Downloaded by guest on September 23, 2021 Proc. Natl. Acad. Sci. USA Vol. 90, pp. 3511-3515, April 1993 Biochemistry

Heterogeneity of the principal cr factor in Escherichia coli: The rpoS gene product, r38, is a second principal cr factor of RNA polymerase in stationary-phase Escherichia coli KAN TANAKA*, YUKO TAKAYANAGI*, NOBUYUKI FUJITAt, AKIRA ISHIHAMAt, AND HIDEO TAKAHASHI** *Institute of Applied Microbiology, University of Tokyo, Bunkyo-ku, Tokyo 113, Japan; and tDepartment of Molecular Genetics, National Institute of Genetics, Mishima, Shizuoka 411, Japan Communicated by R. Haselkorn, January 19, 1993

ABSTRACT The rpoS gene of Escherichia coli encodes a recognized by Ea70 and Eo-38 holoenzymes, but other pro- putative RNA polymerase a factor that is considered to be the moters are transcribed by only one of the two holoenzymes. central regulator of gene expression in stationary phase. The In addition, we examined the expression ofor38 protein in vivo gene product (ar3) was overproduced using the cloned rpoS by Western analysis. gene and purified to homogeneity. Reconstituted RNA poly- merase holoenzyme (Ea38) was found to recognize in vitro a MATERIALS AND METHODS number of typical a70-type promoters, including the lacUV5 and thp promoters. Some, however, were recognized exclu- Bacterial Strains. E. coli strains DH1 (13), XLlblue (14), sively or preferentially by Ear70, whereas at least one, fic, was MC4100 (4), and BL21(DE3) (15) were used in this study. favored by E&rm. Thus E. coli promoters can be classified into Plasmid pTZ19R was obtained from Pharmacia. pET3b, three groups: the first group is recognized by Ea70 and Ea,38 pLysS, and pLysE plasmids are as described (15). but the second and third groups are recognized substantially by Cloning of the rpoS Gene and Determination of the Nucle- either Ea70 or Eam alone. In contrast to other minor afactors, otide Sequence. Purification of DNA from E. coli DH1 and am shares a set of amino acid sequences common among the cloning ofthe 2.3-kb Kpn I fragment containing the rpoS gene principal a factors of eubacteria and is therefore a member of were performed as described (8). The nucleotide sequence of the RpoD-related protein family. The intracellular level of a38 the 1.6-kb Kpn I-Hpa I fragment was determined on both was demonstrated to increase in vivo upon entry into stationary strands using modified T7 DNA polymerase (Sequenase; phase. These results together indicate that am is a second United States Biochemical) as described by the supplier. principal a factor in stationary-phase E. coli. Overproduction and Purification of the rpoS Gene Product. DNA primers for the polymerase chain reaction (PCR), The promoter selectivity of RNA polymerase holoenzyme, 5'-ATCATATGAGTCAGAATACGCTGAAA-3' and 5'- controlled by replacing cr factors, is the primary mechanism TTGGATCCTTATTGTGCACAGAAAAAACCAGC-3', for the global switching ofgene expression in eubacteria. The were synthesized with an Applied Biosystems model 392 principal Cr factor or70 (the rpoD gene product) in exponen- DNA synthesizer. PCR was carried out for 30 cycles as the described (16). Each cycle was at 95°C for 1.5 min, 40°C for tially growing Escherichia coli potentiates transcription 2 min, and 72°C for 4 min. PCR products were digested with of genes controlled by the consensus promoters consisting of Nde I and BamHI and cloned into the corresponding region two hexanucleotide sequences, TTGACA and TATAAT (1, ofexpression plasmid pET3b. The nucleotide sequence ofthe 2). Other minor species of alternative cr factors recognize amplified product was determined and verified to be identical different sets of promoter sequences, each being associated with that of the cloned rpoS sequence (this study). The with a limited number of genes that are mostly expressed in outlines of expression of rpoS and purification of or38 were response to various stress conditions (1, 2). The rpoS (katF) performed as described (15, 17). The expressing strain was gene of E. coli was first identified as a positive regulator of inoculated in 1 