Identification of Negative Regulators of Integrin-Mediated Cell Adhesion

Dissertation zur Erlangung des akademischen Grades eines Doktors der Naturwissenschaften (Dr. rer. nat.)

vorgelegt von

Nina Dierdorf

an der

Universität Konstanz

des Fachbereichs Biologie

Konstanz, Juni 2015

Konstanzer Online-Publikations-System (KOPS) URL: http://nbn-resolving.de/urn:nbn:de:bsz:352-0-303818

Tag der mündlichen Prüfung: 24.09.2015

Erstgutachter: Prof. Dr. Christof Hauck

Zweitgutachter: Prof. Dr. Daniel Legler

Drittgutachter: Prof. Dr. Steffen Backert

Meinen Eltern

Danksagung

An dieser Stelle möchte ich mich ganz herzlich bei einigen Menschen bedanken, die mich während meiner Promotionszeit begleitet haben.

Mein besonderer Dank gilt Prof. Christof Hauck, der mir in meiner gesamten Promotionsphase mit seinem fachlichen Knowhow und seiner freundlichen Art stets zur Seite stand, es schaffte mich in den richtigen Momenten zu motivieren und mir Mut zu machen. Lieber Christof, vielen Dank für die lehrreichen und schönen Jahre in deinem Labor!

Des Weiteren bedanke ich mich ganz herzlich bei Prof. Daniel Legler für die freundliche Übernahme des Zweitgutachtens und Prof. Alexander Bürkle für den Prüfungsvorsitz.

Ich möchte mich bei allen Mitgliedern der AG Hauck für diese erlebnisreiche und schöne Zeit bedanken. Das gute Miteinander in unserer Gruppe wird mir immer mit Freude in Erinnerung bleiben. Besonders bedanke ich mich bei unserer Sekretärin Anne für ihr organisatorisches Talent und ihre herzliche Art, bei unseren tollen Laborengeln Susi, Petra und Claudia für ihre Unterstützung und ihr Engagement, sowie bei meiner Masterstudentin Sarah für ihre Mithilfe an der Phosphatasen-Front.

Lexi möchte ich für die schöne gemeinsame Urlaubszeit danken, die mich immer erfolgreich allen Stress hat vergessen lassen und die ich sehr genossen habe. Bei Alexa bedanke ich mich für ihre unverwechselbare Art, durch die immer alles fröhlicher und besser wurde.

Des Weiteren bedanke ich mich bei Chris, Julia und Arnaud und meinen ehemaligen Kollegen Naja, Alex B., Maike, Timo und Nori für ihre Aufrichtigkeit und Freundschaft, für ihre Hilfsbereitschaft, ihren Rat in fachlichen Fragen, den Spaß und das Lachen im und außerhalb des Labors.

Bei meinem Konstanzer Familienersatz Ina, Dusi, Alex, Kerstin und Ragi möchte ich mich für ihre Unterstützung, ihr Verständnis und die tolle gemeinsame Zeit bedanken.

Zu guter Letzt gilt mein Dank meiner Familie und besonders meinen wundervollen Eltern. Ich sage euch viel zu selten, wie dankbar ich bin, euch an meiner Seite zu haben!

Inhaltsverzeichnis

Inhaltsverzeichnis

Summary ...... 1

Zusammenfassung ...... 3

1. Introduction ...... 5

1.1. The Integrin Family ...... 5 1.1.1. Integrins and Diseases ...... 6 1.1.2. Integrin Structure and Signaling ...... 9 1.1.3. Integrin Activators and Inactivators ...... 13 1.1.4. Site-Specific Phosphorylation of Integrins and Their Regulators ...... 17 1.2. Phosphatases ...... 19 1.2.1. The Serine/Threonine Phosphatase PPM1F ...... 22 1.3. Aims of the Work ...... 26

2. Results ...... 28

2.1. An ShRNA-Based Screening Approach Identified PPM1F as a Negative Regulator of Integrin-Mediated Cell Adhesion...... 28 2.2. PPM1F Negatively Regulates β1 Integrin Activity and Affects Integrin-Mediated Cell Migration in Primary Fibroblasts ...... 32 2.3. Loss of PPM1F Results in Redistribution and Clustering of Talin- Positive Focal Adhesions ...... 33 2.4. PPM1F Co-Localizes with the Inactive β1 Integrin and Its Negative Regulator FilaminA Along Actin Stress Fibers...... 35 2.5. PPM1F Dephosphorylates T788/T789 within β1 Integrin Tail ... 37 2.6. Dephosphorylation of β1 IntegrinT788/T789 Affects Binding of the Integrin Regulators FilaminA and Talin ...... 41 2.7. PPM1F Knockout Leads to Developmental Defects and Embryonic Lethality at E10.5 in Mice ...... 45 2.8. PPM1F Knockout Embryos Exhibit an Abnormal Forebrain Structure ...... 49 2.9. PPM1F Knockout Fibroblasts Display Enhanced β1 Integrin Activity and β1 Integrin Tail Phosphorylation ...... 51

Inhaltsverzeichnis

2.10. Re-Expression of Wildtype but not the Inactive PPM1F in Knockout Fibroblasts Restores Cell Migration Potential ...... 52 2.11. PPM1F+/- Mice Exhibit Reduced PPM1F Brain Expression and Display Increased Activity in a 1 h Open Field Test ...... 54

3. Discussion and Outlook ...... 57

3.1. PPM1F: The Molecular Switch to Inactivate Integrins ...... 57 3.2. PPM1F and Its Role in Cell Migration ...... 64 3.3. Manipulating PPM1F Phosphatase for Therapeutic Benefits ...... 67 3.4. PPM1F and Its Role in Brain Development ...... 69 3.5. Heterozygous PPM1F+/- Mice: A Novel Model to Study ADHD? .. 71

4. Material ...... 75

4.1. Eukaryotic Cells ...... 75 4.2. Media for Eukaryotic Cells...... 77 4.3. Prokaryotic Cells ...... 77 4.4. Media for Prokaryotic Cells ...... 78 4.5. Antibiotics ...... 78 4.6. Antibodies ...... 78 4.6.1. Primary Antibodies ...... 78 4.6.2. Secondary Antibodies ...... 80 4.7. Dyes and Toxins ...... 81 4.8. Enzymes and Proteins ...... 81 4.9. Plasmids ...... 82 4.10. Phospho-Peptides ...... 83 4.11. Oligonucleotides ...... 84 4.12. Buffers and Solutions ...... 88 4.13. Chemicals ...... 92 4.14. Kits ...... 92 4.15. Laboratory Equipment and Consumables ...... 92 4.16. Software ...... 93

5. Methods ...... 94

Inhaltsverzeichnis

5.1. Standard Laboratory Work ...... 94 5.2. Work with Eukaryotic Cells ...... 94 5.2.1. Cell Culture, Transfection of Cells and Cell Lysis ...... 94 5.2.2. Isolation of Genomic DNA from Eukaryotic Cells ...... 95 5.2.3. Lentivirus Production and Generation of Stable Cell Lines ...... 95 5.2.4. Cell Adhesion Assay ...... 95 5.2.5. Re-Plating Assay ...... 96 5.2.6. Integrin Activity Assay (Adhering Cells) ...... 96 5.2.7. Integrin Activity Assay (Suspending Cells) ...... 97 5.2.8. Immunofluorescence Staining for FACS Analysis ...... 97 5.2.9. Immunofluorescence Staining for Microscopic Preparations ...... 98 5.2.10. Single Cell Tracking...... 98 5.3. Work with Mice ...... 99 5.3.1. Mice and Mice Maintenance ...... 99 5.3.2. Isolation of Genomic DNA from Tail Biopsies ...... 99 5.3.3. Genotyping ...... 99 5.3.4. Generation of PPM1F Knockout Fibroblasts ...... 100 5.3.5. LacZ Staining of Frozen Tissue Sections ...... 101 5.3.6. Fluorescent Immunohistochemistry Staining of Frozen Mouse Embryonic Tissue Sections ...... 101 5.3.7. Whole-Mount Histochemical Detection of β-Galactosidase Activity . 102 5.3.8. Paraffin Embedding, Sectioning and Mounting of Whole-Mount Stained Embryos ...... 103 5.3.9. Fixation, Paraffin Embedding and Sectioning of E10.5 Embryos...... 104 5.3.10. Behavioral Testing: 1-h Open Field Test ...... 104 5.4. Molecular Biological Methods ...... 105 5.4.1. Generation of DNA Constructs ...... 105 5.4.2. SOEing (Synthesis by Overlap Extension) PCR for the Generation of a PPM1F Rescue Mutant ...... 107 5.4.3. Site Directed Mutagenesis ...... 108 5.4.4. ShRNA Construction and Cloning ...... 108 5.5. Protein Biochemical Methods ...... 109 5.5.1. Expression and Phosphate-Free Purification of GST-Tagged PPM1F and PPM1FD360A in HEK293T Cells ...... 109 5.5.2. In vitro Kinase Assay ...... 109

Inhaltsverzeichnis

5.5.3. In vitro Phosphatase Assay ...... 110 5.5.4. Protein Microarray ...... 110 5.5.5. Generation of a Polyclonal Antibody Directed Against mPPM1F ...... 111

6. References ...... 113

7. Appendix ...... 125

7.1. Publications ...... 125 7.1.1. Publication Part of This Thesis ...... 125 7.1.2. External Publications ...... 125 7.2. Declaration of Contributions ...... 125 7.3. List of Figures ...... 126 7.4. List of Tables ...... 127 7.5. Abbreviations ...... 128

Summary

Summary

Integrin-mediated cell adhesion is a fundamental process that is critical for the formation and maintenance of multicellular organisms. Integrins are widely expressed transmembrane receptors, indispensable for a multitude of physiological events such as embryogenesis, maintenance of the tissue integrity, survival or immune response. These cellular processes are a result of a complex and precisely controlled interplay of numerous integrin-associated proteins including protein and lipid kinases, phosphatases, small G-proteins and adaptor proteins. To allow cells to sense and respond to their variable microenvironment, integrins have developed a responsive receptor activation mechanism that is characterized by large conformational changes which have been termed integrin activation.

