Proc. Natl. Acad. Sci. USA Vol. 85, pp. 5521-5524, August 1988 Biochemstry cDNA sequence encoding the 16-kDa proteolipid of chromaffin granules implies gene duplication in the evolution of H+-ATPases (proton pump/transmembrane protein/vacuole/organelle evolution) MYRNA MANDEL*, YOSHINORI MORIYAMA*, JEFFREY D. HULMESt, YU-CHING E. PANt, HANNAH NELSON*, AND NATHAN NELSON*t *Roche Institute of Molecular Biology, Roche Research Center, Nutley, NJ 07110; and tHoffmann-La Roche Inc., Department of Protein Biochemistry, Nutley, NJ 07110 Communicated by Herbert Weissbach, April 25, 1988 ABSTRACT Vacuolar H+-ATPases function in generating The vacuolar-type enzyme is present in organelles con- protonmotive force across the membranes of organelies con- nected with the vacuolar system of eukaryotic cells and nected with the vacuolar system ofeukaryotic cells. This family pumps protons without the involvement ofa phosphoenzyme of H+-ATPases is distinct from the two other families of intermediate (2-5). These H+-ATPases are composed of H+-ATPases, the plasma membrane-type and the eubacterial- several polypeptides, and to our knowledge none of these type. One of the subunits of the vacuolar H+-ATPase binds have been sequenced. A 16-kDa subunit resembles the N,N'-dicyclohexylcarbodiimide (DCCD) and has been impli- eubacterial proteolipids in that it binds DCCD and is soluble cated in the proton-conducting activity of these enzymes. We in organic solvents (18). This kind ofproteolipid was isolated have cloned and sequenced the gene encoding the DCCD- from clathrin-coated vesicles and was implicated in proton binding protein (proteolipid) of the H+-ATPase of bovine conductance across the organelle membranes, analogously to chromaffim granules. The gene encodes a highly hydrophobic the eubacterial proteolipids (19, 20). Similar polypeptides protein of 15,849 Da. Hydropathy plots revealed four trans- were detected in several other membranes containing vacuo- membrane segments, one of which contains a glutamic residue lar H+-ATPases, such as fungal and plant vacuoles (21-24). that is the likely candidate for the DCCD binding site. Sequence To ascertain the degree of correlation between the vacuolar homology with the vacuolar proteolipid and with the proteo- and eubacterial proteolipid, we have cloned and sequenced lipids of eubacterial-type H+-ATPases was detected. The pro- the cDNA encoding this subunit of the chromaffin granule teolipids from Escherichia coli, spinach chloroplasts, and yeast H+-ATPase.§ Sequence information could establish whether mitochondria matched better to the NH2-terminal part of the the vacuolar and eubacterial-type proteolipids are homolo- vacuolar protein. The proteolipids of bovine mitochondria and gous, analogous, or dissimilar (5). Neurospora mitochondria matched better to the COOH- terminal end ofthe vacuolar proteolipid. These findings suggest MATERIALS AND METHODS that the proteolipids of the vacuolar H+-ATPases were evolved in parallel with the eubacterial proteolipid, from a common Isolation and Sequencing of Peptides Generated by Cyano- ancestral gene that underwent gene duplication. gen Bromide Treatment. The H+-ATPase was purified from chromaffin granule membranes and reconstituted as de- scribed (25, 26). The proteolipid was extracted from 2 ml of Proton-transporting ATPases (H+-ATPases) play a crucial reconstituted enzyme containing about 500 pkg of protein, by role in biological energy transduction (1). These ion pumps 2 ml ofchloroform/methanol, 2:1 (vol/vol) (18). The aqueous can be classified into three main families: plasma membrane- phase was removed by pipeting and the chloroform/methanol type, eubacterial-type, and vacuolar-type enzymes (2-5). was dried by a stream of argon gas. The dry material was The plasma membrane-type enzyme is present in the plasma suspended in 1.8 ml of70% (vol/vol) formic acid. Then 0.2 ml membrane ofplants, fungi, and acid-secreting gastric vesicles of was (6, 7). The catalysis of these enzymes involves a phos- 70% formic acid containing about 10 mg of CNBr phoenzyme intermediate. The gene coding for this 100-kDa added. The mixture was incubated overnight at room tem- protein in yeast and Neurospora crassa has been cloned and perature in darkness and dried by a stream of argon gas. The sequenced (8-10). dry material was suspended in 1 ml of 1% NaDodSO4, and The eubacterial-type enzyme occurs in chloroplasts, mi- after centrifugation at 30,000 x g for 10 min the supernatant tochondria and bacteria and .operates without a phos- was subjected to high-performance liquid chromatography phoenzyme intermediate (11-13). These enzymes are com- (HPLC). Since some of the peptides were highly hydropho- posed of two distinct structures, a membrane sector, which bic, the