liter of LB medium. When the OD660 of the the katE gene encoding hydroperoxidase II (HPII) (3). Later, culture reached 0.7, isopropyl ,3-D-thiogalactoside was added several other genes that are, for the most part, expressed in at the final concentration of 0.5 mM. Cells were collected by the stationary growth phase were shown to be regulated by centrifugation after 3 hr of further cultivation. The overex- the rpoS allele (4, 5). Thus the rpoS gene was assumed to be pressed protein was recovered as inclusion bodies and sol- the central regulator of gene expression in the stationary ubilized in TGED buffer (10 mM Tris-HCl, pH 8.0/5% phase (4). From the nucleotide sequence ofthe rpoS gene, the glycerol/0.1 mM EDTA/0.1 mM dithiothreitol) containing 6 gene product has been believed to be an RNA polymerase cr M guanidine hydrochloride. r38 was renatured by gradual factor (6, 7). However, a, activity has not been detected dilution with 60 volumes of TGED buffer and absorbed to previously for the rpoS gene product. DE-52 resin (Whatman). The resin was packed into a column, In this study, we determined the nucleotide sequence ofthe and the protein was eluted by TGED buffer containing 0.2 M rpoS gene§ and found that the gene product is structurally NaCl and precipitated with ammonium sulfate. The fraction similar to or70 and the principal or factors from divergent was redissolved in TGED buffer and loaded onto a Sephacryl eubacterial species (7-12). To assess the functional similarity S-300 gel filtration column (Pharmacia). The peak fraction between the rpoS gene product (or38) and cr70, we reconsti- was further purified by high-speed liquid chromatography tuted Eor38 holoenzyme using a highly purified rpoS gene (Waters, model 510) on a protein pack G-DEAE column product and examined its promoter selectivity in in vitro (Waters, 8.2 mm x 75 mm). Elution was with alinear gradient transcription assays using various E. coli promoters. The of0-1.0 M NaCl in the same buffer. cr38 was precipitated with results indicate that a number of E. coli promoters are Abbreviation: E, RNA polymerase core enzyme. The publication costs of this article were defrayed in part by page charge *To whom reprint requests should be addressed. payment. This article must therefore be hereby marked "advertisement" §The sequence reported in this paper has been deposited in the in accordance with 18 U.S.C. §1734 solely to indicate this fact. GenBank data base (accession no. D13548). 3511 3512 Biochemistry: Tanaka et al. Proc. Natl. Acad. Sci. USA 90 (1993) ammonium sulfate, dialyzed against the storage buffer lated to be 37,956. Thus this protein was henceforth referred [TGED plus 0.5 M NaCl with 50% (wt/vol) glycerol], and to as 738. stored at -20°C. The total yield was about 8 mg from 2.7 g 038 shares a common structure with the principal o,factors of E. coli cells (wet weight). The quantity of protein was of divergent eubacteria and is a member of the RpoD-related estimated using a protein assay kit (Bio-Rad) with bovine protein family (7-12). The similarity includes the RpoD box serum albumin as a standard. sequence and the sequences in the DNA binding regions In Vitro Transcription. The purification of RNA polymer- (7-12), which may indicate that a38 is functionally similar to ase core enzyme (E) and o70 subunit have been described (J70. A comparative study of a factors categorized a38 into (18). The core enzyme was mixed with equimolar amounts of group 2, which includes cr factors that are not essential for either a70 or ov38, and the mixtures were incubated for 10 min exponential growth but are similar to the principal of factors at 37°C. Single-round transcription reactions were performed (29). with 3 pmol of reconstituted holoenzyme under standard Overproduction of the rpoS Gene Product. To produce the conditions (19). The templates in each reaction were as rpoS gene product (o,38), a DNA fragment containing the rpoS follows: (a) a 205-bp EcoRI fragment from pKB252 carrying coding region was amplified by PCR and inserted into an the lacUV5 promoter (20); (b) a 