In this study, we identified the serine/threonine phosphatase PPM1F in an shRNA-based screening approach to negatively affect integrin-mediated cell adhesion. Knockdown of PPM1F in different cell types led to increased cell adhesion due to enhanced β1 integrin activity. Consequently, integrin-dependent cellular functions such as cell migration were significantly impaired in PPM1F knockout fibroblasts. Re-expression of the wildtype phosphatase, but not the enzymatic dead version, could rescue cell migration capability. We further found PPM1F to co-localize with the inactive β1 integrin and the integrin inactivating protein FilaminA along the actin cytoskeleton and additionally to affect the subcellular distribution of the integrin activator Talin. We discovered that PPM1F directly dephosphorylates the highly conserved threonine residues Thr788/Thr789 within the cytoplasmic tail of β1 integrin and thereby modulates the binding properties of the integrin regulators Talin and FilaminA. While Talin seems to prefer binding to the phosphorylated threonine residues, FilaminA association is negatively affected by phosphorylation. Thereby, PPM1F activity constitutes a molecular switch that orchestrates protein association with β1 integrin tails. To address the relevance of PPM1F function in an intact organism, we employed mice exhibiting a disruption of the PPM1F gene. Mating of heterozygous PPM1F+/- mice did not result in homozygous offspring and the genotypic ratio suggested embryonic lethality. Interestingly, we could identify homozygous knockout embryos at embryonic day E10.5 but not at later time

1 Summary

points. We further observed that the complete loss of PPM1F resulted in brain developmental defects. PPM1F deficient embryos exhibited an abnormal forebrain structure characterized by a disturbed organization and orientation of neural progenitor cells within the ventricular zone of the telencephalon. Additionally, knockout embryos displayed a defective delimitation of the pia mater and the neuroepithelial cells. We further received the first indication that PPM1F might also support proper brain functions in adult mice. Notably, heterozygous PPM1F knockout mice showed reduced PPM1F brain expression levels accompanied by elevated activity and reduced anxiety- related behavior in a 1h open field test. Taking together, the data presented in this thesis identify PPM1F as an essential protein phosphatase, which controls a phospho-switch to regulate integrin activity and integrin-mediated processes. Furthermore, PPM1F activity is particular important during mammalian brain development and its absence cannot be compensated by other phosphatases. Modulation of PPM1F expression or activity might strike a new path to manipulate integrin function in cells and tissues.

2 Zusammenfassung

Zusammenfassung

Die Integrin-vermittelte Zelladhäsion ist ein elementarer Prozess, der essentiell für die Entstehung und Aufrechterhaltung von multizellulären Organismen ist. Integrine sind ubiquitär exprimierte Transmembranrezeptoren, welche unabdingbar für eine Reihe von physiologischen Ereignissen wie die Embryogenese, die Aufrechterhaltung der Gewebeintegrität, das Überleben oder die Immunantwort sind. Diese zellulären Prozesse sind das Ergebnis eines komplexen und fein regulierten Zusammenspiels von verschiedensten Integrin-assoziierten Proteinen wie zum Beispiel Protein- und Lipidkinasen, Phosphatasen, kleinen G-Proteinen und Adapterproteinen. Damit Zellen ihre Umgebung wahrnehmen und auf sie reagieren können, werden Integrine in ihrer Bindungsfähigkeit an Liganden reguliert, ein Prozess, welcher als Integrin Aktivierung bezeichnet wird und durch umfangreiche Konformationsänderungen der Integrin Untereinheiten gekennzeichnet ist.

In dieser Studie haben wir mittels eines shRNA-basierten Screens die Serin/Threonin Phosphatase PPM1F identifiziert, welche einen negativen Einfluss auf die Integrin- vermittelte Zelladhäsion hat. Der Knockdown von PPM1F führte zu einer Zunahme der Zelladhäsion in verschiedenen Zelltypen und wurde außerdem von erhöhter Integrinaktivität begleitet. Infolgedessen wurde auch die Integrin-abhängige Zellmigration in PPM1F dezimierten Fibroblasten stark beeinträchtigt. Die Reexpression der aktiven, nicht aber der enzymatisch inaktiven Phosphatase, konnte die Bewegungsfähigkeit der Zellen wieder vollständig herstellen. Des Weiteren konnten wir feststellen, dass PPM1F gemeinsam mit dem inaktiven β1 Integrin und dem Integrin- inaktivierenden Protein FilaminA entlang des Aktin Zytoskeletts lokalisiert und zusätzlich die subzelluläre Verteilung des Integrin-aktivierenden Proteins Talin beeinflusst. Wir haben herausgefunden, dass PPM1F direkt die hoch konservierten Threoninreste Thr788/Thr789 in der zytoplasmatischen Domäne von β1 Integrin dephosphoryliert und dadurch die Bindungseigenschaften der Integrin Regulatoren Talin und FilaminA beeinflusst. Während Talin die Bindung an die phosphorylierten Threoninreste zu bevorzugen scheint, wird die Assoziation von FilaminA durch die Phosphorylierung beeinträchtigt. Dies lässt den Schluss zu, dass PPM1F wie ein molekularer Schalter wirkt, welcher die Bindung von Proteinen an die zytoplasmatische 3 Zusammenfassung

Domäne von β1 Integrin reguliert. Zusätzlich haben wir uns gefragt, wie relevant die Funktion von PPM1F in einem intakten Organismus und im Kontext anderer Serin/Threonin Phosphatasen ist. Um diese Frage zu beantworten, haben wir Mäuse mit einer Genetrap-Mutation erworben. Durch Kreuzungen von heterozygoten PPM1F Tieren haben wir herausgefunden, dass es keinen homozygoten Nachwuchs -weder nach dem Abstillen noch perinatal- gibt. Auch das genotypische Verhältnis von Wildtyp zu heterozygoten Tieren weist darauf hin, dass der komplette Verlust von PPM1F zum Abbruch der Embryonalentwicklung führt. An Embryonaltag E10.5 konnten homozygote Knockout Embryos in utero identifiziert werden, nicht aber zu späteren Zeitpunkten der Embryonalentwicklung. Des Weiteren haben wir festgestellt, dass der komplette Verlust von PPM1F zur Schädigungen in der embryonalen Hirnentwicklung führt. PPM1F defiziente Embryonen wiesen eine abnormale Vorderhirn Struktur auf, die durch eine gestörte Orientierung der neuralen Vorläuferzellen innerhalb der ventrikulären Zone des Telencephalons sowie durch eine fehlerhafte Trennung der Pia mater von den neuroepithelialen Zellen gekennzeichnet ist. Zusätzlich haben wir erste Anhaltspunkte dafür erhalten, dass PPM1F möglicherweise auch in die korrekte Hirnfunktion in adulten Mäusen involviert ist. Heterozygote knockout Tiere wiesen eine stark reduzierte PPM1F Expression im zentralen Nervensystem auf, was zusätzlich durch Verhaltensunterschiede, wie eine erhöhte Aktivität und ein reduziertes Angstauftreten, begleitet wurde. Zusammenfassend weisen diese Daten darauf hin, dass PPM1F eine essentielle Phosphatase ist, welche die Integrinaktivität negativ reguliert und somit Integrin-abhängige Prozesse beeinflusst. Des Weiteren spielt PPM1F eine wichtige Rolle während der Säugerhirnentwicklung und ihr Fehlen kann nicht durch die Expression anderer Phosphatasen kompensiert werden. Eine gezielte Veränderung in der PPM1F Expression oder Aktivität könnte in Zukunft dazu genutzt werden, um in Integrin- gesteuerte Prozesse einzugreifen.

