1.8 meters long • • • • • • • • • • • • Bowhead Whale Balaena mysticetus (modern species) Dorudon (40 million years ago) (46 million years ago) Rodhocetus (46 million years (52 million years ago) Pakicetus (52 million years

UNIT 3 • HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY 15 358 21_SHU_31905_ch15_346_367.indd 358 359 15 EVIDENCE FOR EVOLUTION 13/07/17 11:29 AM Manipulation of objects Homo sapiens) ( Mammal: Anatomical, genetic, or developmental similarity to due organisms among ancestry.common Gallus gallus Weight-bearing on land; flying domesticus) Bird: Chicken ( Weight-bearing on land near water Alligator ( mississippiensis) Reptile: Alligator Weight-bearing in shallow water Swimming Amphibian ) Tetrapods ( Common Ancestor the same ancestor—in this case, ancestor—in the same an amphib- is this sig- . Why Tiktaalik like creature ious time you every nificant? of it this Think way: wrist a swipe back and forth—to bend your ear, your a cell phone to or hold paint brush using structures that are example—you for in fish. ago years million 375 first evolved points out, “ThisAs Shubin is some not just this is our of evolution; branch weird archaic, (INFOGRAPHIC 15.5). of evolution” branch Tiktaalik Forelimbs specialized for: Forelimb Homology in Fish and Tetrapods Forelimb Homology Lobe-finned Eusthenopteron) ( Copyright Freeman Publishers. ©2018 W.H. Distributed by W.H. Freeman Publishers. Not for redistribution. Intermedium Other wrist bones Radials Digits The number, order, and underlying structure of the forelimb bones are similar in all the groups illustrated below. The dierences in The number, order, and underlying structure each bone contribute to the specialized function of each forelimb. This anatomical shape the relative width, length, and strength of to dierent environments. and function reflect evolutionary adaptations Perca fluviatilis) Which bone is closest to the body the all in weight-bearing forelimbs? ( The fact that all tetrapods share the same The fact share tetrapods all that Humerus Radius Ulna Ulnare Ray-finned: Perch INFOGRAPHIC 15.5 Fish ? forelimb bones, arranged in the same order, is in the same order, bones, arranged forelimb —a similarity of homolo�y due to an example Darwin, compara- Before common ancestry. sim- such many identified had anatomists tive a was lacked they what ilarities in anatomy; similar- such why for satisfactory explanation expla- that ity exist. Darwin provided should ones that structures are homologous nation: inherited from are they similar because are 21_SHU_31905_ch15_346_367.indd 359 13/07/17 11:29 AM possessdo Development helps us solve other evo- helps us solve Development molec- the to further, even in Zooming