512-bp HindIII fragment overexpression plasmid (pET3b) under the control of a T7 trp promoter (20); (c) a 210-bp promoter (15). The nucleotide sequence ofthe PCR-amplified from pWT101 carrying the product proved to be identical to that of the rpoS gene. The Hinfl fragment from pJLO-2 carrying the rpU promoter (20); resultant plasmid was named pETF and found to be the most (d) a 391-bp Sal I-Hinfl fragment from pSP261 carrying the productive when the host BL21(DE3) strain harbored the rpsApl promoter (21); (e) a 0.8-kb EcoRI-HindIII fragment pLysS plasmid (15). After isopropyl f3-D-thiogalactoside in- from pRP1 carrying the rrnEpl promoter (22); (f) a 459-bp duction, o-38 accumulated as inclusion bodies in overexpress- Nru I-ApaLI fragment from plasmid ColEl carrying the ing E. coli cells. Thus, a38 was recovered as inclusion bodies, RNA I and RNA II promoters (23); (g) a 287-bp BamHI-Kpn solubilized in a guanidine solution, and purified to near I fragment from p48 plasmid carrying the alaS promoter (19); homogeneity by a combination ofcolumn chromatographies. (h) a 320-bp Hpa II fragment from pSY343 carrying the leuX The purity of (38 was carefully examined by SDS/PAGE and promoter (19); (i) a 950-bp Bgl II-Sma I fragment from by Western analysis using monospecific ao70 antiserum. Anal- pTUB2 carrying the tufB promoter (24); (j) a 485-bp BamHI ysis revealed no trace contamination of o,70. As is often the fragment from pMM5 carrying the dnaQpl, dnaQp2, and rnh case with vr family proteins, o.38 migated on an SDS gel promoters (25); and (k) a 796-bp Pst I-EcoRI fragment from slower than expected from the molecular weight and behaved pFC2 carrying the fic promoter (unpublished data). The like a 43-kDa protein (data not shown). transcripts were electrophoresed through a 7% polyacryl- a Activity of the rpoS Gene Product and the Promoter amide gel containing 8 M urea and analyzed with a Bioimage Selectivity of Eorm. Up to the present, a activity has not been analyzer (BAS2000, Fuji Photo Film). detected in vitro for the rpoS gene product. Initially we tried Immunological Techniques. Preparation of the antiserum to reconstitute an in vitro transcription system using recon- against the rpoS gene product (o38) was performed as de- stituted Ea38 and the katE promoter. Although the katE gene scribed (26). Antiserum against a7O was as in a previous paper is under the control of rpoS (30), the anticipated transcript (27). For the Western analysis, bacterial cultures were cen- was not detected (data not shown), suggesting that an addi- trifuged in microcentrifuge tubes, and cells were directly tional factor(s) or condition(s) is required for katE transcrip- resuspended in SDS/PAGE sample buffer (50 mM Tris HCl, tion. Instead, we found that some plasmid-derived promot- pH 6.8/2 mM EDTA/1% SDS, 1% 2-mercaptoethanol/8% ers, such as the RNA I promoter ofthe ColEl-type plasmids, glycerol/0.025% bromophenol blue). Cell mass was esti- were recognized and efficiently transcribed by the Eor38 mated from the absorbance of the culture, and samples holoenzyme. The same results were obtained with linearized corresponding to the same cell mass (equivalent to the mass and supercoiled plasmid templates. To verify these observa- in 10 ,ul of culture of OD60 = 1.0) were electrophoresed in tions, we examined whether Eo-38 holoenzyme recognized 9.4% SDS/polyacrylamide gels. Other procedures of the various canonical (o70-type promoters from the E. coli chro- Western analysis were as described (11). a proteins were mosome. The results are shown in Fig. 1. Surprisingly, quantified by scanning the stained immunoblots with a Shi- several typical o770-type promoters, such as lacUV5 (lactose madzu dual-wavelength chromatoscanner (model CS-930). metabolism, mutated), trp (tryptophan biosynthesis), RNA I Purified a proteins were used to determine the range over (inhibitory RNA for ColEl replication), and dnaQp2 (E which the protein amounts were proportional to the scanned subunit of DNA polymerase III), were transcribed as effec- signal intensities, and measurements