4 1. Introduction

1. Introduction

1.1. The Integrin Family

Cells recognize and respond to their micro environment through a multitude of transmembrane proteins such as the well characterized and intensively studied integrin family. Integrins are widely expressed cell adhesion receptors that are found on the surface of all metazoan cells, indicating that this family evolved relatively early in the history of multicellular animals (Nichols et al. 2006; Rokas 2008). Only some years ago it was discovered, that also unicellular relatives of Metazoa such as the filasterean Capsaspora owczarzaki express integrins and that this key genes, formerly been stated as crucial for metazoan origins, have risen much earlier (Sebe-Pedros et al. 2010; Suga et al. 2013). Furthermore, homologous sequences of the component domains of integrin α and β subunits have even been identified in prokaryotes (Whittaker and Hynes 2002). Since these evolutionary conserved receptors are key players during cell adhesion and migration, it is obvious that integrins are essential for the regulation of fundamental physiological events like embryogenesis, maintenance of the tissue integrity, angiogenesis, or immune response (Calderwood 2004; Harburger and Calderwood 2009). All integrins are highly glycosylated, non-covalently linked, heterodimeric transmembrane receptors composed of an α and a β subunit, mediating cell-cell as well as cell-matrix interactions. In the mammalian genome 18 α and 8 β subunit genes are encoded and to date 24 different heterodimers have been identified at the protein level (Hynes 2002; Humphries et al. 2006), exhibiting overlapping substrate specificity and cell type-specific expression patterns (Fig. 1).

Figure 1. The integrin family. The mammalian integrin subunits and their distinct αβ associations are depicted. 18 α subunits can associate with 8 β subunits to form 24 defined heterodimers, which can further be classified into different subfamilies based on ligand specificity, evolutionary relationships (coloring of α subunits) and expression pattern (with regard to β2 and β7 restricted to leukocytes) (Barczyk, Carracedo et al. 2010).

5 1. Introduction

Integrin molecules act like a molecular bridge, ensuring the bidirectional connection of the actin cytoskeleton (Martin et al. 2002) to the extracellular matrix (ECM). Engagement of integrins by their ligands such as the ECM proteins collagen or laminin induce their clustering into focal adhesions, followed by the recruitment of numerous cytoplasmic proteins that indirectly link the intracellular domains of these receptors to the actin cytoskeleton. This linkage is not only essential for the generation of contractile forces between the cell and the substrate during cell migration but also for the transfer of signals into the cell and thereby integrating cells within their micro environment.

1.1.1. Integrins and Diseases

Integrins are dynamic and precisely regulated cell adhesion molecules that mediate the transfer of information across the membrane. These receptors play a crucial role in regulating matrix remodeling, differentiation, cell migration or survival (Harburger and Calderwood 2009). Hence, it is perspicuous that alterations in integrin structure and function can result in pathological conditions in multicellular organisms.

In line with their role in early embryonic development, mutations were rarely observed in the genes encoding for the α4, α5, αv, β1 or β8 integrin. However, various mutations within integrins with more tissue-specific expression have been connected to human diseases such as the autosomal recessive inherited disorder leukocyte adhesion deficiency (LAD). LAD was first recognized in the 1970s and is characterized by recurrent bacterial infections, impaired wound healing, as well as abnormalities in numerous of adhesion-dependent functions of granulocytes, monocytes, and lymphoid cells (Anderson and Springer 1987). LAD type I (LAD-I) has been linked to mutations in the β2 integrin, leading to a non-functional protein or to reduced or missing cell surface expression. β2 integrin is restricted to the hematopoietic system and part of all four leukocyte integrin heterodimers like the αLβ2 (also known as LFA-1 or CD11a/CD18), αMβ2 (alias MAC-1 or CD11b/CD18), αXβ2 (also known as CD11c/CD18) and αDβ2 (alias CD11d/CD18). Mice expressing a hypomorphic allele of the β2 integrin show an impaired inflammatory response to chemically induced peritonitis and have persistent skin inflammation due to inappropriate neutrophil activation but show no evidence of chronic infection (Bullard et al. 1996). Mice completely lacking β2 integrin closely

6 1. Introduction

resemble LAD-I (Scharffetter-Kochanek et al. 1998) and have deficiencies in T cell activation and extravasation (Grabbe et al. 2002).

It has also been shown that mutations in the gene of ITGA2B and ITGB3, which encode for the two subunits of the platelet integrin αIIbβ3 lead to the bleeding disorder Glanzmann’s thrombasthenia (Nurden 2006). The identified gene mutations reach through the entire length of the integrin subunits, resulting either in a non-functional protein (Chen et al. 1992) or in the reduction or even absence of the corresponding protein on the cell surface (Nelson et al. 2005). Platelets expressing such kind of mutated integrins are unable to bind the extracellular matrix protein fibrinogen and are thus incapable to form thrombi to close wounds. Additionally, mutations in the fibrinogen receptor β3 integrin have not only been linked to Glanzmann’s disease but also to a range of cardiac and vascular disorders, atherosclerosis, bone defects, autism and several cancers (Clemetson and Clemetson 1998; Liu et al. 2008; Schuch et al. 2014). Interestingly, also β3 deficient mice show various defects similar to such observed in humans including bleeding disorder (Hodivala-Dilke et al. 1999), cardiovascular defects, enhanced tumor angiogenesis (Reynolds et al. 2002), age dependent osterosclerosis (McHugh et al. 2000) as well as behavioral disorders (Carter et al. 2011). Not only mutations in different integrin subunits are linked to human disorders but also the up- and down-regulation of integrin expression levels is a hallmark of diseases such as cancer (Friedrichs et al. 1995). Changes in integrin expression profiles enable cancer cells to acquire migratory and invasive features and additionally, to modify integrin- mediated downstream signaling events that in turn is accompanied by increased resistance to apoptosis and survival in a foreign extracellular milieu. Many integrins, including αvβ3, αvβ5, αvβ6, α2β1, α5β1, α6β1, and α6β4 have been associated to cancer growth and invasion (Lu et al. 2008; Bandyopadhyay and Raghavan 2009). For example, high levels of α5β1 integrin seem to correlate with low levels of transformation for certain tumors (Giancotti and Ruoslahti 1990), whereas enhanced expression of αVβ3 is likely to be positively correlated with increased malignancy in melanomas (Nip et al. 1992), ovarian (Landen et al. 2008), and cervical (Gruber et al. 2005) cancers.

It is obvious, that the loss of integrin-regulating proteins results in phenotypes resembling the loss of integrins themselves and is also connected to diseases such as the Kindler syndrome. The Kindler syndrome is an autosomal recessive inherited

7 1. Introduction

dermatosis which was first described in 1954 by Theresa Kindler. It is caused by mutations in the FERMT1 gene, encoding for the integrin activating protein kindlin1 (Kindler 1954). This disorder is characterized by skin blistering as well as skin atrophy in early life, which is followed by photosensitivity and changes in pigmentation and thinning of the skin (Ashton et al. 2004). The mutation in the FERMT1 gene prevents the activation of β1- containing integrins, which leads to the detachment of epidermal cells from the basement membrane and in turn to blistering of the skin. Furthermore, keratinocytes expressing a non-functional kindlin1 show a lack of polarity, decreased proliferation and increased apoptosis, contributing to thinner and more fragile skin (Herz et al. 2006).

Also negative regulators of integrin activity have been linked to human diseases before. Periventricular heterotopia, an X chromosome-linked brain malformation, was one of the first disease associated with mutations in the human FLNA gene encoding for the FilaminA protein (Fig. 2) (Eksioglu et al. 1996). It is assumed that periventricular heterotopia is caused by a loss of function mutation of one FLNA allele.

Figure 2. Periventricular heterotopia. Magnetic resonance imaging (MRI) images of a normal human brain A, B and of a patient with periventricular heterotopia C, D. In contrast to the smooth ventricular surface of the normal brain, a rough zone of cortical neurons (black arrowhead) is obvious along the lateral walls of the lateral ventricles, representing neurons that have not migrated to the cortex during early brain development. A, C axial plane, B, D coronal plane; (Feng and Walsh 2004).

8 1. Introduction

FilaminA is required for the effective inactivation of integrins as well as for the dynamic regulation of filamentous actin at the leading edge of migrating cells. During cortical development the lack of FilaminA leads to the immobilization of neurons, thus preventing them from leaving the ventricular zone and in turn resulting in the disturbance of a proper formation of the six different cortical layers (Feng and Walsh 2004).

Mice lacking specific Filamins show platelet and cardiac (FilaminA), skeletal (FilaminB), and muscular defects (FilaminC), which goes along with the expression profile of these proteins. Equivalent to observation in humans, mice harboring mutations in the FLNA gene hinders neuronal migration to the cerebral cortex as well as causing cardiovascular defects. The complete loss of FilaminA in mice results in embryonic lethality accompanied by severe cardiac structural defects including ventricles, atria, and outflow tracts as well as widespread aberrant vascular patterning (Feng et al. 2006).

It is obvious that mutations and dysregulation of integrins and their associated proteins contributes to a number of serious human disorders and thus, understanding the mechanism of integrin regulation is of both physiological and pathological significance.

