Chi Subunit of Polymerase III Holoenzyme May Have Function in Addition to Facilitating DNA Replication

Master’s Thesis

Presented to

The Faculty of the Graduate School of Arts and Sciences Brandeis University Department of Biochemistry Dr. Susan Lovett, Advisor

In Partial Fulfillment of the Requirements for the Degree

Master of Science in Biochemistry

by Taku Harada

May 2018

Taku Harada

Acknowledgments

I would like to thank my advisor Dr. Susan Lovett. Thank you for sharing this opportunity to explore the E. coli genome with you. I had a wonderful experience. Along the way, your unwavering support and encouragement was irreplaceable. I am greatly fortunate and appreciative.

Thank you to my mentor Dr. Alex Ferazzoli. No amount of words could ever describe the gratitude I have for you. You were a mentor for me in science and life. Thank you for always supporting and encouraging me to learn even if, at times, it meant failure. I attribute my success to your investment and confidence in me. Most importantly, your enthusiasm and joyous personality is inspirational and made every day a good day.

Thank you to Ariana, Dr. Cooper, Laura, Vinny, Julie, McKay and everyone who worked in the Lovett lab during my stay. You all welcomed me in and provided a supportive environment that extended beyond the lab walls. I am very fortunate to have worked with all of you.

Thank you to all my friends. Special thanks Adib, Eli, Jessie, and Rich. My four years at Brandeis have been phenomenal because of your support and motivation. I look forward to many more years of friendship.

Thank you to all the teachers at the Science, Math, and Technology Center at Godwin. Thank you for allowing me to explore and build a solid foundation to become the scientist I am today.

Thank you to my family for always encouraging me to reach for the stars and providing me with the opportunities and support to do so. Your love and care for me is always appreciated.

iii ABSTRACT

Chi Subunit of Polymerase III Holoenzyme May Have Function in Addition to Facilitating DNA Replication

A thesis presented to the Department of Biochemistry

Graduate School of Arts and Sciences Brandeis University Waltham, Massachusetts

By Taku Harada

The chi subunit, encoded by the holC gene, is known to have a significant role in the efficient replication of DNA. It is unknown whether chi has other functions in the cell and it was the goal of this study to elucidate interaction of chi with other proteins. I screened suppressor mutations for a

ΔholC Escherichia coli strain to determine what genes may be linked to chi function. Suppression of

ΔholC mutants was done by culturing the strain in unrestricted growth and replicative stress conditions by exposure to AZT. Colonies that were larger in size relative to others were identified as suppressors and measured for viability and sensitivity to AZT. A total of 79 suppressor colonies were isolated. Many suppressors had greater viability and resistance to AZT relative to ΔholC mutants.

Furthermore, suppressors had morphological changes including elongation of the cell and development of a mucoid membrane. These observations were more pronounced in suppressors isolated from AZT exposure. Twenty of these suppressors were whole genome sequenced and mutations in dnaB, sspA, rpoA, and rpoC were found. These mutations indicated previously unknown interactions with holC. I propose that the chi subunit may have additional functions to its established role in DNA replication, particularly DNA transcription.

iv Table of Contents

List of Tables ………………………………………………………………………………………………………………………………………. VI List of Figures …………………………………………………………………………………………………………………………………..... VII

Introduction ...... 1 DNA Replication and holC ...... 1 DNA Repair and holC ...... 8 Materials and Methods ...... 10 Bacterial strains and growth conditions ...... 11 Isolation and identification of suppressor mutations ...... 12 Phenotypic measurements: Viability, AZT sensitivity, Microscopy ...... 12 DNA extraction and Next-generation whole genome sequencing ...... 13 Data analysis ...... 13 Results...... 14 Initial screen for ΔholC suppressor mutations ...... 14 ΔholC suppression and its control ...... 15 Large scale screen for ΔholC suppressor mutations ...... 18 Discussion ...... 25 References ...... 30

List of Tables

Table 1: Escherichia coli K-12 strains used/made in this study 10 Table 2: PCR and sequencing primers used in study 14 Table 3: ΔholC mutant suppressor strains from initial screen 15 Table 4: Phenotypes of suppressor colonies 23 Table 5: Phenotypes of sequenced suppressors 23 Table 6: ΔholC mutant suppressor strains from large scale screen 24

List of Figures

Figure 1: Schematic of Replisome 2 Figure 2: Schematic of Pol III HE and its interaction with SSB 2 Figure 3: The gamma clamp loader complex hydrolyzes ATP to load the beta clamp 6 Figure 4: Chi subunit of gamma complex displaces primase from SSB to initiate replication 8 Figure 5: Azidothymidine is a chain terminator 9 Figure 6: ΔholC suppression controlled by changing growth conditions 17 Figure 7: tdk gene screen isolated suppressors with large deletions in the gene 19 Figure 8: Suppressor colonies grew robustly and were more resistant to AZT than ΔholC 20 Figure 9: Suppressor colonies have auxotrophic phenotype 21 Figure 10: Suppressor colonies have mucoid coating 23

vii

Introduction DNA Replication and holC Chromosomal replication is an essential process for organisms to pass genetic information down from one generation to the next. This replication process is performed by the replisome which is present in all organisms with highly conserved structural and functional components

(reviewed in Yao, 2010). The replisome of Escherichia coli has proven to serve as an excellent model for understanding each component’s function. When the replication process is unstable, changes in the genome can occur. These changes are known as mutations and can lead to catastrophic outcomes such as cell death. For this reason, it is important to understand how organisms can adapt to limit these occurrences. I am interested in replication stalling events and their effects on mutation.

The replisome is an apparatus of multiple protein subunits responsible for the duplication of genomic DNA (Figure 1). It includes DnaB helicase, DnaG primase and the DNA Polymerase

III holoenzyme (DNA Pol III HE) (Yao, 2010). The DNA Pol III HE synthesizes new DNA in

Escherichia coli (Figure 2). DNA Pol III HE is composed of three polymerase cores (Pol III core)

(McInemy, 2007), a beta clamp, and the gamma complex otherwise known as the clamp loader

(Onrust, 1995). Each Pol III core is responsible for hydrolyzing ATP to rapidly add nucleotides and elongate DNA (McInemy, 2007). It is stabilized to the replication fork by binding to the beta clamp (Stukenberg, 1991). The beta clamp is essential for the synthesis of DNA and is “loaded” to encircle duplex DNA by the gamma complex (Stukenberg, 1991). The gamma complex recognizes primed DNA templates and hydrolyzes ATP to initiate this loading process (Simonetta,

2009). It is made up of five subunits. They are: gamma, delta, delta prime, chi, psi (Onrust, 1993).

Of these subunits, only the gamma, delta, and delta prime subunits have been deemed essential for

the E. coli genome replication (Onrust, 1993). However, strains lacking chi and psi show major growth defects highlighting their importance in efficient genome duplication.

