Posted on Authorea 31 Jan 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158049398.83875848 — This a preprint and has not been peer reviewed. Data may be preliminary. nrcn eae,anvlsrs epnecle plpbi-u”hsbe nraigyrpre npocillo- in reported increasingly been 2017; has Ainsworth, bail-out” & “polyp Camp, Fordyce, called Tambutt´e, 2004; not response (Domart-Coulon, Tambutt´e, Allemand, might stress corals & 2011). novel stressors Ex- porid al., a the periods. et decades, though (Traylor-Knowles prolonged recent even hosts for In corals, coral heterotrophs photosynthesis the pocilloporid as on to live of lethal rely cannot (Kvitt, mortaility directly levels and pocilloporids cause be critical source therefore corals, reach energy stony can stresses major bleaching most once their tended with corals as As these algae in symbiotic 2011). sym- as by occur Tchernov, of ecosystems recognized still & dissociation been reef can systematic Zandbank, have coral host, the Rosenfeld, pocilloporids coral bleaching, on However, some from change zooxanthellae stresses. corals, climate environmental biotic acroporid anthropogenic to corals to resistant of studied relatively Compared impacts extensively being 2011). the about pocil- al., Acroporidae, branch, on et the corals” studies (Traylor-Knowles from branch, “complex corals” derived the “robust understanding water, the in our shallow of complement representatives Schmidt-Roach, inhabit 2019; Being corals generally al., 2014). loporid et in corals (Poquita-Du Andreakis, corals fluctuations & Pocilloporid osmotic reef-building Lundgren, and Miller, major thermal 2011). to the LaJeunesse, susceptible are them & renders Scleractinia) which (Pinzon Anthozoa: Ocean (Cnidaria: Indo-Pacific Pocilloporidae the family the in Corals Transcriptome pathway; Introduction Signaling degradation; ECM Apoptosis; bail-out; Polyp viable of acquisition enable research. Keywords will coral This in and corals.. restoration the reef bail-out on coral inducing stresses of in feasibility lethal use bail-out. the exerting possible polyp suggest upregulation for without during and pathways linear polyps bail-out signals these showing polyp survival inducing triggering profile cell pathways specifically and expression signaling by into anti-apoptotic third insights of a new activation detected provide indicating polyp results we in Our period, genes, degradation These experiment NFKB1 ECM pathway. 24-h FGF-mediated signaling and the FGF and JNK, throughout pathway the XIAP, showing signaling in profile in genes apoptotic different Furthermore, and a extrinsic profile whereas proteases an bail-out. expression h, ECM-degrading of gene 12 involvement by displayed at parallel common was peaks suggest A h expression results their 18 experiment. reached to which growth induction up genes, fibroblast upregulation bail-out CASP8 significant and and polyp related FAS factor genes 24-h the necrosis between and a tumor found apoptosis throughout of was activation of pathways significant upregulation signaling showed Beyond hyperosmosis- (FGF) corals of techniques. factor degradation, initiation qPCR during (ECM) and acuta matrix underlying Pocillopora transcriptomic extracellular mechanisms of both to molecular analyses using laboratory, genetic those the bail-out, conducted from We in polyp distinct demonstrated discussed. induced consequences been been and has rarely mechanisms have bail-out with response polyp corals this of pocilloporid induction some Although by exhibited bleaching. response of stress a is bail-out Polyp Abstract 2020 5, May 1 Chuang Po-Shun acuta Polyp Pocillopora the in in Response Participate Bail-out Pathways Signaling FGF and TNF knw nttt fSineadTcnlg rdaeUniversity Graduate Technology and Science of Institute Okinawa 1 n aoh Mitarai Satoshi and 1 1 Posted on Authorea 31 Jan 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158049398.83875848 — This a preprint and has not been peer reviewed. Data may be preliminary. Kiumrn aa)a 5ak trei h ramn ru n he ntecnrlgop.Light group). control seawater the 26 Artificial in – tanks. 24 three of experimental and range mother the group indoor a in treatment from daily 5-L fluctuate fragments the two to 300 coral allowed in in at six provided (three experiments, placed was 35tanks the randomly intensity to at at and prior Japan) samples day off (Kaisuimaren, RNA One clipped in collected (2016). were response we al. bail-out colony bail-out, et the Shapiro polyp from of of modified induction initiation I) during during (Experiment intervals response analysis 12-hour transcriptomic six transcriptomic over the for for examine seawater sampling To where natural RNA Seragaki, sand-filtered and at flowing, induction experiments. with Section bail-out bail-out supplied Polyp Science polyp tank of Marine outdoor onset OIST the 3000-L the before a to months in transferred kept were were of colonies they colonies Coral six Japan. purchased Okinawa, we 2018, In maintenance and collection Coral polyp signaling in pathways, the pathways respectively. Methods signaling degradation, identify (FGF) signaling and ECM factor to multiple Materials growth and sought of fibroblast apoptotsis involvement and we trigger (TNF) show independently assays, factor likely Results qPCR necrosis which bail-out. tumor and the polyp analysis including to bail-out, transcriptomic lead both that on pathways Based in 2014). bail-out induce al., to stress hyperosmotic applied to polyp we Ho- study, in present 2018). responses the al., proteolytic In that infancy. et and (Wecker proposed its apoptotic polyps in also the individual still activating was pathways of is it signaling detachment bail-out study, coral of in between that understanding resulting (ECM) our In skeleton, matrix and wever, extracellular calcareous 2018). bail-out the the al., of polyp and degradation et between trigger Wecker polyps link cathepsins, 2015; as hypothetical such al., the enzymes, et proteolytic supporting stu- (Kvitt transcriptomic degradation, recent apoptosis coenosarc A tissue-specific with perspective. concert molecular in a genes corals from response pocilloporid enabling this 2017), some of al., of of