1.1.2. Integrin Structure and Signaling

Integrins consist of a large extracellular domain that mediates binding to a variety of ligands including extracellular matrix proteins found in basement membranes like laminin. In addition, integrins also engage fibrilar matrices like fibronectin or collagen meshworks as well as counter receptors on adjacent cells (Humphries, Byron et al. 2006). In contrast to their large extracellular domain that is followed by a single-pass transmembrane helix, integrins only exhibit a comparatively short cytoplasmic domain on average about 20-60 amino acids (Fig. 3). The cytoplasmic parts of the β chains are closely related to each other and harbor a couple of conserved motifs, whereas the cytoplasmic tail of the α subunits are more divergent in sequence and structure (Ylanne 1998; Travis et al. 2003).

The integrin α subunit is composed of a seven-bladed β-propeller followed by a thigh, a calf-1 (C1) and a calf-2 (C2) domain together shaping the integrin extracellular part (Fig.

9 1. Introduction

3). Some of the propeller blade domains exhibit calcium binding EF-hand domains that allosterically can affect ligand binding (Humphries et al. 2003). Within 9 of 18 α subunits a 200 amino acid long I-domain (αI-domain) is inserted between the second and the third β-sheet that has been suggested to mediate collagen-binding functions (Larson et al. 1989; Tuckwell et al. 1995).

Figure 3. Integrin structure. Schematic representation of an αI-domain containing integrin heterodimer. All β subunits contain a βI domain whereas only 9 out of 18 α subunits comprise an αI- domain. Stars indicate divalent cation-binding sites (Barczyk et al. 2010).

Furthermore the αI-domain contains a Mg2+ coordinating metal-ion dependent adhesion site (MIDAS) important for ligand binding. Besides the high homology within the extracellular αI-domains, the α integrin subunits also share one conserved GFFKR-motif in the membrane proximal region within their cytoplasmic tail. This motif is on the one hand essential for hetero-dimerization with the β subunit and on the other hand needed to lock integrins in an inactive conformation (De Melker et al. 1997). The extracellular part of the integrin β subunit is composed of a plexin-sempahorin-integrin (PSI) domain, a hybrid domain (H), an I-like domain (βI domain) and four cysteine-rich epidermal growth factor (EGF) repeats (Fig. 3). Equivalent to the αI-domain the βI domain contains a Mg2+ coordinating MIDAS site for ligand binding and an additional regulatory site adjacent to MIDAS (ADMIDAS). It is inhibited by Ca2+ or activated by Mn2+ regarding ligand binding (Humphries, Symonds et al. 2003). The β chain tails exhibit two NPxY or NPxY-like motifs essential for various integrin-mediated processes as well as conserved threonine residues (TTT or TT-like motif) associated to cell adhesion.

The apparently static receptors exhibit striking plasticity and dynamic properties since the binding of integrins to ECM proteins induces an active, high affinity (open) conformation of these proteins (Fig. 4A, B). 10 1. Introduction

A B

Figure 4. Integrin conformational changes. A Electron micrographs of negatively stained αVβ3 integrin. First picture αVβ3 integrin in the presence of Ca2+, second representative projection average of an extended integrin with a closed headpiece in the presence of Mn2+ and third extended integrin with an open headpiece in the presence of Ca2+ and RGD-peptide. Scale bar: 100 Å. B Ribbon diagrams of the alternative conformations of the extracellular segment of αVβ3 integrin. The bent conformation is shown at the left hand side, the corresponding model of the extended conformation at the right hand side (Takagi et al. 2002).

The ligand-induced active state stimulates intracellular signaling processes that in turn initiate the cellular response to integrin-mediated cell attachment. This process is termed integrin outside-in activation and can either be triggered by ligand binding or artificially induced via manganese stimulation by binding to the MIDAS of the β subunit I-like domain (Dedhar and Hannigan 1996; Hynes 2002). Furthermore, ligand binding to integrins induces their clustering into focal complexes where a characteristic set of cytoplasmic proteins is recruited that indirectly link the short intracellular domains of these receptors to the actin cytoskeleton. The protein composition of these initial adhesion sites changes over time and these multi-protein complexes mature into larger focal adhesions (Zamir and Geiger 2001; Zaidel-Bar et al. 2004) and finally into fibrillar adhesions (Fig. 5A-C) (Geiger et al. 2001; Ciobanasu et al. 2012).

Interestingly, the change from the low affinity, inactive state (closed conformation) to the high affinity state cannot only be induced via ligand binding, but also be triggered by intracellular processes and thus is termed inside-out activation (O'Toole et al. 1994). Integrin inside-out signaling requires dynamic and spatiotemporal regulated assembly and disassembly of focal adhesions and is achieved by an extensive interplay of proteins of the integrin adhesome, including adapter proteins, kinases, phosphatase, GTPases, guanine nucleotide exchange factors (GEFs) and GTPase activating proteins (GAPs).

11 1. Introduction

Figure 5. Images of focal adhesions. A Fluorescence microscopic picture of immuno-fluorescently labelled fibroblasts stained for the focal adhesion-associated adapter protein paxillin (shown in green) and actin (shown in red). The green patches mark the focal adhesions located at each end of the red actin fibers; Scale bar: 10 μm. B A side view of a chicken lens cell showing the interaction of a focal adhesion with the substrate (indicated by the bracket), viewed by transmission electron microscopy; Scale bar: 500 nm; (Winograd-Katz et al. 2014). C Schematic representation of focal adhesion composition, depicting experimentally determined protein positions (Kanchanawong et al. 2010).

Nowadays, about 180 proteins have been identified for being part of the human integrin adhesome and close to 700 interactions between them, highlighting the intricacy and precision of this regulatory process (Zaidel-Bar et al. 2007; Zaidel-Bar and Geiger 2010). Using three-dimensional super resolution fluorescence microscopy, Kanchanawong and colleagues could demonstrate that integrins and the actin cytoskeleton are vertically separated by an approximately 40 nm focal adhesion core complex consisting of different signaling layers and a characteristic set of signaling molecules (Kanchanawong, Shtengel et al. 2010): The integrin signaling layer composed of the cytoplasmic tail of integrins, focal adhesion kinase (FAK) and the adaptor protein paxillin; a force 12 1. Introduction

transduction layer consisting of the adaptors Talin and vinculin; and the actin- regulatory layer including the adaptors zyxin, α-actinin and vasodilator-stimulated phosphoprotein (VASP) (Fig. 5C). The complex composition of focal adhesions and the resulting prospects to generate bidirectional signaling events enable cells to sense and respond to their micro environment, which in turn influences cell behavior and functions (Fig. 6).

Figure 6. Bidirectional integrin signaling. Integrin exists in different conformational states including a bent inactive, an extended or an open activated state. Integrin outside-in activation is dependent on binding of extracellular ligands to the integrin head-domain inducing a transition from a closed to an opened conformation of the β subunit I-like domain (headpiece opening). The adaptor protein Talin is recruited to focal complexes stabilizing the integrin open conformation and connecting these receptors to the actin cytoskeleton. Vinculin binding strengthens the association between Talin and F-actin generating tension which is a crucial factor for full integrin activation. Inside-out activation is dependent on the interaction of cytosolic proteins with the cytoplasmic tail of integrins. Although the exact hierarchy of recruited proteins is not clarified unanimously it is accepted that Talin and FAK are one of the first proteins to be recruited. Binding of the head domain of Talin to the β subunit results in disruption of an inhibitory salt bridge between the α and the β subunit. The co-activator kindlin enhances Talin-induced integrin activation (Bouvard et al. 2013).

1.1.3. Integrin Activators and Inactivators

Regulation of integrin activity is a fundamental process involved in a variety of physiological events including embryogenesis, maintenance of tissue integrity,

13 1. Introduction

angiogenesis and immune response (Harburger and Calderwood 2009). In recent years, a lot of proteins have been identified that positively affect integrin activity. The adaptor protein Talin is one of several proteins that not only links the cytoplasmic domain of the integrin β subunits to actin filaments (Critchley 2004), but is also one of the most essential proteins indispensable for integrin inside-out activation. Besides a rod domain, Talin exhibits a head part containing a FERM (protein 4.1, ezrin, radixin, moesin) domain (subdivided into F1, F2 and F3 subdomains). By binding via the F2-F3 subdomains to the membrane proximal conserved NPxY-motif within the cytoplasmic domain of β integrin tails, Talin triggers a conformational change in the αβ integrin extracellular domain, increasing the affinity for ECM proteins (Tadokoro et al. 2003; Calderwood 2004). It is reported that binding of the Talin head domain to the cytoplasmic domain of integrin β subunits leads to integrin activity by disrupting a salt bridge connecting the α and β integrin subunits (Campbell and Ginsberg 2004). This changes the tilt angle of the β integrin transmembrane domain (Kim et al. 2012) and in turn releases the interactions at the interface between the transmembrane domain outer membrane clasp (OMC) and the inner membrane clasp (IMC) of the α and β subunits (Shattil et al. 2010). Talin exists in an auto-inhibited conformation that can on the one hand be abolished via the interaction with phosphatidylinositol 4,5- bisphosphate (PIP2)(Martel et al. 2001; Goksoy et al. 2008) and cleavage of the inhibitory rod domain by calpain (Franco et al. 2004) or on the other hand via an agonist receptor-mediated activation of Rap1/Rap1 GTP-interacting adapter molecule (RIAM) and the subsequent recruitment of Talin to the membrane (Lee et al. 2009). Regarding Talin irreplaceable function in integrin activation, it is obvious that complete loss of Talin1 results in severe early developmental defects in mice and thus, leading to embryonic lethality at E7.5.

