DOCSLIB.ORG

Identification, Isolation, and Overexpression of the Gene Encoding the * Subunit of DNA Polymerase III Holoenzyme JEFFREY R

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Identification, Isolation, and Overexpression of the Gene Encoding the * Subunit of DNA Polymerase III Holoenzyme JEFFREY R JOURNAL OF BACTERIOLOGY, Sept. 1993, p. 5604-5610 Vol. 175, No. 17 0021-9193/93/175604-07$02.00/0 Copyright © 1993, American Society for Microbiology Identification, Isolation, and Overexpression of the Gene Encoding the * Subunit of DNA Polymerase III Holoenzyme JEFFREY R. CARTER,' MARY ANN FRANDEN,1 RUEDI AEBERSOLD,2 AND CHARLES S. McHENRY'* Department ofBiochemistry, Biophysics and Genetics, The University of Colorado Health Sciences Center, 4200 East Ninth Avenue, Denver, Colorado 80262,1 and The Biomedical Research Centre and Department ofBiochemistry, University ofBritish Columbia, Vancouver, British Columbia, Canada, V6T 1Z32 Received 26 April 1993/Accepted 16 June 1993 The gene encoding the 4 subunit of DNA polymerase m holoenzyme, holD, was identified and isolated by an approach in which peptide sequence data were used to obtain a DNA hybridization probe. The gene, which maps to 99.3 centisomes, was sequenced and found to be identical to a previously uncharacterized open reading frame that overlaps the 5' end of riml by 29 bases, contains 411 bp, and is predicted to encode a protein of 15,174 Da. When expressed in a plasmid that also expressed hoiC, holD directed expression of the * subunit to about 3% of total soluble protein. DNA polymerase III holoenzyme (referred to here as contribution of X and 4, to holoenzyme requires purification holoenzyme) is the 10-subunit replicative enzyme of Esche- of large quantities of each subunit. In this report, we present richia coli. Several biochemical properties distinguish this a vital step toward this objective: the identification, isola- polymerase from the nonreplicative polymerases of E. coli. tion, and overexpression of the gene encoding 4. These include its requirement for single-stranded DNA- binding protein (15), resistance to physiological concentra- tions of salt (2, 8, 17) and spermidine (11), and very high MATERIALS AND METHODS processivity (52). In addition, holoenzyme is thought to Chemicals. Tris-HCl, polyvinylpyrrolidone, dextran sul- adopt an asymmetric, dimeric polymerase conformation that fate, bovine serum albumin, and Ficoll were purchased from allows coordinated leading- and lagging-strand synthesis (19, Sigma. Sodium dodecyl sulfate (SDS), acrylamide, N,N'- 21, 33, 51), and to interact with other proteins of the methylenebisacrylamide, ammonium persulfate, and Coo- replisome (25), e.g., the primosome (53, 56), allowing addi- massie brilliant blue R-250 were purchased from Bio-Rad. tional communication among the various replication en- Urea was purchased from Fisher. SeaKem LE agarose was zymes. purchased from FMC BioProducts. Holoenzyme can be divided into three functional compo- Oligonucleotides. Oligonucleotides were synthesized at the nents. The core polymerase, polymerase III (31), contains University of Colorado Cancer Center Macromolecular Syn- three subunits: a (dnaE [50]), the catalytic subunit (28, 29); thesis Core Facility and purified as described before (5). E (dnaQ [9, 44]), the 3'--5' proofreading subunit (9); and 0 Oligonucleotide sequences are shown in Fig. 1. (holE [4, 46]), which has no known role. These three Bacterial strains, plasmids, phages, and media. XLlBlue subunits are also isolable as part of a four-subunit complex, [F' proAB lacIqZAM15 TnlO (Tetr)IrecAl endA1 gyrA96 thi polymerase III' (30), which contains the T subunit (dnaX [27, hsdRl7 supE44 reLA1 lac; Stratagene] was used for routine 35]). Polymerase III is distinguished from holoenzyme by its plasmid transformation and purification. MGC100, an isolate