Characterization of Yoaa As It Relates to DNA Replication and Repair

Characterization of YoaA as it Relates to DNA Replication and Repair

Senior Thesis

Presented to The Faculty of the School of Arts and Sciences Brandeis University

Undergraduate Program in Biology Susan T. Lovett, Advisor

In partial fulfillment of the requirements of the degree of Bachelor of Science

by Gabriela Giordano May 2021

Acknowledgments

I would like to thank my advisor Dr. Susan T. Lovett for all of the direction she provided throughout this project. I greatly appreciate the trust she put in me as a researcher in her lab and admire the supportive and engaging lab environment she has created.

A big thank you goes to my mentor Vincent A. Sutera, whom I owe for almost everything I’ve learned as a member of the Lovett Lab. I appreciate him taking me on as a mentee and continuing to have faith in me until the end. He has always given me the opportunity to learn something new when I needed a challenge and has pushed me to become more independent in my work.

A special thanks goes to David Glass who has answered every question I’ve ever had, taught me how to use the multiplate reader, and was always there for a good laugh. A final thank you goes to Yonatan Zur, without whom I could have never made it this far. Whether it was showing me where items in the lab are kept, taking plates out of the incubator, Sunday Zoom calls about experiments, or Saturday thesis work outside, I have always been able to count on Yonatan and could not possibly thank him enough.

Table of Contents Acknowledgments……………………………………………………………………..………….ii Abstract……………………..………………………………………………………….…………iii Introduction………………………………………………………………………………………..1 Results………………………………………………………………………………………..…..10 Discussion……………………………………………………………………………………..…14 Materials and Methods…………………………………………………………………………...17 Bibliography……………………………………………………………………………….…….29

Abstract

Effective DNA replication and repair is crucial to the survival of all organisms and necessitates the cooperation of a variety of macromolecules. In Escherichia coli, the DNA

Polymerase III holoenzyme is one of these macromolecules which, along with being the main contributor to DNA replication, is known to participate in other interactions which aid in the repair of damaged DNA. One such interaction is with YoaA, a putative helicase found to promote tolerance to replication inhibiting factors. The interaction between YoaA and the DNA

Polymerase III holoenzyme takes place at HolC, one of the holoenzyme’s protein subunits. This project seeks to further characterize the interaction between YoaA and HolC while also attempting to identify the types of DNA damage and repair to which YoaA responds. Through

Yeast Two-Hybrid, I have shown that the C-terminus of YoaA is the region responsible for HolC binding. Additionally, E. coli growth assays show that mutations in the C-terminus of YoaA may alter the protein’s function in vivo. A variety of phenotypic assays have suggested that YoaA does not exhibit a significant response to recombination events or point mutations.

Introduction to DNA Repair and YoaA DNA replication is one of the most fundamental biological processes present in all living organisms. Given that cells contain such large quantities of genetic material, it is inevitable that

DNA will occasionally contain mistakes. Whether these mistakes are a result of errors in replication or of external mutagens, they pose a problem to further DNA replication. Within cells exist mechanisms capable of identifying such mistakes, recruit the proper repair units, and correct the mistakes to continue replication of DNA. As the correct replication and repair of

DNA is vital to the survival of all organisms, including humans, it is the focus of a great deal of scientific research. Escherichia coli (E. coli) has served as a model organism to study the processes involved in replication and repair because it utilizes several mechanisms and proteins analogous to those of humans. Though much has been learned about DNA replication and repair, there is still a significant amount that is unknown about the intricacies of these biological processes, and research continues to work toward better understanding the cellular participants and mechanisms involved.

One of the relatively unexplored areas of this field deals with the moment at which the cellular replication machinery identifies a mistake in a DNA sequence and recruits those proteins whose function is to repair the mistake. Several proteins are required to facilitate DNA repair, some of which are helicases, which unwind DNA structures in a multitude of situations that require unencumbered DNA for replication. The purpose of my research is to further understand what happens when DNA replication encounters a mistake, with a specific focus on YoaA, a putative helicase that is thought to participate in this process. Little is known about YoaA’s role in DNA repair or about what circumstances result in its recruitment by the cell. My research seeks to further characterize YoaA’s behavior and function in the replication and repair of E. coli

DNA.

DNA Polymerase III

In E. coli, the DNA polymerase III holoenzyme (Pol III) is responsible for catalyzing the majority of DNA replication. Pol III is encoded by nine different genes that give rise to various subunits (see figure 1). The core complex of Pol III, which exhibits both polymerase and exonuclease activity, is comprised of an α, ε, and θ subunit

(encoded by dnaE, dnaQ, and holE respectively). The core complex associates with the clamp loader complex that is responsible for loading the β clamp onto the DNA, the interactions of which work to stabilize the polymerases binding to DNA during replication. Accessory to the Pol III τ τ clamp loader (encoded by holA, holB, and dnaX) are two additional protein subunits: χ (encoded by holC) and ψ δ’

(encoded by holD) (Duigou 1). Though much remains δ unknown about the functions of the HolC and HolD Figure 1: DNA Polymerase III Holoenzyme subunits, there is new evidence to show that both participate (Created with BioRender.com) in coordinating DNA repair when Pol III runs into damaged DNA during replication (Brown et al 2015).

HolC and HolD

While the clamps and clamp loaders involved in DNA replication are universally conserved, with homologs across a variety of eukaryotes, neither HolC nor HolD has been found to have homologous eukaryotic counterparts and are observed only in proteobacteria. This lack of conservation aligns with the non-essential nature of HolC in E. coli and contributes to novel understandings of DNA replication. HolC participates in a variety of processes that assist Pol III

2 activity. One of this protein’s primary interactions is with single-strand DNA binding protein

(SSB) and through its binding to SSB, it aids the polymerization of substrates coated with SSB.

The HolC-HolD complex increases the clamp-loader’s affinity to primer-template DNA and is thought to stabilize the interaction between Pol III for this reason (Duigou 2). This effect of the

HolC-HolD complex functions to promote clamp-loader activity and increase the overall processivity of Pol III. Additionally, HolC assists in displacing primase from RNA primers. It accomplishes this by binding to SSB, which is initially bound to primase and is then transferred to HolC at the primer-template junction (Duigou 2014). Because of its strong connection to SSB, it is believed that HolC acts primarily on the SSB-coated lagging-strand DNA template. This conclusion supports HolC’s coordination of DNA repair as the lagging strand is often subject to the formation and accumulation of DNA duplexes and is frequently in need of DNA repair.