dy et understanding Voolstra genomes 2018; Recently, thorough Traylor-Knowles, under- significance. & more Baker, better ecological a polyps. Gillette, Bay, to its the detached (Cunning, us and published induce of help nature been resettlement to have may in and methods bail-out occurrence survival develop polyp its facilitate underlying to stand would mechanisms help which molecular can corals, understanding Furthermore, (Sammarco, bail-out the restoration stressing polyp reef without in for response participating colonies pathways coral signaling of Identifying and corals under production 2016). stony skeletogenesis mass al., in resume et of method reproductive Shapiro and approach sub- asexual 1982; alternative resettle an different as an to a considered provide thought offer be may are polyps can bail-out these polyps polyp 2016), detached conditions, al., favorable since As et Migotto, Moreover, 2018). Shapiro (Capel, algae. al., months 2018; symbiotic et to al., Wecker weeks for et 2016; of material al., Serrano periods ject et for 2014; conditions Shapiro Kitahara, 2017; laboratory 2018; & al., in Serrano, et Zilberberg, maintained & Fordyce be Inostroza, treatments, 2004; can Coma, different al., polyps Serrano, 2014). with detached et 2015; al., demonstrated (Domart-Coulon et along al., hyperosmosis been Wild et reefs and has 1982; Kvitt and acidification, (Sammarco, bail-out Reef via uncertain stress, polyp Barrier still thermal colonies of Great are including induction triggers coral the the conditions, in of although (Sammarco, laboratory reported Rica, dissociation skeletons Under been Costa by calcareous of has coast the characterized bail-out Wecker Pacific from polyp is the 2016; environments, polyps Vardi, bail-out natural zooxanthellate & In polyp of 1982). Stocker, detachment bleaching, Gavish, and coral Kramarsky-Winter, degradation Unlike Shapiro, coenosarc 2018). 1982; al., Sammarco, 2015; et al., et Kvitt .damicornis P. oilpr damicornis Pocillopora nsitu in codn orcn hlgnccasfiain Jhso ta. 07 cmd-oc et Schmidt-Roach 2017; al., et (Johnston classifications phylogenic recent to according , tde fcrlclua ilg n fsmitcrltosisbtencrl and corals between relationships symbiotic of and biology cellular coral of studies uigplpbi-u eosrtdoeepeso fmn caspase-encoding many of overexpression demonstrated bail-out polyp during μ o htn m photons mol oilpr acuta Pocillopora -2 ° s .Frtetetetgop ihslnt rica seawater artificial high-salinity group, treatment the For C. -1 iha1-ordyngtcce aktmeauewas temperature Tank cycle. day-night 12-hour a with 2 rmteOn ilg ihre oprtv in Cooperative Fisheries Village Onna the from .acuta P. .acuta P. sn yeomtctreatment hyperosmotic a using , pce lsl related closely species a , Posted on Authorea 31 Jan 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158049398.83875848 — This a preprint and has not been peer reviewed. Data may be preliminary. M2,JK FB,adXA;Tbe2 naSeOelsRa-iePRSse Tem ihrSci- Fisher (Thermo System was PCR subse- synthesis Real-Time MMP19, was StepOnePlus RHO, cDNA a FGF2, cDNA on FGFR2, and Synthesized 2) CASP8, (FAS, Table above USA). genes XIAP; described (Invitrogen, stress and 10 NFKB1, Mix as comprising JNK, assay Master extracted MMP24, qPCR VILO a was to IV RNA subjected SuperScript quently total the II, using for experiment conducted 6 from = N samples points; For assay time qPCR was (5 group). RNA and induction control coral synthesis bail-out for response, cDNA polyp 3 genetic of = the time-course N of (150 resolution and the conditions temporal group through lighting treatment better intervals induction a the 6-hour bail-out 35For for at polyp – except for (34 sampled setup I, seawater experimental natural experiment The filtered in of analyses. as experiment qPCR bail-out same for polyp the second samples a was RNA conducted collected we II) analysis, and transcriptomic 2019 (Experiment the in from (qPCR) results PCR validate to bail-out. quantitative order to polyp In real-time 2009) in by pathways 2008, results and signaling Lempicki, transcriptomic and (S43/S35) & of processes h Sherman, Validation cellular 12 (Huang, specific at v6.8 of DEGs resources participation downregulated bioinformatics the DAVID and examine using upregulated intra-individual (S46/S35), for out h separately of 24 cancel performed criteria then to the S43/S35 were with was designed of analyses analysis 2010) h), DE Smyth, comparisons The 24 & pairwise treatment. McCarthy, at and the (Robinson, for by (response Fig. edgeR specifically transcripts using induced 57.9%; S46/S35 response annotated performed (PC1: and transcriptomic on identify treatment h) to hyperosmotic analysis and 12 the variation DE at to replicates conducted attributed response biological be therefore (representing among could We variation variation some the showed 1). of transcripts eukaryotic most annotated SwissProt 14.9%), the the (PC2: of searching (PCA) by analysis assembly component 3 transcriptome on the (downloaded database of protein annotation functional performed anal- We enrichment (GO) ontology gene and (DE), yses expression differential annotation, transcripts Functional 2015). reconstructed Zdobnov, and & Kriventseva, 2011) alignment Ioannidis, Dewey, ( Waterhouse, coverage successful metazoa & low the pairs; (Li with using read v1.3.2 or performed nt million RSEM 200 (˜168 using than reads conducted shorter to RNA was subjected aligned quantification then Successfully read reference were a 19.1%) 2013). to al., rate: GCA libraries) et sequenced (Kim accession: all assembly v2.1.1 from (Andrews, (GenBank pairs To FastQC assembly using read quality genome million sequencing. for (˜877 RNA checked from reads were paired-end reads trimmed and RNA 150-bp 2014) remove x To Usadel, & 150 2010). Lohse, 4000 samples (Bolger, Hiseq v0.36 RNA sequences, Trimmomatic Illumina low-quality Japan). protocol and and (Agilent, extraction adapters construction remove 2100 RNA library Bioanalyzer TRIZOL for a the (OIST) following with quality RNA RNA total RIN checked with extracted and we 1993) I, (Chomczynski, experiment from samples assembly For transcriptome and The sequencing separately. RNA polyps/sample) Illumina 