DOCSLIB.ORG

Cdna Sequence Encoding the 16-Kda Proteolipid of Chromaffin

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Cdna Sequence Encoding the 16-Kda Proteolipid of Chromaffin Proc. Natl. Acad. Sci. USA Vol. 85, pp. 5521-5524, August 1988 Biochemstry cDNA sequence encoding the 16-kDa proteolipid of chromaffin granules implies gene duplication in the evolution of H+-ATPases (proton pump/transmembrane protein/vacuole/organelle evolution) MYRNA MANDEL*, YOSHINORI MORIYAMA*, JEFFREY D. HULMESt, YU-CHING E. PANt, HANNAH NELSON*, AND NATHAN NELSON*t *Roche Institute of Molecular Biology, Roche Research Center, Nutley, NJ 07110; and tHoffmann-La Roche Inc., Department of Protein Biochemistry, Nutley, NJ 07110 Communicated by Herbert Weissbach, April 25, 1988 ABSTRACT Vacuolar H+-ATPases function in generating The vacuolar-type enzyme is present in organelles con- protonmotive force across the membranes of organelies con- nected with the vacuolar system of eukaryotic cells and nected with the vacuolar system ofeukaryotic cells. This family pumps protons without the involvement ofa phosphoenzyme of H+-ATPases is distinct from the two other families of intermediate (2-5). These H+-ATPases are composed of H+-ATPases, the plasma membrane-type and the eubacterial- several polypeptides, and to our knowledge none of these type. One of the subunits of the vacuolar H+-ATPase binds have been sequenced. A 16-kDa subunit resembles the N,N'-dicyclohexylcarbodiimide (DCCD) and has been impli- eubacterial proteolipids in that it binds DCCD and is soluble cated in the proton-conducting activity of these enzymes. We in organic solvents (18). This kind ofproteolipid was isolated have cloned and sequenced the gene encoding the DCCD- from clathrin-coated vesicles and was implicated in proton binding protein (proteolipid) of the H+-ATPase of bovine conductance across the organelle membranes, analogously to chromaffim granules. The gene encodes a highly hydrophobic the eubacterial proteolipids (19, 20). Similar polypeptides protein of 15,849 Da. Hydropathy plots revealed four trans- were detected in several other membranes containing vacuo- membrane segments, one of which contains a glutamic residue lar H+-ATPases, such as fungal and plant vacuoles (21-24). that is the likely candidate for the DCCD binding site. Sequence To ascertain the degree of correlation between the vacuolar homology with the vacuolar proteolipid and with the proteo- and eubacterial proteolipid, we have cloned and sequenced lipids of eubacterial-type H+-ATPases was detected. The pro- the cDNA encoding this subunit of the chromaffin granule teolipids from Escherichia coli, spinach chloroplasts, and yeast H+-ATPase.§ Sequence information could establish whether mitochondria matched better to the NH2-terminal part of the the vacuolar and eubacterial-type proteolipids are homolo- vacuolar protein. The proteolipids of bovine mitochondria and gous, analogous, or dissimilar (5). Neurospora mitochondria matched better to the COOH- terminal end ofthe vacuolar proteolipid. These findings suggest MATERIALS AND METHODS that the proteolipids of the vacuolar H+-ATPases were evolved in parallel with the eubacterial proteolipid, from a common Isolation and Sequencing of Peptides Generated by Cyano- ancestral gene that underwent gene duplication. gen Bromide Treatment. The H+-ATPase was purified from chromaffin granule membranes and reconstituted as de- scribed (25, 26). The proteolipid was extracted from 2 ml of Proton-transporting ATPases (H+-ATPases) play a crucial reconstituted enzyme containing about 500 pkg of protein, by role in biological energy transduction (1). These ion pumps 2 ml ofchloroform/methanol, 2:1 (vol/vol) (18). The aqueous can be classified into three main families: plasma membrane- phase was removed by pipeting and the chloroform/methanol type, eubacterial-type, and vacuolar-type