DOCSLIB.ORG

Cell-Free Gene Expression

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Cell-Free Gene Expression PRIMER Cell- free gene expression David Garenne1,6, Matthew C. Haines 2,6, Eugenia F. Romantseva3,6, Paul Freemont 2,4,5 ✉ , Elizabeth A. Strychalski 3 ✉ and Vincent Noireaux 1 ✉ Abstract | Cell- free gene expression (CFE) emerged as an alternative approach to living cells for specific applications in protein synthesis and labelling for structural biology and proteomics studies. CFE has since been repurposed as a versatile technology for synthetic biology and bioengineering. However, taking full advantage of this technology requires in- depth understanding of its fundamental workflow beyond existing protocols. This Primer provides new practitioners with a comprehensive, detailed and actionable guide to best practices in CFE, to inform research in the laboratory at the state of the art. We focus on Escherichia coli- based CFE systems, which remain the primary platform for efficient CFE. Producing proteins, biomanufacturing therapeutics, developing sensors and prototyping genetic circuits illustrate the broader utility and opportunities provided by this practical introduction to CFE. With its extensive functionality and portability, CFE is becoming a powerful and enabling research tool for biotechnology. Portability Cell-free gene expression (CFE) harnesses the transcrip- analyse many more genetic constructs simultaneously Use outside a controlled tion and translation machinery of living cells to enable than would be possible using an in vivo system, allow- laboratory setting. protein synthesis in vitro through the expression of ing scalability from the femtolitre to litre scale over a natural or synthetic DNA. In the 1960s, the process broad variety of reaction volumes and containers5. of translation was extracted from living cells to estab- A further benefit of CFE is its demonstrated portability6. lish the genetic code embedded into living cells. This As a result, the capabilities offered by CFE are becoming also revealed that the complex parts of the machinery attractive for a broad range of applications7. However, 1Physics and Nanotechnology, University of life could be reconstituted in test tubes, without the the state of the art allows the preparation of highly effi- 1–3 –1 of Minnesota, Minneapolis, requirements of a cell membrane or cell reproduction . cient CFE systems (>1 mg ml of synthesized proteins MN, USA. Coupled cell- free transcription–translation systems considered an informal metric for highly efficient CFE) 8 2Section of Structural based on Escherichia coli were devised soon thereaf- from only approximately half a dozen organisms . With and Synthetic Biology, ter4. The major steps needed to prepare and use CFE a reaction lifetime of less than a day, CFE cannot yet sup- Department of Infectious systems, although considerably optimized, have not port the synthesis of long- lived genetically programmed Disease, Imperial College (Fig. 1) London, London, UK. changed . autonomous biological systems. DNA- dependent protein synthesis by CFE requires 3National Institute of Standards and Technology, isolating the molecular components for transcrip- The new generation of CFE systems Material Measurement tion and translation from living cells by preparing a A new generation of CFE systems has emerged in the Laboratory, Gaithersburg, cytoplasmic lysate stripped of genetic material and past 20 years that provides competitive advantages for MD, USA. membranes. The lysate is supplemented with buffers that engineering biology towards practical applications 4London Biofoundry, Imperial provide the ribonucleosides and amino acids, an ATP beyond the laboratory6. Modern CFE systems, with pro- College Translation & regeneration system to sustain translation and several tein yields up to several milligrams per millilitre9, offer Innovation Hub, London, UK. biochemical cofactors to enhance CFE. Such an open broad versatility, scalability and portability5. Current 5UK DRI Care Research and Technology Centre, Imperial and accessible environment offers unrivalled flexibility CFE systems also extend fundamental studies in other College London, London, UK. to adjust the biochemical environment and engineer bio- research fields, particularly biology, chemistry and phys- 10–12 6These authors contributed logical systems by executing synthetic genetic circuits ics . These capabilities required several key technical equally: David Garenne, assembled in the laboratory. advances. First, the amount of protein produced using Matthew