Codependence of HolC and YoaA

In addition to assisting in DNA replication, HolC has been shown (Brown et al. 2015) to interact with YoaA, a recently discovered putative helicase thought to be involved in DNA repair. The dependence of YoaA and HolC on each other was initially observed using

Azidothymidine (AZT) sensitivity assays which tested E. coli’s survival when either holC or yoaA had been deleted. AZT is a chain-terminating nucleoside analog that causes the accumulation of single-stranded DNA gaps during replication. By challenging E. coli with the deletion of holC and yoaA, the dependence of the proteins on each other could be more closely examined. It was found that, in both strains, bacteria exhibited significant sensitivity to AZT.

Additionally, AZT sensitivity was not suppressed by overexpressing the other gene in a plasmid vector, suggesting that YoaA and HolC are codependent and that their interaction is necessary for normal cell growth (Brown, et al 2015).

Physical Interaction Between YoaA and HolC

Having confirmed the codependence of YoaA and HolC, research has shifted toward examining the physical interaction between the two proteins. A common way to screen for protein binding is through Yeast Two-Hybrid analysis, which is based in the GAL4/UAS system.

In this system, one protein of interest is fused to the binding domain (bait) and the other to the activation domain (prey). The binding domain binds the UAS promoter sequence, and, when there is bait-prey interaction, reconstitutes a transcription factor that recruits RNA Polymerase II and allows for normal transcription (Brückner 2009). Therefore, if the two proteins of interest interact with one another, there will be observable growth. In Yeast-Two Hybrid analysis, the relative strength of protein binding can be determined using different growth media: growth on histidine dropout media indicates weak interaction while growth on adenine dropout indicates strong interaction. This type of analysis was performed with YoaA and HolC (Brown, et al.

2015) and, upon observing growth on histidine dropout media, it was determined that the two proteins physically interact.

Specifics of YoaA-HolC Binding Site

Upon confirming that HolC and YoaA proteins interact and play a role in DNA repair, the next step has been to narrow in on the specificities of the binding between HolC and YoaA.

Several yoaA mutants have been constructed to target potentially important regions of YoaA, some of which change a single amino acid and some of which eliminate several consecutive amino acids. The most notable of these mutants are T620A, R619A (both of which change just one residue), and T3 which is a truncation mutation that has removed the last 18 amino acids of yoaA. All of these residues of interest are located in and around the location at which YoaA is thought to bind to HolC. From there, the goal has been to further characterize the function of

YoaA’s in DNA repair. This characterization includes but is not limited to why YoaA is recruited by HolC, the nature of its interaction with HolC, to which types of DNA damage YoaA responds, and how YoaA assists in repairing such damage.

Effects of YoaA-HolC Binding

Because YoaA is not HolC’s primary protein interaction, their relationship, especially when manipulated, may have unusual effects on cell life. We have found, for example, that the overexpression of yoaA can be toxic to cell growth, and, given that YoaA’s only known protein interaction occurs with HolC, it is possible that their relationship is in some way connected to this observed toxicity.

Early-stage Characterization of YoaA

Because little is currently known about yoaA, it is advantageous to first characterize its function in a broad sense. Several preliminary assays can be conducted to screen for the types of damage to which YoaA may respond. Creating environments in which DNA damage is abundant or especially visible allows us to view whether or not YoaA has an effect on the response to this damage. One type of DNA damage to which YoaA could respond involves point mutations, which can be screened for using rifampicin, an antibiotic most notably used to treat tuberculosis.

Rifampicin, also known as rifampin, functions by inhibiting DNA dependent RNA polymerase activity. It accomplishes this by either physically blocking RNA elongation or by reducing polymerase affinity for short RNA transcripts (Suresh 2020). While rifampicin often targets other species of bacteria, resistance can also arise in E. coli. Most resistance to rifampicin occurs as a result of mutations in the β subunit of DNA dependent RNA polymerase. In the majority of these cases, rifampicin resistance arises from point mutations (Goldstein 2014). Mutations such as these can accumulate due to exposure to DNA damaging agents followed by an inability to

5 correctly repair the damage, or simply by faulty repair mechanisms. I propose that, if YoaA does indeed play a critical role in the successful repair of DNA, then a knockout yoaA strain will give rise to a genome that is more susceptible to mutations such as those that cause rifampicin resistant E. coli.

Structural Similarities Between YoaA and DinG

Upon examination of YoaA’s structure and amino acid sequence, it has been found that the protein is closely related to DinG, which encodes a E. coli 5ˈ to 3ˈ Fe-S helicase and is thought to function in a similar manner. DinG is a member of superfamily 2 DNA helicases, a group that includes Chl1, Rad3, and Rad15 from various yeast species and XPD and BACH1 from humans. The dinG gene is damage-inducible and is regulated by the SOS response, a cell’s response to DNA damage. The Fe-S cluster that is present in DinG and presumed to exist in

YoaA is one of the most notable features of both proteins. The presence of iron-sulfur clusters in proteins is thought to date back to a time in the Earth’s history in which the two elements were more abundant as the environment was anaerobic (Fuss 2015). The conservation of this region throughout history signals that it plays an important role in a protein’s function. In YoaA, as in many other proteins that contain this region, the iron-sulfur cluster can be indicated by the presence of multiple cysteines in close proximity to one another. In the case of YoaA, there are four cysteines at positions 120, 194, 199, and 205 that are thought to comprise the Fe-S cluster.

The sulfurs in the cysteines serve to coordinate iron and the whole system acts as a redox center, allowing the Fe-S cluster and the protein in which it is contained to bind DNA through a charge transfer (Fuss 2015). Just as it does for DinG, the Fe-S cluster is thought to be indicative of

YoaA’s ability to process DNA.