Replication initiates when DnaA opens the double-stranded DNA (dsDNA) to two single- strands (ssDNA), the leading and lagging strand. There is one origin of replication that creates two replication forks proceeding in a bidirectional manner. Single-stranded binding protein (SSB) binds to the ssDNA and then recruits components of the replisome (Yao, 2010). DnaB helicase unwinds the dsDNA further (Biswas, 1999). The DnaG primase synthesizes RNA primers onto both the leading and lagging single-stranded DNA (ssDNA) (Frick, 2001). DNA Pol III HE then hydrolyzes ATP to incorporate nucleotides in a 5’3’ direction. This specific directionality of Pol

III HE causes the formation of Okazaki fragments on the lagging strand (Yao, 2010). Between these fragments are gaps of ssDNA. ssDNA is unstable and can be a source for DNA damage or formation of secondary structures (Brown, 2015). Both occurrences can disrupt DNA replication and are prevented with the help of SSB.

SSB functions as a tetramer by binding to ssDNA independent of sequence. It is important in ensuring the rapid elongation and processivity of DNA Pol III HE. SSB protects ssDNA from nuclease activity and prevents secondary structure formation (reviewed in Chase, 1986).

Formation of secondary structures could potentially impede or stall DNA replication by creating a physical obstacle. SSB also serves as a central scaffolding protein to recruit other proteins necessary for DNA replication to their respective sites of function (Chase, 1986). One of these proteins is the chi subunit of the DNA Pol III HE clamp-loader complex.

Chi is coded by the gene holC and is a 16.6 k-Da monomer comprised of 147 amino acids

(Xiao, 1993). It directly interacts with SSB by binding to its highly conserved C-terminus tail. The consensus amino acid sequence of the tail is DDDIPF (Witte, 2003; Kozlov, 2010; Naue, 2011).

This tail is essential for binding of the two proteins as its deletion leads to the failure of interaction between the two (Witte, 2003; Naue, 2011). One SSB tetramer can bind up to 4 chi molecules with

5 −1 a binding affinity (Ka) in the 10 푀 range (Witte, 2003; Kozlov, 2010; Reyes-Lamothe, 2010;

Naue, 2011). X-ray crystallography and site-directed mutagenesis studies show that chi contains a hydrophobic pocket that acts as the SSB C-terminal tail binding site (Naue, 2011). Similar hydrophobic pockets are present in the known SSB binding sites of RecQ and ExoI. RecQ is a

DNA dependent helicase that unwinds it in a 3’5’ direction (Umezu, K., 1990). RecQ helps relieve DNA replication stalling events (Chakraverty, R., 1999). ExoI is a DNA mismatch repair exonuclease that works in a 3’5’ direction in E. coli and a 5’3’ direction in yeast and humans

(Kolodner, 1996; Tishkoff, 1997; Dzantiev, 2004). Sharing a conserved domain with these proteins, including a cross-species Exo1, could suggest that chi shares a similar function.

The function of chi is relatively still unknown. It is non-essential, as strains with a genetic knockout of holC and kanamycin marker insertion in place of the gene can survive (Datsenko,

2000). However, these mutant strains grow substantially slower than wild type strains. In addition,

E. coli mutants with overactive dnaA (dna(cos) mutants) are rescued with suppressor mutations that knock out or decrease the expression of holC (Nordman, 2007). An overactive dnaA creates too many sites of replication that can lead to collision of replisomes, which can cause DNA damage and hinder growth. It is suggested that without holC, the efficiency and rate of DNA replication significantly decreases and compensates for the increased replication initiation caused by the overactive DnaA, thus preventing collisions (Nordman, 2007). These observations suggest that chi plays a significant role in the replication of DNA and growth of E. coli. Chi interacts both directly and indirectly with other proteins in the replisome. Its roles include initiating replication by stimulating the gamma complex, enhancing stabilization of ssDNA through SSB, and displacing

DnaG primase from SSB and its RNA primer.

Chi interacts directly with the psi subunit of the DNA Pol III HE. The chi and psi subunits create a 1:1 heterodimer complex (Gulbis, 2004). The psi subunit also binds tightly to the gamma subunit of the gamma complex and acts as a bridge to assimilate the chi subunit into the gamma clamp loader complex (Xiao, 1993; Anderson, 2007). The clamp loader is then responsible for binding of the polymerase core complex to DNA (Yuzhakov, 1999). ΔholC strains are observed to suffer from replication arrest and polymerase loss due to the intrinsic lack of stability of the Pol

III HE on DNA (Nordman, 2007; Duigou, 2014; Michel, 2017). Chi does not interact directly with any other subunit on the DNA Pol III HE (Xiao, 1993).

The heterodimer of chi and psi also plays a role in activating the ATPase activity of the gamma clamp loader (Figure 3). This heterodimer is necessary to efficiently stimulate a 3 to 4- fold higher, relative to without it, ATPase activity of the gamma clamp loader complex to load the beta clamp onto primed DNA (Xiao, 1993; Anderson, 2007). The chi subunit alone is unable to stimulate ATPase activity to initiate DNA replication (Glover, 1998). A strain with mutant SSB, that does not allow for chi interaction with SSB, shows that assembly of the beta clamp onto primed sites and subsequent chain elongation are less efficient compared to strains with wild type SSB

(Yuzhakov, 1999). Since chi could not interact with SSB, psi and the remaining gamma complex was also unable to efficiently interact with SSB to load the beta clamp. The psi subunit has been observed to stimulate ATPase activity on its own but, the stimulation is minimal and significantly increased with the addition of the chi subunit (Anderson, 2007). These results would explain why beta clamp assembly was not completely lost. Furthermore, the gamma complex without the subunits delta prime, psi, and chi is still able to assemble the beta clamp onto primed DNA (Xiao,

1993). These findings show again that the chi subunit, along with psi, is non-essential. Due to chi’s

specificity to binding SSB, it is believed that chi helps localize the clamp loading process to only

DNA coated with SSB (Glover, 1998; Kozlov, 2010).

The chi subunit of the Pol III HE clamp-loader complex indirectly enhances the stabilization of ssDNA through its interaction with SSB. There is no observation of chi directly interacting with ssDNA. Binding of chi to SSB increases SSB’s affinity to ssDNA and prevents premature dissociation from the lagging strand (Witte, 2003). Thus, binding enhances the protection of ssDNA from nuclease activity and secondary structure formation. DNA Pol III HE activity becomes more efficient with avoidance of these obstacles. Strains null of holC have a 16- fold elevated rate in chromosomal deletions of tandem repeats likely associated to the inefficiency of DNA replication in these mutants (Saveson, 1997).