15 – different (10 3). on polyps group = group. times treatment detached (N the three and control experiments in repeated polyps observed the undetached was was for bail-out) both experiment polyp collected unchanged same of we remained onset h, of salinity 24 indicator at (an while detachment conditions, polyp partial hyperosmotic Since create to (48mL/min > P cut e ilo)fra es irre nagvnpiws oprsn Oenrichment GO comparison. pairwise given a in libraries 3 least at for million) per (counts CPM 5 > eesn oteDASqecn eto tteOiaaIsiueo cec n Technology and Science of Institute Okinawa the at Section Sequencing DNA the to sent were 7 d9dtstt xmn opeeeso h rncitm seby(Simao, assembly transcriptome the of completeness examine to dataset odb9 rd Symbiodinium u 09 ihbat,uigatrsodo E=10 of threshold a using blastx, with 2019) Jul enovo de < rncit e ilo)wr icre.BSOaayi was analysis BUSCO discarded. were million) per transcripts 5 r sebyuigTiiyv.. Gahr ta. 01.RNA 2011). al., et (Grabherr v2.8.4 Trinity using assembly wrasfo luiaRAsqecn eetimdwith trimmed were sequencing RNA Illumina from reads aw n te oa-soitdmcoims efis mapped first we microbiomes, coral-associated other and 3 .acuta P. 0749.)(unn ta. 08 sn Tophat using 2018) al., et (Cunning 003704095.1) oois iha es n ot between month one least at with colonies, μ o htn m photons mol > oilpr damicornis Pocillopora -odaslt change absolute 2-fold -5 lhuhprinciple Although . -2 s -1 n h use the and ) Posted on Authorea 31 Jan 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158049398.83875848 — This a preprint and has not been peer reviewed. Data may be preliminary. oi aaw on eakbeurglto fegtmti ealpoens MP-noigtranscripts (MMP)-encoding metalloproteinase matrix eight of upregulation ( remarkable found we data tomic σιγναλινγ κινασε/ΝΦ-κΒ this GO DEGs, of pathway ECM upregulated scope signaling Among apoptosis, the to bail-out. beyond related polyp involved is , pathways in likely which signaling directly are as of and participate such results which discussion processes categories our survival, biological the in cell to were fluctuations, terms and attention analyses osmotic degradation, GO specific enrichment to eriched paid GO most corals we As of response, study, responses bail-out DEGs. general polyp downregulated as and the up- in showing for involved 3,691 conducted mechanisms and molecular 2,927 identify with To identified, down- analysis were enrichment showing DEGs (GO) 1,617 6,618 ontology and analysis, of Gene upregulation DE total showing the a 1,936 respectively. (S46/S35), In downregulation, with h and (S43/S35), treatment. 24 upregulation h hyperosmotic at aiming 12 While S46/S35, the a at and comprised to regulation. S43/S35 identified PC1) of specific were (57.9%, comparisons induced DEGs variation pairwise for responses 3,553 of designed majority transcriptomic was the identify analysis DE anal- that to 1), showed DE to analysis (Fig. subjected component response and stress principle annotated the functionally As were transcripts ysis. 17,908 assembly, transcriptome the From analysis 9.7%; (DE) (fragmented, expression completeness analysis. Differential BUSCO transcriptomic those the 84% by including with identified microbiomes, 6.2%) GIDI00000000), missing, coral-associated accession: from assembly reads GenBank RNA removing After of assembly. polyps of transcriptome the responses of genetic change 50% examine (salinity – To group 2). 30 control which (Fig. at the experiment of h, For the assembly 24 during Transcriptome 2). at time observed any (Fig. was at skeleton bail-out were observed Polyp was response the stress response group. from a treatment detached of the found signs in obvious were h 35˜46no 12 from at (48increased seawater seen high-salinity of in addition response gradual bail-out polyp the induce To Welch’s using induction tested bail-out was Polyp points time between significance Results statistical test. initial post-hoc and the Games-Howell gene, to a [?][?]CT and with each = ANOVA replicates) for ([?][?][?]CT three experiments deviation) of during average dard changes (on group expression control determine [?][?]CT the to pair. of h) primer those (log (0 each to expression conditions (CT of normalized gene value specificity then relative [?]CT were the calculate group mean confirm to to the used qPCR was gene, after replicates stress conducted target was each (MCA) For analysis 10 of curve volume melting total a A 95 to at USA) step (Bio-Rad, initiation Supermix an Green SYBR iQ with mixed 200 reaction, qPCR A USA). entific, raotsspoelssrltdG aeoysoe infiatenrichment. significant showed category GO apoptosis/proteolysis-related or ( significant > bols rwhfco FF eetrsgaigpathway signaling receptor (FGF) factor growth fibroblast 0fl xrsincag rm0ht 4h,atog niheto h Ocategory GO the of enrichment although h), 24 to h 0 from change expression 10-fold Symbiodinium h 0 ?[]T=[?]CT = [?][?]CT ; p .0a 2had01 t2 ) mn oneuae Es oseicsgaigpathway signaling specific no DEGs, downregulated Among h). 24 at 0.14 and h 12 at 0.20 = β- oa f7,0 rncit eercntutd(5 ,7 t 9N0=176nt; 1,756 = E90N50 nt; 1,278 = (N50 reconstructed were transcripts 73,903 of total a , ppoi process apoptotic uui ee(UB a eetda h nenlcnrlfrteqC nlss o each For analysis. qPCR the for control internal the as selected was (TUBB) gene tubulin eesgicnl nihda oh1 n 4h( h 24 and h 12 both at enriched significantly were μ fec rmrad1 and primer each of M ° o i n 0cce fPRapicto t95 at amplification PCR of cycles 40 and min 3 for C a infiata 2hbtnta 4h(al ) nadto,i u transcrip- our in addition, In 1). (Table h 24 at not but h 12 at significant was ramn group treatment .acuta P. .acuta P. , xrni ppoi inln pathway signaling apoptotic extrinsic oilpr acuta Pocillopora uigplpbi-u nuto,w rtcntutdareference a constructed first we induction, bail-out polyp during [?]CT – μ fsnhszdcN cnetainudtrie)were undetermined) (concentration cDNA synthesized of L oto group control 4 oto gene control yeomtcevrnetwsetbihdby established was environment hyperosmotic a , 2 .Dt r rsne smas+ D(stan- SD +- means as presented are Data ). and , tasomd.