YoaA’s Possible Functional Similarities to DinG

Through biochemical characterization of DinG, it has been found that the protein exhibits both DNA-dependent ATPase and helicase activity. Additionally, it unwinds DNA duplexes with a 5ˈ to 3ˈ polarity as do the other helicases in superfamily 2. DinG is also capable of unwinding

DNA-RNA hybrids and structures analogous to the intermediates formed during replication and homologous recombination such as D- and R-loops (Voloshin 2007). YoaA’s functions and roles in DNA damage response have been linked to those of DinG because of their genetic similarities.

The two proteins share 29% sequence identity (Brown et al 2015), and within this shared identity are the four cysteines that make up the Fe-S coordination site in DinG. Because of its similarity to DinG, YoaA is suspected to behave in a similar way when responding to damaged DNA and unwinding duplexes and other intermediate structures that may hinder replication. One such

DNA duplex is the D-loop, an intermediate structure formed during gene conversion, a main form of homologous recombination. Assistance in the process of gene conversion may be one of the ways by which YoaA can be characterized, though the extent of its involvement is currently unknown.

Gene Conversion and Creation of Intermediate DNA Structures

Homologous recombination, the umbrella under which gene conversion is located, is one of the primary biological methods that cells use to repair DNA. It is a process in which portions of DNA that share a great deal of sequence identity are used to repair damaged sections of the genome (Chen 2007). Gene conversion is a specific type of homologous recombination that occurs in prokaryotes and eukaryotes alike. In eukaryotic organisms, gene conversion is initiated when there are double-stranded breaks in DNA which can arise as a result of both internal and external factors. The first step in repairing of these breaks is performed by a 5’ to 3’ exonuclease

7 which comes in and cuts the ends of each of the double-stranded breaks to create single-stranded tails on each, or sticky ends. These short overhanging strands of unpaired DNA then ‘search’ the genome to find homologous sequences. Upon ‘finding’ such a sequence, one of the single- strands will invade the duplex to form a D-loop and, acting as a primer, will allow for the extension of this region through normal DNA synthesis (Chen 2007). As the study of this branch of homologous recombination has evolved, it has been found that at this moment the process of gene conversion splits into two distinct pathways. The synthesis-dependent strand annealing

(SDSA) model shows that, after extension occurs in the D-loop, the newly formed strand gets displaced from its template and anneals to the other single-stranded tail that did not invade. From this point, DNA synthesis occurs, and the nicks are ligated, giving rise to completely repaired, non-crossover, double-stranded DNA. The other possible pathway after D-loop extension is double-strand break repair (DSBR). Here, newly formed DNA within the loop pairs with the other 3’ single-stranded tail. Subsequent DNA synthesis and nick ligation results in the formation of two Holliday junctions, another common type of intermediate of homologous recombination.

Just as was seen previously in this process, the formation of this intermediate results in two diverging pathways, referred to as resolution and dissolution. In the former, enzyme activity cleaves the two junctions and leaves two non-crossover double-stranded DNA products with correct sequences. In the latter, the two Holliday junctions migrate toward one another (assisted by enzyme activity) and result in the collapse of the double junction structure (Chen 2007).

Suggested Role of YoaA in Processing Intermediate DNA Structures

As can be gleaned from this description of gene conversion, intermediate DNA structures play an integral role in homologous recombination and are therefore an inevitable part of DNA repair. However, intermediate structures such as the previously mentioned D-loops and Holliday

8 junctions pose a problem for DNA replication if not unwound properly so as to allow DNA polymerase to bind DNA. This is where helicases, and specifically YoaA, enter the process.

DinG, paralog of YoaA, has already been shown to be capable of undoing synthetic D-loops

(Voloshin 2007) and it is thought that YoaA may share this capability. One way of testing whether this is true would be through a lacZ gene conversion assay. In such an assay, a portion of the lacZ gene is deleted and is present elsewhere on the E. coli chromosome. This creates a situation in which gene conversion through homologous recombination is frequent as it is required for cell survival. By deleting the YoaA gene in such cells, it could be seen whether the protein plays a role in facilitating the undoing of intermediates so that successful gene conversion can take place.

Conclusions and Future Directions

The next steps in the study of YoaA are going to be aimed at narrowing in on the exact role it plays in DNA repair. To do this, I have performed a range of experiments that target various repair pathways and attempt to gain a better understanding of YoaA’s cellular interactions and behaviors. Mutating or deleting yoaA in such experiments has made the extent to which YoaA is a necessary participant in each pathway observable and measurable.

DNA damage comes in many forms as do the mechanisms that are used to repair it.

YoaA has been shown to participate in DNA repair, however how it does so and to which types of damage it responds remains unknown. Though the experiments discussed here begin to expand our knowledge of YoaA, they only represent a small fraction of the potential ways in which to characterize its functions. Through continued investigation of various repair pathways, we draw nearer to a more complete understanding of YoaA’s importance.

Results

Yeast Two-Hybrid Assay

Both orientations of wildtype YoaA and HolC in two-hybrid plasmids showed growth on -HIS plates however neither the YoaA T620A, ΔT3, nor R619A mutants showed any growth in either orientation (Figure 2). All yeast strains grew as expected on all control plates: growth on YEPD plates indicated yeast viability, growth on -LEU and -TRP plates indicated the presence of two- hybrid plasmids (activation domain and binding domain respectively), and growth on -LEU/-

TRP plates confirmed the presence of both plasmids in each strain. Additionally, positive and negative control strains (not shown) grew appropriately on all plates: pCL1 and pGADT7-T/pGBKT7-53 serve as positive controls on -HIS and -ADE plates, the former encoding the full wildtype GAL4 protein and the latter encoding fusion of large T antigen and p53 to the activation and binding domains; pGADT7-T/pGBKT7-Lam serves as a negative control as it encodes human lamin C and accounts for the coincidental interaction between an unrelated protein and that bound to the activation domain (Clontech, 2007).

Yeast Two-Hybrid Analysis

Figure 2: Yeast Two-Hybrid Analysis of YoaA and HolC Interaction. -LEU/-TRP plates in top row control for the presence of activation domain and binding domain plasmids. -HIS plates in bottom row select for low stringency interactions between yoaA and holC which are fused to the activation and binding domains (both orientations shown).