chickens and you’ll see that they all look all look they that see you’ll and chickens - the embry should Why similar. remarkably the resemble a human of onic stage the adults of a fish when stage embryonic Similar of each species look so different? embryological further structures evi- are a common have all vertebrates dence that . (INFOGRAPHIC 15.6) ancestor as why such as well, lutionary conundrums other limbs like have don’t snakes like reptiles fact,In tetrapods. snake the beginnings of limbs, but these limb buds into rudimentary remain develop not do and can still see you limbs (although full-fledged hindlimbs in some species of snake stubby serve which structures, vestigial Such today). functionorganism,modern in a apparent no thesenow evolution: for evidence strong are from inherited are useless features apparently function.a did serve they whom in ancestor an structures include of vestigial Other examples tailbone and the phenomenon ofthe human pimples” (technically called erector “goose puff help to animals in fur-covered pili), which maintain better fur up to heat. of examples more still find we level, ular of com- evidence more thus homology—and since known Scientists have mon ancestry. is the molecule of hered- DNA that the 1950s organisms all living by it is and that shared ity, on Earth. molecule of DNA—whether Every bacterium, fish, maple tree, or human— from (A, C, nucleotides is of the same four made and G), and all organisms use the informa- T, make to those nucleotides tion encoded by using the in the same basic way, Why 8). Chapter (see code genetic universal things use the same system all living should The best information? of decoding genetic the one was is this that system explanation living ancientthe all of ancestor by used organisms,descen- all of its passed on to billions of throughout dants, and preserved of evolution. years Simon D. Pollard/Science Source Pollard/Science D. Simon Vestigial leg bones If they have the same bones, why then same bones, the why have If they can in adult see homology not only We do a human arm and a bird wing look so dif- wing look so and a bird arm do a human during the process that Remember ferent? continually are , cell of and of genes, DNA the into being introduced or in occur these mutations when that mutations eggSuch inherited. are they cells, in the proteins changes subtle can produce involved those genes—proteins encoded by up an in constructing make the bones that in bone Changes example. arm or a wing, for bones, altered slightly in can result proteins or thinner. instancefor making them longer helpful to When these bones modified are and , survival an organism’s the passed on to are traits the advantageous that emerge and populations generation, next with these This adaptations. “descent have again) results phrase (Darwin’s modification” organismscommon— sharing in diverse homologous—structures and putting them to uses. different as well. development but in early anatomy, vertebrate of embryos early a look at Take and fish, as humans, diverse as animals Copyright Freeman Publishers. ©2018 W.H. Distributed by W.H. Freeman Publishers. Not for redistribution. VESTIGIAL VESTIGIAL STRUCTURE STRUCTURE ancestor that no longer organism that possesses it. possesses that organism serves a clear function the in A structure inherited from an Some snakes have remnants of and leg bones left over from their their from over of pelvis and leg bones left remnants have Some snakes ancestors. four-legged Snakes have remnants of pelvis and leg bones leftover from their four-legged ancestors.

UNIT 3 • HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY 15 360 21_SHU_31905_ch15_346_367.indd 360 361 15 EVIDENCE FOR EVOLUTION

13/07/17 11:29 AM

Courtesy of Rachel M. Warga M. Rachel of Courtesy Volodymyr Kozieiev/ Dreamstime.com Kozieiev/ Volodymyr

Fish

ISM / Michel DELARUE / Medical Images Medical / DELARUE Michel / ISM Murray/iStockphotos Tamara

Bird

dhalbrook/iStockphoto Olivier Pourquié Olivier

Snake

Cameron Spencer/Getty Images Spencer/Getty Cameron of Science/Science Source Science/Science of Eye

mutations will tend to be preserved, while while be preserved, to will tend mutations be selected to will tend harmful mutations of much In addition, against and eliminated. consists of non- of long stretches DNA our function. known no with sequences coding no in these have Because regions mutations over effect on an organism, accumulate they descen- passed on to are time. As mutations differences of sequence dants, the number between the ancestor and its descendants