enzymes (2-5). was dried by a stream of argon gas. The dry material was The plasma membrane-type enzyme is present in the plasma suspended in 1.8 ml of70% (vol/vol) formic acid. Then 0.2 ml membrane ofplants, fungi, and acid-secreting gastric vesicles of was (6, 7). The catalysis of these enzymes involves a phos- 70% formic acid containing about 10 mg of CNBr phoenzyme intermediate. The gene coding for this 100-kDa added. The mixture was incubated overnight at room tem- protein in yeast and Neurospora crassa has been cloned and perature in darkness and dried by a stream of argon gas. The sequenced (8-10). dry material was suspended in 1 ml of 1% NaDodSO4, and The eubacterial-type enzyme occurs in chloroplasts, mi- after centrifugation at 30,000 x g for 10 min the supernatant tochondria and bacteria and .operates without a phos- was subjected to high-performance liquid chromatography phoenzyme intermediate (11-13). These enzymes are com- (HPLC). Since some of the peptides were highly hydropho- posed of two distinct structures, a membrane sector, which bic, the solvent system and the method ofsolubilization ofthe is hydrophobic, and a catalytic sector, which is hydrophilic peptides generated by cyanogen bromide treatment were in nature. The function of the membrane sector is to conduct modified. Details of this approach will be described else- protons across the membrane. This sector is composed of where. The peptides were subjected to amino acid sequence three or more polypeptides, one of which is an N,N'- analysis and the following sequences were obtained: peptide dicyclohexylcarbodiimide (DCCD)-binding protein (proteo- 1, Val-Phe-Ser-Ala-Leu-Gly-Ala-Ala-Tyr-Gly-Thr-Ala-Lys- lipid ofabout 8 kDa) that is involved in the proton conduction Ser-Gly-Thr-Gly-Ile-Ala; peptide 2, Arg-Pro-Glu-Met-Ile. (14-16). The catalytic sector, which is the site of the ATPase Cleavage of the proteolipid by cyanogen bromide on the reaction, can be readily separated from the membrane by Polybrene-treated glass filter of the sequenator yielded the EDTA treatment or by applying mechanical force (17). Abbreviation: DCCD, N,N'-dicyclohexylcarbodiimide. tTo whom reprint requests should be addressed. The publication costs of this article were defrayed in part by page charge §The sequence reported in this paper is being deposited in the payment. This article must therefore be hereby marked "advertisement" EMBL/GenBank data base (IntelliGenetics, Mountain View, CA, in accordance with 18 U.S.C. §1734 solely to indicate this fact. and Eur. Mol. Biol. Lab., Heidelberg) (accession no. J03835). 5521 Downloaded by guest on September 25, 2021 5522 Biochemistry: Mandel et al. Proc. Natl. Acad. Sci. USA 85 (1988) sequence of peptide Pro-Val-Val-Met-Gly-Ile-Ile-Ala-Ile- 75 Tyr-Leu-Val-Val-Ala-Val-Leu-Ile-Ala-Asn-Ser-Leu-Asn- CGGCTTCGCACCTCGCCCC6GCCTGGTCCGTTGAACTGCCCCTTCCCAACCGCAGACATGTCCGAGGCCAAGAAC 150 Asp-Gly. The NH2-terminal amino acid of the proteolipid is M S E A K N blocked and the sequence of peptide 4, Ser-Glu-Ala-Xaa- Asn-Gly-Pro-Glu-Tyr-Ala, was obtained after deblocking the GGCCCCGAGTACGCTTCCTTTTTCGCGGTCATGGGTGCCTCAGCCGCCATGGTCTTCAGCGCCCTTGGCGCCGCC 225 HPLC-purified proteolipid or the isolated polypeptide by G P E Y A S F F A V M G A S A A M V F S A L G A A acid treatment on the glass filter. This hydrophilic peptide A AALACACLLMMAALAALLAAALA tbLALGALLGCCAlT1LTAll CGLbALLAAbAG IATA AAGITLATC 300 was readily isolated and was sequenced several times. Y G T A K S G T G I A A M S V M R P E M I M K S I and Sequencing of the cDNA Encoding the Proteo- Isolation ATCCCGGTGGTCATGGCGGGGATCATCGCCATCTATGGTCTGGTGGTGGCAGTCCTCATTGCCAACTCCCTGAAT 375 lipid. Three oligodeoxynucleotide probes were synthesized I P V V M A G I I A I Y G L V V A V L I A N S L N according to polypeptide 1: (i) d(GGCGATGCCGGTGCCG- CTTGGCGGTGCCGTAGGCGGCGCCAGGGCGCTGAA- GACGGCATCAGTCTCTACAGGAGTTTCCTTCAGCTGGGCGCAGGCTTGAGTGTGGGCCTGAGCGGGCTGGCGGCA 