were performed within tively by the Ea38 holoenzyme as by the Ecr70 holoenzyme this range. (these promoters are referred to as "type I" promoters). However, promoters including rplJ (ribosomal protein L10), rpsApl (ribosomal protein S1), rrnEpl (rRNA), RNA II RESULTS (primer RNA for ColEl replication), alaS (alanine tRNA Nucleotide Sequence of the rpoS Gene and Structure of the synthetase), leuX (leucine tRNA), tuflB (elongation factor rpoS Gene. The 2.3-kb Kpn I fragment containing the rpoS Tu), rnh (RNase H), and dnaQpl were exclusively or pref- gene was isolated by cross-hybridization with the rpoD probe erentially recognized by the Ecr70 holoenzyme ("type II" (8) and cloned into the Kpn I site of plasmid pTZ19R. This promoters). Recently we found that the upstream promoter of fragment was shown to complement a defective rpoS allele in the fic-pabA operon (31, 32) (p-aminobenzoic acid biosyn- vivo (data not shown). The nucleotide sequence of the thesis) is positively regulated by the rpoS allele in vivo 1642-bp Kpn I-Hpa I fragment was determined. An open (unpublished data). We, therefore, examined the (a require- reading frame of 330 amino acids was found, and this corre- ment ofthefic promoter in vitro and found that this promoter sponds to the previously reported rpoS open reading frame was recognized preferentially by the Eo38 holoenzyme (7). We found that the sequence we determined was different ("type III" promoter) (Fig. lk). From these data, we con- from the published rpoS sequence (7) at some points. The clude that the Eor38 holoenzyme recognizes some of the difference of the nucleotide sequence may be attributed to canonical E&70-type promoters in addition to the Eoi38-type strain heterogeneity. In fact, variations ofthe rpoS nucleotide promoter(s). sequence among several K-12 strains were recently reported The nucleotide sequences of the promoters examined are (28). The molecular weight of the gene product was calcu- aligned in Fig. 2. The -10 elements of the promoters are Biochemistry: Tanaka et al. Proc. Natl. Acad. Sci. USA 90 (1993) 3513 (.d) 1 2 (b) 3 4 (c)).4.W5 0 (d) 7 8 A type I dnaQp2 AAATIMCTACCTGTTTAAGCATCTCTGG TAGACT TCCTGTAATTGAATCG lacUV5 AGGCT.TACACTTTATGCTTCCGGCTCG TATAAT GTGTGGAATTGTGAGC rna I GTTCTIGAAGTAGTGGCCCGACTACGGC TACACT AGAAGGACAGTATTTG t rp AGCTGITTACAATTAATCATCGAACTAG TTAACT AGTACGCAAGTTCACG B type II -* rrp alaS GTATTTTACCTTCCCAGTCAAGAAAACT TATCTT ATTCCCACTTTTCAGT dnaQpl TAAAGGI.TICTCGCGTCCGCGATAGCG TAAAAT AGCGCCGTAACCCCCA 4 leuX CCACAACGTTTTCCGC v rplJ - rpsApl TGGCGCITGCAIGGTGGCGTGCGACAGG rna II TCTTCTTGAGATCCTTTTTTTCTGCGCG TAATCT GCTGCTTGCAAACAAA aw,dr * IacLV5 rnh TTGCAGITGTATAGCGGTCATTTATGT CAGACT TGTCGTTTTACAGTTC rplJ ATGCCITITACTGGGCGGTGATTTTGTC :ITACAATICTTACCCCCACGTATA rpsApl TACAGTTGCAGGTGAAGGGCTTTAGTGT TAACTT TGAGCGCCTTTTGGCC rrnEpl TTTCTATT2GCGGCCTGCGGAGAACTCCC TATAAT GCGCCTCCATCGACAC tufB TTTAGTTGCATGAACTCGCATGTCTCCA TAGAAT GCGCGCTACTTGATGC C type III (e) 9 1() (t) 11 12 (g) 13 14 (h) 15 160 fic GCTCTCCGGCGTAACCCGATTTGCCGCT TATACT TGTGGCAAATGGACAC FIG. 2. Comparison of the promoter sequences. The promoters ' a v4 mall tested were classified by the recognition pattems of the two holoen- -rnEpI _ a zymes. Promoter -10 boxes are marked by a box, and -35 elements are underlined. Promoters were classified as follows: (A) type I *4 ala.S promoters (recognized by Ea-70 and Ea-38); (B) type II promoters 0 _4* rnul (recognized solely or mainly by Eoa70); (C) type III promoter (rec- ognized only by Ecr38). 