Toxicity of yoaA Overexpression pCA24N was induced with IPTG to overexpress yoaA in high copy to assess its toxicity to E. coli growth. Though the presence of the pCA24N plasmid appears to slow growth on its own

(compared with background strain growth, not shown), induction of wildtype yoaA reduces growth to a greater extent. Overexpression of yoaA T3 results in faster growth with the induced strains showing more growth than the uninduced. yoaA K51R overexpression also shows increased growth compared to the empty vector and wildtype yoaA strains though there is not a significant difference between induced and uninduced strains by the end of the 6-hour growth period.

pCA24N-yoaA Growth

Figure 3: pCA24N-yoaA Growth and Toxicity. OD600 readings map E. coli growth over 6 hours and were taken every 15 min. IPTG was added after the first 3 hours. Each point represents the mean of six replicates with standard deviation.

Rifampicin Resistance Assay

Fraction survival of wildtype E. coli (MG1655) was compared to that of a yoaA::ΔFRT strain, which is an MG1655 background strain in which yoaA has been knocked out and contains an FRT site. Mean fraction survival values were calculated for five individual trials of the assay.

At 50 ug/mL of rifampicin, the was no significant difference between the fraction survival of wildtype E. coli (1.41x10-8) and that of the yoaA::ΔFRT strain (2.72x10-8). Likewise, no significant difference was seen at the higher concentration of 100 ug/mL between wildtype E. coli (1.29x10-8) and the yoaA::ΔFRT strain (2.53x10-8).

yoaA Knockout Fraction Survival

Figure 4: Rifampicin Fraction Survival in yoaA Knockout. Each data point represents an individual trial of a rifampicin resistance assay that measured fraction survival. Center horizontal bars represent mean values of fraction survival, upper and lower error bars represent standard deviation, and assays were conducted at two concentrations of rifampicin.

Gene Conversion

Two strains were used to assay for yoaA’s effect on gene conversion: attTn7::lacZAS+

LacZASD and attTn7::lacZAS+ LacZASD yoaA::ΔFRT. The attTn7::lacZAS+ LacZASD genotype describes a strain in which 5 base pairs have been deleted from lacZ on the chromosome and have been inserted into the attTn7 site with 250 base pairs of homology on either side. The attTn7::lacZAS+ LacZASD yoaA::ΔFRT is a strain in which yoaA::ΔFRT was transduced into the previous strain. Both strains were plated on LB, Minimal + Glucose, and Minimal + Lactose plates in both serially diluted form and on full plates. Growth of blue colonies on lactose plates indicated successful gene conversion. After being incubated overnight, colonies were counted, and the counts were normalized to 1mL so that conversion frequencies and rates could be calculated. There was no significant difference between the mean gene conversion rate

(calculated in relation to growth on LB) of the background strain (1.18x10-6) and that of the yoaA knockout strain (1.94x10-6). Likewise, there was no significant difference in gene conversion rate between the two strains when calculated in relation to growth on minimal media, where the background strain had a rate of 8.40x10-7 and the yoaA knockout had a rate of

1.98x10-6.

lacZ Gene Conversion Rate

Figure 5: lacZ Gene Conversion Rate in yoaA Knockout. Conversion rates are represented in relation to growth on LB plates as well as to minimal plates. Bars represent mean values of three trials for the yoaA::ΔFRT strain and two trials for the background strain. Error bars represent standard deviation.

Discussion

As has been shown in previous studies (Brown et al 2015), YoaA binds to HolC, the chi subunit of Pol III. Though YoaA is a paralog of DinG, another 5’ to 3’ helicase, it contains some unique features, one being the last 18 amino acids at the C-terminus of the protein. Several constructs of yoaA were made such that mutations were introduced into this region of the

14 protein, with focus on three in particular: T620A, T3, and R619A. These constructs were put into the Gal4 UAS reporter system so that they could be assayed through Yeast Two-Hybrid

Analysis. This analysis showed no growth of any of mutant strains on HIS- plates which assay for weak protein-protein interaction. This suggests that when these particular residues are mutated or removed, YoaA loses the ability to bind to HolC, further suggesting that this 18- amino acid C-terminus is the region responsible for HolC binding.

As one of YoaA’s most distinguishing characteristics is its interaction with HolC, further attention has been paid to the effect that this interaction has on cell viability. Because YoaA is not the only protein to which HolC binds, the current thinking is that an abundance of YoaA in the cell may outcompete other more essential HolC interactions such as those with HolD or SSB.

Through high-copy plasmid overexpression, it was shown that wildtype YoaA is toxic and results in slowed growth compared to uninduced expression. Given that overexpressed yoaA may be causing this toxicity by over-binding to HolC, the T3 yoaA mutant was introduced into the growth assay and also overexpressed at high copy. Both the uninduced and induced yoaA T3 strains grew the most of all the strains assayed, with the induced strains reaching the highest

OD600 by the end of the growth period. Effectively, the T3 mutation suppresses the toxicity that normally arises from expressing wildtype YoaA in the cell. These findings are consistent with the thinking that the toxicity of YoaA overexpression in E. coli is due to increased HolC binding given that the T3 mutant has been shown to be incapable of even weak interactions with HolC.

While not relating to the interaction between YoaA and HolC, a yoaA K51R mutant was also introduced into this growth assay to determine the effect of this mutant on YoaA toxicity.

The lysine normally found at position 51 is part of the Walker A box, a conserved motif thought to be associated with helicase function. Specifically, the motif appears to be responsible for the

15 coordination of ATP binding and hydrolysis (delToro 2016). Due to the conserved nature of this amino acid, it would be expected that a mutation would significantly alter protein function.

When overexpressed in pCA24N, yoaA K51R displays growth similar to that of the T3 mutant, which is faster than that of both the empty vector and wildtype yoaA. While this result in the T3 mutant may be due to decreased HolC binding, it is unclear why decreased helicase function due to an altered Walker A box would show increased growth. If the reason for increased mutant growth has to do purely with loss of YoaA function, we would need to examine what about properly functioning YoaA causes it to be toxic to cell growth.

What remains unclear is why both mutant strains grow more quickly than the empty pCA24N vector. Given that the empty vector control also grows more poorly than the background strain (MG155), it can be inferred that there is something about the vector itself that is mildly toxic to the cell. While this does not negatively affect the ability to interpret this assay, it is important to note when using pCA24N going forward.