450 CACCAT); (ii) a mixed probe in which the redundant D G I S L Y R S F L Q L G A G L S VG L S G L A A nucleotides were replaced by all genetic code alternatives; LA LTALLATILGGAT 1Al AAGLALCAAGLLA ALAITALALLALLLAALAALLALAALILGITl1 1TATGA 525 and (iii) d(GCIATICCIGTICCGCTCTTIGCIGTICCITAIG- R S P S A L L G T Q G R A C T A Q Q P R L FV G M CIGCICCIAGIGCICTIAAIACCAT), in which those nucle- A A otides were replaced by deoxyinosine. The probes were used 600 to screen a cDNA library of bovine adrenal medulla that was I LI L I F A E V L G L Y G L I V A L I L ST K obtained from U. Gubler (27). Several positive clones were CTCTGCGGGCCGCCAGCCACAGAATACAATTGATGTCAAGACCACCCCCTTCTCATTCCACAACGAACAGCCTGA 675 obtained and the two with the largest cDNA inserts, 1.1 and 1.2 kilobases long, were sequenced. The dideoxy chain- CACACGCACGSGCAGCCGCCCGCCAG1AGTCGGTCTTGTAAATGCGCAGTGTCCCAGTGCCCACCGTCTGTTGCC 750 termination technique supplemented by exonuclease III was CCAGCCTCGCCCCTGCCCGCCCCGCCCCGTGCTGTGGACATCTGGGCCCACCAGTCCCCACCCCGGCCCTGACCA 825 used to determine the nucleotide sequence of the cDNA (28, 29). The amino acid sequence of the polypeptide used for GTGAGGACGCCGGCCTCCCGCCCCGCCCATCTGCCCTAGAGTGCTCTGTGTATAAGGATGAATTAGAGTTGTCAT 900 generating the probes was identified in the cloned cDNA by sequencing the two opposite strands of phage M13 with the TTTCTCTTCACTCGGATGTTTATTTATAAAGATTTGACCTGTTCATACGTCTGTGGAGCAGCTCTCGTCTCCAAC 975 probe serving as a primer. This sequence was used to TCTATAGTAACCTTAGGTAGACTGTTGTTGCGTTGTGCGGTTACCGTTTACCCTGAGACCCGTTGGATGGAACCA 1050 generate a second probe to serve as a primer for the second strand. Translation of this sequence revealed the amino acid CCTCTTGCAGCCCTQGTTCGCGGGCCAGTGTGACGGGCCGCTGGCGTGGTGCCGCTCCGTGTCCAATAAAGCTCT 1125 sequence of the original polypeptide. This approach was CAGATGT time-saving, since one of the clones that was positive by hybridization displayed only partial sequence
Load more

Recommended publications
  • Conservation of Topology, but Not Conformation, of the Proteolipid Proteins of the Myelin Sheath
    The Journal of Neuroscience, January 1, 1997, 17(1):181–189 Conservation of Topology, But Not Conformation, of the Proteolipid Proteins of the Myelin Sheath Alexander Gow,1 Alexander Gragerov,1 Anthony Gard,2 David R. Colman,1 and Robert A. Lazzarini1 1Brookdale Center for Molecular Biology, Mount Sinai School of Medicine, New York, New York 10029-6574, and 2Department of Structural and Cell Biology, University of South Alabama College of Medicine, Mobile, Alabama 36688 The proteolipid protein gene products DM-20 and PLP are during de novo synthesis. Surprisingly, the conformation (as adhesive intrinsic membrane proteins that make up $50% of opposed to topology) of DM-20 and PLP may differ, which has the protein in myelin and serve to stabilize compact myelin been inferred from the divergent effects that many missense sheaths at the extracellular surfaces of apposed membrane mutations have on the intracellular trafficking of these two lamellae. To identify which domains of DM-20 and PLP are isoforms. The 35 amino acid cytoplasmic peptide in PLP, which positioned topologically in the extracellular space to participate distinguishes this protein from DM-20, imparts a sensitivity to in adhesion, we engineered N-glycosylation consensus sites mutations in extracellular domains. This peptide may normally into the hydrophilic segments and determined the extent of function during myelinogenesis to detect conformational glycosylation. In addition, we assessed the presence of two changes originating across the bilayer from extracellular PLP translocation stop-transfer signals and, finally, mapped the interactions in trans and trigger intracellular events such as extracellular and cytoplasmic dispositions of four antibody membrane compaction in the cytoplasmic compartment.