sensitivity to single-stranded DNA-binding protein and sper- of RS320 [Alac(IPOZYA)U169 Alon araD139 strA supF; gift midine (11) and by its very low processivity (11, 12). of R. Sclafani, University of Colorado Health Sciences Processivity is conferred on the polymerase by the 3 subunit Center] resistant to a phage that contaminates our fermenter (dnaN [3, 8]), which assembles as a torus-shaped dimer (probably bacteriophage T1), was the source of holoenzyme. around primed template DNA, forming a sliding clamp that MAF102, a lexA3 uvrD (49) derivative of the wild-type strain fastens the polymerase to the template (23, 47). The ,B MG1655 (18), was the source of E. coli chromosomal DNA. subunit is loaded onto a primed template in a reaction The primary cloning vector was pBlueScript II SK+ requiring ATP hydrolysis and catalyzed by the y complex (Stratagene). All expression plasmids (pMAF51, pMAF300, (23, 47), a DNA-dependent ATPase containing ry (dnaX [13, pMAF310, and pRT581) were derivatives of pBBMD11, the 27]), 8 (holA [5, 10]), 8' (holB [5, 10]), X (holC [6, 54]), and P. original laboratory tac promoter-based expression plasmid In in vitro replication reactions, the indispensable activity (14, 32, 48). pRT581 expresses the 51-kDa subunit of human of the -y complex can be provided by the two-subunit immunodeficiency virus reverse transcriptase (48). The X complexes yb, Tb, and Tb' (36). The contribution of the subunit expression plasmid pMAF51 (6) was the positive- remaining two -y complex subunits, X and *, is more subtle. control plasmid in the overexpression experiment. Together, X and * stabilize reconstituted polymerase L broth and agar (34) were used for routine bacterial (otel3yb) against higher concentrations of salt (36) and mod- growth. F medium (1.4% yeast extract, 0.8% peptone, 1% erately stimulate the DNA-dependent ATPase activity of glucose, 1.2% potassium phosphate [pH 7.5]) was used in the reconstituted y complex (-ybb' [37]). To understand fully the holD expression experiment. When required, ampicillin, streptomycin, and tetracycline were used at 150, 25, and 10 ,ug/ml, respectively. * Corresponding author. Enzymes. Restriction enzymes and T4 DNA ligase were 5604 VOL. 175, 1993 GENE FOR * SUBUNIT OF DNA POLYMERASE III HOLOENZYME 5605 PCR to obtain a DNA probe obtained from Takara Shuzo, Inc. Hybridization of radiola- CTCGAATTCARCARYTNGGNATHAC #1.1 beled probe DNA to this blot was performed according to CTCGAATTCGCNATGYTNCCNCARGG #2.1 the procedures provided with the blot. CTGCATCTAGACCYTGNGGNARCATNGC #2 .2 DNA sequencing. Dideoxy chain termination DNA se- CTCGAATTCGARGGNGCNCARGTNGC #3.1 quencing (43) of polymerase chain reaction (PCR) products cloned into pBlueScript II SK+ was performed with the CTGCATCTAGAGCNACYTGNGCNCCYTC #3.2 Sequenase version 2.0 DNA sequencing kit from United States Biochemical Corp. DNA was labeled with [35S]dATP PCR to clone the entire gene (12.5 mCi/ml). Sequencing reactions were subjected to elec- CTGCATCTAGACGCCCTGGTTGCTGGCAAACG trophoresis on a 6% polyacrylamide-8 M urea gel as de- CTCGAATTCTTGGCGCGGTATCGACGAATT scribed before (42). Gels were dried and autoradiographed for 24 to 48 h with Kodak X-Omat AR X-ray film. Dideoxy Construction of holD overexpression plasmid chain termination sequencing of two independent isolates of CCATAGATCTGATATCAGGAGGTAATAAATA- the gene encoding 4 was performed by Lark Sequencing ATGACTTCCCGTCGCGACTGGCAG Technologies, Inc. (Houston, Tex.). The entire gene was sequenced in both directions. GGACAGTCGACGGTAAGCCGGCGGTAAATCAGTCG PCR. PCR was performed in a Perkin Elmer Cetus model FIG. 1. Oligonucleotides. Abbreviations: H, A, C, or T; R, A or 480 PCR machine. Reactions designed to amplify fragments G; Y, C or T; N, A, C, G, or T. of the gene encoding 4 were performed with the Perkin Elmer GeneAmp PCR reagent kit that included AmpliTaq DNA polymerase. Each 