[]Tvle ftetreatment the of values [?]CT -transformed). CT – uo erssfco (TNF)-mediated factor necrosis tumor p agtsrs gene stress target < , ° .5,wieercmn of enrichment while 0.05), o 5scad60 and sec 15 for C eaierglto fcl death cell of regulation negative μ .qC odtosincluded conditions qPCR L. rmtotechnical two from ) proteolysis < .ohrstress 0.5other ie iepoint time given ° o 0sec. 30 for C a in- was Ι-κΒ – Posted on Authorea 31 Jan 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158049398.83875848 — This a preprint and has not been peer reviewed. Data may be preliminary. G inln nue C erdto n oy detachment polyp and degradation 4). ECM possibly (Fig. induces a response to signaling stress point FGF and this bail-out in involvement polyp for microbes in evidence pathway symbiotic further signaling of add apoptotic role thus extrinsic results receptor-mediated Our TNF the 2018). of Vardi, & Kramarsky-Winter, Shapiro, (Gavish, osito hmclsgaspoie rmmcoe otecrlhs.I at twsrcnl eotdthat reported recently was attributable it fact, be In may bail-out host. coral polyp the of to initiation microbes 2013), from in provided al., bail-out signals step. et microbes polyp chemical Webster processing coral-associated of data of 2011; shift our composition Bourne, to during the & alter out substantially bail-out filtered Willis, of polyp can were that during environment (Littman, which pathway to culture TNF corals, compared the to the the spike found changing triggering Similar delayed in signals Since was a that analysis. microorganisms with TNF possible symbiotic qPCR found is of from or was It overexpression came overexpression transcriptomic genes. TNF no the receptor (2018) assay, in TNF al., and qPCR either al. caspase study, transcriptomic et et the Wecker Wecker this our in in in 2014; in finding, gene induction pathway is our al., receptor bail-out pathway, signaling caspase-8, et FAS polyp TNF signaling by (Quistad the the the initiated apoptotic during bail-out of of cascade extrinsic upregulation polyp enrichment caspase and in significant The a data with proposed even and 2018). was Interestingly, family and al., receptor 2018). animals et TNF among Wecker the conserved 2015; by highly al., proposed mediated degradation et signals coenosarc (Kvitt comprising apoptosis-induced studies of hypothesis previous the in supports 1) (Table data transcriptomic h infiatercmn fG terms GO of degradation enrichment coenosarc significant to and The needed apoptosis are however, to studies, response. an leads Additional stress as signaling this considered ocean. after TNF of the be skeletogenesis significance to can resume ecological return response and washed to the stress resettle get polyps illuminate this to fragments coral further 2016), coral able “lost” al., when for are et mechanism or polyps (Shapiro escape evaporation, strong detached bail-out to Since polyp experience due hyperosmosis-induced tide. tides, may the of low high corals during increase at these lagoons salinity occasionally and a ashore that pools Although and tide polyp in recognize. corals that develop generally implies pocilloporid we observation in than This > frequently response shown). more common not fluctuations/stresses (data a osmotic timing be on was and tests bail-out may preliminary conditions polyp 14our bail-out similar – studies, (10 under previous levels bail-out and stress Although this similar polyp relatively between stress. at different hyperosmotic both evaporation-driven are by in profiles observed induced salinity-changing be can and bail-out species polyp the that showed (2016) al. to et ˜46i.e., stress reached hyperosmotic salinity seawater applied when we study, corals this pocilloporid In in bail-out polyp induces 3, Hyperosmosis experimental (Fig. entire stabilized the expression during significant upregulation gene III). Another linear the profile Discussion h. genes, which (2.5- 3, XIAP 12 after h (Fig. and to h, 6 detected JNK, h 18 first was NFKB1, 6 to the the period from h in for 40-fold 12 seen While over from was II). FGF2, of identified upregulation profile by upregulation was little exhibited significant 8.4-fold genes, was a of these profile by upregulation For expression followed genes. second average) MMPs A on and two I). fold h the expression profile 12 three first and were 3, assay, the RHO, qPCR corals during (6-h (Fig. our FGFR2, occurred in afterward in upregulation resolution genes significant changes stable stress genes, temporal relatively FAS morphological 10 and remained the finer and CASP8 Among For profile at shown). identified. salinity-changing not were samples (data profiles same I RNA The experiment in collected assay. as second observed and qPCR a conducted a II) we for (experiment bail-out, intervals) polyp experiment in pathways bail-out signaling abovementioned polyp the of involvement validate To genes stress of PCR Quantitative 0nwtr ntesbia oe(hr otpclooi oaslv) yeomtcevrnet can environments hyperosmotic live), corals pocilloporid most (where zone subtidal the in waters 10in .damicornis P. a eidcdb nclto ihtecrlpathogen, coral the with inoculation by induced be can aions eitpr hystrix Seriatopora damicornis, P ppoi process apoptotic oilpr acuta Pocillopora 5 and xrni ppoi inln pathway signaling apoptotic extrinsic n bevdplpbi-u fe 4h, 24 after bail-out polyp observed and and , tlpoapistillata, Stylophora .verrucosa P. irocoralliilyticus Vibrio lodisplayed also Shapiro nour in Posted on Authorea 31 Jan 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158049398.83875848 — This a preprint and has not been peer reviewed. Data may be preliminary. C opnnst h oys nspoto u yohss rvossuishv on htfibronectin- that found have studies previous hyperosmotic suitable hypothesis, providing of our by of levels or it support secretion that different hypothesize In ECM to we stimulating polyps. ECM, by corals of the either 2017; degradation subjecting to resettlement by al., by components polyp mediated ECM induce is et study to polyps Fordyce this of possible detachment 2004; in be been since might achieved al., Also, has was et processes S1). and (Domart-Coulon these (Fig. 2015) stress of treatments separation different al., Indeed, using et studies bail-out. Kvitt independence