Other essential integrin activators are proteins of the kindlin family composed of three evolutionarily conserved proteins kindlin-1, -2 and -3. These proteins have been identified to cooperate with Talin and are essential for full integrin activation (Montanez et al. 2008; Moser et al. 2008). Similar to Talins also kindlins contain a FERM domain and via their F3 subdomain directly interact with the cytoplasmic tail of the integrin β subunit (Meves et al. 2009). Binding of the two positive regulators Talin and kindlin to integrins results in the recruitment of other cytoskeletal and signaling proteins and

14 1. Introduction

synergize to activate integrin binding to extracellular ligands. Mutations in the kindlin-1 gene have been connected to a serious skin disease the Kindler syndrome (see 1.1.1. Integrins and Disease) (Jobard et al. 2003) and a complete loss of kindlin-2 leads to early embryonic lethality in mice at E6.5 highlighting its essential role in integrin regulation.

An essential hallmark of integrins is their ability to fine-tune their affinity for their ligands. Integrins are not passively returning to their inactive conformation, hence it is obvious that not only integrin activation but also their inactivation has to be precisely controlled. A direct mechanism of integrin inhibition involves the binding of a protein to the integrin cytoplasmic tail that in turn disturbs association of integrin activators. So far a few factors are known that stabilize the integrin “off” state. Filamin is large rod- shaped actin cross-linking protein known to interact with several proteins via its 24 immunoglobulin-like domains (Stossel et al. 2001). Abolishing of the auto-inhibition of Filamin via tension-induced binding to actin exposes several binding sites for different focal adhesion proteins as well as for integrins (Pentikainen and Ylanne 2009). Since Filamin and Talin share overlapping binding sites, it becomes obvious that these proteins compete for binding to integrin tails (Fig. 7A, E). FilaminA-mediated displacement of Talin from the β integrin tail stabilizes the inactive conformation (Kiema et al. 2006). Interestingly, depletion of both proteins in cells completely restores integrin activity, indicating that the switch between Talin and Filamin binding to integrins is crucial for integrin activity (Nieves et al. 2010). Hence, it is plausible that complete loss of the negative integrin regulator Filamin (FilaminA) leads to embryonic lethality in mice at E14.5 (Feng, Chen et al. 2006).

Other integrin inhibitors like the PTB-containing (phosphotyrosine binding domain) proteins including docking protein 1 (DOK1) and integrin cytoplasmic domain- associated protein (ICAP1) have also been reported to compete with Talin and kindlin for β integrin tail binding (Bouvard et al. 2003; Wegener et al. 2007; Millon-Fremillon et al. 2008). DOK1 binds to the same region on the β integrin tail as Talin and ICAP1 shares a similar binding region with kindlin (Fig. 7B, C, E). Thus, binding of the respective inactivator leads to the expulsion of the corresponding activator. Another integrin regulator called SHARPIN binds directly to a conserved IMC region within the integrin α subunits and therefore, represents the first integrin regulator affecting the α tail (Rantala et al. 2011).

15 1. Introduction

A B

C D

E

Figure 7. Integrin inhibitors and their mechanism of action. Binding of the integrin inactivators Filamin, ICAP1, Dok1, SHARPIN and MDGI (mammary-derived growth inhibitor) to the α or β subunit results in displacement of the positive regulators Talin and kindlin. A Epidermal growth factor-activated ribosomal protein S6 kinase2 (RSK2)-mediated phosphorylation of Filamin on Ser2152 promotes integrin binding and Talin displacement. B Binding of Krev interaction trapped 1 (KRIT1) to ICAP1 prevents Integrin-ICAP1 interaction and Talin displacement. C Src-mediated integrin tyrosine phosphorylation (within proximal NPxY motif) enhances DOK1 binding and Talin displacement. D MDGI and SHARPIN bind to the integrin α subunit. SHARPIN prevents recruitment of Talin and kindlin to integrins. E The α and β binding sites of integrin regulators are depicted. The residue of the inner membrane clasp between the α and β subunit are colored in green, the conserved NPxY motifs in blue (Bouvard, Pouwels et al. 2013).

SHARPIN binds to the highly conserved WKXGFFKR sequence within the integrin α subunit and thereby prevents the recruitment of Talin and kindlin. It was shown that the last arginine residue of the WKXGFFKR motif, forming the inhibitory salt bridge with the corresponding aspartic acid residue within the β subunit, is not required for SHARPIN binding. SHARPIN binds to integrins with an intact salt bridge and thus might stabilize this inhibitory clamp. 16 1. Introduction

1.1.4. Site-Specific Phosphorylation of Integrins and Their Regulators

To date a multiplicity of proteins has been identified that either directly (more than 40) or indirectly (more than 230) interact with the cytoplasmic tail of integrins (Legate and Fassler 2009; Zaidel-Bar and Geiger 2010). Thus, it is obvious, that there is the necessity of a spatiotemporal regulation of these interactions by different mechanisms.

In recent years more and more focus has been placed on phosphorylation events affecting integrin affinity and integrin-mediated down-stream signaling. Indeed, the cytoplasmic tail of integrins is comparatively short but nevertheless it accommodates plenty of phosphorylation sites potentially serving as posttranslational switches that regulate binding of different molecules (Fig. 8).

Figure 8. Amino acid sequence of some α and β integrin cytoplasmic tails. The motif needed for stabilizing the integrin inactive state (salt bridge formation) is shaded in red. The α chain motif, containing a serine residue important for outside-in activation, is colored in yellow. The conserved NPxY motifs within the β chain are shaded in blue and the conserved threonine residues in green. Potential phosphorylation sites are shown in red (Fagerholm et al. 2004).

The β integrin subunit exhibits conserved phosphorylation sites which turned out to serve as a dynamic mechanism to conduct adaptor binding to integrins. The conserved tyrosine residues of both NPxY motifs were decoded to modulate integrin activation. These tyrosine residues can be phosphorylated in a Src-dependent manner (Sakai et al. 2001; Bledzka et al. 2010). Phosphorylation of the membrane distal NITY motif within β3 integrin disrupts kindlin-2 binding (Bledzka, Bialkowska et al. 2010), whereas phosphorylation of the membrane proximal NPLY motif leads to impaired Talin association (Oxley et al. 2008). In contrast, phosphorylation of the proximal NPLY motif within β3 integrin enhances binding of the negative regulator DOK1 to the integrin tail (Oxley, Anthis et al. 2008). Not only the tyrosine residues of both NPxY motifs were

17 1. Introduction

identified to affect integrin activity but also the threonine residues within the cytoplasmic tail of the β subunit. In humans, the Thr789 in β1 integrin is conserved across all integrin tails except for the β1D isoform, whereas Thr788 is replaced by serine residues within β3, β5 and β6. Mutational studies revealed the first indication for the importance of these residues (T788A/T789A) within the cytoplasmic tail of β1 integrin, negatively affecting cell spreading and integrin activity (Wennerberg et al. 1998; Nilsson et al. 2006). In this regard it was also shown that T cell receptor complex activation can trigger phosphorylation of β7 integrin threonine residue leading to enhanced β7- mediated cell adhesion (Hilden et al. 2003). Furthermore, the phosphorylation status of Thr758 of β2 as well as Thr783 and Thr785 of β7 integrin seems to be important for integrin function, since modification of this residues have been identified to strongly decrease FilaminA association (Kiema, Lad et al. 2006; Takala et al. 2008). So far, kinases that have been identified to play a role in phosphorylation of these threonine residues within the β integrin subunit are the protein kinase C (PKC), the calcium/calmodulin- dependent protein kinase II (CaMKII), Akt and 3-phosphoinositide dependent protein kinase-1 (PDK1). Angiotensin-dependent activation of PCKε in rat cardiac fibroblasts results in the association of this kinase with β1 integrin, accompanied by increased β1 Thr788/789 phosphorylation as well as enhanced cell adhesion (Stawowy et al. 2005). Also CaMKII has been found to interact with β1 integrin in normal human epithelial cells and is thought to phosphorylate Thr788/789 during mitosis, but contradictory, resulting in reduced cell adhesion (Takahashi 2001; Suzuki and Takahashi 2003). T779 within the platelet β3 integrin (which is homologous to β1 integrin T789) was found to be phosphorylated by Akt and PDK1 in vitro and inhibits outside-in signaling of this receptor (Kirk et al. 2000), indicating that phosphorylation of these residues might differ among integrins.

However, not only phosphorylation of integrins themselves has been shown to influence integrin affinity but also phosphorylation of their regulators modulates integrin activity. Phosphorylation of FilaminA via RSK2 and phosphorylation of ICAP1 via the CaMKII at a specific serine and threonine residue triggers binding of these proteins to β2 and β1 integrin, respectively, and hereby stabilizing the integrin “off” state (Gawecka et al. 2012; Millon-Frémillon et al. 2013).