C. Haines, CFE already offers powerful capabilities, and areas modern CFE systems allows synthetic DNA constructs Eugenia F. Romantseva. for further improvement have been clearly identified. with biological relevance to be expressed, from single ✉e- mail: The ability to express genetic circuits in the absence short pieces of DNA to long genetic programmes encod- [email protected]; 5 elizabeth.strychalski@ of the rest of the genome allows experiments to be ing >100 genes . Increased understanding and new nist.gov; [email protected] carried out in isolation without endogenous DNA. methods to provide more biochemical energy to lysates https://doi.org/10.1038/ Current CFE technology uses a rapid experimental has led to CFE systems capable of routine protein syn- s43586-021-00046- x set- up for high- throughput operations able to test and thesis at the milligram level13. Second, although far from NATURE REVIEWS | METHODS PRIMERS | Article citation ID: (2021) 1:49 1 0123456789();: PRIMER The PURE system understood, the large biochemical parameter space of scales. This enables high-throughput reaction assembly (The Protein synthesis Using a CFE reaction is now amenable to machine learning and execution, offering the potential to improve repro- recombinant Elements system). approaches14. Finally, proteomic studies have revealed ducibility, as well as more rapid workflows to screen A system that reconstitutes the the content of extract- based CFE systems, which may constructed DNA designs24 or the activity of enzymes Escherichia coli translational 25 machinery with fully be exploited to improve protein synthesis or enzymatic in parallel , for example. CFE systems are gaining 15,16 recombinant proteins, pathways . increasingly widespread use through their integration with the exception of CFE can also offer a more convenient prototyping into the design–build–test–learn (DBTL) engineering ribosomes and tRNAs. platform for testing engineered biological functions workflow, common to synthetic and engineering biol- than a living chassis. Although some early demonstra- ogy research. CFE also offers an alternative biopro- tions have shown good transferability between CFE cessing environment for biomanufacturing, both in the and cell- based function17–19, further work is required conventional sense of the production of biologics using to predict and design function in vitro before trans- cell-free bioreactors and for future distributed biomanu- ferring to in vivo systems. Although still widely used facturing6. Finally, the emerging efforts to interface and one of the most efficient, the T7 transcription CFE with synthetic substrates, such as unnatural amino system is no longer the only option to express genes acids26,27, as well as soft and hard materials28–30, seek to in vitro9,17,20,21. The repertoire of DNA parts that can be conceive novel hybrid smart materials, creating innova- expressed in CFE extends to natural bacterial regula- tive opportunities to expand the capabilities of biological tory elements22,23. CFE is also compatible with modern and material systems. laboratory automation at both academic and industrial Scope and goals of this review CFE workflow Achieving cell- free protein synthesis in optimal condi- tions requires specific skills and knowledge. This Primer Experimental • Select CFE system offers practical approaches to CFE, emphasizing the design • Select DNA sequences for expression • Design DNA template first principles of its workflow (Fig. 1) and allowing both • Select/design reagents new and existing practitioners to assimilate best prac- • Select/design energy mix tices. We provide metrics to benchmark the successful implementation of the major steps in the preparation of Workspace • Identify biosafety level preparation • Identify needed personal protective equipment CFE systems to facilitate troubleshooting. Although the and biocontainment synthetic yield of a reporter protein remains a typical safety • metric of CFE performance, other metrics can be con- experiment sidered, such as the response time and dynamic range of a biosensor. Other recent reviews provide complemen- Reagent • Prepare equipment and vessels, e.g. by sterilization 7 preparation • Familiarize with kit components or choose lysate preparation tary discussions focused, for example, on applications , protocol choosing the type of cells for specific applications8 and • Prepare, flash freeze and store lysates at –80 ºC, if needed the history of cell extract methodology31. • Choose amino acid mix components • Choose energy mix components E. coli remains — both historically and currently — • Determine concentrations of supplemental components, the most common model system for CFE and, indeed, e.g. amino acid mix, energy mix, Mg, K and crowding agent for molecular biology broadly. It is also one of the most studied and best characterized organisms32. The growth DNA template • Check suitability of plasmid design of E. coli cultures is rapid and inexpensive. Additionally, preparation • Prepare at required scale, mini/midi/maxi • Include