in previous possible polyps. detachment suggests in viable also polyp of reported degradation and acquisition ECM path- degradation facilitate and these shall coenosarc apoptosis targeting to corals, of finding specifically leading the pathways agonists This on of or stresses 4). discreteness ligands systemic The using exerting (Fig. avoiding bail-out bail-out by polyp polyp which, inducing ways, in of FGF-mediated involved pathway, feasibility are apoptotic the extrinsic signals suggests receptor-mediated anti-apoptotic/survival TNF and the that degradation, appears ECM it applications results, our future 3). polyp on and Based in (Fig. bail-out involvement survival polyp functional anti-apoptotic subsequent into the their their in insights that and to variation New suggest signals and spatial investigation. results survial polyps further to anti-apoptotic/cell our coral requires these Accordingly, attributed however, in bail-out, of activity be 2001). trigger caspase may ultimate of al., NF- bail-out The inhibition et and to polyp Tang JNK leading repsonse. genes, in 2004; the signals, bail-out Nakano, JNK of apoptosis polyp activation and 2007; of the and XIAP, al., tissue-specificity in XIAP NFKB1, et signals of the (Lu anti-apoptotic association 1996). illustrated of and models, Verma, survival cell profiles & these mammalian Green, expression of In Kafri, concurrent Lin, association Martin, showed & Antwerp, possible (Karin Van further suggesting 1998; signaling results survival Williams, qPCR as & anti-apoptotic/cell after such Our Amiri, of signal terms Reinhard, activation TNF GO Roulston, earlier delayed data, 2002; a indicating transcriptomic by 1), our induced (Table in is Salvesen,experiments However, Takahashi, response Deveraux, anti-apoptotic 2018). 2013; the al., Qiu, , that et & (Wecker the proposed Chen bail-out was at 2009; It polyp regulate Steller, mediated to & significant shown 1997). is identified (Bader been Reed, have we bail-out death & both data cell which polyp transcriptomic gene, the and XIAP in our activities at of found in caspase upregulation apoptosis collected and hypothesis, was ubiquitination tissue-specific this (T24-2) protein expression of of that polyps enrichment gene support hypothesize In solitary caspase therefore level. detached in We post-transcriptional and difference (T24-1) time. significant tissue same no coral data, coenosarc-containing transcriptomic between our we in results, bail-out Interestingly, polyp these subsequent and after on degradation polyps likely ECM Based of is initiate Survival turn signal signals. in the explained which 4). and FGF the be MMPs, stress (Fig. and activate thus environmental and detachment to can under MMPs polyp GTPases analysis, bail-out, triggered between family qPCR is polyp Rho our pathway loop by in signaling coral relayed feedback h FGF2 FGF of 18 the positive of to irreversibility that release a h hypothesize The induce 6 of to from formation MMPs shown 1996). in by and been genes FGF2 Underwood, have aforementioned 2003). of & MMPs upregulation the al., remarkable some and Iozzo, et activation, RHO Pintucci Murdoch, upon between 1993; Furthermore, profiles (Whitelock, family al., expression Rho assay. through of et qPCR occurs similarity Birkedal-Hansen likely our MMPs the 2009; of involvement by function activation al., its suggested to MMP-inducing for receptors et GTPases, The FGF cells (Ardi from assay. mammalian transduction of angiogenesis many qPCR signal profiles in our and Intracellular expression documented in migration since been genes pathway, cell has MMP signaling pathway in two FGF signaling the the FGF2/FGFR2 of to the of ECM those Regulation linked of in matched probably 2000). function FGFR2 is Seiki, that and & bail-out proteases FGF2 Masuho, polyp of Matsumoto, in Itoh, family MMPs eight Kojima, a these of 1993; are upregulation al., remarkable MMPs et found (Birkedal-Hansen we experiments. study, degradation the that with during Congruent transcripts 2018). MMP-encoding al., et (Wecker bail-out polyp of of study previous A eaierglto fcl death cell of regulation negative .damicornis P. and , ugse atcpto fEMdgaaini h oy-eahetstep polyp-detachment the in degradation ECM of participation suggested -Βκνσ/Φκ σιγναλινγ κινασε/ΝΦ-κΒ Ι-κΒ 6 eesgicnl nihddrn the during enriched significantly were κ inln a been has signaling B N cascade JNK Posted on Authorea 31 Jan 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158049398.83875848 — This a preprint and has not been peer reviewed. Data may be preliminary. oatCuo,I,Tmute . abt´,E,&Almn,D 20) hr emvaiiyo ottissue soft of of viability corals. inhibitor 199-217. term reef-building direct (2), of Short a skeleton (2004). is the D. IAP from Allemand, X-linked detached & Tambutt´e, (1997). Tambutt´e, E., C. S., I., J. Domart-Coulon, Reed, & S., G. proteases. the Salvesen, cell-death R., of Takahashi, analysis L., Comparative Q. Deveraux, evolution. (2018). coral N. in Traylor-Knowles, system & immune proteins of A., 16134. role and Baker, highlights DNA P., genome RNA, damicornis Gillette, Pocillopora of R., Bay, isolation R., simultaneous Cunning, single-step the samples. tissue for and survival. reagent cell and A from death invasion? cell (1993). towards of P. crossroad tool Chomczynski, the Another at Ubiquitin (2014). (2013). V. 32 X.-B. M. cancer, Qiu, Kitahara, & & Y.