Finally, the chi subunit competes with DnaG primase to bind to SSB and displaces primase from SSB and its RNA primer to initiate DNA replication (Figure 4). Primase is an enzyme in the

replisome that is recruited by and binds to SSB to synthesize an RNA primer on ssDNA at the replication fork (Frick, 2001). Primase has been observed to remain tightly bound to SSB even after its primary role of synthesizing RNA primer (Yuzhakov, 1999). Primase does prevent dissociation of the primer and protects it against nuclease activity (Frick, 2001). It is also believed that primase does not detach until displaced by chi to create specificity for DNA replication by only the Pol III polymerase, not Pol I or Pol II. However, primase must be displaced from SSB at some point to make room for the beta clamp and Pol III HE. Furthermore, the scarcity of primase

(only 50-100 molecules per cell compared to 2000-3000 primed sites on a chromosome) in the cell indicates that it needs to be recycled to create new primers at other sites of replication, such as on the lagging strand (Kornberg, 1992). Based on this necessity to recycle, it has been proposed that another reason for primase to bind to SSB is that it guarantees the displacement of primase even if the chi subunit fails to displace it. SSB is predestined to dissociate from ssDNA upon chain extension meaning that the primase will dissociate along with the SSB eventually. When the chi subunit binds to SSB, the interaction between primase and SSB is weakened leading to its displacement. Once primase is dissociated, the beta clamp is loaded onto the RNA primer through chi’s interaction with the gamma complex and the Pol III core is activated for DNA synthesis. This displacement of primase is facilitated through SSB as chi and primase do not interact directly. No other subunit on the Pol III HE is known to have primase displacement activity (Yuzhakov, 1999).

DNA Repair and holC Recent research suggests a role for chi in DNA repair by relieving replication stalling events. Replication arrests may be caused by breaks in the DNA or by physical obstacles such as secondary structures that do not allow the DNA Pol III HE to perform its task (Brown, 2015).

When replication is stalled, ssDNA gaps are formed because the polymerase is detached and reinitiates replication at a site downstream of the stalling event. Failure to repair these gaps has negative consequences on growth and can be lethal. A study using the nucleoside analog 3’- azidothymidine (AZT) found that chi may play a role in repairing these gaps (Brown, L., 2015).

AZT is a chain terminating molecule because its 3’-hydroxyl group is replaced with an azide group making it impossible for the next nucleotide to be added by the DNA Pol III HE (Figure 5). In terminating replication, the drug causes the formation of ssDNA gaps (Cooper, 2011). The study suggests that through its interaction with SSB, chi may recruit a putative helicase YoaA which

then proceeds to unwind the damaged DNA to make room for entrance of repair factors. These repair factors then remove the azidothymidine, so replication may continue (Brown, 2015.

The question of does chi have a function in addition to assisting the efficient replication of

DNA has been raised. It has been implicated in ssDNA gap repair mechanisms through its interaction with YoaA (Brown, 2015). Chi has also been found in excess relative to polymerase core complexes (Reyes-Lamothe, R., 2010). As mentioned earlier, chi shares a hydrophobic binding site with two proteins, Exo1 and RecQ, that function in DNA repair mechanisms.

Furthermore, Chi is known to be non-essential for DNA replication of E. coli. Perhaps the chi subunit is not necessary for replication but is necessary for the repair of replication stalling events.

E. coli ΔholC mutants may have poor growth because the strain fails to repair ssDNA gaps, not due to the inefficiency of DNA replication.

A recent study in ΔholD E. coli and its suppressors found a variety of mutations that suppressed the ΔholD mutation (Michel, 2017). Since chi forms a heterodimer with psi, coded by the holD gene, we were curious to see if a ΔholC E. coli strains may present similar suppressor mutations.

The goal of this study is to elucidate functions of chi. A genetic screen for mutations that suppress an E. coli strain with complete deletion of the holC gene was performed. Poor growth of

ΔholC may be due to inefficient replication or DNA repair. I am interested in suppressor mutations in genes that have known roles in DNA replication or repair. Mutations that restore the viability of ΔholC mutant strains implicate an interaction between holC and the respective suppressor gene.

A total of 79 ΔholC suppressor colonies were isolated from unrestricted growth or replicative stress conditions. Twenty of these were whole genome sequenced to identify mutations that compensated for the deletion and restored viability comparable to that of wild type E. coli.

Materials and Methods Table 1: Escherichia coli K-12 strains used/made in this study Strain Number Suppressor Strain Plasmid Genotype Resistance type background STL 242 N/A MG1655 N/A F-rph-1 N/A (wild type) STL 18822 N/A MG1655 N/A holC::FRT Kan F- Kan rph-1 STL 20976 AZT MG1655 N/A holC::FRT Kan F- Kan rph-1 STL 20977 AZT MG1655 N/A holC::FRT Kan F- Kan rph-1 STL 20978 AZT MG1655 N/A holC::FRT Kan F- Kan rph-1 STL 20979 AZT MG1655 N/A holC::FRT Kan F- Kan rph-1 STL 20980 AZT MG1655 N/A holC::FRT Kan F- Kan rph-1 STL 20981 AZT MG1655 N/A holC::FRT Kan F- Kan rph-1 STL 21572 Growth MG1655 N/A holC::FRT Kan F- Kan rph-1 STL 21573 Growth MG1655 N/A holC::FRT Kan F- Kan rph-1 STL 21574 Growth MG1655 N/A holC::FRT Kan F- Kan rph-1 STL 21575 Growth MG1655 N/A holC::FRT Kan F- Kan rph-1 STL 21576 Growth MG1655 N/A holC::FRT Kan F- Kan rph-1 STL 21577 Growth MG1655 N/A holC::FRT Kan F- Kan rph-1

STL 21578 Growth MG1655 N/A holC::FRT Kan F- Kan rph-1 STL 21579 Growth MG1655 N/A holC::FRT Kan F- Kan rph-1 STL 21580 Growth MG1655 N/A holC::FRT Kan F- Kan rph-1 STL 21581 Growth MG1655 N/A holC::FRT Kan F- Kan rph-1 STL 21582 Growth MG1655 N/A holC::FRT Kan F- Kan rph-1 STL 21583 AZT MG1655 N/A holC::FRT Kan F- Kan rph-1 STL 21584 AZT MG1655 N/A holC::FRT Kan F- Kan rph-1 STL 21585 AZT MG1655 N/A holC::FRT Kan F- Kan rph-1 STL 21586 AZT MG1655 N/A holC::FRT Kan F- Kan rph-1 STL 21587 AZT MG1655 N/A holC::FRT Kan F- Kan rph-1 STL 21588 AZT MG1655 N/A holC::FRT Kan F- Kan rph-1 STL 21589 AZT MG1655 N/A holC::FRT Kan F- Kan rph-1 STL 21590 AZT MG1655 N/A holC::FRT Kan F- Kan rph-1 STL 21591 AZT MG1655 N/A holC::FRT Kan F- Kan rph-1 STL 21268 N/A MG1655 N/A holC::FRT Kan F- Kan rph-1 STL 21274 N/A STL 242 pBad-18 F-rph-1 Ap (MG1655) holC resiAp STL 21396 N/A STL 21268 pBad-18 holC::FRT Kan F- Ap, Kan (MG1655) holC rph-1 resiAp

Bacterial strains and growth conditions The strains used in this study are listed in Table 1. Apart from the holC mutant (STL 21268) when trying to control suppression, all E. coli K-12 strains were grown at 37℃ in Luria-Bertani

(LB) medium (1% tryptone, 0.5% NaCl, 0.5% yeast extract), with 1.5% agar for plates. When controlling suppression, the holC mutant was grown at 30℃ in minimal media (1% 1x56/2 saline

solution, 0.2% glucose, 0.001% B1), with 2.0% agar for plates. LB medium was supplemented as necessary with 30ug/mL of kanamycin (Kan) and either 7.5ng/mL or 12.5ng/mL of azidothymidine.