Load more

Recommended publications
  • Zinc Fingers and a Green Thumb: Manipulating Gene Expression in Plants Segal, Stege and Barbas 165
    163 Zinc fingers and a green thumb: manipulating gene expression in plants David J Segaly, Justin T Stegez and Carlos F Barbas IIIç Artificial transcription factors can be rapidly constructed A variety of techniques have been developed to manip- from predefined zinc-finger modules to regulate virtually any ulate gene expression in plants. Increased expression of gene. Stable, heritable up- and downregulation of endogenous genes is most commonly achieved through endogenous genes has been demonstrated in transgenic transgene overexpression [1]. The introduction of tissue- plants. These advances promise new approaches for creating specific and inducible promoters has improved the utility functional knockouts and conditional overexpression, and of this approach, and efficient and robust plant transforma- for other gene discovery and manipulation applications in tion techniques have made the construction of transgenes plants. a relatively routine task. However, variable expression and co-suppression of transgenes often complicate this process. Addresses Furthermore, transgenes cannot accommodate alternative ÃThe Skaggs Institute for Chemical Biology and the Department of splicing, which may be important for the appropriate Molecular Biology, The Scripps Research Institute, La Jolla, function of some transgenes [2]. California 92037, USA yDepartment of Pharmacology and Toxicology, University of Arizona, Tucson, Arizona 85721, USA Reducing or eliminating the expression of a gene in plants zDiversa Corporation, San Diego, California 92121, USA is not as simple as overexpressing a gene. Gene disruption §The Scripps Research Institute, BCC-550, North Torrey Pines Road, by homologous recombination, tDNA insertions and che- La Jolla, California 92037, USA mical mutagenesis has been used successfully, but these e-mail: [email protected] Correspondence: Carlos F Barbas III approaches are inefficient and time-consuming technolo- gies.
    [Show full text]
  • Evolution of Genomic Expression
    C H A P T E R 5 Evolution of Genomic Expression Bernardo Lemos, Christian R. Landry, Pierre Fontanillas, Susan P. Renn, Rob Kulathinal, Kyle M. Brown, and Daniel L. Hartl Introduction Genomic regulation is key to cellular differentiation, tissue morphogenesis, and development. Increasing evidence indicates that evolutionary diversity of phenotypes—from cellular to organismic—may also be, in large part, the result of variation in the regulation of genomic expression. In this chapter we explore the complexity of gene regulation from the perspective of single genes and whole genomes. The first part describes the major factors affecting gene expression levels, from rates of gene transcrip- tion—as mediated by promoter–enhancer interactions and chromatin mod- ifications—to rates of mRNA degradation. This description underscores the multiple levels at which genomic expression can be regulated as well as the complexity and variety of mechanisms used. We then briefly describe the major experimental and computational biology techniques for analyzing gene expression variation and its underlying causes. The final section reviews our understanding of the role of regulatory variation in evolution, including the molecular evolution and population genetics of noncoding DNA, as well as the inheritance and phenotypic evolution of levels of mRNA abundance. The Complex Regulation of Genomic Expression The regulation of gene expression is a complex and dynamic process. It is not a simple matter to turn a gene on and off, let alone precisely regulate its level of expression. Regulation can be accomplished through various mech- anisms at nearly every step of the process of gene expression. Furthermore, each mechanism may require a variety of elements, including DNA sequences, RNA molecules, and proteins, acting in combination to deter- 2 Chapter Five Evolution of Genomic Expression 3 mine the final amount, timing, and location of functional gene product.