    [Show full text]
  • In Silico Perspectives on the Prediction of the PLP’S Epitopes Involved in Multiple Sclerosis
    Iranian J Biotech. 2017 January;15(1):e1356 DOI: 10.15171/ijb.1356 Research Article In Silico Perspectives on the Prediction of the PLP’s Epitopes involved in Multiple Sclerosis Zahra Zamanzadeh1, Mitra Ataei1, Seyed Massood Nabavi2, Ghasem Ahangari1, Mehdi Sadeghi1, Mohammad Hosein Sanati1,* 1 Department of medical biotechnology. Institute of Medical Genetic, National Institute of Genetics Engineering and Biotechnology (NIGEB), Tehran, 14965/161 Iran 2 Department of Neurology, Faculty of Public Health, Shahed University, Tehran, 18155/159, Iran *Corresponding author: Department of Medical Genetic, National Institute of Genetic Engineering and Biotechnology (NIGEB), Shahrak-e- Pajoohesh, 15th Km, Tehran-Karaj Highway, Tehran, 14965-161, Iran. Tel.: +98 21 44780365; Fax: +98 21 44780395; E-mail: [email protected] Received: 15 Sep. 2015 Revised: 29 May 2016 Accepted: 13 March 2017 Published online: 31 May 2017 Background: Multiple sclerosis (MS) is the most common autoimmune disease of the central nervous system (CNS). The main cause of the MS is yet to be revealed, but the most probable theory is based on the molecular mimicry that concludes some infections in the activation of T cells against brain auto-antigens that initiate the disease cascade. Objectives: The Purpose of this research is the prediction of the auto-antigen potency of the myelin proteolipid protein (PLP) in multiple sclerosis. Materials and Methods: As there wasn’t any tertiary structure of PLP available in the Protein Data Bank (PDB) and in order to characterize the structural properties of the protein, we modeled this protein using prediction servers. Meta prediction method, as a new perspective in silico, was performed to fi nd PLPs epitopes.
    [Show full text]
  • FUNCTIONAL ROLES for POST-TRANSLATIONAL MODIFICATIONS of T-SNARES in PLATELETS
    University of Kentucky UKnowledge Theses and Dissertations--Molecular and Cellular Biochemistry Molecular and Cellular Biochemistry 2016 FUNCTIONAL ROLES FOR POST-TRANSLATIONAL MODIFICATIONS OF t-SNARES IN PLATELETS Jinchao Zhang University of Kentucky, [email protected] Digital Object Identifier: http://dx.doi.org/10.13023/ETD.2016.044 Right click to open a feedback form in a new tab to let us know how this document benefits ou.y Recommended Citation Zhang, Jinchao, "FUNCTIONAL ROLES FOR POST-TRANSLATIONAL MODIFICATIONS OF t-SNARES IN PLATELETS" (2016). Theses and Dissertations--Molecular and Cellular Biochemistry. 26. https://uknowledge.uky.edu/biochem_etds/26 This Doctoral Dissertation is brought to you for free and open access by the Molecular and Cellular Biochemistry at UKnowledge. It has been accepted for inclusion in Theses and Dissertations--Molecular and Cellular Biochemistry by an authorized administrator of UKnowledge. For more information, please contact [email protected]. STUDENT AGREEMENT: I represent that my thesis or dissertation and abstract are my original work. Proper attribution has been given to all outside sources. I understand that I am solely responsible for obtaining any needed copyright permissions. I have obtained needed written permission statement(s) from the owner(s) of each third-party copyrighted matter to be included in my work, allowing electronic distribution (if such use is not permitted by the fair use doctrine) which will be submitted to UKnowledge as Additional File. I hereby grant to The University of Kentucky and its agents the irrevocable, non-exclusive, and royalty-free license to archive and make accessible my work in whole or in part in all forms of media, now or hereafter known.