100-,ul reaction mix contained 1 ng purchased from Promega or New England Biolabs. Vent of E. coli chromosomal DNA and two oligonucleotide prim- polymerase was purchased from New England Biolabs. Calf ers, each at 1 ,uM. Reaction mixes were incubated without intestinal alkaline phosphatase was purchased from Boehr- polymerase or deoxynucleoside triphosphates (dNTPs) at inger Mannheim Biochemicals. Commercial proteins were 94°C for 7 min to denature template DNA and shifted to 85°C used according to instructions provided by the manufactur- for 4 min to allow addition of polymerase and dNTPs. ers. Holoenzyme was purified as described before (7). Reaction mixes were then cycled 35 times through a 1-min DNA purification. Plasmid DNA was isolated by the alka- incubation at 94°C, a 5-min ramp from 50 to 65°C, and a rapid line-SDS lysis procedure (la), and purified by two CsCl- return to 94°C. ethidium bromide equilibrium density gradient centrifuga- PCRs used to amplify the entire gene encoding 4 were tions (42). Alternatively, plasmid DNA was purified with the performed with Vent polymerase and the reaction buffer Promega Magic Mini Prep or Magic Maxi Prep kit. Chromo- supplied by New England Biolabs. Each 60-,ul reaction mix somal DNA was extracted and purified by two 55% (wt/vol) contained 100 ng of template DNA, two oligonucleotide CsCl equilibrium density gradient centrifugations as de- primers, each at 1 ,uM, and bovine serum albumin at 100 scribed before (7). ,ug/ml. Tubes containing template DNA and primers were DNA restriction fragments were separated by agarose gel incubated at 94°C for 7 min to denature the template and electrophoresis, excised from the gel without UV irradiation shifted to 85°C. One unit of Vent polymerase and the four of the DNA (7), and purified with the GeneClean DNA dNTPs, each at a final concentration of 0.2 mM, were added purification kit from Bio 101. to each reaction mixture. The reaction mixes were cycled 25 Agarose gel electrophoresis. Horizontal agarose gel elec- times through a 1-min incubation at 94°C, a 2-min incubation trophoresis was performed as described
Load more

Recommended publications
  • Chi Subunit of Polymerase III Holoenzyme May Have Function in Addition to Facilitating DNA Replication
    Chi Subunit of Polymerase III Holoenzyme May Have Function in Addition to Facilitating DNA Replication Master’s Thesis Presented to The Faculty of the Graduate School of Arts and Sciences Brandeis University Department of Biochemistry Dr. Susan Lovett, Advisor In Partial Fulfillment of the Requirements for the Degree Master of Science in Biochemistry by Taku Harada May 2018 Copyright by Taku Harada © 2018 Acknowledgments I would like to thank my advisor Dr. Susan Lovett. Thank you for sharing this opportunity to explore the E. coli genome with you. I had a wonderful experience. Along the way, your unwavering support and encouragement was irreplaceable. I am greatly fortunate and appreciative. Thank you to my mentor Dr. Alex Ferazzoli. No amount of words could ever describe the gratitude I have for you. You were a mentor for me in science and life. Thank you for always supporting and encouraging me to learn even if, at times, it meant failure. I attribute my success to your investment and confidence in me. Most importantly, your enthusiasm and joyous personality is inspirational and made every day a good day. Thank you to Ariana, Dr. Cooper, Laura, Vinny, Julie, McKay and everyone who worked in the Lovett lab during my stay. You all welcomed me in and provided a supportive environment that extended beyond the lab walls. I am very fortunate to have worked with all of you. Thank you to all my friends. Special thanks Adib, Eli, Jessie, and Rich. My four years at Brandeis have been phenomenal because of your support and motivation. I look forward to many more years of friendship.