The rifampicin and gene conversion assays represent initial attempts to gauge the types of

DNA damage to which YoaA might respond and the ways in which it might function to repair damage. Rifampicin resistance arises as a result of point mutations in RNA Polymerase, as this is the piece of cellular machinery on which the drug acts. It was hypothesized that if YoaA plays a role in repairing point mutations, a yoaA knockout strain will accumulate more unrepaired point mutations, some of which will exist in RNA Polymerase and cause rifampicin resistance. It would then be expected that we would see a higher frequency of resistant colonies in the yoaA knockout strain. However, based on the mean fraction survival values from five trials of this assay, this effect was not apparent. There was no significant difference in rifampicin resistance between strains, which suggests that the absence of yoaA does not give rise to more point

16 mutations in RNA Polymerase. This assay, however, represents only a small portion of yoaA’s possible role in point mutation repair. It does not account for point mutations that occur in locations other than RNA Polymerase and it is possible that the frequency of mutations that give rise to rifampicin resistance is not high enough to show a visible effect when yoaA is absent.

A gene conversion assay provided another way to examine the possible functions of

YoaA in DNA repair. Gene conversion occurs when missing DNA is repaired through homologous recombination. Because intermediate structure formation is a necessary part of homologous recombination, we thought it possible that a helicase such as YoaA might play a role in the process, one in which it would unwind these structures when no longer needed. Were

YoaA a participant in homologous recombination, it would be expected that there would be less successful gene conversion events in a strain with yoaA knocked out. This, however, was not seen as there was no significant difference in the conversion rate of the knockout strain vs the background. One simple explanation of this is that YoaA does not participate in the process of homologous recombination. However, it is also possible that, given the variety of ways in which homologous recombination can occur, YoaA may not be necessary in just this form of conversion.

Materials and Methods

Strain Lists

Table 1: E. coli Strains Strain # Strain Plasmid Genotype Resistance Background 242 MG1655 F-rph- 1 9811 MG1655 Cm 9813 MG1655 yoaA::FRT F- rph-1 7580 MG1655 recA::FRT kan F- rph-1 Km 20340 MG1655 pCA24N F- rph-1 Cm 20341 MG1655 pCA24N-yoaA F- rph-1 Cm

20624 DH5α pDONRZEO-holC F- phi80d lacZΔM15 Δ(lacZYA- Zeo, Phleo argF)U169 endA1 recA1 hsd17 deoR supE44 thi-1 λ- gyrA96 relA1 20630 DH5α pDONRZEO-yoaA F- phi80d lacZΔM15 Δ(lacZYA- Zeo, Phleo argF)U169 endA1 recA1 hsd17 deoR supE44 thi-1 λ- gyrA96 relA1 20716 DH5α pGADT7-yoaA F- phi80d lacZΔM15 Δ(lacZYA- Ap, Leu argF)U169 endA1 recA1 hsd17 deoR supE44 thi-1 λ- gyrA96 relA1 20718 DH5α pGBKT7-yoaA F- phi80d lacZΔM15 Δ(lacZYA- Km, Trp argF)U169 endA1 recA1 hsd17 deoR supE44 thi-1 λ- gyrA96 relA1 20724 DH5α pGADT7-holC F- phi80d lacZΔM15 Δ(lacZYA- Ap, Leu argF)U169 endA1 recA1 hsd17 deoR supE44 thi-1 λ- gyrA96 relA1 20729 DH5α pGBKT7-holC F- phi80d lacZΔM15 Δ(lacZYA- Km, Trp argF)U169 endA1 recA1 hsd17 deoR supE44 thi-1 λ- gyrA96 relA1 20733 DH5α pGBKT7-GW F- phi80d lacZΔM15 Δ(lacZYA- Km, Leu argF)U169 endA1 recA1 hsd17 deoR supE44 thi-1 λ- gyrA96 relA1 20734 DH5α pGADT7-GW F- phi80d lacZΔM15 Δ(lacZYA- Ap, Trp argF)U169 endA1 recA1 hsd17 deoR supE44 thi-1 λ- gyrA96 relA1 20791 DH5α pDONRZEO- F- phi80d lacZΔM15 Δ(lacZYA- Zeo, Phleo yoaA-T620A argF)U169 endA1 recA1 hsd17 deoR supE44 thi-1 λ- gyrA96 relA1 20822 DH5α pDONRZEO-yoaA F- phi80d lacZΔM15 Δ(lacZYA- Zeo, Phleo T3 argF)U169 endA1 recA1 hsd17 deoR supE44 thi-1 λ- gyrA96 relA1 20825 DH5α pGBKT7-yoaA F- phi80d lacZΔM15 Δ(lacZYA- Km, Trp T620A argF)U169 endA1 recA1 hsd17 deoR supE44 thi-1 λ- gyrA96 relA1 20866 DH5α pGADT7-yoaA F- phi80d lacZΔM15 Δ(lacZYA- Ap, Leu T620A argF)U169 endA1 recA1 hsd17 deoR supE44 thi-1 λ- gyrA96 relA1 20901 DH5α pGADT7-yoaA T3 F- phi80d lacZΔM15 Δ(lacZYA- Ap, Leu argF)U169 endA1 recA1 hsd17 deoR supE44 thi-1 λ- gyrA96 relA1 20902 DH5α pGBKT7-yoaA T3 F- phi80d lacZΔM15 Δ(lacZYA- Km, Trp argF)U169 endA1 recA1 hsd17 deoR supE44 thi-1 λ- gyrA96 relA1 22695 – NEB 5-alpha pDONRZEO-yoaA fhuA2Δ(argF-lacZ)U169 phoA Zeo 22702 R619A glnV44 Φ80Δ (lacZ)M15 gyrA96 recA1 relA1 endA1 thi-1 hsdR17 22713 NEB 5-alpha pGADT7-yoaA fhuA2Δ(argF-lacZ)U169 phoA Ap, Leu R619A glnV44 Φ80Δ (lacZ)M15 gyrA96 recA1 relA1 endA1 thi-1 hsdR17