ΔholC strain (holC::FRT Kan F- rph-1) was made by P1 transduction (STL 21268)

(Thomason, L., 2007). The strain was confirmed by PCR and Sanger sequencing through the

GENEWIZ sequencing service. LCG media (1% tryptone, 0.5% NaCl, 0.5% yeast extract, 0.2%

CaCl2, 0.1% glucose) with 0.5% and 1% agar for top agar and plates, respectively, was used to perform the transduction. PCR product was purified using Biobasic EX-10 Spin Column PCR

Product Purification kit. Primers used for the PCR and sequencing are listen in Table. Strains were frozen at −80℃ in LB freezing media (0.5% NaCl, 0.5% yeast extract, 1% tryptone, 15% ultrapure glycerol).

Isolation and identification of suppressor mutations To isolate mutations that suppress ΔholC, STL 21268 was grown overnight in minimal media at 30℃ and diluted to a factor of 10-3 and plated on LB, LB 7.5ng/mL AZT, and LB

12.5ng/mL AZT plates. After incubation at 37℃ for an additional night, suppressors were selected on their relatively large-size to other colonies in the sample. Suppressors from AZT plates were identified by their healthier appearance relative to the other dead or weakened colonies in addition to the larger sizes. Picked colonies were isolated by re-streaking onto minimal plates and grown at

30℃. Colonies that regrew were screened for large mutation (deletion) in the tdk gene through colony PCR and subsequent gel-electrophoresis of the product. Colonies that did not regrow on minimal media or were identified as having a mutation in the tdk gene were not further analyzed.

Phenotypic measurements: Viability, AZT sensitivity, Microscopy Spot assays were conducted to measure the viability and AZT sensitivity of suppressors.

Suppressors were grown in minimal media overnight at 30℃. Serial 10-fold dilutions, beginning

with an OD of 0.100, were performed and 3uL each dilution up to 10-5 were spotted onto LB, LB

7.5ng/mL, and 12.5ng/mL AZT plates. Plates were incubated 48 hours at 30℃. The viability of the strain was determined by the presence of cell growth at different dilution factors. More cells at the same dilution factor indicated greater viability.

Cells from suppressor colonies were observed under a compound light microscope to check for morphological changes at the cellular level. Samples were observed at a magnification of 40x and phase contrasting techniques were used to help visualization of the cells. A Fischer Scientific

Micromaster microscope was used.

DNA extraction and Next-generation whole genome sequencing Suppressor colony genomic DNA was extracted and purified using a modified method of the Masterpure epicenter DNA purification kit. A second round of purification of the DNA by incubating the samples overnight at 37℃ with 1uL 5ug/uL RNase A, 1uL 5ug/uL RNase If, and

5uL NEBuffer3 in 70uL Tris pH 8.0. Ethanol precipitation was conducted at the end and the DNA was stored at −20℃ in 10mM Tris pH 8.0. Quality and purity of DNA was analyzed with 260/280 and 230/260 ratios measured using a NanoDrop spectrophotometer. A Qubit high sensitivity dsDNA kit was used to measure the quantity of DNA.

The DNA libraries were prepared using the Nextera XT Library Prep Kit. Libraries were sequenced on the Illumina Miseq system using v3 chemistry paired-end 300bp reads.

Data analysis Bbduk tool from BBTools v37.33 was used to process demultiplexed pair-end reads

(Bushnell, 2014). Reads were trimmed for quality and filtered using the following parameters: k=23, edist=1, hdist=1, ktrim=r, tpe=t, ftr2=1, qtrim=r, trimq=20, ml=35. Remaining reads were mapped iteratively using geneious version 9.1.8 (Biomatters) read mapper to the MG1655

reference sequence (NC_000913.3). Variance were scored with a minimum sequence identity of

90% and minimum coverage of 20.

Table 2: PCR and Sequencing Primers used in study Name of Primer Primer Sequence holC forward external 5’- TTGCGTCAGGCAAGGCTGTTATTGC -3’ holC reverse external 5’- TAGCGGATCATGGTATCCATGATGG -3’ tdk forward external 3’- CGCATATACCCACTTCTGTGC -5’ tdk reverse external 3’- GTCACAAGTCAACGTCGGTGC -5’

Results To elucidate holC’s function in DNA repair mechanisms, suppressors of holC knockout E. coli were isolated from growth on LB 7.5 ng/mL AZT plates at 37℃. The whole genome was sequenced to identify mutations that suppressed the mutant strain. Previous research found that chi may have a function in ssDNA gap repair induced by AZT. (Brown, 2015) AZT was used because it stalls replication and most likely forms ssDNA gaps (Cooper, D., 2011). Mutations that suppressed the ΔholC mutant could indicate interaction with the holC gene. More importantly interaction of the holC gene with a gene in DNA repair pathways may indicate its role in part of a pathway or another parallel pathway. For this reason, I was interested in suppressor mutations of genes implicated in DNA repair mechanisms.

Initial screen for ΔholC suppressor mutations In my initial genetic screen, a total of 6 suppressors were isolated within 24 hours of plating and incubation. Mutations in the 6 suppressors are listed in Table 3. Sequencing revealed that 3 out of 6 suppressor mutations were in tdk. It encodes for thymidine kinase and is required for phosphorylating AZT for its incorporation in the genome as a thymidine analog. Furthermore, its deletion makes E. coli resistant to AZT treatment (Elwell, 1987). Thus, mutation in the tdk gene may simply affect the incorporation of AZT and not any function in DNA replication or repair

pathway. For this reason, the suppressors with mutations in the tdk gene are not of great interest for this study.

Besides tdk, an interesting mutation in dnaB was identified. The mutation changed a glutamine to a valine at the 360th amino acid residue. The residue is in the DNA binding domain of DnaB and could potentially affect the interaction between the helicase and its DNA substrate

(Biswas, 1999). This mutation could influence the efficiency of replication and compensate for the inefficient replication caused by the loss of chi. This genetic interaction between the chi subunit and DnaB helicase is interesting because YoaA, another helicase, has also been shown to interact with chi. I also found a silent mutation in the ATP-dependent RNA helicase gene hrpA. The function of HrpA is unknown. These findings prompted us to expand our search on a larger scale to determine if more suppressor mutations in DnaB, HrpA, or other helicases could be found.