18 1. Introduction

1.2. Phosphatases

Protein phosphorylation is a fast and efficient tool to control cell response to internal and external cues. It is the most common form of reversible posttranslational modifications (PTM) and plays a key role in controlling a multiplicity of cellular processes such as differentiation, proliferation, apoptosis, migration or metabolism (Manning et al. 2002). Impressively, from the estimated 20,000-25,000 human protein- coding genes approximately 17,000 proteins have at least one annotated residue in the Phosphosite database (Hornbeck et al. 2012), highlighting the importance of this modification. Thus, it is obvious that abnormal phosphorylation profiles are the cause or the consequence of different human diseases like cancer, diabetes and neurodegenerative or inflammatory disorders (Table 1) (Cohen 2001; Gee and Mansuy 2005; Easty et al. 2006; Tonks 2006).

Table 1. Disease caused by mutations in specific protein kinases and phosphatases (Cohen 2001).

The majority of protein phosphorylation in eukaryotic cells occurs predominantly on the hydroxyl-containing amino acids serine (Ser), threonine (Thr) and tyrosine (Tyr). Serine is the predominant target with about 86 %, followed by phosphorylation events at threonine residues up to 11.8 % and finally about 1.8 % of protein phosphorylation

19 1. Introduction

occurs at tyrosine residues (Olsen et al. 2006). Phosphorylation of proteins is a common mechanism for controlling the behavior of a protein, such as affecting its subcellular distribution or leading to its activation or inactivation. The addition or the removal of a phosphate group to or from a molecule, respectively, is accomplished by antagonizing activities of protein kinases and phosphatases. The human genome encodes about 518 putative protein kinases that can be classified into 428 serine/threonine kinases and 90 tyrosine kinases (Lander et al. 2001; Johnson and Hunter 2005).

Figure 9. Classification of protein phosphatase superfamily. (1) Phosphatases were first classified into six families according to the catalytic domain InterPro annotation. (2) Each family was further subdivided into classes according to their preferred substrates or literature annotation (3) (Sacco et al. 2012).

In contrast to the abundance of kinases the fully sequenced human genome is thought to contain only about 200 phosphatases, subdivided into 108 putative tyrosine phosphatases (PTPs), roughly 30 serine/threonine phosphatases (phosphoprotein phosphatases (PPPs) as well as metal-dependent protein phosphatases (PPM)), 21 phosphatases containing a haloacid dehalogenase-like hydrolase domain (HADs), 37

20 1. Introduction

enzymes harboring a phosphatidic acid phosphatase or inositol polyphosphate-related domain (LPs) as well as 5 phosphatases with a NUDIX hydrolase domain (NUDT) (Fig. 9) (Alonso et al. 2004; Sacco, Perfetto et al. 2012).

Regarding the ratio of protein kinases to phosphatases it becomes comprehensible, why over the past decades the scientific community has focused on kinases. While the number of protein tyrosine kinases compared to tyrosine phosphatases is almost fairly balanced, there is a striking difference in the quantity of serine/threonine kinases to phosphatases. Therefore, phosphatases have been considered for a long time for being promiscuous, unregulated enzymes that play a non-specific role in controlling phosphoprotein homeostasis in vivo. However, besides the approximately 200 identified proteins containing a phosphatase catalytic domain there are also about 56 regulatory subunits identified to date.

Figure 10. The complexity of PP2A regulation. PP2A predominately exist as heterotrimer composed of conserved A and C subunits and variable B subunits. This complex is regulated in multiple ways, including regulation of heterotrimer assembly, microbial toxins (e.g. okadaic acid or microcystin), protein inhibitors such as SET or CIP2A, and phosphorylation of the B and C subunits to regulate activity, assembly, and targeting. At the right hand side the regulating B subunits are depicted, corresponding to at least 15 different genes, each with multiple splice variants (Virshup and Shenolikar 2009).

All 13 members of the PPP family of serine/threonine phosphatases receive regulation and substrate specificity within the cell through combinatorial interactions between 21 1. Introduction

their conserved catalytic subunits and various numbers of regulatory subunits, together forming an active holoenzyme. PP2A for example, belonging to the PPP family of serine/threonine phosphatases typically exist as heterotrimer composed of a catalytic C- , a structural A- and a regulatory B-type subunit (Fig. 10).

The core complex, comprising the catalytic and the structural subunit, can exist independently or can be associated with the regulatory components via the structural A- type subunit (Janssens et al. 2008; Virshup and Shenolikar 2009). Hence, regulated binding and the dynamic exchange of the B-type subunits represents a beneficial mechanism for controlling PP2A activity, including substrate selectivity as well as targeting the enzyme within the cell. In contrast to the PPP, members of the PPM family do not associate with regulatory B-type subunits, but instead harboring additional interaction domains and conserved sequence motifs. One member of the Mn2+/Mg2+- dependent PPM family is the Protein Phosphatase 2C (PP2C). PP2C represents a large family of highly conserved protein phosphatases with 15 distinct PP2C genes encoded in the human genome (Lammers and Lavi 2007), all characterized by the conserved PP2C- like domain. Interestingly, homologs of human PP2Cs can be found in almost all phyla, spanning from plants, bacteria, and yeast, to nematodes, insects, and mammals (Schweighofer et al. 2004), highlighting their particular need in regulating key cellular signaling events. Unlike the PPP family, PP2C has a large number of isoforms encoded by different genes. These different isoforms are marked by specific sequences and domain organizations giving the PP2C isoforms distinct functions, subcellular distribution and expression pattern. It is assumed that these additional interacting sites probably contribute to substrate specificity and selectivity. Nevertheless, further research is needed to unravel the molecular determinants affecting the mode of action of this class of protein phosphatases.

1.2.1. The Serine/Threonine Phosphatase PPM1F

PPM1F belongs to the PP2C family of metal-dependent serine/threonine protein phosphatases. So far, two genes, PPM1F and PPM1E, have been identified (Koh et al. 2002). PPM1F, also known as POPX2 (Partner of PIX2), CaMKPase or hFem-2, was first discovered in 1998 by Ishida and colleagues in rat brain as a unique phosphatase

22 1. Introduction

specifically affecting multifunctional CaMKs (Ishida et al. 2003). Afterwards, PPM1E (alias POPX1 or CaMKP-N) was isolated as a binding partner for the PAK interacting guanine nucleotide exchange factor (PIX), sharing 52 % sequence identity in the catalytic domain to PPM1F (Manser et al. 1998; Takeuchi et al. 2001; Koh, Tan et al. 2002). The cytosolic PPM1F with a relative molecular mass of around 50 kDa is ubiquitously expressed, while the larger 84 kDa, nuclear PPM1E is predominately found in brain and testis (Takeuchi, Ishida et al. 2001). Recently, Zhang and colleagues could solve the crystal structure of the full-length Caenorhabditis elegans Fem-2 (cFem-2), the homolog of the human PPM1F (Zhang et al. 2013). cFem-2 is composed of an N-terminal domain and a C-terminal PP2C-like domain. Equivalent to other members of the PP2C family (Shi 2009), the C-terminal domain harbors a central β sandwich formed by two sets of antiparallel β sheets. One set of β sheets is flanked by two α helices in an antiparallel fashion, whereas the other set is flanked by three α helices (Fig. 11A).

A B

Figure 11. Overall structure of cFem-2. A The N-terminal domain of cFem-2 is shown in cyan and the C- terminal domain in purple. The Mg2+ ions are depicted as spheres and helices in the N-terminal region are marked. B The catalytic core of cFem-2 and the residues involved in Mg2+ coordination, shown as sticks, are illustrated. Mg2+ ions and water molecules are marked as blue and red spheres, respectively. Metal- oxygen coordination bonds are depicted as red dashed lines (Zhang, Zhao et al. 2013).

PPM1F and its homologs require manganese or magnesium ions (Mn2+/Mg2+) for their enzymatic activity. Resolving the crystal structure of cFem-2 discovered two Mg2+ ions in the catalytic center. Both are hexa-coordinated by oxygen atoms from amino acids and water molecules (Fig. 11B), conformable with the structure of the human PP2Cα (Shi 2009). Notably, comparing the residues involved in phosphate interaction and in

23 1. Introduction

the coordination of metal ions are highly conserved among different Fem-2 homologs, reaching from different nematode species to the human PPM1F (Fig. 12). Mutations of these residues involved in metal ion coordination all abolish or dramatically impair phosphatase activity (Harvey et al. 2004; Oliva-Trastoy et al. 2007; Zhang, Zhao et al. 2013). It has also been found that PPM1F phosphatase activity is regulated by oxidation and reduction at the cysteine residue 359, that upon reduction, e.g. by 2- mercaptoethanol, leads to an increase in enzymatic activity (Baba et al. 2012). Unlike the C-terminal domain of PPM1E that seems to control its catalytic activity (Sueyoshi et al. 2012; Ishida et al. 2013), the N-terminal domain of PPM1F does not directly regulate its phosphatase activity but rather acts as a protein interaction or scaffold domain (Zhang, Zhao et al. 2013; Phang et al. 2014).