-S., Chen, C., Zilberberg, Tubastraeacoccinea. A., in data. Migotto, sequence “bail-out” C., Illumina Polyp for C. trimmer K. flexible a Capel, Trimmomatic: (2014). B. Usadel, J. 30 & Engler, Bioinformatics, M., & Lohse, A., M., DeCarlo, A. B., Bolger, system. review. Birkedal-Hansen, ubiquitin–proteasome a L., the Windsor, metalloproteinases: by M., Matrix Bodden, death (1993). W., cell Moore, of H., Birkedal-Hansen, Regulation 21 biology, (2009). cell P. H. in J. Steller, opinion Quigley, & pathway. & M., (FGF-2)/FGFR-2 I., factor Bader, E. growth Deryugina, fibroblast 284 and B., basic vivo Chemistry, Babraham Schweighofer, in Biological a activation G., of efficient via In: undergoes Opdenakker, angiogenesis TIMP-1, induces E., by data. unencumbered P. catalytically sequence proenzyme, Steen, MMP-9 throughput Neutrophil den high Van (2009). for C., V. tool Ardi, control Kingdom. quality United Cambridge, a Institute, FastQC: Babraham Bioinformatics, (2010). manuscript. S. the Section on Andrews, comments Analysis study. providing Data this and in and editing assembly for Computing transcriptome References Aird the Scientific D. for RNA- Steven Technology OIST service constructing computing Dr. and the for performance appreciate Science (SQC) and We high of the Section sequencing providing Institute Sequencing for performing Okinawa DNA (SCDA) and from OIST the Unit libraries acknowl- thank gratefully Biophysics seq We authors Marine The (OIST). the University JP18J20226. to Graduate Number climate Grant support KAKENHI global generous JSPS anticipated by edge supported to was response work This in ecosystems reef coral polyp shaping Acknowledgements understand in to help mechanisms role may bail-out its findings pocillo- these polyp and change. as water, of Moreover, shallow nature study in levels. in corals molecular this and bail-out reef-building studies, cellular dominant genetic at are studies corals and coral porid physiological future for both information for Future additional restoration. provides species as reef of such coral 2005). for maintenance corals, colonies model al., and coral as pocilloporid et resettlement of some Puverel for production that mass conditions 2004; Considering for optimize al., use to et their expected potentiating (Domart-Coulon are polyps, cells coral processes resettlement, single after resettlement into although of substrates, dissociated studies resettlement to to polyps tended solitary polyps of attachment facilitated peptide like 1) 640. (12), 1) 2114-2120. (15), aue 388 Nature, 6,878-884. (6), itcnqe,15 Biotechniques, 3) 25854-25866. (38), 63) 300-304. (6639), oa ef,33 reefs, Coral rtclRvesi rlBooy&Mdcn,4 Medicine, & Biology Oral in Reviews Critical 3,5254 536-537. 532-534, (3), ora fEprmna aieBooyadEooy 309 Ecology, and Biology Marine Experimental of Journal .damicornis P. 7 4,1165-1165. (4), and .pistillata S. aebe ieyused widely been have , cetfi eot,8 reports, Scientific hns ora of journal Chinese 2,197-250. (2), Current Journal (1), Posted on Authorea 31 Jan 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158049398.83875848 — This a preprint and has not been peer reviewed. Data may be preliminary. itci . u .J,Saoy . amn,F . aoaa . rsa . inti P. Mignatti, Pocillopora genus the . ecology. in symbiosis corals reef and common genetics . of 311-325. population delimitation Species phylogenies, sequence . (2011). nucleotide C. using T. A., LaJeunesse, & (ERK-1/2). Frasca, H., and-2 J. F., Pinzon, kinases-1 90 Saponara, signal-regulated biochemistry, extracellular G., cellular of microvascular of F. activation FGF-2-/- Journal in prolonged Baumann, (FGF-2) requires factor-2 growth R., cells NF- fibroblast by Sharony, induces endothelial (MMP-3) XIAP stromelysin-1 J., of (2007). Induction P. H. (2003). Yu, Wu, . G., NF- . Pintucci, between . crosstalk Y.-C., Signaling Lo, (2004). a R., dimerization. H. during Rich, BIR1 Nakano, holobiont J., and coral Y. interaction BIR1/TAB1 Kang, the the Y., of via Huang, analysis activation S.-C., Metagenomic Lin, Reef. (2011). M., Barrier G. Lu, Great D. the Bourne, on & event bleaching L., natural B. without or Willis, with R., data RNA-Seq Littman, by from quantification pathways transcript accurate apoptotic genome. RSEM: of reference (2011). a N. Regulation C. Dewey, & B., (2011). bleaching. Li, D. and stress Tchernov, thermal & survive . polyps to K., e28665. in Pocilloporidae) Zandbank, . initiated (Anthozoa, H., pistillata is Stylophora . conditions Rosenfeld, pH H., H., reduced Rosenfeld, under Kvitt, A., form Kushmaro, colonial apoptosis. coral K., through of mediated Zandbank, Breakdown and K., (2015). Maor-Landaw, D. E., Tchernov, Kramarsky-Winter, H., metallo- matrix Kvitt, 6 MMP. Membrane-type (GPI)-anchored (2000). inositol M. glycosyl-phosphatidyl 480 Seiki, second & letters, accurate the Y., is TopHat2: Masuho, MMP-25) S.-i., (MT6-MMP, fusions. (2013). Matsumoto, proteinase Y., gene L. Itoh, and S. S.-i., deletions Salzberg, Kojima, insertions, & of R., presence Kelley, R36. the H., (4), in Pimentel, transcriptomes C., Trapnell, of alignment G., Pertea, D., NF- Kim, (2002). A. R. Lin, Toonen, Pocillopora. & & in M., S., diversification Karin, I. and plasticity Knapp, of H., Pinz´on, fog J. the S., through Schmidt-Roach, 7 glance gene J.-F., genomic large Flot, A of H., (2017). analysis Z. J. integrative Forsman, and C., Systematic E. (2009). Johnston, A. toward R. resources. paths Lempicki, bioinformatics & tools: DAVID T., enrichment using B. Bioinformatics lists Sherman, (2008). W., lists. A. D. gene R. Huang, large Lempicki, of & analysis T., Tri- functional (2011). B. comprehensive Q. the Sherman, Zeng, . W., . D. . Huang, I., data. Amit, RNA-Seq A., from D. genome Thompson, a Z., without J. 29 transcriptome Levin, full-length M., a Yassour, reconstructing J., nity: B. disease Haas, fate. coral G., polyp of M. of tracking Grabherr, Microscale heterogeneity (2018). and following A. Vardi, infection damicornis & of E., Pocillopora timeline Kramarsky-Winter, in H., reveals bailout O. Shapiro, Polyp R., (2017). A. Gavish, D. T. Ainsworth, & F., stress. E. thermal Camp, J., A. Fordyce, 1,5991. (1), 7,644. (7), 23,142-146. (2-3), 10Rsac,6 F1000Research, M iifrais 12 bioinformatics, BMC κ rceig ftentoa cdm fsine,112 sciences, of academy national the of Proceedings . ttecosod flf n death. and life of crossroads the at B 5,1015-1025. (5), auepooos 4 protocols, Nature 1,323. (1), niomna irbooyRprs 3 Reports, Microbiology Environmental κ 8 n JNK. and B uli cd eerh 37 research, acids Nucleic bioRxiv 1,44. (1), rnsi muooy 25 immunology, in Trends oeua el 26 cell, Molecular 302778. , aueimnlg,3 immunology, Nature oeua clg,20 ecology, Molecular 1,1-13. (1), auebiotechnology, Nature 5,689-702. (5), eoebooy 14 biology, Genome 7,2082-2086. (7), lSoe 6 one, PloS cetfi reports, Scientific 6,651-660. (6), 8,402-405. (8), 3,221. (3), FEBS (12), (2), κ B Posted on Authorea 31 Jan 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158049398.83875848 — This a preprint and has not been peer reviewed. Data may be preliminary. ekr . eele,G,Giet . hu . onr,I,&Breu-eele,V 21) xoueto Exposure (2018). V. bail-out Berteaux-Lecellier, damicornis. polyp & P. causes I., coral and Bonnard, genes the detoxification Y., in Near-future induces Zhou, chlordecone (2013). insecticide I., S. environmentally-persistent Guibert, the Uthicke, G., taxa. . (2017). Lecellier, reef . M. P., coral Wecker, . diverse Aranda, Bott´e, E., within R., associations . Soo, microbial 5 C., Reports, in . Microbiology Humphrey, differences F., causes . acidification Flores, J.