Cat

Claudia Dewald/iStockphoto Claudia Omikron Omikron/Getty Images Omikron/Getty Omikron Early Development Early Vertebrate Animals Share a Similar Pattern of Pattern a Similar Share Animals Vertebrate Human Copyright Freeman Publishers. ©2018 W.H. Distributed by W.H. Freeman Publishers. Not for redistribution. We can identify homologous structures by tracing their embryological development. Some of our bones, for example, are development. Some of our middle ear structures by tracing their embryological We can identify homologous these structures develop from gills in fish. We know this because all of bones of reptiles and bones supporting homologous with the have a post-anal tail (the in development. Similarly, all vertebrates that appear in all vertebrate embryos early the pharyngeal pouches evidence that all vertebrate These developmental homologies are strong cord past the anus) during development. extension of the spinal stages that give rise to distinct time have introduced modifications in later common ancestry. Genetic changes over animals are related by di erences. species with vast physical Of the organisms shown, which post-anal a have tail as adults? Pharyngeal pouches Post-anal tail Limb buds INFOGRAPHIC 15.6 INFOGRAPHIC ? Adult Organisms on species-specific shape and function. Later in development, these structures take Early Embryos of related organisms share common structures. Early-stage embryos DNA and Descent and DNA organisms share While all living the twono code, species share genetic the nucleotides. of DNA same sequence exact described (as because 10) in Chapter That’s and other muta- replication in DNA errors variation introducing continually tions are they (and the proteins sequences DNA into time, neutral and advantageous encode). Over 21_SHU_31905_ch15_346_367.indd 361 13/07/17 11:29 AM - opment in fish—though endwith a different than rather (fins result limbs). how and work these genes in their changes how cansequences DNA large-scaleproduce plan in body changes or limb structure is a of biologyrightarea hot known informally now, (short for as “evo-devo” develop “evolutionary mentalbiology”). past life, the fossil record is still record fossil the past life, . They knew, from the existing fossil fossil existing the from knew, . They all —Ted Daeschler —Ted ­Tiktaalik Filling in the Gaps he thinks is most interesting what Asked of Tiktaalik, Daeschler the discovery about is a popular mis- he says homes in on what it’s record—that the fossil conception about not simply But that’s “spotty” and “chaotic.” the factDespite it does that not true, he says. record in fact, can good, you “very that good”—so can, test predictions. You and make to it use of fish record the fossil look at example, for and—suspectingand tetrapods on the basis related— are the two that groups of anatomy an intermediate-looking that hypothesize point. some at existed have animal must it. look for can Daeschler refers go Then you and as “filling in the gaps,” thisto process did with he and Shubin what exactly it’s - reli is a more evidence often DNA 16, Chapter common ancestry to able clue than is physical canand con- on check a as appearance, serve - or anat record fossil the from clusions derived is knowledge our DNA deepening As well, omy. constructed the molecular at limbs are of how lab have in Shubin’s Scientists level. working limb orchestrate the same genes that shown as chickens, in animals as diverse development discovered they In 2016, mice, and humans. - devel fin also coordinate these same genes that splits the - “

” sh—lived sh—lived ­ common common . Tiktaalik difference between think we something and as a fish of think we something as a limbedof animal. - ancestor—a lobed-finned fi ­ancestor—a (INFOGRAPHIC 15.7) When combined with evidence from the from When combined with evidence For example, when scientists looked at at scientists when looked example, For roughly 375 million years ago. The more more The ago. years million 375 roughly two the more speciesdistantly are, related and sequences, in DNA differences sequence serves will see. DNA you the less homology, eachclock: molecular of kind a as additional a tick of the clock, is like difference sequence has elapsed of time that the amount showing a since the two species shared discussed evidence, of line fourth a in ography, 16), Chapter molecular data become a powerful see in As we’ll understanding for tool evolution. fossil record, anatomy, development (and bioge development anatomy, record, fossil ancestor grows—slowly in the case- cod of sequences grows—slowly structures criticaling for are whose proteins their functions, to and more adapted well in the case of noncoding DNA,rapidly which Closely making proteins. in is not involved more have species will therefore related than species sequences are that similar DNA distantly related. more cystic fibrosis DNA—the of one specificregion (or CFTR ) region— regulator transmembrane that discovered they in this DNA human isregion - 99% iden tical to DNA. The fact the that of these twoDNA spe cies identical is nearly reflects the fact that chimps and humans a common share - rel lived ancestor that recently—just atively ago. 5–7 million years contrast, human By identical isDNA 85% of a mouse the DNA to given sense makes this which at region, same common a share and mice humans that between mil- 100 and 60 lived that ancestor Less identity sequence would ago. lion years whose and a , be seen between a human common Copyright Freeman Publishers. ©2018 W.H. Distributed by W.H. Freeman Publishers. Not for redistribution.

UNIT 3 • HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY 15 362 21_SHU_31905_ch15_346_367.indd 362 363 15 EVIDENCE FOR EVOLUTION

13/07/17 11:29 AM PhotoAlto / Alamy / PhotoAlto Human

100% similarity Tier und Naturfotogra e / Superstock / Naturfotogra e und Tier Common ancestor of and humans, about 5–7 mya. 3 dierences in 30 nucleotides similarity 3/30 = 10%; or 90% 5 dierences in 30 nucleotides similarity 5/30 = 17%; or 83% n Chimpanzee Data from Thomas, J.W. et al. (2003) 424:788-793 99% similarity