Table 3: ΔholC mutant suppressor strains from initial screen Suppressor # Strain Number Plate suppressor DNA Change Amino Acid (STL) was isolated from Change 1 20976 7.5 ng/mL AZT Δ(yjjU’ – lplA’) N/A 2 20977 7.5 ng/mL AZT tdk: G523T TDK: E175X 3 20978 7.5 ng/mL AZT hrpA: G1671T YbjJ: A9S CstA: A378E 4 20979 7.5 ng/mL AZT dnaB: A1079T DnaB: E360V 5 20980 7.5 ng/mL AZT Δ(tdk’ – ychE’) N/A 6 20981 7.5 ng/mL AZT Δtdk’ N/A

ΔholC suppression and its control When viability of the six suppressors was tested, it was observed that the parental ΔholC mutant grew better than some of the suppressors. This outcome was unexpected and prompted us to suspect that the parental ΔholC mutant may have been suppressed in storage. A new ΔholC mutant strain (STL 21268) was created by a P1 transduction of the holC::FRT Kan marker into wild type

E. coli. However, it was observed that the strain constantly suppressed even during construction.

To prevent suppression of the strain during construction, a method to control it was developed. To

determine the growth conditions for controlling suppression, the ΔholC mutant strain was grown on LB at 37℃, LB at 30℃ and minimal at 37℃. LB at 37℃ served as a control where suppression of the strain was expected. The lower temperature and minimal nutrition was used to slow growth in hopes of reducing suppression. As expected, a mixed colony morphology indicating suppression was observed on LB at 37℃ as expected (Figure 6 B). The other two growth conditions still yielded suppressor colonies within 24 hours of plating, evident by the appearance of mixed colony morphology (Figure 6 D, E). Growth was further slowed down by growing the ΔholC mutant strain on minimal at 30℃. Colonies grown in this condition did not appear to suppress the ΔholC mutant and exhibited expected growth phenotype. These traits include slow growth and relatively small colony size. The colonies took over 48 hours to grow. There was minimal to no mixed colony morphology in this growth condition (Figure 6 G). With a method to control the suppression of the ΔholC mutant, I was able to successfully construct a new holC::FRT Kan F- rph-1 strain and continue my genetic mutation screen on ΔholC suppressors.

Figure 6: ΔholC suppression controlled by changing growth conditions. Different growth conditions were tested to control suppression of the ΔholC mutant (STL 21268). Appearance of mixed colony morphology indicated suppression. Colonies larger in relative size indicated suppressor colonies (Red arrows). Small colonies were unsuppressed (Black arrows). The condition that prevented suppression was minimal media plates grown at 30℃ (H). No mixed colony morphology was observed at this condition. A) WT on LB at 37℃. B) STL 21268 on LB at 37℃ C) WT on LB at 30℃ D) STL 21268 on LB at 30℃ E) WT on Minimal at 37℃ F) STL 21268 on Minimal at 37℃ G) WT on Minimal at 30℃ H) STL 21268 on Minimal at 30℃

Large scale screen for ΔholC suppressor mutations After solving the ΔholC’s problem of rapid suppression, I searched for suppressors under controlled conditions. Table 4 shows the results. I conducted a large-scale attempt to isolate ΔholC suppressors to continue our study of chi’s function by plating 96 colonies onto LB, LB 7.5ng/mL

AZT, and LB 12.5ng/mL AZT plates at 37℃. LB media without AZT was used to search for suppressors of unrestricted growth with the hopes of finding mutations that may elucidate the general function of chi. A higher concentration of AZT was used to induce greater replication stalling repair events. A total of 14, (14.6%), 28 (29.2%), and 31 (32.3%) suppressor colonies were identified from LB, LB 7.5ng/mL AZT, and LB 12.5ng/mL AZT plates, respectively. Suppressor colonies were once again visible within 24 hours of plating and incubation.

We developed a PCR screen against the tdk gene to help identify interesting mutations.

This screen was conducted because I found that tdk gene suppressor mutations were prevalent

(50%). Since 2 of the 3 tdk gene mutations were large deletions, I decided to run gel- electrophoresis on the tdk gene of isolated suppressors and screen out any that showed these large deletions (Figure 7). Only 1 suppressor was screened out, thus making this screening method inefficient. I then conducted phenotypic measurements of suppressor colonies such as viability, sensitivity to AZT, and morphological changes to help narrow down suppressors of interest.

Upon screening out tdk gene mutants, suppressor colonies’ viabilities were measured.

Select spot assay results are displayed in Figure 8. Suppressor colonies generally showed more robust growth than the ΔholC mutant. Suppressors took less than 24 hours to grow compared to over 48 hours for the ΔholC mutant. Many suppressors had viabilities that showed the ΔholC mutant strain was rescued. Some grew to levels comparable with wild type. Suppressed colonies generally had a lower sensitivity to AZT relative to the parental ΔholC mutant strain but were more sensitive to AZT relative to wild type. Colonies picked from AZT plates showed greater resistance to a second round of AZT exposure compared with suppressors picked from LB plates. However, these colonies were still more sensitive than wild type colonies to AZT. Suppressors that did not show significant increase in viability or resistance to AZT were not selected for sequencing because their phenotype was not close to that of wild type and indicated poor or no suppression.

Interestingly, when picked suppressor colonies were re-struck onto minimal plates to isolate them, several displayed an auxotrophic phenotype. Colonies had developed a dependence on nutrient rich AZT plates. When the suppressor colonies were picked and re-struck onto minimal plates, no growth was observed. However, these colonies did regrow when re-struck onto LB or

LB AZT plates (Figure 9). It is unclear what these colonies are auxotrophic for. This auxotrophic phenotype was observed in 32.1% and 32.3% of suppressors from 7.5 and 12.5ng/mL AZT, respectively. Only 1 (7.1%) suppressor isolated from LB was auxotrophic. Suppressors with an auxotrophic phenotype were not sequenced because it suggested a mutation in the metabolism of organic molecules such as nucleotides. The suppressor mutation could be a change in the uptake or metabolism of AZT and not one implicated in DNA replication or repair pathways. I was interested specifically in genes that have been implicated in DNA replication of repair pathways.

Suppressor colonies that regrew on minimal media were observed under a microscope at

40x magnification (Images not shown). Elongation of the cell was observed in 30% and 40% of suppressor colonies from 7.5 and 12.5ng/mL AZT plates, respectively. These rates were both greater than the 7.7% of elongated cells observed in suppressor colonies from the LB plate. Cell elongation is associated with the induction of the SOS DNA repair pathway and its observance in cells not directly exposed to DNA damaging agents such as AZT is interesting (Little, 1982). The result suggests the suppressor mutation causes a constitutively active SOS response.

Another morphological observation was the development of a mucoid coating on suppressor colonies (Figure 10). All suppressors with a mucoid coating appeared the same even if picked from different plates (LB, 7.5ng/mL, 12.ng/mL AZT). Colonies exposed to AZT showed greater prevalence in this abnormal phenotype. 50% of suppressors from 7.5 and 12.5ng/mL AZT compared to 30.8% of suppressors from LB plates. This morphological change was the most prevalent across all suppressors but its implications towards holC function are unknown.