    [Show full text]
  • Hexosamine Biosynthetic Pathway-Derived O-Glcnacylation Is Critical for RANKL-Mediated Osteoclast Differentiation
    International Journal of Molecular Sciences Article Hexosamine Biosynthetic Pathway-Derived O-GlcNAcylation Is Critical for RANKL-Mediated Osteoclast Differentiation Myoung Jun Kim 1,†, Hyuk Soon Kim 2,3,† , Sangyong Lee 1, Keun Young Min 1, Wahn Soo Choi 1,4 and Jueng Soo You 1,4,* 1 School of Medicine, Konkuk University, Seoul 05029, Korea; [email protected] (M.J.K.); [email protected] (S.L.); [email protected] (K.Y.M.); [email protected] (W.S.C.) 2 Department of Biomedical Sciences, College of Natural Science, Dong-A University, Busan 49315, Korea; [email protected] 3 Department of Health Sciences, The Graduate School of Dong-A University, Busan 49315, Korea 4 KU Open Innovation Center, Research Institute of Medical Science, Konkuk University, Chungju 27478, Korea * Correspondence: [email protected]; Tel.: +82-2-2049-6235 † The first two authors are equally contributed. Abstract: O-linked-N-acetylglucosaminylation (O-GlcNAcylation) performed by O-GlcNAc trans- ferase (OGT) is a nutrient-responsive post-translational modification (PTM) via the hexosamine biosynthetic pathway (HBP). Various transcription factors (TFs) are O-GlcNAcylated, affecting their activities and significantly contributing to cellular processes ranging from survival to cellular dif- ferentiation. Given the pleiotropic functions of O-GlcNAc modification, it has been studied in various fields; however, the role of O-GlcNAcylation during osteoclast differentiation remains to be explored. Kinetic transcriptome analysis during receptor activator of nuclear factor-kappaB (NF-κB) ligand (RANKL)-mediated osteoclast differentiation revealed that the nexus of major nutri- ent metabolism, HBP was critical for this process. We observed that the critical genes related to HBP Citation: Kim, M.J.; Kim, H.S.; activation, including Nagk, Gfpt1, and Ogt, were upregulated, while the global O-GlcNAcylation was Lee, S.; Min, K.Y.; Choi, W.S.; You, J.S.
    [Show full text]
  • INTRODUCTION Sirna and Rnai
    J Korean Med Sci 2003; 18: 309-18 Copyright The Korean Academy ISSN 1011-8934 of Medical Sciences RNA interference (RNAi) is the sequence-specific gene silencing induced by dou- ble-stranded RNA (dsRNA). Being a highly specific and efficient knockdown tech- nique, RNAi not only provides a powerful tool for functional genomics but also holds Institute of Molecular Biology and Genetics and School of Biological Science, Seoul National a promise for gene therapy. The key player in RNAi is small RNA (~22-nt) termed University, Seoul, Korea siRNA. Small RNAs are involved not only in RNAi but also in basic cellular pro- cesses, such as developmental control and heterochromatin formation. The inter- Received : 19 May 2003 esting biology as well as the remarkable technical value has been drawing wide- Accepted : 23 May 2003 spread attention to this exciting new field. V. Narry Kim, D.Phil. Institute of Molecular Biology and Genetics and School of Biological Science, Seoul National University, San 56-1, Shillim-dong, Gwanak-gu, Seoul 151-742, Korea Key Words : RNA Interference (RNAi); RNA, Small interfering (siRNA); MicroRNAs (miRNA); Small Tel : +82.2-887-8734, Fax : +82.2-875-0907 hairpin RNA (shRNA); mRNA degradation; Translation; Functional genomics; Gene therapy E-mail : [email protected] INTRODUCTION established yet, testing 3-4 candidates are usually sufficient to find effective molecules. Technical expertise accumulated The RNA interference (RNAi) pathway was originally re- in the field of antisense oligonucleotide and ribozyme is now cognized in Caenorhabditis elegans as a response to double- being quickly applied to RNAi, rapidly improving RNAi stranded RNA (dsRNA) leading to sequence-specific gene techniques.