    [Show full text]
  • DNA POLYMERASE III HOLOENZYME: Structure and Function of a Chromosomal Replicating Machine
    Annu. Rev. Biochem. 1995.64:171-200 Copyright Ii) 1995 byAnnual Reviews Inc. All rights reserved DNA POLYMERASE III HOLOENZYME: Structure and Function of a Chromosomal Replicating Machine Zvi Kelman and Mike O'Donnell} Microbiology Department and Hearst Research Foundation. Cornell University Medical College. 1300York Avenue. New York. NY }0021 KEY WORDS: DNA replication. multis ubuni t complexes. protein-DNA interaction. DNA-de penden t ATPase . DNA sliding clamps CONTENTS INTRODUCTION........................................................ 172 THE HOLO EN ZYM E PARTICL E. .......................................... 173 THE CORE POLYMERASE ............................................... 175 THE � DNA SLIDING CLAM P............... ... ......... .................. 176 THE yC OMPLEX MATCHMAKER......................................... 179 Role of ATP . .... .............. ...... ......... ..... ............ ... 179 Interaction of y Complex with SSB Protein .................. ............... 181 Meclwnism of the yComplex Clamp Loader ................................ 181 Access provided by Rockefeller University on 08/07/15. For personal use only. THE 't SUBUNIT . .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. 182 Annu. Rev. Biochem. 1995.64:171-200. Downloaded from www.annualreviews.org AS YMMETRIC STRUC TURE OF HOLO EN ZYM E . 182 DNA PO LYM ER AS E III HOLO ENZ YME AS A REPLIC ATING MACHINE ....... 186 Exclwnge of � from yComplex to Core .................................... 186 Cycling of Holoenzyme on the LaggingStrand
    [Show full text]
  • Connecting Replication and Repair: Yoaa, a Helicase-Related Protein, Promotes Azidothymidine Tolerance Through Association with Chi, an Accessory Clamp Loader Protein
    RESEARCH ARTICLE Connecting Replication and Repair: YoaA, a Helicase-Related Protein, Promotes Azidothymidine Tolerance through Association with Chi, an Accessory Clamp Loader Protein Laura T. Brown, Vincent A. Sutera, Jr., Shen Zhou, Christopher S. Weitzel¤, Yisha Cheng, Susan T. Lovett* a11111 Department of Biology and Rosenstiel Basic Medical Sciences Research Center MS029, Brandeis University, Waltham, Massachusetts, United States of America ¤ Current address: Department of Biochemistry, School of Molecular and Cellular Biology, University of Illinois Urbana-Champaign, Urbana, Illinois, United States of America * [email protected] OPEN ACCESS Abstract Citation: Brown LT, Sutera VA, Jr., Zhou S, Weitzel CS, Cheng Y, Lovett ST (2015) Connecting Elongating DNA polymerases frequently encounter lesions or structures that impede prog- Replication and Repair: YoaA, a Helicase-Related ress and require repair before DNA replication can be completed. Therefore, directing repair Protein, Promotes Azidothymidine Tolerance through Association with Chi, an Accessory Clamp Loader factors to a blocked fork, without interfering with normal replication, is important for proper Protein. PLoS Genet 11(11): e1005651. doi:10.1371/ cell function, and it is a process that is not well understood. To study this process, we have journal.pgen.1005651 employed the chain-terminating nucleoside analog, 3’ azidothymidine (AZT) and the E. coli Editor: Lyle A. Simmons, University of Michigan, genetic system, for which replication and repair factors have been well-defined. By using UNITED STATES high-expression suppressor screens, we identified yoaA, encoding a putative helicase, and Received: April 28, 2015 holC, encoding the Chi component of the replication clamp loader, as genes that promoted Accepted: October 14, 2015 tolerance to AZT.