22714 NEB 5-alpha pGBKT7-yoaA fhuA2Δ(argF-lacZ)U169 phoA Km, Trp R619A glnV44 Φ80Δ (lacZ)M15 gyrA96 recA1 relA1 endA1 thi-1 hsdR17 23440 MG1655 pCA24N-yoaA T3 F- rph-1 Cm 23589 XL1 Blue pCA24N-yoaA F’ [ proAB lacIq lacZ∆M15 ::Tn10 ] Cm K51R recA1 endA1 gyrA96 thi hsdR17 supE44 relA1 lac 23593 MG1655 pCA24N-yoaA F- rph-1 Cm K51R 21752 MG1655 attTn7::lacZAS+ LacZASD Km bglG::∆FRT Kan F- rph-1 23391 9811 attTn7::lacZAS+ LacZASD Cm, Km bglG::∆FRT Kan F- rph-1 yoaA::∆FRT CAT F- rph-1

Table 2: S. cerevisiae Strains Strain # Strain Plasmid Genotype Background 358 AH109 MATa, trp1-901, leu2-3, 112, ura3-52, his3-200, gal4Δ, gal80Δ, LYS2 : : GAL1UAS-GAL1TATA- HIS3, GAL2UAS-GAL2TATA-ADE2, URA3 : : MEL1UAS-MEL1TATA-lacZ 359 AH109 pCL1 MATa, trp1-901, leu2-3, 112, ura3-52, his3-200, gal4Δ, gal80Δ, LYS2 : : GAL1UAS-GAL1TATA- HIS3, GAL2UAS-GAL2TATA-ADE2, URA3 : : MEL1UAS-MEL1TATA-lacZ 360 AH109 pGADT7-T/ MATa, trp1-901, leu2-3, 112, ura3-52, his3-200, pGBKT7-53 gal4Δ, gal80Δ, LYS2 : : GAL1UAS-GAL1TATA- HIS3, GAL2UAS-GAL2TATA-ADE2, URA3 : : MEL1UAS-MEL1TATA-lacZ 361 AH109 pGADT7-T/ MATa, trp1-901, leu2-3, 112, ura3-52, his3-200, pGBKT7-lam gal4Δ, gal80Δ, LYS2 : : GAL1UAS-GAL1TATA- HIS3, GAL2UAS-GAL2TATA-ADE2, URA3 : : MEL1UAS-MEL1TATA-lacZ 368 AH109 pGADT7-yoaA/ MATa, trp1-901, leu2-3, 112, ura3-52, his3-200, pGBKT7-holC gal4Δ, gal80Δ, LYS2 : : GAL1UAS-GAL1TATA- HIS3, GAL2UAS-GAL2TATA-ADE2, URA3 : : MEL1UAS-MEL1TATA-lac 369 AH109 pGADT7-holC/ MATa, trp1-901, leu2-3, 112, ura3-52, his3-200, pGBKT7-yoaA gal4Δ, gal80Δ, LYS2 : : GAL1UAS-GAL1TATA- HIS3, GAL2UAS-GAL2TATA-ADE2, URA3 : : MEL1UAS-MEL1TATA-lacZ 377 AH109 pGADT7- MATa, trp1-901, leu2-3, 112, ura3-52, his3-200, yoaAT620A/ gal4Δ, gal80Δ, LYS2 : : GAL1UAS-GAL1TATA- pGBKT7-holC HIS3, GAL2UAS-GAL2TATA-ADE2, URA3 : : MEL1UAS-MEL1TATA-lacZ 378 AH109 pGADT7-holC/ MATa, trp1-901, leu2-3, 112, ura3-52, his3-200, pGBKT7- gal4Δ, gal80Δ, LYS2 : : GAL1UAS-GAL1TATA- yoaAT620A HIS3, GAL2UAS-GAL2TATA-ADE2, URA3 : : MEL1UAS-MEL1TA

593 AH109 pGADT7- MATa, trp1-901, leu2-3, 112, ura3-52, his3-200, yoaAR619A/ gal4Δ, gal80Δ, LYS2 : : GAL1UAS-GAL1TATA- pGBKT7-holC HIS3, GAL2UAS-GAL2TATA-ADE2, URA3 : : MEL1UAS-MEL1TATA-lacZ 596 AH109 pGADT7-holC/ MATa, trp1-901, leu2-3, 112, ura3-52, his3-200, pGBKT7- gal4Δ, gal80Δ, LYS2 : : GAL1UAS-GAL1TATA- yoaAR619A HIS3, GAL2UAS-GAL2TATA-ADE2, URA3 : : MEL1UAS-MEL1TATA-lacZ 636 AH109 pGADT7-yoaAT3/ MATa, trp1-901, leu2-3, 112, ura3-52, his3-200, pGBKT7-holC gal4Δ, gal80Δ, LYS2 : : GAL1UAS-GAL1TATA- HIS3, GAL2UAS-GAL2TATA-ADE2, URA3 : : MEL1UAS-MEL1TATA-lacZ 637 AH109 pGADT7-holC/ MATa, trp1-901, leu2-3, 112, ura3-52, his3-200, pGBKT7-yoaAT3 gal4Δ, gal80Δ, LYS2 : : GAL1UAS-GAL1TATA- HIS3, GAL2UAS-GAL2TATA-ADE2, URA3 : : MEL1UAS-MEL1TATA-lacZ

Media

Luria broth (LB) with no antibiotic was used to grow competent cells, transformation cultures, and any stains with no antibiotic resistance. LB with 15µg/mL Chloramphenicol, 60 µg/mL

Kanamycin, 100 µg/mL Tetracycline, or 100 ug/mL Ampicillin (stock 50 mg/mL) were made to grow strains containing chromosomal resistance markers or plasmids. The same antibiotic concentrations were made in LB agar plates.

LCG media was used to create and transduce phage for gene construction. 1% Tryptone

(w/v), 0.5% NaCl (w/v), and 0.5% yeast extract (w/v), were added to double distilled water. If the media is for plates or top agar, 0.7% (w/v) agar is added. Once autoclaved, glucose (stock:

20%) is added to 0.1% (v/v) and CaCl2 (stock 1M) is added to a final concentration of 2mM.

Minimal media was also made; deionized water, 10x 56/2 media, 20% glucose, and 0.1%

B1 solution are autoclaved separately, and a 1% solution of arginine is filter sterilized. 10% (v/v)

18of the 10x 56/2 media is added to the water as well as 1% (v/v) of 20% glucose or lactose and

0.1% B1, and 10% (v/v) of 1% Arginine is added.