After examination of suppressor phenotypes, 20 were selected for whole genome sequencing. Phenotypes of the 20 selected suppressors are in Table 5. Suppressor mutations are

listed in Table 6. Sequencing revealed 4 interesting suppressor mutations, all related in some way to DNA transcription. Two suppressors had mutations in the sspA gene (Suppressor 8 and 13), previously identified as a suppressor mutation in ΔholD suppressors (Michel, 2017). The first was a substitution from an adenine to cytidine, 6 base-pairs upstream of the start codon for sspA. This mutation could potentially affect the promoter region and expression of the gene. Changing expression of a transcriptional regulator may have wide-scale downstream effects that could potentially compensate for ΔholC. The other sspA mutation changed a tyrosine to a glutamate at the 186th residue. There is no known functional domain at this residue but, changing from a neutral to charged amino acid could affect the folding of the protein and its function in regulating transcription (Hansen, 2005). This finding strongly supports the potential of chi and psi either dependently or independently interacting with sspA.

The other two suppressor mutations were found in genes coding for subunits of RNA polymerase (Suppressor 11 and 18). Suppressor 11 had an amino acid change from glutamate to lysine at the 756th residue of the RpoC protein. The RpoC protein or beta prime subunit of RNA polymerase is the catalytic subunit that incorporates ribonucleotides to create mRNA

(Ovchinnikov, 1982). Mutation in this subunit could disrupt the efficiency of transcription. More interestingly, suppressor 18 had an amino acid change from arginine to cysteine at the 191st residue of RpoA or the alpha subunit of RNA polymerase. The alpha subunit is responsible for several tasks including recognizing the promoter region, act as a target for transcriptional regulators, and assembly of the RNA polymerase subunits (alpha, beta, beta prime, and sigma) (Ebright, 1995).

This arginine at the 191st residue has been shown to directly contact the beta prime subunit and assist its assembly onto the polymerase (Igarashi, 1990). The specific R191C mutation has also been well documented and it weakens the reaction between alpha and beta prime, severely

affecting the fidelity of DNA transcription (Ishihama, 1980; Igarashi, 1990). It appears that this mutation has a large effect on DNA transcription and its link to suppressing ΔholC is exciting.

Table 4: Phenotypes of suppressor colonies Plate LB LB 7.5ng/mL AZT LB 12.5 ng/mL AZT # Suppressors 14 28 31 Isolated % Suppressors 7.1 32.1 32.3 Auxotrophic % Suppressors 7.7 30.0 40.0 Elongated % Suppressors 30.8 50 50 Mucoid

Table 5: Phenotypes of sequenced suppressors Suppressor Plate isolated from > viability Elongated Cells Mucoid Number than holC mutant 7 LB - - - 8 LB + - - 9 LB - - - 10 LB - + - 11 LB + - - 12 LB + - - 13 LB + - - 14 LB - - -

15 LB + - + 16 LB + - + 17 LB - - - 18 LB 7.5ng/mL AZT + - - 19 LB 7.5ng/mL AZT - + - 20 LB 7.5ng/mL AZT + - + 21 LB 7.5ng/mL AZT - - + 22 LB 12.5ng/mL AZT + + + 23 LB 12.5ng/mL AZT - + - 24 LB 12.5ng/mL AZT + + + 25 LB 12.5ng/mL AZT + - + 26 LB 12.5ng/mL AZT - - +

Table 6: ΔholC mutant suppressor strains from large scale screen. Suppressors 1-6 were from initial screen and are shown in Table 3. Only suppressor that were sequenced are shown. A total of 96 suppressors were isolated. Suppressor # Strain Number Plate suppressor DNA Change Amino Acid (STL) was isolated from Change 7 21571 LB yhal: T278A Yhal: V93E 8 21572 LB AC mismatch N/A 6bp upstream sspA 9 21573 LB -G upstream N/A tnaA 10 21574 LB N/A N/A 11 21575 LB ydbA: C299A YdbA: S100Y yeeJ: A6739T YeeJ: S2247C rpoC: G2266A RpoC: E756K 12 21576 LB N/A N/A 13 21577 LB A(8)A(7) PssA: G152A upstream dgcC SspA: Y186D TC upstream waaA pssA: G455C sspA: A556C 14 21578 LB N/A N/A 15 21579 LB N/A N/A 16 21580 LB waaC: -C659 N/A 17 21581 LB N/A N/A 18 21582 7.5 ng/mL AZT CG 7 bp LsrD: G97A upstream tdk RpoA: R191C lsrD: G290C MalM: G144D rpoA: G571A malM: G431A

19 21583 7.5 ng/mL AZT fabH: -G888 N/A (polynucleotide run) 20 21584 7.5 ng/mL AZT Δ(fadE’- gmhA’) N/A fdnG: T2832A 21 21585 7.5 ng/mL AZT AC upstream HldD: G141V yeeO Kup: I188V TC upstream fimB hldD: G422T kup: A562G 22 21586 12.5 ng/mL AZT prpE: C542T PrpE: A181V hldE: C787A HldE: G263C 23 21587 12.5 ng/mL AZT tdk: -C176 N/A rph: 610-692del 24 21588 12.5 ng/mL AZT waaC: 471- N/A 479del 25 21589 12.5 ng/mL AZT hldE: del471 N/A Δ(deoA’) 26 21590 12.5 ng/mL AZT AC upstream N/A yeeO TC upstream fimB tdk: T422A hldD: G422T Discussion Chi, the protein product of the holC gene, functions in assisting the efficient replication of

DNA in E. coli. Recent findings have also suggested its role in ssDNA gap repair pathways and possibly transcription (Brown, 2015; Michel, 2017). For this reason, the goal of this study was to identify the function of chi in general and in single-stranded gap repair in the model system E. coli.

This study confirmed ΔholC mutant’s high rate of suppression and found conditions for controlling its suppression. Suppressor colonies were isolated from conditions of unrestricted growth and replicative stress by AZT. New evidence was found suggesting that the chi subunit of the Pol III HE in E. coli may play an additional role from its known function in DNA replication.

Through a survey of mutations in ΔholC suppressor colonies, the genetic interaction between chi

and DnaB, a replicative helicase, was discovered. In addition, 4 suppressor mutations with implications to DNA transcription were found.

The ΔholC had weak growth and was suppressed at high rates, as suspected (Saveson,

1997), when growth was unrestricted. Colonies that suppress the holC deletion grew better and resulted in larger colonies comparable to those of wild type. The mutant strain took over 48 hours to grow compared to less than 24 hours for wild type E. coli. This observation is supported by the fact that chi is known to play a role in maintaining the efficiency of DNA replication. Inefficient replication may lead to slow growth because cells cannot complete replication to divide.

An additional explanation may be that chi plays a role in DNA repair mechanisms. The deletion of the holC gene may be inhibiting the ability for YoaA or another protein and chi to facilitate ssDNA gap repair. Without proper DNA damage repair, the strain may lack the ability to restart or continue DNA replication. Strains with complete deletion of the holC gene have a 16- fold higher mutation rate relative to wild type (Saveson, 1997) suggesting that replication may be severely error prone due to loss of function in chi.

To control suppression, the mutant strain was grown in conditions of slow growth (30℃ on minimal nutrient plates). The strain did not suppress, indicated by small colonies and the absence of a mixed colony morphology. We believe that suppression was controlled because of the mutant strain’s inefficiency in DNA replication. Under unrestricted growth conditions, the cell may be initiating DNA at the same rate of a wild type strain. However, our chi-less strain may not have the necessary replication machinery to perform replication at the wild type rate. Initiation of

DNA occurring without replication could lead to an excess of single-stranded gaps and explain our strain’s weak growth. To compensate, suppressor mutations may slow down the mutant’s initiation of replication and allow more time for the replication process without chi to “catch up”.