    [Show full text]
  • Tobias Viehboeck1, Harald Gruber-Vodicka2, Patrick Hyden3, Thomas Rattei3, Silvia Bulgheresi1
    Genomics of marine nematode symbionts Tobias Viehboeck1, Harald Gruber-Vodicka2, Patrick Hyden3, Thomas Rattei3, Silvia Bulgheresi1 - Laxus oneistus and Robbea hypermnestrae, two free-living nematodes (subfamily Stilbonematinae) live in a binary symbiotic association with chemoautotrophic, S-oxidizing Gammaproteobacteria, Candidatus Thiosymbion oneisti and Ca. T. hypermnestrae, respectively rchaea Biology and Ecogenomics - Each symbiont 9sattached to the nematode cuticle by one pole as to ensheath its host VIENNA © U. Dirks © N. Leisch © N. Leisch © N. Leisch Laxus oneistus 150 µm Robbea hypermnestrae 150 µm Ca. Thiosymbion oneisti 2 µm Ca. Thiosymbion hypermnestrae 1 µm Illumina - Nanopore Hybrid assembly Single-cell sequencing - A single-worm metagenome was sequenced on Illumina HiSeq 2x100 bp, - FACS & WGA-XTM at the Bigelow SCGC assembled (SPAdes 3.11), binned with gbtools - 10 single-amplified genomes for sequencing on Illumina NextSeq 550 - A symbiont isolate was sequenced on a MinION (Oxford Nanopore 2x150 bp (12M reads/cell) Technologies, ONT) - thereof 3 for ONT sequencing A A A A A A A A A A A B A A A A A A A A A A A B A A A A A A A A A A A B A A A A A A A A A A A B - The Illumina assembly was scaffolded with ultra long reads 03:23 04:02 08:55 02:03 05:30 03:22 03:41 02:00 06:56 02:08 02:48 02:04 02:05 02:04 03:30 02:04 02:29 B A A A A A A A A A A B A A A A A A A A A A A B B A A A A A A A A A A B A A A A A A A A A A A B 09:24 03:57 02:25 03:19 02:22 02:24 02:14 02:06 02:33 02:45 03:24 02:47 02:03 01:57 02:30 02:35 01:44 10:18
    [Show full text]
  • Structure, Function, and Therapeutic Targeting of SSB Protein Interactions
    Structure, function, and therapeutic targeting of SSB protein interactions By Aimee H. Marceau A dissertation submitted in partial fulfillment of the requirements of the degree of Doctor of Philosophy (Microbiology) at the UNIVERSITY OF WISCONSIN-MADISON 2012 Date of final oral examination: 09/21/2012 The dissertation is approved by the following members of the Final Oral Committee: James L. Keck, Professor, Biomolecular Chemistry Joseph Dillard, Professor, Medical Microbiology & Immunology Michael Cox, Professor, Biochemistry Michael G. Thomas, Professor, Bacteriology Warren E. Rose, Professor, Pharmacy i Structure, function, and therapeutic targeting of SSB protein interactions Aimee Helen Marceau Under the supervision of Professor James L. Keck University of Wisconsin-Madison ABSTRACT DNA unwinding creates single-stranded (ss) DNA intermediates that serve as templates for diverse cellular functions. Exposed ssDNA results in two specific problems for the cell; first, ssDNA is thermodynamically less stable than dsDNA, which leads to spontaneous formation of duplex secondary structures that impede genome maintenance processes. Second, relative to dsDNA, ssDNA is hypersensitive to chemical and nucleolytic attacks that can cause damage to the genome. These potential problems are solved by encoding specialized ssDNA-binding proteins (SSBs) that bind to and stabilize ssDNA structures required for essential genomic processes. The SSB protein in bacteria contains two functionally distinct regions; the N-terminal oligonucleotide/oligosaccharide binding (OB) fold is responsible for oligomerization and ssDNA ii binding, while the flexible amphipathic C-terminal tail (SSB-Ct) is the site of its essential interactions with many proteins involved in DNA processing and genome maintenance. SSB is directly involved with the replication process in bacteria.