    [Show full text]
  • 5 Inhibitors of Protein Synthesis
    5 Inhibitors of protein synthesis Many antimicrobial substances inhibit protein biosynthesis. In most cases the inhibition involved one or other of the events which take place on the ribosomes. Only a few agents inhibit either amino acid activation or the attachment of the activated amino acid to the terminal adenylic acid residue of transfer RNA (tRNA). There are many chemical types to be found among the inhibitors of prolein synthesis, a fa ct which has increased the difficulty of unders tanding the molecular nature of their inhibitory effects. Indeed, while the reaction which is inhibited has been ideIHified with some precision in certain instances, the nature of the molecular interaction between the sensitive site and inhibi tor remains generally elusive. The reason lies in the complexity of the reactions leading to the for mation of correctly sequenced polypeptides on the ribosome and also in the complex. ity of the structure of the ribosome itself. Our intention is to provide an outline of the current knowledge of the steps in protein biosynthesis. More detailed discussion is given to those specific reactions which are blocked by the inhibitors of protein biosynthesis. RIBOSOMES These remarkable organelles are the machines upon which polypeptides are elaborated. There are three main classes of ribosomes identified by their sedimentation coefficients. The 80S ribosomes are apparently confined to eukaryotic cells, while 70S ribosomes are found in both prokaryotic and euk aryotic cells. A unique species of50-55S ribosome found only in mamma· tian mitochondria resembles bacterial ribosomes in functional organization and antibiotic sensitivity. The 80S particle dissociates reversibly into 60S and 405 subunits and the 70S into 505 and 305 subunits as the Mg:2+ concentration of the solution is reduced.
    [Show full text]
  • Molecular Biology and Applied Genetics
    MOLECULAR BIOLOGY AND APPLIED GENETICS FOR Medical Laboratory Technology Students Upgraded Lecture Note Series Mohammed Awole Adem Jimma University MOLECULAR BIOLOGY AND APPLIED GENETICS For Medical Laboratory Technician Students Lecture Note Series Mohammed Awole Adem Upgraded - 2006 In collaboration with The Carter Center (EPHTI) and The Federal Democratic Republic of Ethiopia Ministry of Education and Ministry of Health Jimma University PREFACE The problem faced today in the learning and teaching of Applied Genetics and Molecular Biology for laboratory technologists in universities, colleges andhealth institutions primarily from the unavailability of textbooks that focus on the needs of Ethiopian students. This lecture note has been prepared with the primary aim of alleviating the problems encountered in the teaching of Medical Applied Genetics and Molecular Biology course and in minimizing discrepancies prevailing among the different teaching and training health institutions. It can also be used in teaching any introductory course on medical Applied Genetics and Molecular Biology and as a reference material. This lecture note is specifically designed for medical laboratory technologists, and includes only those areas of molecular cell biology and Applied Genetics relevant to degree-level understanding of modern laboratory technology. Since genetics is prerequisite course to molecular biology, the lecture note starts with Genetics i followed by Molecular Biology. It provides students with molecular background to enable them to understand and critically analyze recent advances in laboratory sciences. Finally, it contains a glossary, which summarizes important terminologies used in the text. Each chapter begins by specific learning objectives and at the end of each chapter review questions are also included.
    [Show full text]
  • Actin Gene Requires Myod1, Carg-Box Binding Factor, and Spl
    Downloaded from genesdev.cshlp.org on October 3, 2021 - Published by Cold Spring Harbor Laboratory Press Muscle-specific expression of the cardiac -actin gene requires MyoD1, CArG-box binding factor, and Spl Vittorio Sartorelli, Keith A. Webster, 1 and Larry Kedes 2 Program in Molecular Biology and Genetics, Institute for Genetic Medicine, and Departments of Biochemistry and Medicine, University of Southern California School of Medicine, Los Angeles, California 90033 USA Expression of the human cardiac ~-actin gene (HCA) depends on the interactions of multiple transcriptional regulators with promoter elements. We report here that the tissue-specific expression of this promoter is determined by the simultaneous interaction of at least three specific protein-DNA complexes. The myogenic determinant gene MyoD1 activated the transcription of transfected HCA-CAT promoter constructs in nonmuscle cells, including CV-1 and HeLa cells. Gel mobility-shift and footprinting assays revealed that MyoD1 specifically interacted with a single consensus core sequence, CANNTG, at -50. Previously characterized sites interact with a protein identical with or related to the serum response factor (SRF) at - 100 and Spl at -70. All three elements must be intact to support transcription in muscle cells: site-specific mutation within any one of these three elements eliminated transcriptional expression by the promoter. Furthermore, expression of the promoter in embryonic Drosophila melanogaster cells that lack MyoD1 and Spl is strictly dependent on all three sites remaining intact and on the presence of exogenously supplied Spl and MyoD1. These experiments suggest that the presence of three sequence-specific binding proteins, including MyoD1, and their intact target DNA sequences are minimal requirements for muscle-specific expression of the HCA gene.