    [Show full text]
  • In Silico Perspectives on the Prediction of the PLP's
    Iranian J Biotech. 2017 January;15(1):e1356 DOI: 10.15171/ijb.1356 Research Article In Silico Perspectives on the Prediction of the PLP’s Epitopes involved in Multiple Sclerosis Zahra Zamanzadeh1, Mitra Ataei1, Seyed Massood Nabavi2, Ghasem Ahangari1, Mehdi Sadeghi1, Mohammad Hosein Sanati1,* 1 Department of medical biotechnology. Institute of Medical Genetic, National Institute of Genetics Engineering and Biotechnology (NIGEB), Tehran, 14965/161 Iran 2 Department of Neurology, Faculty of Public Health, Shahed University, Tehran, 18155/159, Iran *Corresponding author: Department of Medical Genetic, National Institute of Genetic Engineering and Biotechnology (NIGEB), Shahrak-e- Pajoohesh, 15th Km, Tehran-Karaj Highway, Tehran, 14965-161, Iran. Tel.: +98 21 44780365; Fax: +98 21 44780395; E-mail: [email protected] Received: 15 Sep. 2015 Revised: 29 May 2016 Accepted: 13 March 2017 Published online: 31 May 2017 Background: Multiple sclerosis (MS) is the most common autoimmune disease of the central nervous system (CNS). The main cause of the MS is yet to be revealed, but the most probable theory is based on the molecular mimicry that concludes some infections in the activation of T cells against brain auto-antigens that initiate the disease cascade. Objectives: The Purpose of this research is the prediction of the auto-antigen potency of the myelin proteolipid protein (PLP) in multiple sclerosis. Materials and Methods: As there wasn’t any tertiary structure of PLP available in the Protein Data Bank (PDB) and in order to characterize the structural properties of the protein, we modeled this protein using prediction servers. Meta prediction method, as a new perspective in silico, was performed to fi nd PLPs epitopes.
    [Show full text]
  • A Myelin Proteolipid Protein-Lacz Fusion Protein Is Developmentally Regulated and Targeted to the Myelin Membrane in Transgel C Mice Patricia A
    A Myelin Proteolipid Protein-LacZ Fusion Protein Is Developmentally Regulated and Targeted to the Myelin Membrane in Transgel c Mice Patricia A. Wight, Cynthia S. Duchala, Carol Readhead,* and Wendy B. Macklin Mental Retardation Research Center, UCLA Medial Center, Los Angeles, California 90024; and * Department of Biology, California Institute of Technology, Pasadena, California 91125 Abstract. Transgenic mice were generated with a fu- expression occurred in embryos, presumably in pre- or sion gene carrying a portion of the murine myelin pro- noumyelinating cells, rather extensively throughout the teolipid protein (PLP) gene, including the first intron, peripheral nervous system and within very discrete fused to the E. coli LacZ gene. Three transgenic lines regions of the central nervous system. Surprisingly, were derived and all lines expressed the transgene in /~-galactosidase activity was localized predominantly in central nervous system white matter as measured by a the myelin in these transgenic animals, suggesting that histochemical assay for the detection of/~-galactosi- the NH2-terminal 13 amino acids of PLP, which were Downloaded from dase activity. PLP-LacZ transgene expression was present in the PLP-LacZ gene product, were sufficient regulated in both a spatial and temporal manner, con- to target the protein to the myelin membrane. Thus, sistent with endogenous PLP expression. Moreover, the first half of the PLP gene contains sequences suf- the transgene was expressed specifically in oligoden- ficient to direct both spatial and temporal gene regula- drocytes from primary mixed glial cultures prepared tion and to encode amino acids important in targeting www.jcb.org from transgenic mouse brains and appeared to be de- the protein to the myelin membrane.