To make IPTG and X-Gal plates, LB and minimal media were made as mentioned previously.

IPTG was added to a final concentration of 1.0mM (stock 1M), and X-Gal was added to a final concentration of 20µg (stock 20mg/ml).

1x 56/2 is made by diluting 1:10 of 10x 56/2: 8.7% anhydrous dibasic sodium phosphate at a final concentration of 0.6M, 5.3% monobasic potassium phosphate, 2.0% ammonium sulfate,

0.2% magnesium sulfate, 0.1% calcium nitrate, and iron sulfate to a final concentration of

0.01mM in distilled water.

Freezing Strains

All constructed strains were given a STL or ySTL (yeast) number and frozen by adding a swab of either E. coli or S. cerevisiae cells into appropriate freezing media. The media was then aliquoted into two freezing vials, labeled with the strain number and stored at -80°C.

Making Electrocompetent Cells

Competent cells (Dower et al. 1988) were made by inoculating two 5 mL tubes of

XL1 Blue cells in LB media and growing shaking overnight at 37°C. The cells were then diluted down to 1/100th in LB media and grown to an O.D.600 of 0.8, measured using Bio Rad

SmartSpecÔ Plus Spectrophotometer. The competent cells were grown and isolated following a modified protocol created by Dower et al. 1988 (NAR 16:6127). Cells were re-suspended in 1/5 of the volume of HEPES twice as well as washed with half that volume of 7% DMSO. Lastly the cells were re-suspended in 2 mL of 7% DMSO, aliquoted and stored at -80°C.

Quick Prep

Desired cells were scraped from appropriate agar plate and placed in a sterile 1.5mL

microcentrifuge tube containing 1mL of cold 1mM HEPES. Cells were then resuspended

using a pipette and centrifuged for 1 minute at 13000 RPM at 4°C. The supernatant was

removed, and cells were resuspended in 300µL of cold 7% DMSO. Cells were either

used immediately or frozen at -80℃.

Drop Dialysis

DNA samples that had been cloned and/or ligated were drop dialyzed before being used for electroporation. Samples were pipetted onto a 90 mm MF-Millipore mixed-cellulose membrane floating on distilled water but not submerged. Samples were incubated for 2 minutes per microliter and then used for subsequent transformations.

Bacterial Transformation

Electroporation of competent E. coli was performed following the protocol developed by Dower et al. 1988 (NAR 16:6127) using LB media rather than Super Optimal broth with Catabolite repression (SOC). Salt free plasmid was added to 40µL of competent cells on ice and then added to 0.2cm electroporation cuvettes. Cell mixtures were electroporated using the BioRad Gene

Pulser instrument at 2.5 V. Entire mixture was poured into 1mL of LB and incubated at 37˚C for

1 hour in a rotating drum. 1/5 of the of cells were plated on LB agar plates with appropriate selective media and incubated overnight at 37˚C. Transformants were re-struck to singles on selective LB agar plates and frozen away.

Yeast Transformation

Yeast strains were grown overnight at 30 °C shaking, and 0.5-0.8 ml of culture were used for each transformation. Cells were resuspended in 100 μL of cold transformation buffer (0.1M

DTT, 0.2 M LiAc, 40% PEG). Plasmid DNA and 30 μg sonicated and denatured (boiled for 5 min) salmon sperm (Agilent) were added, and the reactions were incubated in a water bath at 45

°C for 30 min, mixing twice. Cells were then resuspended in 100 μl sterile ddH2O and plated on the appropriate drop-out media. Plates were incubated for 2 days.

Sequencing

Purified plasmids and PCR products were sequenced at GENEWIZ following GENEWIZ requirements. Sequences were aligned and visualized using SnapGene.

Gel Electrophoresis

All gels were run using 0.8% agarose in 1X TAE Buffer at 90V for 70-90 minutes. Samples were mixed with loading dye prior to loading and a 2-log ladder from New England Biolabs was run in the first lane as a marker. After being run, gels were stained with 1.0 µg/mL ethidium bromide, washed with 1X TAE Buffer, and imaged.

Strain Construction

P1 Lysate

Phage stock of P1 242 (MG1655) was used to create P1 Lysate of yoaA::ΔFRT. Cultures of desired strain were grown overnight in 5mL of LCG media, standing, at 37℃. 200µL of culture was aliquoted into small test tubes. 20µL of P1 242 stock was added to the first tube (1:10

23 dilution). 1:10 serial dilutions are done down to a concentration of 10-6 (6 tubes), vortexing between each dilution. The tubes are incubated for 25 min at 37˚C. 3mL of molten LCG top agar was added, vortexed, and poured and spread onto correctly labeled LCG agar plate. Plates are incubated overnight at correct temperature. Phage is then harvested from correct dilution by scraping the agar off the plate and placing into a 30mL Corex glass centrifuge tube. 2mL of LB and 0.5mL of Chloroform are added and vortexed every 2 minutes for 10 minutes. The sample is centrifuged for 5 minutes at 7000 RPM and supernatant is transferred into a sterile vial, and

0.5mL of Chloroform is added. P1 stored at 4˚C.

P1 Transduction

Strain to be induced was grown standing in 5mLs of LCG at 37℃ overnight. The next day, 3 microcentrifuge tubes of 1mL of culture were spun down at 14000 rpm for 30 seconds. The cells were then each resuspended in 100uL of LCG. One tube received no P1 phage, one received

5uL, and one received 20uL. Tubes were incubated in a water bath at 37℃ for 25 minutes. After incubation, 100uL of sodium citrate was added to each tube and the mixture was then spread on the appropriate selective LB plate. Successfully transduced colonies were re-struck to singles and frozen away.

PCR

Table 3: Primer List

Name Sequence yoaA K51A/R_R TCCTGCTTCCACCACCAGCGGCTGGCCTTTTTCT yoaA K51R_F ACCGGTACGGGCAgAACCTACGCTTACCTG

Colony PCR

Promega GoTaqTM Green Master Mixture was used to perform low fidelity PCR for sequence confirmation. The reagents were added, and the run settings were determined according to the

NEB protocol with the following modifications: annealing temperatures were chosen so that they were roughly 5 below the melting temperature of the primer of interest.