    [Show full text]
  • Purification of Escherichia Coli Yoaa, a Putative Helicase Master's Thesis
    Purification of Escherichia coli YoaA, a Putative Helicase Master’s Thesis Presented to The Faculty of the Graduate School of Arts and Sciences Brandeis University Department of Biochemistry Dr. Susan Lovett, Advisor In Partial Fulfillment of the Requirements for the Degree Master of Science in Biochemistry by Mark Gregory May 2019 Copyright by Mark Gregory © 2019 Acknowledgements I would like to thank my advisor Dr. Susan Lovett. Thank you for sharing with me the incredible opportunity to work in her laboratory. I am grateful for your patience, optimism, encouragement and knowledge throughout the entirety of my work at your laboratory. Thank you to my mentor Vincent Sutera. Thank you for the time and support you gave me in allowing me to develop as a scientist. You instilled in me the importance of being organized in my thinking when carrying out my experiments and devising the next plans of action. These are qualities that go beyond the laboratory setting and will stay with me for the rest of my life. I would also like to thank everyone who worked with me in the Lovett lab. You were all very welcoming and provided a supportive environment during my experience. Thank you to all my friends. Special thanks to Elena for motivation and support. Thank you to the faculty in the Biochemistry Department for nourishing my love of biochemistry throughout my research. Thank you to my family for encouraging me and providing me with the support to always be ambitious. iii ABSTRACT Purification of Escherichia coli YoaA, a Putative Helicase A thesis presented to the Department of Biochemistry Graduate School of Arts and Sciences Brandeis University Waltham, Massachusetts By Mark Gregory All cells must maintain their genomic integrity to survive.
    [Show full text]
  • Architecture and Conservation of the Bacterial DNA Replication Machinery, an Underexploited Drug Target
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Research Online University of Wollongong Research Online Faculty of Science - Papers (Archive) Faculty of Science, Medicine and Health 2012 Architecture and conservation of the bacterial DNA replication machinery, an underexploited drug target Andrew Robinson University of Wollongong, [email protected] Rebecca J. Causer University of Wollongong, [email protected] Nicholas E. Dixon University of Wollongong, [email protected] Follow this and additional works at: https://ro.uow.edu.au/scipapers Part of the Life Sciences Commons, Physical Sciences and Mathematics Commons, and the Social and Behavioral Sciences Commons Recommended Citation Robinson, Andrew; Causer, Rebecca J.; and Dixon, Nicholas E.: Architecture and conservation of the bacterial DNA replication machinery, an underexploited drug target 2012, 352-372. https://ro.uow.edu.au/scipapers/2996 Research Online is the open access institutional repository for the University of Wollongong. For further information contact the UOW Library: [email protected] Architecture and conservation of the bacterial DNA replication machinery, an underexploited drug target Abstract "New antibiotics with novel modes of action are required to combat the growing threat posed by multi- drug resistant bacteria. Over the last decade, genome sequencing and other high-throughput techniques have provided tremendous insight into the molecular processes underlying cellular functions in a wide range of bacterial species. We can now use these data to assess the degree of conservation of certain aspects of bacterial physiology, to help choose the best cellular targets for development of new broad- spectrum antibacterials.