4_*4 leulX from OD6so = 0.2 to 2.7. The cells were lysed in SDS sample buffer, and the amounts corresponding to the same cell mass were directly electrophoresed on SDS/polyacrylamide gels. The two identically prepared Western blots were allowed to react with either anti-a38 or anti-a-70 antiserum. The results (i) 17 18 (j) 192() (k) 21 22 are shown in Fig. 3. The relative amounts ofcr38 protein were determined by scanning the blot with a densitometer. o.38 protein increased 20-fold per cell mass when the comparison tuf13 dnaQp I was made between the cells of 0.2 and 2.7 OD6w units (lanes 4 ttc 1 and As it is known that the cell size shrinks in -w* dixiQp 8). stationary phase, we counted the viable cells in the cultures and used these numbers for normalization. The viable cell counts per absorbance unit increased at most 3-fold in these samples. Thus, o.38 protein per cell was shown to increase at least 7-fold under these conditions. These results are consistent with the fact that various a38-dependent genes are induced in the stationary phase. a70 protein was similarly quantified and shown to be rather constant throughout the time of the FIG. 1. In vitro transcription experiments with the reconstituted analysis (at most, 1.3-fold increase per cell). Eo-38 and Eo!70 holoenzymes. DNA templates containing one or more well-defined promoters were tested by the single-round transcription assay in vitro with either enzyme (19). Odd-numbered lanes are DISCUSSION reactions with Ea-38, and even-numbered lanes are with Eor70. The amounts oftemplate DNA and the expected lengths oftranscripts are Genetic studies indicated that the rpoS (katF) gene product as follows: (a) lacUV5, 0.19 pmol, 63 nt (lanes 1 and 2); (b) trp, 0.15 functions as a a- factor of RNA polymerase for transcription pmol, 141 nt (lanes 3 and 4); (c) rplJ, 0.15 pmol, 69 nt (lanes 5 and of at least several stationary-phase-specific genes (3-6). In 6); (d) rpsApl, 0.23 pmol, 90 nt (lanes 7 and 8); (e) rrnEpl, 0.10 pmol, this study, we detected the a- activity of a38 purified from 363 nt (lanes 9 and 10); (f) RNA I/RNA II, 0.30 pmol, 108/301 nt rpoS-expressing E. coli cells. We then examined the pro- (lanes 11 and 12); (g) alaS, 0.20 pmol, 169 nt (lanes 13 and 14); (h) moter of a-38. The RNA holoenzyme leuX, 0.18 pmol, 81 nt (lanes 15 and 16); (i) tuIB, 0.10 pmol, 195 nt selectivity polymerase (lanes 17 and 18); (j) dnaQpl/dnaQp2/rnh, 0.17 pmol, 310/224/284 containing a-38 (Ea38) recognized various typical E. coli nt (lanes 19 and 20); and (k)fic, 0.30 pmol, 257 nt (lanes 21 and 22). promoters, which are also recognized efficiently by Ea-70 holoenzyme. Minor a factors recognize completely different conserved among the three types of promoters. Typical -35 sets ofpromoters that are not recognized by a70(1, 2). To our elements are observed in the type I and type II promoters but knowledge, promoters that are recognized by two different not in the type III promoter. The Ea-38 holoenzyme is able to RNA polymerase holoenzymes containing distinct a- factors have not been reported previously. The functional cross-talk discriminate type II from types I and III promoters, indicat- between a-70 and a-38 is in good agreement with their structural ing the presence of a yet-unidentified sequence motif(s) similarity. specific for a38. It should, however, be noted that the promoter preference Increased Production of c3m in Stationary Growth Phase. of the two holoenzymes differs clearly. The promoters as- Our in vitro study has revealed that a-38 and a-70 proteins have sociated with genes highly expressed in rapidly growing cells some cross-specificity for promoter recognition. To estimate tend to be transcribed specifically by Ea-70 (type II promot- the relative contribution of each a- factor in the transcription ers). All stringently controlled promoters so far examined, of various promoters at different growth phases, we next including genes for the translational apparatus, were classi- observed (by Western blot analysis) the amounts of the two fied as type II. These gene products are required at high levels a-factors in E. coli cells at various phases of growth. For this in the exponential growth phase but only at low levels in purpose, MC4100 cells were inoculated in LB medium at stationary-phase cells. In contrast, a38-dependent cellular 37°C and sampled periodically during the growth transition functions are activated and/or required in the stationary 3514 Biochemistry: Tanaka et al. Proc. Natl. Acad. Sci. USA 90 (1993) A Exponential I 2 3 4 5 6 7 8 t phase Stationary phase 38 G

B 1 2 3 4 5 6 7 8 9

70

C 10

70 6 38