Common ancestor of mice, chimpanzees, and humans, about 60–100 mya. Tier und Naturfotogra e / Superstock / Naturfotogra e und Tier ACTTCTAC ACTTCTAC GCC of evolution is correct: “It confirms that we have have is we “It confirms that correct: of evolution of understandingframework of the good a very predicted “We Daeschler. says the ,” with enough, Tiktaalik, and sure something like it.” a little time and effort, found we Mouse ACATA Common ancestor of puerfish, mice, chimpanzees, and humans, about 420 mya. 85% similarity C CGAGGTTCTACATTGC CGAGGTTCG

A A Related Organisms Share DNA Sequences Share Organisms Related Steven Hunt/Getty Images Hunt/Getty Steven A A ACATTGCAACTTCTAC GGTATCGAGGTTCT GGA GGA Copyright Freeman Publishers. ©2018 W.H. Distributed by W.H. Freeman Publishers. Not for redistribution. Pufferfish 65% similarity Species A Close relative Distant relative Related organisms share DNA sequences inherited from a common ancestor. Over time, the sequence in each species acquires independent ancestor. Over time, the sequence in each DNA sequences inherited from a common Related organisms share Thus, the percentage of of sequence dierences that will be present. time that has passed, the greater the number mutations. The more of the evolutionary distance between them. between two species gives an indication nucleotides that dier What is the percent similarity between the close relative and the distant relative shown the in top panel? is excit- Tiktaalik Daeschler, and Shubin For Similarity to human DNA sequences for the CFTR region Similarity to human DNA sequences Sequence homology between species Sequence homology INFOGRAPHIC 15.7 INFOGRAPHIC ? record, when such a creature was likely to to likely was a creature such when record, of question just a then it was so existed, have it. for look to where understanding our that shows it ing because 21_SHU_31905_ch15_346_367.indd 363 CHAPTER 15 SUMMARY

■■ The theory of evolution—what Darwin called circumstances provide opportunities for new “descent with modification”—draws two main adaptations to evolve by . conclusions about life: that all living things are ■■ Homology—the anatomical, developmental, or related, sharing a common ancestor in the distant genetic similarities shared among groups of related past; and that the species we see today are the organisms—is strong evidence that those groups result of natural selection operating over millions descend from a common ancestor. of years. ■■ Homology can be seen in the common bone ■■ The theory of evolution is supported by a wealth of structure of the forelimbs of tetrapods, the similar evidence, including fossil, anatomical, and DNA of all vertebrate animals, evidence. and the universal genetic code. ■■ Fossils are the preserved remains or impressions of ■■ Many genes, including those controlling limb once-living organisms that provide a record of past development, are shared among distantly related life on Earth. Not all organisms are equally likely to species, an example of molecular homology owing form fossils. to common ancestry. ■■ Fossils can be dated directly or indirectly: on the ■■ DNA can be used as a : more- basis of the age of the rocks they are found in, or on closely related species show greater DNA sequence their position relative to rocks or fossils of known homology than do more-distantly related species. ages.

■■ When fossils are dated and placed in sequence, they show how life on Earth has changed over time. MORE TO EXPLORE ■■ As predicted by descent with modification, the ■■ Tiktaalik roseae home page: http://tiktaalik.uchicago.edu fossil record shows the same overall pattern for all ■■ PBS, Your Inner Fish (2014): http://www.pbs.org/your- inner-fish/home/ lines of descent: younger fossils are more similar to ■■ Shubin, N. (2008) Your Inner Fish: A Journey into the modern organisms than are older fossils. 3.5-Billion- History of the Human Body. New York: Random House. ■■ Descent with modification also predicts the ■■ Nakamura, T., et al. (2016). Digits and fin rays share existence of intermediate organisms, such as common developmental histories. Nature 537:225–228. Tiktaalik, that possess mixtures of “old” and “new” ■■ Daeschler, E. B., et al. (2006) A Devonian tetrapod-like fish and the evolution of the tetrapod . Nature traits. Tiktaalik has features of both fish and 440:757–763. tetrapods (four-limbed vertebrates). ■■ PBS, NOVA (2009) What Darwin Never Knew, based on Carroll, S. (2006) Endless Forms Most Beautiful: The New ■■ An organism’s anatomy reflects adaptation to its Science of Evo Devo. New York: Norton. ecological environment. Changed ecological

Copyright ©2018 W.H. Freeman Publishers. Distributed by W.H. Freeman Publishers. Not for redistribution.