DnaB and chi may have a genetic interaction identified by the suppressor mutation of dnaB in a ΔholC mutant. The newly discovered interaction between chi and DnaB is interesting because the genetic interaction between the two was previously unknown. This genetic interaction may suggest that chi has another unknown function in DNA replication. Furthermore, DnaB is a helicase and a previous study has shown potential interaction between chi and the putative helicase

YoaA (Brown, 2015). Since DnaB is a helicase, its interaction with chi may be similar with that of YoaA and chi. The finding also prompted us to search for more suppressors with the potential that we could find a pattern or prevalence of suppressor mutations in helicase genes. Discovery of this pattern would strongly support the presence of an unknown interaction with chi and helicases.

A direct interaction between chi and DnaB should be detected for confirmation.

Suppressor colonies generally have more robust growth than the parental ΔholC mutant.

Lack of chi severely impacts the development of cells and colonies. Suppressor colonies have mutations that may compensate for this loss and restore development. These compensations may include increasing the efficiency of DNA replication that is lost in the absence of chi. An additional explanation is that the suppressor mutation may compensate for the loss of chi’s presence in the cell’s DNA repair mechanisms.

As stated earlier, chi interacts through SSB with YoaA to facilitate repair of ssDNA gap formed by AZT. AZT is a thymidine analog that terminates DNA chain elongation because it lacks the 3’ hydroxyl group to which the next nucleotide is added. By terminating chain elongation, ssDNA gaps are created (Cooper, 2011). The cell must then respond to this damage. Without chi, repair pathways could be nullified or impeded leading to weak growth. Compensation of this hinderance would restore growth because the cell can repair damaged DNA and replicate as normal. Further support for suppressor mutations’ roles in DNA repair pathways is the observance

that suppressor colonies had greater resistance to AZT than the parental ΔholC mutant. Some suppressor mutations potentially allow the cell to better repair damage caused by AZT exposure making them more resistant. However, suppressor colonies were not as resistant to AZT as wild type suggesting the lack of chi still causes a significant disruption in the DNA repair pathway.

Further support that chi may have a role in DNA repair pathways was the observance of elongated cells of suppressor colonies that were picked and re-struck onto minimal media plates.

Cell elongation is associated with the inhibition of cell division, a part of the SOS DNA repair pathway (Little, 1982). Elongation in cells not directly exposed to DNA damaging agents such as

AZT suggests that the suppressor mutation causes a constitutively active SOS response.

The SOS response is a system of processes induced in response to DNA damage. The response repairs the DNA damage and even induces mutagenesis in severe cases of DNA damage where the cell sacrifices DNA replication fidelity for survival (Friedberg, 2002). An active SOS response indicates that there is DNA damage in the cell. This ΔholC mutant may be experiencing

DNA damage because chi is unavailable to perform a role in DNA repair pathways and could explain the weak growth observed for this strain. Suppressor colonies may be activating the SOS response to compensate for the loss of chi in DNA repair pathways.

I found 2 mutations that could potentially affect the SspA transcription regulator protein and 2 mutations in the alpha and beta prime subunits of RNA polymerase. The sspA mutations may be compensating for ΔholC by changing the regulation of transcription and expression levels of its respective genes and proteins. For example, overexpression of a protein or proteins could help compensate for the loss of chi and its function in facilitating efficient DNA replication. The fact that sspA’s mutation has been identified in another study of ΔholD (Michel, 2017), strongly supports that it shares an interaction with chi and psi or its heterodimer. This interaction may be

through SspA’s compensation of DNA replication or chi and psi’s role in transcription regulation.

A more global effect could be occurring with the mutations in the alpha and beta prime subunits of RNA polymerase. These mutations could change transcription efficiency and change expression levels of all genes and proteins. These changes could produce proteins to compensate for chi’s lost function in DNA replication.

An alternative explanation could be that the loss of chi causes a change in transcription for compensation. The R191C mutation in rpoA destabilizes the interaction between the alpha and beta prime subunit of RNA polymerase (Igarashi, 1990). As stated earlier, the beta prime subunit is the catalytic subunit and this mutation is known to severely affect the fidelity of DNA transcription by RNA polymerase (Ovchinnikov, 1982; Ishihama, 1980; Igarashi, 1990). As fidelity of a process decreases, the processivity of it may increase. For example, the E. coli SOS response utilizes more processive but less accurate polymerases to repair DNA damage (Friedberg,

2002). The loss in accuracy explains the common occurrence of mutagenesis in the process.

With these facts, I propose a possible explanation for the suppression of ΔholC by the RpoA

R191C mutation and speculate an additional role for chi. The chi subunit could have a function in the efficiency of DNA transcription like in DNA replication and its loss is critically damaging to the process, as seen by the weak growth of ΔholC strains. To compensate for chi’s loss and save the cell, this R191C mutation causes a loss in fidelity but potentially an increase in the processivity of RNA polymerase. This trade-off could help the rate of transcription return to the level of when chi was present. Furthermore, if chi were responsible for only the efficiency of DNA replication, this R191C mutation could instead be devastating. Chi’s loss would decrease the efficiency of

DNA replication and it seems unlikely that a compensatory mutation would also decrease the fidelity of another important process in transcription.

The discovery of a genetic interaction between chi and SspA and the alpha and beta prime subunits of RNA polymerase strongly support that another function of chi may be in DNA transcription. To further confirm our genetic interaction, more genetic studies could be conducted.

One could be to add wild type holC back to our suppressor with the R191C mutation in RpoA and observe if the strain reverts to weak growth. Since the R191C mutation decreases fidelity of RNA transcription, the cell may be damaging itself if holC function is returned to wild type. Instead of compensating for the loss of holC, it would just be transcribing poorly and possibly lead to poor growth or death. The function of chi potentially now includes roles in transcription as well as in

DNA replication and repair. It would be interesting to observe direct interactions of chi with other proteins or pathways in the future.

References 1. Anderson, S., et al. (2007). A Function for the ψ Subunit in Loading the Escherichia coli DNA Polymerase Sliding Clamp. J. Biol. Chem. 282 (10), 7035-7045.

2. Bikard, D. et al. (2010). Folded DNA in action: Hairpin formation and biological functions in prokaryotes. Microbiology and Molecular Biology Reviews. 74, 570- 588

3. Biswas, E., and Biswas, S. (1999). Mechanism of DnaB Helicase of Escherichia coli: Structural Domains Involved in ATP Hydrolysis, DNA Binding, and Oligomerization. Biochemistry. 38, 10919-10928.

4. Brown, L., et al. (2015). Azidothymidine Tolerance through Association with Chi, an Accessory Clamp Loader Protein. PLOS Genetics. 11, 1-19.

5. Bushnell, B. (2014). BBM ap short read aligner, and other bioinformatic tools version 37.33. Available at https://sourceforge.net/projects/bbmap/. Accessed April 3, 2018.