-F., ocean A., Flot, Negri, D., N., Zoccola, Webster, corals. S., of TNF- Baumgarten, species of of between J., Suppression genomes differences Y. extensive (1996). the Liew, M. of Y., I. analysis Verma, Li, Comparative & R., R., C. D. Green, Voolstra, T., Kafri, NF- Finnerty, J., by S. apoptosis . Martin, induced . the J., . for D. (PocilloporaBase) Y., Antwerp, database Van Xia, transcriptomic S., and Garamszegi, damicornis. transcriptome JNK R., reference Pocillopora of J. a coral, Inhibition Parikh, of cauliflower (2001). Production J., A. T. (2011). Lin, Lubinski, R. & J. R., M., B. Karin, Granger, Z., N., Traylor-Knowles, Li, H., N. BUSCO: Purcell, NF- B., (2015). through Dibling, activation M. Y., E. Minemoto, Zdobnov, G., Tang, & V., orthologs. E. single-copy Kriventseva, with completeness P., 3210-3212. annotation Ioannidis, and assembly coral-on-a-chip M., genome A assessing R. Waterhouse, (2016). A., A. Vardi, Sim˜ao, F. & corals. R., reef-building Stocker, of R., microscopy 10860. A. live-imaging Gavish, enabling calycularis platform E., Astroides microfluidic Kramarsky-Winter, coral the H., by O. bail-out Polyp Shapiro, (2018). O. Serrano, & Dendrophylliidae). K., of (Scleractinia, Inostroza, revision R., a Coma, open: E., Serrano, Pocilloporidae) wide (Scleractinia; eyes complex With species genetics. of damicornis (2014). and Pocillopora means N. morphology the Andreakis, new to using related & a closely P., and and Lundgren, within stress J., species environmental K. to Miller, S., response Schmidt-Roach, escape an bail-out: corals. Polyp in reproduction (1982). W. kinase P. factor N-terminal Sammarco, necrosis c-Jun tumor of activation to Early response in (1998). survival differential T. 273 cell L. for regulate Williams, package kinase & Bioconductor p38 P., a and Amiri, C., edgeR: Reinhard, Rohwer, (2010). A., data. K. Roulston, . expression G. gene . Smyth, digital & of . J., analysis A., D. expression conservation. J. McCarthy, functional Grasis, D., of J., M. My B. Robinson, 550 Hilton, sciences reveals A., of apoptosis C. academy TNF-induced Smurthwaite, national of L., the Evolution biomineralization. K. (2014). coral Barott, L. A., study F. Stotland, to (2005). D., tool S. Tambutte, S. new Quistad, . a . D. scleractinians: Huang, . in S., . matrix Lotto, 24 A., reefs, organic . Bouchot, the I., . Domart-Coulon, against tropical C., D., Antibodies a E. Zoccola, in Heery, E., urbanization Tambutte, K., coastal S., Tun, Puverel, with S., associated Schmidt-Roach, corals S., Pocilloporidae of S. state. loss Jain, city standing: R., species B. Last Z. (2019). Quek, C., R. Poquita-Du, 1) 10232-10239. (17), 1,149-156. (1), aieBiodiversity Marine aieeooypors eis ledr,10 Oldendorf, series. progress ecology Marine κ 2,243-251. (2), agtgenes. target B κ B. hmshr,195 Chemosphere, cec,274 science, 1-15. , olgclJunlo h ina oit,170 Society, Linnean the of Journal Zoological aieBoiest,48 Biodiversity, Marine 201405912. , tlpoapistillata Stylophora aue 414 Nature, M eois 12 genomics, BMC 58) 787-789. (5288), cetfi eot,7 reports, Scientific 190-200. , iifrais 26 Bioinformatics, 9 66) 313-317. (6861), 3,1661-1665. (3), and 1,585. (1), cooadigitifera Acropora 1,17583. (1), 1,57-65. (1), 1,139-140. (1), α. ora fBooia Chemistry, Biological of Journal auecmuiain,7 communications, Nature 1,1-33. (1), iifrais 31 Bioinformatics, rvdseiec for evidence provides Environmental rceig of Proceedings Coral (19), α- , Posted on Authorea 31 Jan 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158049398.83875848 — This a preprint and has not been peer reviewed. Data may be preliminary. t4 ,btn eahdplp eese uigteeprmn lwr.Saae aiiyi niae on indicated is salinity Seawater (lower). experiment both the of during (unit: observed seen 48release photo was acute were created each (salinity: degradation Under polyps of h coenosarc was detached side stress, thereafter. 4624 no stress the hyperosmotic salinity but (salinity: mild mild unchanging h, h Under a with 48 12 (upper). h while at at polyps 12 mL/min, observed clustered for 11.2 and was mL/min solitary retraction at 4 tentacle 48tank at stress, seawater of hyperosmotic 48salinity addition of by addition created by was survival stress cell response, hyperosmotic apoptotic and the anti-apoptotic suppress S1. to bodies, subsequent activated Figure survival. are polyp its XIAP, polyp and In to promotes NFKB, extracellular turn and JNK, in in polyps. as coenosarc which results such of (RHO), genes the detachment by (MMP) GTPases in mediated family and metalloproteinase signals Rho apoptosis degradation matrix through to (ECM) likely and TNF leads MMPs, matrix (CASP) the of caspases triggers activation caspase of stress while the Environmental Activation degradation, activate data. which respectively. qPCR pathways, and cascades, transcriptomic signaling our FGF on and based hypothesized are out deviation). ( (standard expression with SD differences 4. ANOVA which +- Welch’s significant Figure means after the using with as h, during conducted expressed Groups observed 18 was are was to and analysis upregulation test. log2-transformed h Statistical linear post-hoc 6 III). genes, Games-Howell from (profile XIAP a upregulation and experiment remarkable NFKB1, the JNK, and of the h time-course showed For that 6 (profile II). profile afterward expression first (profile stable common the stabilized a remained displayed and for genes h MMP24 upregulation and 12 little MMP19, first RHO, the FGF2, during FGFR2, The upregulated I). significantly were samples genes photos. of CASP8 the and Labels