21_SHU_31905_ch15_346_367.indd 364 13/07/17 11:29 AM CHAPTER 15 Test Your Knowledge

DRIVING QUESTION 1 How does the fossil USE IT record reveal information about evolutionary changes? 5 You have molecular evidence that leads you to hypothesize that a particular group of soft-bodied sea By answering the questions below and studying cucumbers evolved at a certain time. You have found a Infographics 15.1, 15.2, and 15.3, you should be able fossil bed with many hard-shelled mollusks dating from to generate an answer for the broader Driving the critical time, but no fossil evidence to support your Question above. hypothesis about the sea cucumbers. Does this cause you to reject your hypothesis? Why or why not?

KNOW IT 6 A specific type of oyster is found in North American fossil beds dated from 100 million years ago. If similar 1 Which of the following is most likely to leave a fossil that oyster fossils are found in European rock, in layers represents most of the organism? along with a novel type of barnacle fossil, what can be concluded about the age of the barnacles? Explain your a. a jellyfish answer. b. a c. a wolf apply YOUR d. an octopus (an organism that lacks a skeleton) KNOWLEDGE e. All of the above are equally likely to leave a fossil. BRING IT HOME

2 Generally speaking, if you are looking at layers of rock, 7 Do an Internet search to find out about fossils at what level would you expect to find the newest— discovered in your home state. Determine what that is, the youngest—fossils? kinds of organisms they represent, how old they are, and where in your state you would need to 3 You are examining a column of soil that contains go in order to have a chance of finding fossils in vertebrate fossils from deeper to shallower layers. the field. Would you expect a fossil with four limbs with digits to occur higher or lower in the soil column relative to a “standard” fish? Explain your answer.

4 What can the fossil shown below tell us about the DRIVING QUESTION 2 What features make structure and lifestyle of the organism that left it? Tiktaalik a transitional fossil, and what role do these types of Describe your observations. fossils play in the fossil record?

By answering the questions below and studying Infographics 15.4 and 15.5, you should be able to generate an answer for the broader Driving Question above.

KNOW IT

8 Which of the following features of Tiktaalik is not shared with other bony fishes? a. scales b. teeth

Mantonature/istockphoto Mantonature/istockphoto c. a mobile neck d. fins e. none of the above

Copyright ©2018 W.H. Freeman Publishers. Distributed by W.H. Freeman Publishers. Not for redistribution.

21_SHU_31905_ch15_346_367.indd 365 13/07/17 11:29 AM 13/07/17 11:29 AM TTTCTAGGAATA TTTCTAGGAATA ter paws have five digits? five have paws ter east and in sea urchins. Both east and in sea urchins. o from a chicken ? Why or why or why Why embryo? a chicken o from ee sequences of a given gene from three three from gene given ee sequences of a What do these structures develop into in an into develop these structures What do is present in y in X is present not? encodes the amino acid sequence phenylalanine– what amino acid sequence leucine–glycine–isoleucine, in bacteria? will that same DNA sequence specify is slightly but the yeast X, protein produce What explains protein. sea urchin the from different use this information might you How this difference? to evolutionarily closer whether humans are judge to sea urchins? or to yeast Vertebrate embryos have structures called pharyngeal pharyngeal called structures have embryos Vertebrate pouches. fish? In an adult bony adult human? thr have You how determine could you How organisms. different related? are organisms closely the three that the fact for explanation What is the evolutionary and ot both human hands a distinguish of a tail to use the presence Could you human embry the DNA sequence in humans, If, Gene