    [Show full text]
  • Characterization of Yoaa As It Relates to DNA Replication and Repair
    Characterization of YoaA as it Relates to DNA Replication and Repair Senior Thesis Presented to The Faculty of the School of Arts and Sciences Brandeis University Undergraduate Program in Biology Susan T. Lovett, Advisor In partial fulfillment of the requirements of the degree of Bachelor of Science by Gabriela Giordano May 2021 Copyright by Gabriela Giordano Acknowledgments I would like to thank my advisor Dr. Susan T. Lovett for all of the direction she provided throughout this project. I greatly appreciate the trust she put in me as a researcher in her lab and admire the supportive and engaging lab environment she has created. A big thank you goes to my mentor Vincent A. Sutera, whom I owe for almost everything I’ve learned as a member of the Lovett Lab. I appreciate him taking me on as a mentee and continuing to have faith in me until the end. He has always given me the opportunity to learn something new when I needed a challenge and has pushed me to become more independent in my work. A special thanks goes to David Glass who has answered every question I’ve ever had, taught me how to use the multiplate reader, and was always there for a good laugh. A final thank you goes to Yonatan Zur, without whom I could have never made it this far. Whether it was showing me where items in the lab are kept, taking plates out of the incubator, Sunday Zoom calls about experiments, or Saturday thesis work outside, I have always been able to count on Yonatan and could not possibly thank him enough.
    [Show full text]
  • The Topoisomerase IV Parc Subunit Colocalizes with the Caulobacter Replisome and Is Required for Polar Localization of Replication Origins
    The topoisomerase IV ParC subunit colocalizes with the Caulobacter replisome and is required for polar localization of replication origins Sherry C. Wang*† and Lucy Shapiro*‡ *Department of Developmental Biology, Stanford University School of Medicine, Beckman Center B300, 279 Campus Drive, Stanford, CA 94305; and †Cancer Biology Program, Stanford Medical School, Stanford, CA 94305 Contributed by Lucy Shapiro, April 9, 2004 The process of bacterial DNA replication generates chromosomal motile swarmer cell and a stalked cell (Fig. 1A). In the swarmer topological constraints that are further confounded by simulta- cell, which is unable to initiate DNA replication, the origin of neous transcription. Topoisomerases play a key role in ensuring replication is located at the flagellated pole (1). DNA replication orderly replication and partition of DNA in the face of a continu- initiates when the swarmer cell differentiates into a stalked cell ously changing DNA tertiary structure. In addition to topological and replisome components assemble onto the replication origin constraints, the cellular position of the replication origin is strictly at the stalked cell pole (14). A copy of the replicated origin controlled during the cell cycle. In Caulobacter crescentus, the moves rapidly to the pole opposite the stalk in what is thought origin of DNA replication is located at the cell pole. Upon initiation to be an active process [see the companion article by Viollier et of DNA replication, one copy of the duplicated origin sequence al. (15) in this issue of PNAS], and as DNA replication proceeds, rapidly appears at the opposite cell pole. To determine whether the the replisome progresses from the stalked pole to the division maintenance of DNA topology contributes to the dynamic posi- plane (14).
    [Show full text]
  • Systematic Identification of Synthetic Lethal Mutations With
    Genes Genet. Syst. (2016) 91, p. 183–188 Systematic identification of synthetic lethal mutations with reduced-genome Escherichia coli: synthetic genetic interactions among yoaA, xthA and holC related to survival from MMS exposure Keisuke Watanabe, Kento Tominaga, Maiko Kitamura and Jun-ichi Kato* Department of Biological Sciences, Graduate Schools of Science and Engineering, Tokyo Metropolitan University, Minamiohsawa, Hachioji, Tokyo 192-0397, Japan (Received 22 October 2015, accepted 25 January 2016; J-STAGE Advance published date: 2 May 2016) Reduced-genome Escherichia coli strains lacking up to 38.9% of the parental chromosome have been constructed by combining large-scale chromosome deletion mutations. Functionally redundant genes involved in essential processes can be systematically identified using these reduced-genome strains. One large-scale chromosome deletion mutation could be introduced into the wild-type strain but not into the largest reduced-genome strain, suggesting a synthetic lethal interac- tion between genes removed by the deletion and those already absent in the reduced-genome strain. Thus, introduction of the deletion mutation into a series of reduced-genome mutants could allow the identification of other chromosome deletion mutations responsible for the synthetic lethal phenotype. We identified a synthetic lethality caused by disruption of nfo and xthA, two genes encoding apurinic/apyrimidinic (AP) endonucleases involved in the DNA base excision repair pathway, and two other large-scale chromosome deletions. We constructed temperature-sensitive mutants harboring quadruple-deletion mutations in the affected genes/chromosome regions. Using these mutants, we identified two multi-copy suppressors: holC, encoding the chi subunit of DNA polymerase III, and yoaA, encoding a putative DNA helicase.