6. Chakraverty, R., and Hickson, I. (1999). Defending genome integrity during DNA replication: a proposed role for RecQ family helicases. BioEssays. 21, 286-294.

7. Chase, J. and Williams, K. (1986). Single-stranded DNA binding proteins required for DNA replication. Ann. Rev. Biochem. 55, 103-136.

8. Cooper, D., and Lovett, S. (2011). Toxicity and tolerance mechanisms for azidothymidine, a replication gap-promoting agent, in Escherichia coli. DNA Repair. 10, 260-270.

9. Datsenko, K., and Wanner, B. (2000). One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. PNAS. 97, 6640-6645.

10. Duigou, S., et al. (2014). SSB Gene Duplication Restores the Viability of ΔholC and ΔholD Escherichia coli Mutants. PLOS Genetics. 10 (10), 1-10.

11. Dzantiev, L. et al. (2004). A Defined Human System that Supports Bidirectional Mismatch-Provoked Excision. Molecular Cell. 15, 31-41.

12. Elwell, L., et al. (1987). Antibacterial Activity and Mechanism of Action of 3’-Azido 3’Deoxythymidine. Antimicrobial Agents and Chemotherapy. 31, 274-280.

13. Ebright, R. and Busby, S. (1995). The Escherichia coli RNA polymerase alpha subunit: structure and function. Current Opinion in Genetics and Development. 5, 197- 203.

14. Frick, D., and Richardson, C. (2001). DNA Primases. Annual Review of Biochemistry. 70, 39-80.

15. Friedberg, E., et al. (2002). Specialized DNA Polymerases, Cellular Survival, and the Genesis of Mutations. Science. 296, 1627-1630.

16. Glover, B., and McHenry, C. (1998). The χψ Subunits of DNA Polymerase III Holoenzyme Bind to Single-Stranded DNA-binding Protein (SSB) and Facilitate Replication of an SSB coated Template. J. Biol. Chem. 273 (36), 23476-23484.

17. Gulbis, J., et al. (2004). Crystal structure of the chi:psi subassembly of the Escherichia coli DNA polymerase clamp-loader complex. Eur. J. Biochem. 271, 439-449.

18. Igarashi, K., et al. (1990). Sequence analysis of two temperature-sensitive mutations in the alpha subunit gene (rpoA) of Escherichia coli RNA polymerase. Nucleic Acids Research. 18, 5945-5948.

19. Ishihama, A., et al. (1980). Temperature-sensitive mutations in the alpha subunit gene of Escherichia coli RNA polymerase. J Mol Biol. 137, 137-150.

20. Kelman, Z. et al. (1998). Devoted to the lagging strand the chi subunit of DNA polymerase III holoenzymes contacts SSB to promote processive elongation and sliding clamp assembly. The EMBO Journal. 17, 2436-2449.

21. Kolodner, R. (1996). Biochemistry and genetics of eukaryotic mismatch repair. Genes and Development. 10, 1433-1442.

22. Kornberg, A., and Baker, T. (1992). DNA Replication, Second edition (New York: W.H. Freeman and Company).

23. Kozlov, A. et al. (2010). Binding Specificity of E. coli SSB protein for the χ subunit of DNA pol III Holoenzyme and PriA helicase. Biochemistry. 49 (17), 3555-3566.

24. Little, J., and Mount., D. (1982). The SOS Regulatory System of Escherichia coli. Cell. 29, 11-22.

25. McInemey, P., et al. (2007). Characterization of a Triple DNA Polymerase Replisome. Molecular Cell. 27, 527-538.

26. Michel, B. and Sinha, A. (2017). The inactivation of rfaP, rarA or sspA gene improves the viability of the Escherichia coli DNA polymerase hold mutant. Mol. Microbio. 104 (6), 1008-1026.

27. Naue, N., et al. (2011). Site-directed mutagenesis of the χ subunit of DNA polymerase III and single-stranded DNA-binding protein of E. coli reveals key residues for their interaction. Nucleic Acids Research. 39 (4), 1398-1407.

28. Nordman, J., Skovgaard, O., and Wright, A. (2007). A novel class of mutations that affect DNA replication in E. coli. Mol. Microbio. 64 (1), 125-138.

29. Onrust, R. and O’Donnell, M. (1993). DNA Polymerase III Accessory Proteins. J Biol Chem. 268, 11766-11772.

30. Onrust, R., et al. (1995). Assembly of a chromosomal replication machine: Two DNA polymerases, a clamp loader, and sliding clamps in one holoenzyme particle. The Journal of Biological Chemistry. 270, 13366-13377.

31. Ovchinnikov, Y., et al. (1982). The primary structure of E. coli RNA polymerase. Nucleotide sequence of the rpoC gene and amino acid sequence of the beta prime subunit. Nucleic Acids Research. 10, 4035-4044.

32. Reyes-Lamothe, R., Sherratt, D., and Leake, M. (2010). Stoichiometry and architecture of active DNA replication machinery in Escherichia coli. Science. 328 (5977), 498- 501.

33. Saveson, J. and Lovett, S. (1997). Enhanced Deletion Formation by Aberrant DNA Replication in Escherichia coli. Genetics. 146, 457-470.

34. Simonetta, K., et al. (2009). The mechanism of ATP-dependent primer-template recognition by a clamp loader complex. Cell. 137, 659-671.

35. Stukenberg, P., et al. (1991) Mechanism of the sliding beta-clamp of DNA polymerase III holoenzyme. J Biol Chem. 266, 11328-11334.

36. Thomason, L., et al. (2007). E. coli genome manipulation by P1 transduction. Curr Protoc Mol Biol. 79, 1-8.

37. Tishkoff, D. et al. (1997). Identification and characterization of Saccharomyces cerevisiae EXO1, a gene encoding an exonuclease that interacts with MDH2. Proc. Natl. Acad. Sci. 94, 7487-7492.

38. Umezu, K., et al. (1990). Escherichia coli RecQ protein is a DNA helicase. Proc. Natl. Acad. Sci. 87, 5363-5367.

39. Witte, G., Urbanke, C., and Curth, U. (2003). DNA polymerase III χ subunit ties single stranded DNA binding protein to the bacterial replication machinery. Nucleic Acids Research. 31 (15), 4434-4440.

40. Xiao, H., Dong, Z., and O’Donnell, M. (1993). DNA Polymerase III Accessory Proteins IV. Characterization of χ and ψ. J. Biol. Chem. 268 (16), 11799-11784.

41. Xiao, H. et al. (1993). DNA Polymerase III Accessory Proteins III. holC and holD encoding χ and ψ. J. Biol. Chem. 268 (16), 11773-11778.

42. Yao, N., and O’Donnell, M. (2010). Snapshot: The Replisome. Cell. 141 (6) 1088-1088.

43. Yuzhakov, A., Kelman, Z., and O’Donnell, M. (1999). Trading Places on DNA – A Three Point Switch Underlies Primer Handoff from Primase to the Replicative DNA Polymerase. Cell. 96, 153-163.