    [Show full text]
  • 11743.Full.Pdf
    The Journal of Neuroscience, November 8, 2006 • 26(45):11743–11752 • 11743 Cellular/Molecular Perturbed Interactions of Mutant Proteolipid Protein/DM20 with Cholesterol and Lipid Rafts in Oligodendroglia: Implications for Dysmyelination in Spastic Paraplegia Eva-Maria Kra¨mer-Albers,1,3 Katja Gehrig-Burger,2 Christoph Thiele,4 Jacqueline Trotter,1 and Klaus-Armin Nave3,5 1Department of Biology, Unit of Molecular Cell Biology, and 2Institute of Biochemistry, University of Mainz, 55099 Mainz, Germany, 3Department of Neurogenetics, Max Planck Institute of Experimental Medicine, 37075 Go¨ttingen, Germany, 4Max Planck Institute of Molecular Cell Biology and Genetics, 01307 Dresden, Germany, and 5Hertie Institute of Multiple Sclerosis Research, 37075 Go¨ttingen, Germany Missense mutations in the human PLP1 gene lead to dysmyelinating diseases with a broad range of clinical severity, ranging from severe Pelizaeus–Merzbacher disease (PMD) to milder spastic paraplegia type 2 (SPG-2). The molecular pathology has been generally attributed to endoplasmic reticulum (ER) retention of misfolded proteolipid protein (PLP) (and its splice isoform DM20) and induction of the unfolded protein response. As opposed to previous studies of heterologous expression systems, we have analyzed PLP/DM20 trafficking in oligodendroglial cells, thereby revealing differences between PMD and SPG-2-associated PLP/DM20 isoforms. PLP A242V and DM20 A242V ( jimpy-msd in mice), associated with severe PMD-like phenotype in vivo, were not only retained in the ER but also interfered witholigodendroglialprocessformation.Incontrast,glialcellsexpressingSPG-2-associatedPLP I186T orDM20 I186T (rumpshakerinmice) developed processes, and mutant PLP/DM20 reached a late endosomal/lysosomal compartment. Unexpectedly, PLP/DM20 with either substitution exhibited impaired cholesterol binding, and the association with lipid raft microdomains was strongly reduced.
    [Show full text]
  • R-Ras Gtpases Signaling Role in Myelin Neurodegenerative Diseases
    International Journal of Molecular Sciences Review R-Ras GTPases Signaling Role in Myelin Neurodegenerative Diseases Berta Alcover-Sanchez , Gonzalo Garcia-Martin , Francisco Wandosell and Beatriz Cubelos * Departamento de Biología Molecular and Centro Biología Molecular “Severo Ochoa”, Universidad Autónoma de Madrid, 28049 Madrid, Spain; [email protected] (B.A.-S.); [email protected] (G.G.-M.); [email protected] (F.W.) * Correspondence: [email protected]; Tel.: +34-91-1964561 Received: 23 July 2020; Accepted: 14 August 2020; Published: 17 August 2020 Abstract: Myelination is required for fast and efficient synaptic transmission in vertebrates. In the central nervous system, oligodendrocytes are responsible for creating myelin sheaths that isolate and protect axons, even throughout adulthood. However, when myelin is lost, the failure of remyelination mechanisms can cause neurodegenerative myelin-associated pathologies. From oligodendrocyte progenitor cells to mature myelinating oligodendrocytes, myelination is a highly complex process that involves many elements of cellular signaling, yet many of the mechanisms that coordinate it, remain unknown. In this review, we will focus on the three major pathways involved in myelination (PI3K/Akt/mTOR, ERK1/2-MAPK, and Wnt/β-catenin) and recent advances describing the crosstalk elements which help to regulate them. In addition, we will review the tight relation between Ras GTPases and myelination processes and discuss its potential as novel elements of crosstalk between the pathways. A better understanding of the crosstalk elements orchestrating myelination mechanisms is essential to identify new potential targets to mitigate neurodegeneration. Keywords: myelin; oligodendrocyte; neurodegeneration; PI3K/Akt/mTOR; ERK1/2-MAPK; Wnt/β-catenin; R-Ras 1.