on h. indicated 24 3. (unit: at Figure observed times were specific detachment, at polyp salinity and seawater degradation and coenosarc transcripts. e.g., bail-out, annotated polyp functionally reflects 17,908 component on principal 2. second based Figure was the Analysis while gradient, replicates. salinity biological the between with variation concordant is component principal 1. writing writing Figure manuscript manuscript research, analysis, of data Design research, Mitarai: of S. design experiments, of Conduction Chuang: PS. Contributions Author GIDI00000000 accession assembly GenBank assembly: Transcriptome following SRR10708225- the SRR10708182-SRR10708188, with SRR10696823-SRR10696829, database SRA: NCBI SRR10708230 NCBI on available data: openly raw are RNA-seq study this of findings numbers: the reference support that coral data Massive The (2014). A. Merico, statement Rica. & accessibility Costa C., Data Pacific Jimenez, of I., reefs Stuhldreier, in C., ablations Sanchez-Noguera, en- tissue T., human of Rixen, degradation C., collagenase, The Wild, stromelysin, by (1996). factor A. growth P. fibroblast heparanases. Underwood, basic & and bound of V., plasmin, release R. and Iozzo, perlecan D., cell-derived A. dothelial Murdoch, M., J. Whitelock, uniaiePR(PR ftnsrs ee hwdtredsic xrsinpols h FAS The profiles. expression distinct three showed genes stress ten of (qPCR) PCR Quantitative rnia opnn nlsscasfidRAsqlbaisb ramnsadrpiae.Tefirst The replicates. and treatments by libraries RNA-seq classified analysis component Principal aallsgaigptwy rge oy alot oeua ehnsslaigt oy bail- polyp to leading mechanisms Molecular bail-out. polyp trigger pathways signaling Parallel oilpr acuta Pocillopora oilpr acuta Pocillopora ora fBooia hmsr,271 Chemistry, Biological of Journal oysbi u nrsos ohprsoi tes opooia etrsof features Morphological stress. hyperosmotic to response in out bail polyps epne ieetya ieetlvl fhprsoi tes nacute An stress. hyperosmotic of levels different at differently responded aae,Junlo oa efSuis 16 Studies, Reef Coral of Journal Galaxea, 10 1) 10079-10086. (17), p < .5 r niae.Dt were Data indicated. are 0.05) 1,13-14. (1), Posted on Authorea 31 Jan 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158049398.83875848 — This a preprint and has not been peer reviewed. Data may be preliminary. RHO 2.63 2.3E-03 FGFR2 1.49 2.2E-04 1.37 FGF2 1.3E-03 1.82 2.43 ID CASP8 UniProt 4.0E-02 2.0E-03 cascade JNK 1.81 2.89 5.5E-04 ubiquitination 8.1E-03 protein 2.71 concentration FAS four least 1.48 at 2.9E-02 with Gene dilution 4.1E-03 10x-serial a 1.65 in tested concentration). GIDI00000000). was each death accession: 2.2E-04 at gene cell 1.75 assembly 3 of each (GenBank 2.75 = regulation for gene (N negative process each (E) points apoptotic 2.4E-02 for pathway qPCR indicated signaling of 1.5E-03 2.05 are apoptotic Efficiency ID) pathway 1.38 (UniProt signaling receptor annotation 2.55 4.6E-02 factor based pathway pathway growth 8.3E-03 signaling signaling fibroblast process factor-mediated apoptotic 2. apoptotic necrosis extrinsic Table 1.2E-02 of tumor regulation 1.96 3.41 process 2.69 apoptotic 2.17 2.7E-02 of regulation 2.2E-02 positive 2.2E-02 signaling pathway 1.4E-04 kinase/NF-kappaB signaling I-kappaB receptor 1.64 factor growth pathway fibroblast signaling factor-mediated 3.8E-03 necrosis tumor ubiquitination protein cascade death JNK cell of regulation negative pathway signaling apoptotic extrinsic pathway signaling process apoptotic apoptotic of regulation positive process apoptotic of regulation process apoptotic bold in indicated h are 12 h 24 and h 12 both at enrichment significant ( showing pathways signaling and processes 1. Table p < 0.05 ). rmr sdi h PRasy h eeec rncit(e) rmrpstos(o) n blastx- and (Pos), positions primer (Ref), transcript reference The assay. qPCR the in used Primers ppoi n eea inln ahasaeatvtddrn oy alotidcin Biological induction. bail-out polyp during activated are pathways signaling several and Apoptosis P vle n odercmn F)aeidctdfrec Ocategory. GO each for indicated are (FE) enrichment fold and -values RHO FGFR2 FGF2 CASP8 TNR6 PC RHO APLCA OI FGF2 BOVIN I TNR6 PIG UA CASP8 HUMAN EL FGFR2 XENLA GCCTGTCATAATCTTCCTGTC RHO GAAAAAAC TCTGCCACGAG- TCCTCTGCTGACCTGATAAC FGFR2 CAACACAAAAAC CCATCTTGGA- TTGTTTCCAATGCCGTCC GGCTAAGCAAGCAGCAAAC CASP8 CACTTCCAGGGAAAC AATGAA- GCAAAGCAATTACCGCAAAC – (5’ Primer ACFGF2 CATC CACCAGAAAGT- CTAAACC- E (Pos) Ref TNR6 GACAC CAACTCAGGA- GCCAA- 3’) R1: F1: 11 F1: F1: .E0 2.37 4.3E-02 p R1: F1: R1: F1: vleF 4h 24 FE -value R1: > R1: 762) – 1031) – 587) – 828) – 53528 50055 28352 22697 4317 17–398) – (197

c14 c27 c4 c0 c0 g1 g1 g1 g1 g1 1(540 i1 (845 i1 (380 i1 (617 i1

i1 96.6% 97.2% 95.2% 93.8% 93.7% p vleFE -value Posted on Authorea 31 Jan 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158049398.83875848 — This a preprint and has not been peer reviewed. Data may be preliminary. NFKB1 XIAP JNK MMP24 TUBB ID UniProt MMP19 Gene NFKB1 XIAP JNK MMP24 TBB MMP19 RM JNK DROME AL TUBB PARLI UA XIAP HUMAN HC NFKB1 CHICK A MMP24 RAT MMP19 HUMAN XIAP GACCCCAG TTCCAGTCAAA- GAACTGCACGAATTGTTCATTA JNK GATGATAAG GAATCAGACA- TGAGTAAAGATGCCATGAAGAG MMP24 GAACGGCAG TCCAATGGAA- CCAAACGAACATTGCGTCC MMP19 GAGACCCCAG GGTCTAAAGTA- TTTTCACCCTCCTCTTCCTC TUBB GCTATGTTC GCAGTTCACG- TGTCATGAATCTGTTTAGAGGC NFKB1 GCAGTG TACCAGT- CCTTTTG- TCGCCAGTACCCAAGTAATAG – (5’ Primer ’ e Ps E (Pos) Ref 3’) R1: TCATCA- F1: 12 F1: R1: R2: F2: R1: F1: R1: F1: R1: F1: > 13 1832) – (1637 1013) – 308) 200) 33455 20183 3229 12 1615) – (1427 449) – 36257 27043 30610 c0 c1 c1 c0 c3 c0 g1 g1 g1 g1 g1 g1 1(9– (19 i1 i1 (847 i2 – (90 i1 i1 (259 i2 93.1% 92.0% 98.6% 96.1% 98.4% 90.7% Posted on Authorea 31 Jan 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158049398.83875848 — This a preprint and has not been peer reviewed. Data may be preliminary. 13 Posted on Authorea 31 Jan 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158049398.83875848 — This a preprint and has not been peer reviewed. Data may be preliminary. 14 Posted on Authorea 31 Jan 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158049398.83875848 — This a preprint and has not been peer reviewed. Data may be preliminary. 15