Figure 12. Sequence alignment of different Fem-2 homologs. The conserved residues contributing to phosphate and Mg2+ binding are highlighted with red stars. Residues with 100 % homology, over 75 % homology, and over 50 % homology are colored in dark blue, purple, and light blue, respectively (Zhang, Zhao et al. 2013).

One of the main substrates identified so far are the multifunctional CaMKs, including CaMKI, II, and IV (Ishida et al. 1998; Fujisawa 2001; Ishida, Shigeri et al. 2003). PPM1F has been shown to deactivate the auto-phosphorylated CaMKII by dephosphorylating Thr286 within the kinase activation loop in vitro (Ishida, Kameshita et al. 1998; Harvey,

24 1. Introduction

Banga et al. 2004). In return, PPM1F can be phosphorylated by CaMKII in the presence of poly-L-lysine resulting in a 2-fold increase in its enzymatic activity. Accordingly, the activity of PPM1F seems to be regulated through phosphorylation by its target enzyme (Kameshita et al. 1999). PPM1F is also known to be an inhibitor of members of the p21- activated kinases (PAK) family of serine/threonine kinases. In vitro studies have demonstrated that PPM1F dephosphorylates key residues within the activation loop of PAK such as Thr422 (Koh, Tan et al. 2002). Equivalent to PPM1E also PPM1F can interact with the Rho-GEF PIX and thus block efficiently PAK-mediated biological effects such as actin reorganization and cell migration downstream of the Rho-GTPases Cdc42 and Rac. In this regard, it was also shown that PPM1F can inhibit actin stress fiber breakdown mediated by active Cdc42 (Koh, Tan et al. 2002). Another identified PPM1F interaction partner is the formin protein mDia1. PPM1F can negatively affect mDia1- and RhoA-dependent transcription (Hill et al. 1995) mediated by serum response factor (SRF) (Xie et al. 2008). Recently, Phang and colleagues discovered that PPM1F also can dephosphorylate the KIF3 kinesin motor complex (KIF3A) at the serine residue 690. It was hypothesized that the PPM1F-mediated dephosphorylation of KIF3A keeps this protein in an auto-inhibited conformation, resulting in an impaired transport of N- cadherin and β-catenin to the membrane and hereby losing cell-cell contacts sides (Phang, Hoon et al. 2014). PPM1F might also be involved in the regulation of cytoskeleton dynamics through the regulation of MAP kinases (MAPK1/3) and glycogen synthase kinase 3 (GSK3) activities, since silencing of PPM1F alters the phosphorylation level of these kinases and decreases their activity (Zhang et al. 2013). Furthermore, PPM1F has been detected to be highly expressed in invasive cancer and its depletion dramatically reduces cancer cell motility and invasiveness, accompanied by the loss of stress fibers, reduced focal adhesions and β1 integrin expression (Susila et al. 2010). Finally, PPM1F has also been linked to cell death, since its overexpression induces caspase-dependent apoptosis in mammalian cells (Tan et al. 2001).

25 1. Introduction

1.3. Aims of the Work

The Ph.D. project entitled “Identification of Negative Regulators of Integrin-Mediated Cell Adhesion” aimed at a detailed understanding of the regulatory network of focal adhesion proteins that affect integrin activation in a negative manner.

In recent years, more and more focus has been placed on phosphorylation events affecting integrin activity as well as integrin-mediated down-stream signaling. The cytoplasmic tail of integrins comprises conserved phosphorylation sites, which turned out to serve as a molecular switch to regulate adaptor binding to integrins. For sure, not only integrins themselves have been identified to be regulated via phosphorylation, but also integrin effector proteins are controlled via their phosphorylation state. Since a lot of kinases have been identified affecting integrin activity modulation, we defined their antagonists -protein phosphatases- for being a reasonable target controlling integrin affinity in a negative way. Therefore, we ask the following questions:

1. Do further proteins exist that regulate integrin activity in a negative manner and in particular are protein phosphatases of the human integrin adhesome involved in the integrin activity control?

2. What is/are the target/s of the candidate phosphatase and how is the underlying molecular mechanism regulated?

3. Does the candidate phosphatase affect integrin-dependent cellular processes?

4. Does the candidate phosphatase also impact on integrin activity in vivo and consequently affects physiological events?

First, an shRNA-based (small hairpin RNA) functional screening approach was used to identify a candidate protein negatively affecting integrin-mediated cell adhesion as well as integrin activity. Furthermore, this project included a candidate approach in human cells to elucidate the role of the novel regulator in integrin-mediated cell adhesion and its mode of action. The role of the identified candidate protein was also evaluated in an in vivo mouse model.

26 1. Introduction

A detailed understanding of the regulatory network of focal adhesion proteins that affect integrin activation is highly worthwhile and will possibly open up new starting points for novel anti-inflammatory drugs with a promising therapeutic target.

27 2. Results

2. Results

2.1. An ShRNA-Based Screening Approach Identified PPM1F as a Negative Regulator of Integrin-Mediated Cell Adhesion

Binding of the cytoplasmic adapter protein Talin to the conserved NPxY motif in the cytoplasmic tail of the β integrin subunit is critical for integrin inside-out activation. Talin is composed of an N-terminal globular head domain that is allosterically repressed via a flexible rod domain and thereby kept in an auto-inhibited conformation (Goksoy, Ma et al. 2008). In 1999, Calderwood and colleagues could show that expression of a Talin fragment containing the head domain led to a constitutively active variant of this protein able to activate integrin αIIbβ3 (Calderwood et al. 1999). In a preliminary proof- of-concept experiment, we observed that expression of the Talin head domain (Talin1 aa1-433) in HEK 293T cells (human embryonic kidney cells) resulted in increased cell adhesion. We speculated that depletion of a negative regulator of integrin activity should also lead to enhanced cell adhesion to extracellular matrix proteins to a similar extent as the overexpression of the Talin head domain. HEK cells expressing the constitutively active Talin variant exhibited increased integrin activity which was reflected via enhanced cell adhesion to the integrin ligand collagenI but not to the integrin- independent substrate Poly-L-lysine (Fig. 13A, B). To identify novel integrin regulators affecting integrin activity in a negative manner, a lentivirus-based system was used to silence phosphatases of the human integrin adhesome in HEK cells. Adhesion potential of these stable knockdown cells was evaluated on the integrin ligands collagenI and fibronectin and the control substrate Poly-L-lysine. The screening results yield a first indication of three interesting candidates with regard to the serine/threonine phosphatase PPM1F, the tyrosine phosphatase PTP-PEST, as well as the receptor-like tyrosine phosphatase alpha (RPTPα). Knockdown of these phosphatases led to increased cell adhesion compared to control cells (Fig. 13C). RPTPα has been directly linked to αVβ3 integrin-cytoskeleton connection before and is required for the force-dependent formation of focal complexes (von Wichert et al. 2003). Also, PTP-PEST has been connected to integrin regulation and cell adhesion previously (Souza et al. 2012).

28 2. Results

Figure 13. Identification of PPM1F as a negative regulator of integrin activity. A HEK cells were transfected as indicated and seeded onto collagenI (1 µg/ml) or onto Poly-L-lysine (10 µg/ml) for 40 min. Non-adherent cells were removed via washing and remaining cells were quantified after crystal violet staining. Values were normalized to total number of seeded cells. Bar represent mean ± SD of 3 wells. B HEK cells were transfected as indicated and whole cell lysates were analyzed via western blotting. C HEK cells were transduced with lentiviral particles encoding shRNAs targeting the indicated phosphatases. Stable cell lines were seeded onto integrin

ligands (1 µg/ml collagenI, 0.8 µg/ml fibronectinIII9-12) or onto Poly-L-lysine. Adherent cells were quantified and values were normalized to total number of seeded cells. Bar represent mean ± SD of 3 wells. Representative pictures are shown in D. E

Expression of focal adhesion proteins in control and PPM1F knockdown cells was analyzed by western blotting. Coll=CollagenI; Poly-L=Poly-L-lysine; FN=Fibronectin

In contrast, PPM1F has not been directly linked to integrin regulation before. Moreover, PPM1F-depleted cells exhibited the most prominent increased adhesiveness compared

29 2. Results

to control cells, solely when cells were seeded on extracellular matrix proteins. Hence, this effect was absent on Poly-L-lysine (Fig. 13C, D).

Fibronectin-dependent cell adhesion is primarily mediated by the α5β1 and αVβ3 heterodimers and the collagenI-dependent interaction via the α2β1 receptor, pointing either to a modulation in the affinity of these specific receptors or to an altered valency. However, enhanced adhesion of PPM1F-depleted cells was not due to a change in integrin α5, αV, β1 or β3 surface expression (data not shown) or different expression levels of relevant focal adhesion proteins such as Talin, Kindlin-2, FilaminA, FAK, ILK, Paxillin, or Vinculin. Western blot analysis also confirmed a clear reduction of PPM1F expression levels in shRNA treated cells (Fig. 13E).