    [Show full text]
  • The Structure of Bovine Brain Myelin Proteolipid and Its Organization In
    Proc. Nati. Acad. Sci. USA Vol. 81, pp. 2912-2916, May 1984 Neurobiology The structure of bovine brain myelin proteolipid and its organization in myelin (myelin basic protein/membrane proteins/protein folding/amino acid sequence/secondary structure prediction) RICHARD A. LAURSEN*, MOHAMMED SAMIULLAH*, AND MARJORIE B. LEESt *Department of Chemistry, Boston University, Boston, MA 02215; and tEunice Kennedy Shriver Center, Waltham, MA 02254 Communicated by Francis 0. Schmitt, December 27, 1983 ABSTRACT A model, based on amino acid sequence data, in the proteolipid are defined in terms of polarity, proposed is proposed for the organization of the myelin proteolipid in orientation in the membrane, and sequence homology. Thus, myelin membrane. The model has three distinctive features: Ti (residues 59-90), T2 (residues 151-177) and T3 (residues three trans-membrane segments that traverse the lipid bilayer, 238-267) are hydrophobic trans-membrane segments that two cis-membrane domains that enter and exit the same side of span the bilayer; Cl (residues 1-35) and C3 (residues 206- the membrane, and a highly charged segment resembling my- 216) contain hydrophobic cis-membrane segments that enter elin basic protein on the cytoplasmic side of the membrane. It and exit the same side of the bilayer; El, E2, and E3 are is proposed that the cis-membrane domain(s) can promote the intervening extra-membrane sequences that contain nearly formation and stabilization of the multilamellar myelin struc- all of the charged amino acids (Figs. 1 and 2). The segments ture by hydrophobic interaction with the apposite bilayer C1', C2, and C3' are designated as cis-membrane segments across the extracellular space.
    [Show full text]
  • Isolation of a Chloroplast N,N'-Dicyclohexylcarbodiimide
    Proc. Natl. Acad. Sci. USA Vol. 74, No. 6, pp. 2375-2378, June 1977 Biochemistry Isolation of a chloroplast N,N'-dicyclohexylcarbodiimide-binding proteolipid, active in proton translocation (1-butanol extraction/reconstitution of liposomes/dicyclohexylcarbodiimide-sensitive proton channel) NATHAN NELSON*, ESTHER EYTAN*, BAT-EL NOTSANI*, HANS SIGRISTt, KRISTINE SIGRIST-NELSONt, AND CARLOS GITLERt * Department of Biology, Technion-Israel Institute of Technology, Haifa, Israel; and tDepartment of Membrane Research, The Weizmann Institute of Science, Rehovot, Israel Communicated by Michael Sela, April 4, 1977 ABSTRACT The NN'-dicyclohexylcarbodiimide-binding MATERIALS AND METHODS proteolipid from lettuce chloroplast membranes has been pu- rified by a novel, rapid technique involving 1-butanol extraction Chloroplasts from lettuce were prepared as previously described and ether precipitation. Reconstitution of this proteolipid into (13) with the following exceptions: bovine serum albumin was liposomes composed of chloroplast lipids and subsequent in- omitted; an extra wash with 0.15 M NaCI was introduced; and corporation of bacteriorhodopsin resulted in the formation of chloroplasts were suspended in 0.01 M N-[tris(hydroxy- liposomes exhibiting a light-dependent accumulation of protons. This accumulation was significantly enhanced upon addition methyl)mnethyl]glycine (Tricine) (pH 8) at a chlorophyll con- of NN'-dicyclohexylcarbodiimide at concentrations similar to centration of 3-4 mg/mi. those that inhibit chloroplast adenosinetriphosphatase
    [Show full text]
  • Aspects of Subunit Interactions in the Chloroplast ATP Synthase'
    Plant Physiol. (1993) 102: 241-249 Aspects of Subunit Interactions in the Chloroplast ATP Synthase’ 1. lsolation of a Chloroplast Coupling Factor 1-Subunit 111 Complex from Spinach Thylakoids Downloaded from https://academic.oup.com/plphys/article/102/1/241/6066835 by guest on 23 September 2021 Carolyn M. Wetzel’ and Richard E. McCarty* Field of Botany, Cornell University, Ithaca, New York 14853 (C.M.W.); and Department of Biology, The Johns Hopkins University, Baltimore, Maryland 2121 8 (R.E.M.) decreasing molecular mass. CFl has a molecular mas of A chloroplast ATP synthase complex (CFl [chloroplast-coupling 400,000 D (Moroney et al., 1983) and a subunit stoichiometry factor l]-CFo[membrane-spanning portion of chloroplast ATP syn- of a3P3yk(Süss and Schmidt, 1982; McCarty and Moroney, thase]) depleted of all CF, subunits except subunit 111 (also known 1985). CFo contains four different subunits, with a probable as the proteolipid subunit) was purified to study the interaction stoichiometry of 111121116-121VIand molecular mass (for 11112) between CFl and subunit 111. Subunit 111 has a putative role in of 171,000 D (Süss and Schmidt, 1982; Fromme et al., 1987a, proton translocation across the thylakoid membrane during pho- 1987b; Grotjohann and Graber, 1990). Based on hydropathy tophosphorylation; therefore, an accurate model of subunit inter- actions involving subunit 111 will be valuable for elucidating the plot analysis of the amino acid sequences of CFo subunits I, mechanism and regulation of energy coupling. Purification of the 111, and IV, each appears to contain at least one membrane- complex from a crude CFl-CFo preparation from spinach (Spinacia spanning region in addition to hydrophilic regions (Hudson oleracea) thylakoids was accomplished by detergent treatment et al., 1987).