    [Show full text]
  • Chapter 12 Gene Expression and Regulation
    PYF12 3/21/05 8:04 PM Page 191 Chapter 12 Gene expression and regulation Bacterial genomes usually contain several thousand different genes. Some of the gene products are required by the cell under all growth conditions and are called house- keeping genes. These include the genes that encode such proteins as DNA poly- merase, RNA polymerase, and DNA gyrase. Many other gene products are required under specific growth conditions. These include enzymes that synthesize amino acids, break down specific sugars, or respond to a specific environmental condition such as DNA damage. Housekeeping genes must be expressed at some level all of the time. Frequently, as the cell grows faster, more of the housekeeping gene products are needed. Even under very slow growth, some of each housekeeping gene product is made. The gene prod- ucts required for specific growth conditions are not needed all of the time. These genes are frequently expressed at extremely low levels, or not expressed at all when they are not needed and yet made when they are needed. This chapter will examine gene regulation or how bacteria regulate the expression of their genes so that the genes that are being expressed meet the needs of the cell for a specific growth condition. Gene regulation can occur at three possible places in the production of an active gene product. First, the transcription of the gene can be regulated. This is known as transcriptional regulation. When the gene is transcribed and how much it is transcribed influences the amount of gene product that is made. Second, if the gene encodes a protein, it can be regulated at the translational level.
    [Show full text]
  • Techniques for Study of Protein Synthesis
    283. TECHNIQUES FOR STUDY OF PROTEIN SYNTHE'SIS F. C. PARRISH, JR. IOWA STATE UNIVERSITY ............................................................................... A study of skeletal muscle protein biosynthesis requires a number of both simple and sophisticated techniques because it involves a study of cellu- lar subunits and molecules and their reactions. Many of these techniques h?-ve already been successfully used to acquire a considerable body of knowledge about muscle biochemistry and ultrastructure. Consequently, adaptation of these techniques provides a strong potential for obtaining some very inter- esting and illuminating information about muscle protein biosynthesis and development. Other aids in the study of muscle protein biosynthesis hwe been the knowledge supplied by the molecular biologist on the biosynthetic mecha- nism of cells and on the behavior of actin and myosin in solution. Recent research, utilizing many of the same techniques as those used for the study of protein chemistry and structure, has provided us with some very profound information about myof ibrillogenesis of mammalian skeletal muscle. Naturally, the subject of myofibrillogenesis is of much interest and concern to the muscle biologist and meat scientist because the proteins of the myofibril are the ones that most directly affect muscle growth and development, contraction, rigor mortis, meat tenderness, water binding, emulsification and human nutri- tion. If we are able to make substantial improvement in the quantitative, qualitative, and nutritive characteristics of meat we must turn to the use of techniques that will yield information on how muscle proteins are synthesized and formed into meat at the cellular and molecular level. With knowledge gained at these levels we can then begin to regulate those mechanisms and compounds affecting muscle growth and composition.
    [Show full text]
  • Translation and Folding of Single Proteins in Real Time PNAS PLUS
    Translation and folding of single proteins in real time PNAS PLUS Florian Wrucka,1, Alexandros Katranidisb,2, Knud H. Nierhausc,3, Georg Büldtb,d, and Martin Hegnera,2 aCentre for Research on Adaptive Nanostructures and Nanodevices, School of Physics, Trinity College Dublin, Dublin 2, Ireland; bInstitute of Complex Systems ICS-5, Forschungszentrum Jülich, 52425 Jülich, Germany; cInstitute for Medical Physics and Biophysics, Charité–Universitätsmedizin Berlin, 10117 Berlin, Germany; and dLaboratory for Advanced Studies of Membrane Proteins, Moscow Institute of Physics and Technology, 141700 Dolgoprudny, Russia Edited by George H. Lorimer, University of Maryland, College Park, MD, and approved April 21, 2017 (received for review October 27, 2016) Protein biosynthesis is inherently coupled to cotranslational pro- ensemble methods. Optical tweezers have been used to observe tein folding. Folding of the nascent chain already occurs during stepping of motor proteins (19–23), DNA–protein complexes (24), synthesis and is mediated by spatial constraints imposed by the as well as unfolding and refolding of RNA molecules and proteins ribosomal exit tunnel as well as self-interactions. The polypeptide’s (25, 26). This powerful single-molecule method has provided in- vectorial emergence from the ribosomal tunnel establishes the possi- formation on (i) the translation machinery by reporting on the ble folding pathways leading to its native tertiary structure. How strength of interactions between the ribosome and mRNA (27), cotranslational protein folding and the rate of synthesis are linked (ii) its translocation along a short hairpin-forming mRNA mole- to a protein’s amino acid sequence is still not well defined. Here, we cule (28), as well as (iii) the release of an arrested nascent chain follow synthesis by individual ribosomes using dual-trap optical twee- (7).