solvent system and the method ofsolubilization ofthe is hydrophobic, and a catalytic sector, which is hydrophilic peptides generated by cyanogen bromide treatment were in nature. The function of the membrane sector is to conduct modified. Details of this approach will be described else- protons across the membrane. This sector is composed of where. The peptides were subjected to amino acid sequence three or more polypeptides, one of which is an N,N'- analysis and the following sequences were obtained: peptide dicyclohexylcarbodiimide (DCCD)-binding protein (proteo- 1, Val-Phe-Ser-Ala-Leu-Gly-Ala-Ala-Tyr-Gly-Thr-Ala-Lys- lipid ofabout 8 kDa) that is involved in the proton conduction Ser-Gly-Thr-Gly-Ile-Ala; peptide 2, Arg-Pro-Glu-Met-Ile. (14-16). The catalytic sector, which is the site of the ATPase Cleavage of the proteolipid by cyanogen bromide on the reaction, can be readily separated from the membrane by Polybrene-treated glass filter of the sequenator yielded the EDTA treatment or by applying mechanical force (17). Abbreviation: DCCD, N,N'-dicyclohexylcarbodiimide. tTo whom reprint requests should be addressed. The publication costs of this article were defrayed in part by page charge §The sequence reported in this paper is being deposited in the payment. This article must therefore be hereby marked "advertisement" EMBL/GenBank data base (IntelliGenetics, Mountain View, CA, in accordance with 18 U.S.C. §1734 solely to indicate this fact. and Eur. Mol. Biol. Lab., Heidelberg) (accession no. J03835). 5521 Downloaded by guest on September 25, 2021 5522 Biochemistry: Mandel et al. Proc. Natl. Acad. Sci. USA 85 (1988) sequence of peptide Pro-Val-Val-Met-Gly-Ile-Ile-Ala-Ile- 75 Tyr-Leu-Val-Val-Ala-Val-Leu-Ile-Ala-Asn-Ser-Leu-Asn- CGGCTTCGCACCTCGCCCC6GCCTGGTCCGTTGAACTGCCCCTTCCCAACCGCAGACATGTCCGAGGCCAAGAAC 150 Asp-Gly. The NH2-terminal amino acid of the proteolipid is M S E A K N blocked and the sequence of peptide 4, Ser-Glu-Ala-Xaa- Asn-Gly-Pro-Glu-Tyr-Ala, was obtained after deblocking the GGCCCCGAGTACGCTTCCTTTTTCGCGGTCATGGGTGCCTCAGCCGCCATGGTCTTCAGCGCCCTTGGCGCCGCC 225 HPLC-purified proteolipid or the isolated polypeptide by G P E Y A S F F A V M G A S A A M V F S A L G A A acid treatment on the glass filter. This hydrophilic peptide A AALACACLLMMAALAALLAAALA tbLALGALLGCCAlT1LTAll CGLbALLAAbAG IATA AAGITLATC 300 was readily isolated and was sequenced several times. Y G T A K S G T G I A A M S V M R P E M I M K S I and Sequencing of the cDNA Encoding the Proteo- Isolation ATCCCGGTGGTCATGGCGGGGATCATCGCCATCTATGGTCTGGTGGTGGCAGTCCTCATTGCCAACTCCCTGAAT 375 lipid. Three oligodeoxynucleotide probes were synthesized I P V V M A G I I A I Y G L V V A V L I A N S L N according to polypeptide 1: (i) d(GGCGATGCCGGTGCCG- CTTGGCGGTGCCGTAGGCGGCGCCAGGGCGCTGAA- GACGGCATCAGTCTCTACAGGAGTTTCCTTCAGCTGGGCGCAGGCTTGAGTGTGGGCCTGAGCGGGCTGGCGGCA 450 CACCAT); (ii) a mixed probe in which the redundant D G I S L Y R S F L Q L G A G L S VG L S G L A A nucleotides were replaced by all genetic code alternatives; LA LTALLATILGGAT 1Al AAGLALCAAGLLA ALAITALALLALLLAALAALLALAALILGITl1 1TATGA 525 and (iii) d(GCIATICCIGTICCGCTCTTIGCIGTICCITAIG- R S P S A L L G T Q G R A C T A Q Q P R L FV G M CIGCICCIAGIGCICTIAAIACCAT), in which those nucle- A A otides were replaced by deoxyinosine. The probes were used 600 to screen a cDNA library of bovine adrenal medulla that was I LI L I F A E V L G L Y G L I V A L I L ST K obtained from U. Gubler (27). Several positive clones were CTCTGCGGGCCGCCAGCCACAGAATACAATTGATGTCAAGACCACCCCCTTCTCATTCCACAACGAACAGCCTGA 675 obtained and the two with the largest cDNA inserts, 1.1 and 1.2 kilobases long, were sequenced. The dideoxy chain- CACACGCACGSGCAGCCGCCCGCCAG1AGTCGGTCTTGTAAATGCGCAGTGTCCCAGTGCCCACCGTCTGTTGCC 750 termination technique supplemented by exonuclease III was CCAGCCTCGCCCCTGCCCGCCCCGCCCCGTGCTGTGGACATCTGGGCCCACCAGTCCCCACCCCGGCCCTGACCA 825 used to determine the nucleotide sequence of the cDNA (28, 29). The amino acid sequence of the polypeptide used for GTGAGGACGCCGGCCTCCCGCCCCGCCCATCTGCCCTAGAGTGCTCTGTGTATAAGGATGAATTAGAGTTGTCAT 900 generating the probes was identified in the cloned cDNA by sequencing the two opposite strands of phage M13 with the TTTCTCTTCACTCGGATGTTTATTTATAAAGATTTGACCTGTTCATACGTCTGTGGAGCAGCTCTCGTCTCCAAC 975 probe serving as a primer. This sequence was used to TCTATAGTAACCTTAGGTAGACTGTTGTTGCGTTGTGCGGTTACCGTTTACCCTGAGACCCGTTGGATGGAACCA 1050 generate a second probe to serve as a primer for the second strand. Translation of this sequence revealed the amino acid CCTCTTGCAGCCCTQGTTCGCGGGCCAGTGTGACGGGCCGCTGGCGTGGTGCCGCTCCGTGTCCAATAAAGCTCT 1125 sequence of the original polypeptide. This approach was CAGATGT time-saving, since one of the clones that was positive by hybridization displayed only partial sequence