    [Show full text]
  • Hifa Regulates Developmental Myelination Independent of Autocrine Wnt Signaling
    The Journal of Neuroscience, January 13, 2021 • 41(2):251–268 • 251 Development/Plasticity/Repair HIFa Regulates Developmental Myelination Independent of Autocrine Wnt Signaling Sheng Zhang,1,3 Yan Wang,1,3 Jie Xu,3 Bokyung Kim,1 Wenbin Deng,2,3 and Fuzheng Guo1,3 1Department of Neurology, School of Medicine, University of California, Davis, California 95616, 2Department of Biochemistry and Molecular Medicine, School of Medicine, University of California, Davis, California 95616, and 3Institute for Pediatric Regenerative Medicine (IPRM), Shriners Hospitals for Children—Northern California, Sacramento, California 95817 The developing CNS is exposed to physiological hypoxia, under which hypoxia-inducible factor a (HIFa) is stabilized and plays a crucial role in regulating neural development. The cellular and molecular mechanisms of HIFa in developmental mye- lination remain incompletely understood. A previous concept proposes that HIFa regulates CNS developmental myelination by activating the autocrine Wnt/b-catenin signaling in oligodendrocyte progenitor cells (OPCs). Here, by analyzing a battery of genetic mice of both sexes, we presented in vivo evidence supporting an alternative understanding of oligodendroglial HIFa-regulated developmental myelination. At the cellular level, we found that HIFa was required for developmental myeli- nation by transiently controlling upstream OPC differentiation but not downstream oligodendrocyte maturation and that HIFa dysregulation in OPCs but not oligodendrocytes disturbed normal developmental myelination. We demonstrated that HIFa played a minor, if any, role in regulating canonical Wnt signaling in the oligodendroglial lineage or in the CNS. At the molecular level, blocking autocrine Wnt signaling did not affect HIFa-regulated OPC differentiation and myelination. We fur- ther identified HIFa–Sox9 regulatory axis as an underlying molecular mechanism in HIFa-regulated OPC differentiation.
    [Show full text]
  • Analysis of Gene Expression in the Normal and Malignant Cerebellum
    Analysis of Gene Expression in the Normal and Malignant Cerebellum ROBERT J. WECHSLER-REYA Department of Pharmacology and Cancer Biology, Duke University Medical Center, Durham, North Carolina 27710 ABSTRACT The developing nervous system consists of a small number of multipotent precursors that undergo extensive proliferation to generate the neurons and glia that make up the adult brain. Elucidating the mechanisms that control the growth and differentiation of these cells is important not only for understanding normal neural development but also for understanding the etiology of central nervous system tumors. A particularly striking example of this is in the cerebellum. Recent studies have suggested that the Sonic hedgehog-Patched signaling pathway plays a critical role in regulating the proliferation of cerebellar granule cell precursors and is also a major target of mutation in the cerebellar tumor medulloblastoma. In light of these observations, identification of additional genes that control cerebellar growth and differentiation is likely to provide important insight into the basis of cerebellar tumors. Similarly, analysis of gene expression in medulloblastoma will no doubt shed light on previously unknown signaling pathways that regulate normal cerebellar development. The advent of high-throughput gene expression analysis techniques — such as adapter-tagged competitive polymerase chain reaction (ATAC-PCR), serial analysis of gene expression (SAGE), and DNA microarrays — makes identification of such genes faster and easier than ever before. This review summarizes recent studies of gene expression in the cerebellum and discusses the value of such approaches for understanding development and tumorigenesis in this tissue. I. Development of Cerebellar Granule Cells The cerebellum is required for motor coordination and has been implicated in a variety of cognitive and affective functions as well (Leiner et al., 1993; Altman and Bayer, 1997).
    [Show full text]