Around the World PCR

Kinase Reaction

In a microcentrifuge tube, 300 pmols of appropriate primer were combined with 10X T4

polynucleotide kinase buffer, 10mM ATP, 10 units of T4 polynucleotide kinase, and

distilled water to reach a final volume of 50 uL. The reaction was incubated for 1 hour in

a 37℃ water bath.

PCR

Phusion High-Fidelity DNA Polymerase from New England Biolabs was used for

Around the World PCR reaction. The reagents were added, and the run settings were

determined according to the NEB protocol with the following modifications: annealing

temperatures were chosen so that they were roughly 5 below the melting temperature of

the primer of interest.

Digest

20 units of DpnI were added to the Around the World PCR reaction to digest the template

DNA. The digest was incubated in a water bath at 37℃ for 1.5 hours.

Ligation

20 units of T4 DNA ligase and 10X T4 DNA ligase buffer were added to the digested

Around the World PCR reaction and incubated in a water bath at 16 for 1.5 hours.

DNA Purification

Plasmid Purification

Plasmids were purified according to the BioBasic column plasmid DNA miniprep kit

protocol. Samples were eluted in 50µL of elution buffer and stored at 4℃.

PCR Purification

PCR products were purified according to the BioBasic column PCR purification kit

protocol. Samples were eluted in 50uL of elution buffer and stored at 4℃.

Yeast Two-Hybrid Assay

Yeast Two-Hybrid Analysis was performed using the protocol and controls from the

Matchmaker Gold Yeast Two-Hybrid System from Clontech, Takara Bio. Single colonies of each strain were grown in 5 mL of dropout media according to corresponding plasmid markers for 20 hours. Cultures were then diluted 1:50 in sterile water. 5uL of this dilution was plated on the following media: YEPD, -leucine, -tryptophan, -leucine and tryptophan, -histidine and - adenine. YEPD is the universal medium for which all cultures will grow and plates lacking either leucine, tryptophan or both are controls to test plasmid retention. The histidine deficient plates test for weak protein-protein interactions while adenine deficient plates test for stronger interaction. Plates were incubated for two days at 30°C.

Rifampicin Assay

Strains of interest are grown overnight in 5mL cultures of LB media standing at 37℃. The following day, culture is diluted 1:100 and grown up for 4 hours shaking at 37℃. 1.2mL of each

26 culture was spun down and washed twice with 1.2mL of 1X 52/6. The final pellet was then resuspended in 1.2mL of 1X 52/6. 200uL of the resuspension was then aliquoted into a 96 well plate and serially diluted 1:10 up to 10-7 in 1X 56/2. 5uL of serially diluted cells are plated onto

LB plates. The remaining 1mL was spun down and resuspended in 200uL to be plated on full rifampicin plates of 50 and 100 ug/mL concentrations. All plates were grown overnight, colonies were counted, and counts were used to calculate fraction survival.

Gene Conversion Assay

Strains of interest were grown from single colonies standing overnight in 5mL cultures of appropriate selective media. The next day 1mL of culture was spun down at 10,000 rpm for 2 min and pellet was resuspended in1mL of 1X 56/2. This wash was performed twice. The resuspensions were serially diluted 1:10 up to 10-5 in 1X 56/2 and plated on three different plates: LB + X-Gal + IPTG + Glucose, Minimal Media + X-Gal + IPTG + Glucose, and Minimal

Media + X-Gal + IPTG + Lactose. Additionally, 200µL of each resuspension was plated on each type of plate, one strain per plate. Plates were incubated overnight at 37℃ with the exception of the lactose plates which were incubated for two days. When plates were completely grown, colonies were counted, and conversion rates were calculated according to the method of the median (Lea and Coulson 1949).

Toxicity Assay yoaA+, yoaA T3, and yoaA K51R were overexpressed in pCA24N, a high copy plasmid induced by IPTG. The empty vector was used as a control and all strains are in an MG1655 background.

Single colonies of strains of interest were inoculated in 5mL standing cultures of LB overnight.

The next day cultures were diluted 1:100 in 1X 56/2 in a Costar 96 Well Assay Plate (treated polystyrene, black plate, clear bottom)). Samples were grown shaking in the BioTek Cytation 1

Plate Reader at 37℃ for three hours. After three hours, IPTG was added to half of the wells at a final concentration of 1mM and samples were grown shaking for an additional three hours.

OD600 readings were taken every 15 minutes. Values plotted represent the mean OD of six replicates.

Bibliography

Brown, Laura T., et al. “Connecting Replication and Repair: YoaA, a Helicase-Related Protein, Promotes Azidothymidine Tolerance through Association with Chi, an Accessory Clamp Loader Protein.” PLoS Genet, vol 11, 11, 2015

Brückner, Anna, et al. “Yeast Two-Hybrid, a Powerful Tool for Systems Biology” Int J Mol Sci. 10(6): 2763–2788, 2009

Clontech Laboratories, Inc. “Matchmaker™ GAL4 Two-Hybrid System 3 & Libraries User Manual”. 2007

Chen, Jian-Min, et al. “Gene conversion: mechanisms, evolution and human disease.” Nature, vol 8, 762-775 2007 delToro, Damian., et a1. “Walker-A motif acts to coordinate ATP hydrolysis with motor output in viral DNA packaging”. J Mol Biol. 428(13): 2709–2729. 2016

Duigou, Stéphane, et al. “ssb Gene Duplication Restores the Viability of ΔholC and DholD Escherichia coli Mutants.” PLoS Genet, vol 10, 10, 2014

Fuss, Jill O., et al, “Emerging critical roles of Fe–S clusters in DNA replication and repair.” BBA, 1853, 1253–1271, 2015

Goldstein, Beth P. “Resistance to rifampicin: a review.” The Journal of Antibiotics, 67, 625–630, 2014

Suresh, Ashithkumar Beloor and Wadhwa, Roopma. “Rifampin.” StatPearls, StatsPearl Publishing, 2020

Voloshin, Oleg N. and Camerini-Otero, R. Daniel. “The DinG Protein from Escherichia coli Is a Structure-specific Helicase”. The Journal of Biological Chemistry, 282, 18437-18447, 2007