O.D. 660 FIG. 4. a equilibrium model. The two circles represent sets of promoters, each of which is active in the exponential growth phase and/or in stationary phase. The promoters were classified into three groups: housekeeper promoters, stringent promoters, and gearbox promoters. A quantitative or qualitative equilibrium of the two principal o factors may determine the overall balance of cellular transcription. The predominance of or70 or o38 would result in a shift of the balance in the direction indicated by the arrow. mine the relative strength of each promoter. In fact, the relative ratio of o(38 to o70 increases in the stationary phase 0.1 (Fig. 3), which may lead to a shift in the of equilibrium (Fig. 0 1 2 3 4 5 6 7 24 4). A low level of o.38 protein was identified even in actively Time (hours) growing cells (Fig. 3), indicating that some cr38-dependent genes may be expressed even in exponential phase. In fact, FIG. 3. Growth-phase dependence of the quantity of 38 protein. rpoS-deficient strains show temperature-sensitive growth on MC4100 cells were grown in LB medium, and the quantity of o-38 lactose MacConkey agar plates, and this phenotype is res- protein was examined by Western blot analysis. (A and B) Cells were cued the addition of the harvested at the indicated optical density, and the samples were used by p-aminobenzoic acid, metabolic for Western analysis with either anti-o38 antiserum (A) or anti-or70 product of the enzymes encoded by the fic-pabA operon antiserum (B). Arrowheads show the positions. The OD660 of each (unpublished data). sample was as follows: lane 1, 0.20; lane 2, 0.46; lane 3, 0.78; lane 4, Sequence alignment ofthe tested promoters did not lead to 1.08; lane 5, 1.80; lane 6, 1.96; lane 7, 2.52; lane 8, 2.70; lane 9, 2.46. the identification of a discriminating motif between o.38 and (C) Growth curve ofthe MC4100 cells. The numbers along the curve cr70 specificities (Fig. 2). Since the "TATAAT"-like se- correspond to the lane numbers in A and B. quence in the -10 region was commonly found among the three promoter types, it is impossible at present to predict the phase. Although the fic promoter is only one example of the or species dependence of a promoter solely from sequence type III promoter so far detected in vitro, its expression in vivo is under the control of rpoS and enhanced in vivo in the information. Thus, the concept that "consensus" promoters carrying TATAAT elements at the -10 position are tran- stationary phase (R. Utsumi, personal communication). The scribed by Eo-70 holoenzyme should be reexamined. increase in the intracellular level of oy38 concomitantly with In o.70 and the cessation of cell growth (Fig. 3) is consistent with this other factors, conserved regions 2.4 and 4.2 notion. have been suggested to contact and recognize the -10 and -35 hexanucleotide sequences, respectively (1). The amino E. coli promoters were categorized into three classes based acid sequence similarity between cr70 and o(38 in these regions on the relationship between their expression level and the is consistent with their recognition specificities (7, 10, 29). rate ofcell growth (33): (i) housekeeper promoters, which are Divergent eubacterial species other than E. coli, such as constantly active independent of the growth rate, (ii) strin- Pseudomonas aeruginosa (11), Streptomyces coelicolor (10), gent promoters, which are dependent on the growth rate, and cyanobacteria (34), possess multiple species of RpoD or being more active at higher growth rate, and (iii) gearbox RpoD-related proteins. Thus, at least two types of principal promoters, of which the activities are inversely related to the oc factor with promoter growth rate. The present study, together with the results of overlapping recognition properties seem to exist in these bacteria, and growth phase-dependent other groups (3-7, 30, 33), has indicated that replacement variation in the level of each oa form may play a key role in between &o70 and oJ38 iS involved in switching among these the gene three classes of promoters. The stringent and the house- global control of