    [Show full text]
  • IGA 8/E Chapter 8
    8 RNA: Transcription and Processing WORKING WITH THE FIGURES 1. In Figure 8-3, why are the arrows for genes 1 and 2 pointing in opposite directions? Answer: The arrows for genes 1 and 2 indicate the direction of transcription, which is always 5 to 3. The two genes are transcribed from opposite DNA strands, which are antiparallel, so the genes must be transcribed in opposite directions to maintain the 5 to 3 direction of transcription. 2. In Figure 8-5, draw the “one gene” at much higher resolution with the following components: DNA, RNA polymerase(s), RNA(s). Answer: At the higher resolution, the feathery structures become RNA transcripts, with the longer transcripts occurring nearer the termination of the gene. The RNA in this drawing has been straightened out to illustrate the progressively longer transcripts. 3. In Figure 8-6, describe where the gene promoter is located. Chapter Eight 271 Answer: The promoter is located to the left (upstream) of the 3 end of the template strand. From this sequence it cannot be determined how far the promoter would be from the 5 end of the mRNA. 4. In Figure 8-9b, write a sequence that could form the hairpin loop structure. Answer: Any sequence that contains inverted complementary regions separated by a noncomplementary one would form a hairpin. One sequence would be: ACGCAAGCUUACCGAUUAUUGUAAGCUUGAAG The two bold-faced sequences would pair and form a hairpin. The intervening non-bold sequence would be the loop. 5. How do you know that the events in Figure 8-13 are occurring in the nucleus? Answer: The figure shows a double-stranded DNA molecule from which RNA is being transcribed.
    [Show full text]
  • Gene Expression: Layers of Gene Regulation
    RESEARCH HIGHLIGHTS GENE EXPRESSION methylation. Spearman’s rank cor- relation between methylation levels Layers of gene regulation (within 50 kb on either side of the transcription start site) and alterna- A new study investigates genetic and expression and DNA methylation lev- tive splicing levels show that, for epigenetic influences on genome els often overlap functional elements. many of the genes tested, there is a regulation and alternative splicing, Across cell types, expression quantita- significant association. Of note, many and highlights the tissue specificity of tive trait loci (eQTLs) are enriched in of the associations between DNA some of these interactions. DNase I-hypersensitive sites, whereas methylation and alternative splicing In a previous study, the researchers methylation QTLs (mQTLs) are are cell type-specific, illustrating examined the relationship between enriched in enhancers and insulators. another layer of cellular variability. genetic variation, DNA methyation Their statistical analyses show that, A complex relationship between and gene expression using samples generally, genetic variation has a more DNA methylation and gene expres- from the GenCord cohort that were consistent effect on gene expres- sion is beginning to emerge. This derived from umbilical cords of 204 sion across cell types, although the study further defines the roles of newborn children. They genotyped strength of the effect can be variable. genomic and epigenomic variation 2.5 million single-nucleotide poly- However, the effects of epigenetic in determining cellular phenotypes, morphisms (SNPs), assayed the meth- variation on gene expression are more and the mechanisms by which these ylation levels of 482,421 CpG sites tissue-specific. Methylation sites effects might occur.
    [Show full text]