18 19 14 15 USE IT 16 17 ed t fish, part part t fish, ure and function of an and function ure What can anatomy andWhat anatomy can ibed as “intermediate” or “intermediate” ibed as e both fishlike and tetrapod-like and tetrapod-like e both fishlike Copyright Freeman Publishers. ©2018 W.H. Distributed by W.H. Freeman Publishers. Not for redistribution. Compare and contrast the struct contrast and Compare and function of a human eagle wing with the structure arm. tetrapod. Speculate on the fossil appearance of its appearance on the fossil Speculate tetrapod. would descendant—what features tetrapod first true you old would ? How Titkaalik distinguish it from ? Titkaalik to be relative to expect those fossils modifications that allow If some fish evolved didn’t fish just why be successful on land, them to still plenty of there are why disappear? In other words, favorable so many fish in the sea if the land presented opportunities? has been called a “fishapod”—par Tiktaalik has been called a fossils hav Tiktaalik fossils characteristics. Which characteristics are related to to related are characteristics Which characteristics. out of the water? the body supporting “transitional” fossils. What does this mean? Why are are Why What does this mean? fossils. “transitional” of life? in the history significant organisms transitional fossils are descr are Tiktaalik fossils



9 DNA reveal about evolution? DRIVING QUESTION 3 DRIVING QUESTION KNOW IT KNOW 13 12 By answering the questions below and studying should you be able Infographics and 15.7, 15.6, 15.5, to generate an answer for the broader Driving Question above. 11 USE IT 10

UNIT 3 • HOW DOES LIFE CHANGE OVER TIME? EVOLUTION AND DIVERSITY 15 366 21_SHU_31905_ch15_346_367.indd 366 367 15 EVIDENCE FOR EVOLUTION 13/07/17 11:29 AM YOUR YOUR apply KNOWLEDGE ACTCCGGCCCCTACATCCCCAGCTCCCA ACTCCGGCCCCTACATCCCCAGCTCCCA AGTCTGGCTCCTACATCTCCAGCTCCCA ACTCCGGCCCCTACATCCCCAGCTCCCA ACTCTGGCCCCTACATCCCCAGCTCCCA ATTCTGGCTCCTACATTTCCAGCTCCCA ACTCCGGCCCCTACATCCCCAGCTCCCA Sequence ACTCCGGCCCCTACATCCCCAGCTCCCA YOUR YOUR apply KNOWLEDGE (dog) Tiktaalik (or an equally (rhesus monkey) (chimpanzee) (human) (human) (human) (human) Copyright Freeman Publishers. ©2018 W.H. Distributed by W.H. Freeman Publishers. Not for redistribution. (pig) Homo sapiens Homo scrofa Sus sapiens Homo Macaca mulatta Homo sapiens Homo Pan troglodytes Homo sapiens Homo familiaris lupus Canis Species gene from pairs of different species, given below. below. given species, different pairs of from CDSN gene of the Look at the sequence of a portion in other organisms. appears to organism which sequence, in this the variations From the number of differences. determine pair, each For humans? to closely related be least to appears organism Which humans? to be most closely related important transitional fossil) had been found had been found fossil) transitional important a private and sold to hunters fossil amateur by be any should think there Do you collector? the loss prevent to hunting fossil of regulation the from scientific information of valuable public domain? of many lineages of plants and animals. of plants and animals. lineages of many scientific a valuable represent therefore They What resource. if ). This gene is present is present gene This (CDSN). dogs is called corneodesmosin in Mexican hairless hairlessness for responsible The gene understand the evolution us to allow Fossils INTERPRETING DATA INTERPRETING CASE MINI 20 21 21_SHU_31905_ch15_346_367.indd 367 HPHLP representing Macmillan Learning 300 American Metro Blvd, Suite 140 Hamilton, NJ 08619 macmillanlearning.com

Real stories. Real biology.

INSIDE: SAMPLE CHAPTER 8 Genes to Proteins: Bulletproof SAMPLE CHAPTER 15 Evidence for Evolution: A Fish with Fingers?

To request your review copy, contact your local Macmillan Learning representative or visit macmillanlearning.com/learnmoreShuster3e

Copyright ©2018 W.H. Freeman Publishers. Distributed by W.H. Freeman Publishers. Not for redistribution.