    [Show full text]
  • Supplementary Materials: Modular Diversity of the BLUF Proteins and Their Potential for the Development of Diverse Optogenetic Tools
    Appl. Sci. 2019, 9, x FOR PEER REVIEW 1 of 10 Supplementary Materials: Modular Diversity of the BLUF Proteins and Their Potential for the Development of Diverse Optogenetic Tools Manish Singh Kaushik, Ramandeep Sharma, Sindhu KandothVeetil, Sandeep Kumar Srivastava and Suneel Kateriya Table S1. String analysis [1] output showing the details of query proteins, domains, interacting proteins and annotated functions. S. No. Query protein Domain Interacting Partner Annotation JD73_03740 C-di-GMP phosphodiesterase YeaP Diguanylate cyclase JD73_23680 Diguanylate cyclase JD73_23675 Diguanylate cyclase YdaM Diguanylate cyclase EAL (Diguanylate 1. JD73_24940 AriR Regulator of acid resistance cyclase) YcgZ Two-component-system connector protein HTH-type transcriptional regulator, MerR YcgE domain protein JD73_25605 Regulatory protein MerR GJ12_01945 Transcriptional regulator AMSG_00147 Phosphodiesterase AMSG_00905 Phosphodiesterase AMSG_01576 Uncharacterized protein Adenylyl cyclase-associated protein belongs to AMSG_01591 the CAP family AMSG_04591 DNA-directed RNA polymerase subunit beta CHD (class III AMSG_08774 Uncharacterized protein 2. AMSG_04679 nucleotydyl cGMP-dependent 3',5'-cGMP cyclase) AMSG_08967 phosphodiesterase A Adenylate/guanylate cyclase with GAF and AMSG_09378 PAS/PAC sensor 3,4-dihydroxy-2-butanone 4-phosphate AMSG_10048 synthase AMSG_11978 DNA helicase Hhal_0366 Multi-sensor hybrid histidine kinase Hhal_0474 CheA signal transduction histidine kinase Hhal_0522 Putative CheW protein Hhal_0934 CheA signal transduction histidine
    [Show full text]
  • Exploring Tripartite Interaction Between Yoaa, Holc, and SSB, Required for Repair of DNA Damage Made by AZT
    Exploring tripartite interaction between YoaA, HolC, and SSB, required for repair of DNA damage made by AZT Una Milovanovic, Sneha Sathish, Margaret Hibnick, Mentor: Doctor Linda Bloom Department of Biochemistry and Molecular Biology, College of Medicine, University of Florida, Gainesville, FL Introduction The structure of DNA is constantly being challenged by chemicals that are naturally present in cells including oxygen and water. It has been estimated that 20,000 DNA damaging events occur within a cell in a 24 hour period. If those damages do not get fixed, the genetic code will be altered and chromosomes may break. This issue is addressed by cell mechanisms where the damaged bit of DNA is removed and the undamaged DNA strand is used as a template to remake the damaged strand. However, there is some damage that does not get repaired prior to DNA replication. In this case, cell have to conduct special mechanisms to either fix the damaged DNA during replication or bypass the damage and fix it later. Our collaborators in the Lovett laboratory at Brandeis University use genetic approaches in Escherichia coli, a model organism, to discover processes that can repair DNA damage during replication. They recently discovered a pathway that requires at least two proteins, HolC and YoaA, to give cells tolerance to DNA damage created by 3’-azido- 3’-thymidine (AZT). AZT is a chain terminator so that when it is incorporated into DNA by a DNA polymerase, the DNA polymer cannot be extended any further. Thus, DNA replication is blocked. When the polymerase stops, single-stranded DNA starts to accumulate and is bound by a protein called single-stranded DNA binding protein or SSB.
    [Show full text]