transcription. However, the pro- moter selectivity of RNA polymerase may also be controlled keeper promoters are associated with a.70, whereas the by modulation ofthe core enzyme (35, 36). Stationary-phase- housekeeper and the gearbox promoters are associated with 0.38 (Fig. 4). In agreement with the finding that housekeeper specific transcription from the katE promoter might be an example of such core enzyme control. promoters are recognized, even though at different levels, by o.70 and are Cr38, the two principal ov factors structurally We thank T. Yura, R. Utsumi, M. Kawamukai, and M. Yamagishi similar. This a finding also raises the possibility that single for discussions and encouragement. This work was supported in part promoter exhibits two different levels of activity depending by Grants for Scientific Research from the Ministry of Education, on the molecular species of RNA polymerase oa factor. An Science and Culture of Japan and for the "Biodesign Research equilibrium between the two principal o factors may deter- Program" from RIKEN. Biochemistry: Tanaka et al. Proc. Natl. Acad. Sci. USA 90 (1993) 3515 1. Helmann, J. D. & Chamberlin, M. J. (1988) Annu. Rev. Bio- 20. Kajitani, M. & Ishihama, A. (1983) Nucleic Acids Res. 11, chem. 57, 839-872. 671-686. 2. Ishihama, A. (1988) Trends Genet. 4, 282-286. 21. Petersen, S., Skouv, J., Kajitani, M. & Ishihama, A. (1984) 3. Loewen, P. C. & Triggs, B. L. (1984) J. Bacteriol. 160, 668- Mol. Gen. Genet. 196, 135-140. 675. 22. Kajitani, M. & Ishihama, A. (1983) Nucleic Acids Res. 11, 4. Lange, R. & Hengge-Aronis, R. (1991) Mol. Microbiol. 5, 3873-3888. 49-59. 23. Chan, P. T., Ohmari, H., Tomizawa, J. & Lebowitz, J. (1985) 5. McCann, M. P., Kidwell, J. P. & Matin, A. (1991) J. Bacteriol. J. Biol. Chem. 260, 8925-8935. 173, 4188-4194. 24. Mizushima-Sugano, J. & Kaziro, Y. (1985) EMBO J. 4, 1053- 6. Siegele, D. A. & Kolter, R. (1992) J. Bacteriol. 174, 345-348. 1058. 7. Mulvey, M. R. & Loewen, P. C. (1989) Nucleic Acids Res. 17, 25. Nomura, T., Fujita, N. & Ishihama, A. (1985) Nucleic Acids 9979-9991. Res. 13, 7647-7661. 8. Tanaka, K., Shiina, T. & Takahashi, H. (1988) Science 242, 26. Harlow, E. & Lane, D. (1988) Antibody: A Laboratory Manual 1040-1042. (Cold Spring Harbor Lab., Plainview, NY). 9. Shiina, T., Tanaka, K. & Takahashi, H. (1991) Gene 107, 27. Iwakura, Y., Ito, K. & Ishihama, A. (1974) Mol. Gen. Genet. 145-148. 133, 1-23. 10. Tanaka, K., Shiina, T. & Takahashi, H. (1991) Mol. Gen. 28. Ivanova, A., Renshaw, M., Guntaka, R. V. & Eisenstark, A. Genet. 229, 334-340. (1992) Nucleic Acids Res. 20, 5479-5480. 11. Tanaka, K. & Takahashi, H. (1991) Biochim. Biophys. Acta 29. Lonetto, M., Gribskov, M. & Gross, C. A. (1992) J. Bacteriol. 1089, 113-119. 174, 3843-3849. 12. Tanaka, K., Masuda, S. & Takahashi, H. (1992) Biochim. 30. von Ossowski, I., Mulvey, M. R., Leco, P. A., Borys, A. & Biophys. Acta 1132, 94-96. Loewen, P. C. (1991) J. Bacteriol. 173, 514-520. 13. Hanahan, D. (1983) J. Mol. Biol. 166, 557-580. 31. Kawamukai, M., Matsuda, H., Fujii, W., Utsumi, R. & Ko- 14. Bullock, W. O., Fernandez, J. M. & Short, J. M. (1987) Bio- mano, T. (1989) J. Bacteriol. 171, 4425-4529. techniques 5, 376-378. 32. Tran, P. V., Bannor, T. A., Doktor, S. Z. & Nicholis, B. P. 15. Studier, M., Rosenberg, A. H., Dunn, J. J. & Dubendorff, (1990) J. Bacteriol. 172, 397-410. J. W. (1990) Methods Enzymol. 185, 60-89. 33. Vincente, M., Kushner, S. R., Garrido, T. & Aldea, M. (1991) 16. Sambrook, J., Fritch, E. F. & Maniatis, T. (1989) Molecular Mol. Microbiol. 5, 2085-2091. Cloning: A Laboratory Manual (Cold Spring Harbor Lab., 34. Tanaka, K., Masuda, S. & Takahashi, H. (1992) Biosci. Bio- Plainview, NY). tech. Biochem. 56, 1113-1117. 17. Gribskov, M. & Burgess, R. R. (1983) Gene 26, 109-118. 35. Ozaki, M., Wada, A., Fujita, N. & Ishihama, A. (1991) Mol. 18. Igarashi, K. & Ishihama, A. (1991) Cell 65, 1015-1022. Gen. Genet. 230, 17-23. 19. Nomura, T., Fujita, N. & Ishihama, A. (1986) Nucleic Acids 36. Ozaki, M., Fujita, N., Wada, A. & Ishihama, A. (1992) Nucleic Res. 14, 6857-6870. Acids Res. 20, 257-261.