For subsequent analysis human primary foreskin fibroblasts (normal human dermal fibroblast NHDF) were chosen as a cell model exhibiting more physiological relevance. Similarly to experiments in HEK cells, depletion of PPM1F led to significantly enhanced cell adhesion capability to collagenI and fibronectin (Fig 14A, B). Cell adhesion was slightly increased on low laminin concentration, whereas no effect was observed on higher laminin concentrations or on vitronectin (Fig. 14C). Analysis of PPM1F expression in knockdown NHDFs revealed significant reduction of phosphatase protein levels. Again, levels of other focal adhesion proteins were not affected (Fig. 14D). Importantly, surface expression of collagen- and fibronectin-binding integrins was not changed, indicating a change in integrin affinity coincided with the loss of PPM1F (Fig. 14E).

30 2. Results

Figure 14. PPM1F regulates integrin-mediated cell adhesion in NHDFs. A NHDFs were transduced with lentiviral particles encoding shRNA targeting PPM1F as well as the empty pLKO.1 and subjected to cell adhesion assays (1 µg/ml collagenI, 0.8 µg/ml fibronectinIII9-12). Values were normalized to total number of seeded cells. Bars represent mean ± s.e.m. of 3 independent experiments done in triplicate; unpaired t-test, * p<0.05, ** p<0.01, *** p<0.001. Representative pictures are shown in B. C Control and PPM1F depleted cells were seeded onto the indicated integrin ligands (Coll: CollagenI; VN: Vitronectin; MG: Matrigel). Adherent cells were quantified and values were normalized to total number of seeded cells. Bar represent mean ± SD of 3 wells. D Expression of focal adhesion proteins in control and PPM1F

31 2. Results

knockdown NHDFs was analyzed by western blotting and integrin surface expression by flow cytometry analysis, 6000 counts E.

2.2. PPM1F Negatively Regulates β1 Integrin Activity and Affects Integrin-Mediated Cell Migration in Primary Fibroblasts

To further elucidate whether the effect of increased cell adhesiveness in PPM1F- depleted cells is due to altered integrin affinity the conformation sensitive 9EG7 antibody (Lenter et al. 1993) was used to analyze β1 integrin activation. PPM1F knockdown and control fibroblasts were stained for active β1 integrin (9EG7) or total

β1 integrin surface expression (AIIB2). MnCl2 served as an artificial activator of integrins reflecting maximal inducible integrin activity. PPM1F-depleted fibroblasts displayed increased staining of active β1 integrin compared to control cells, while the amount of total surface β1 integrin was not altered (Fig 15A).

Figure 15. PPM1F affects β1 integrin activity and cell migration. A Control and PPM1F knockdown NHDFs were re-plated onto fibronectin coated dishes and stimulated with Mn2+ or remained unstimulated

32 2. Results

before fixation and staining for active β1 integrin (9EG7) or total β1 integrin (AIIB2). Graphs show ratio of active β1 integrin to total β1 integrin and active β1 integrin to artificial inducible β1 integrin activity. Bars represent mean ± s.e.m. of triplicates of one representative experiment; unpaired t-test, * p<0.05. B HT1080 cells were transduced with lentiviral particles encoding for a second shRNAs targeting PPM1F/E and stained for active or total β1 integrin. Bars represent mean ± s.e.m. of triplicates of one representative experiment; unpaired t-test, ** p<0.01 C PPM1F depleted NHDFs were seeded onto the indicated concentrations of collagenI and starved for 4.5 hours. Upon stimulation cells were monitored every 15 min for 17 hours using time-lapse microscopy. Unpaired t-test, normality test via sigmastat, n=15; ** p <0.01, *** p <0.001. Representative cell-tracks are shown.

Off-target effects could be excluded since the same effect was observed when human kerationcytes HT1080 were transduced with a second shRNA targeting PPM1F/E. Also, PPM1F/E depleted cells showed enhanced integrin activity compared to control cells (Fig. 15B).

Cell migration capability is dependent on the interaction of integrins and their ligands. This comprises the affinity or avidity of these receptors, respectively, as well as the levels of their ligands (Palecek et al. 1997). Since it was found that depletion of PPM1F in human fibroblasts and kerationcytes affects integrin activity, we assumed this could also influence integrin-mediated cell migration. To this end, control and PPM1F knockdown NHDFs were seeded onto increasing amounts of collagenI and monitored by time-lapse microscopy. Tracking of single cells revealed that the velocity of cell migration depends on substrate concentration. Loss of PPM1F increased migration speed, solely when cells were seeded on low matrix concentrations. This effect was absent when knockdown cells were cultured on intermediate amounts of substrate and yet inverted on high concentrations (Fig. 15C). This finding indicates that PPM1F negatively regulates integrin ligand binding and thus also affects integrin-mediated cellular processes.

2.3. Loss of PPM1F Results in Redistribution and Clustering of Talin- Positive Focal Adhesions

Integrin activation results in the recruitment of multiple proteins to focal complexes where they regulate the architecture and dynamics of these adhesion sites. Since we found that the loss of PPM1F results in increased integrin activity, we were interested

33 2. Results

whether this has an effect on the distribution or size of focal adhesions. Western blot and flow cytometry analysis of control and PPM1F-deficient NHDFs showed that β1 integrin and Talin are expressed to a similar extent (Fig. 14D, E). However, taking into account the subcellular distribution of these proteins, control cells exhibited focal adhesions throughout the cell body characterized by a dot-like morphology (Fig. 16A, top row). In contrast, PPM1F knockdown cells showed pronounced clustered Talin- positive focal adhesions mainly situated at the cell periphery in line with a distinct staining for active β1 integrin (Fig. 16A, middle row), similar to observations made in FilaminA knockdown cells (Fig. 16A, bottom row, B).

Figure 16. Loss of PPM1F affects Talin clustering and its subcellular distribution in NHDFs. A Control, PPM1F and FilaminA-depleted NHDFs were seeded onto 1 µg/ml

fibronectinIII9-12 coated cover- slips. 1.5 hours post seeding cells were stained as indicated and analyzed using wide field microscopy. Insets: Higher magnification; Scale bar: 20 µm. B The knockdown of FilaminA was analyzed by western blotting.

34 2. Results

2.4. PPM1F Co-Localizes with the Inactive β1 Integrin and Its Negative Regulator FilaminA Along Actin Stress Fibers

We found PPM1F to not only affect the distribution of the positive integrin regulator Talin but also to be localized along the actin cytoskeleton together with the negative regulator and actin crosslinking protein FilaminA (Fig. 17A, first and second row). The inactive β1 integrin (Mab13 staining) was found to localize within membrane ruffles and focal adhesion sites (Fig. 17B, C) and surprisingly along actin stress fibers co-localizing with PPM1F and FilaminA (Fig. 17A, first and third row). Interestingly, inactive β1 integrin observed along the actin cytoskeleton was expressed on the cell surface (Fig. 17B, third row, without permeabilization (w/o perm.)), indicating that not only activated β1 integrin within focal adhesions is connected to filamentous actin (F-actin). Accordingly, active β1 integrin (9EG7 staining) was predominantly situated at cell- matrix contact sites lacking PPM1F (Fig. 17A, fourth row). PPM1F- and β1 integrin- depleted cells demonstrated antibody specificity (Fig. 17C- E).

35 2. Results

Figure 17. PPM1F co-localizes with inactive β1 integrin along actin stress fibers. A Control NHDFs were seeded onto 1 µg/ml fibronectinIII9-12 coated coverslips. Cells were double stained as indicated 1.5 hours post seeding and analyzed using wide field microscopy. The insets show higher magnification and the arrows indicate co-localization of PPM1F with FilaminA, the actin cytoskeleton (phalloidine) and the inactive β1 integrin (Mab13). The arrowhead demonstrates active β1 integrin within focal adhesions. Scale bar: 20 µm; Representative images of 2 experiments are shown. B Control cells were fixed 1.5 hours post seeding, treated with 0.2% TritonX100 (+perm.) or without (-perm.) and stained as indicated. Wide field analysis demonstrated distribution of the inactive β1 integrin along actin stress fibers (arrows) and in membrane ruffles (arrowhead). C Immunofluorescence staining of control and PPM1F knockdown NHDFs with a second anti-PPM1F antibody revealed staining specificity and localization of PPM1F along stress fibers (arrows). Simultaneous fixation and permeabilization of cells clearly discovered inactive β1 integrin to be also localized in focal adhesions (arrowhead). Scale bar: 20 µm. D Immunofluorescence staining of control and β1 integrin knockdown NHDFs for the inactive or active β1 integrin confirmed staining specificity. Scale bar: 20 µm. E Validation of an shRNA targeting β1 integrin was conducted in HEK cells. Cells were transduced with lentiviral particles encoding the shRNA or the control virus and whole cell lysates were subjected to western blot analysis.

36 2. Results

2.5. PPM1F Dephosphorylates T788/T789 within β1 Integrin Tail

Since loss of PPM1F led to pronounced clustered Talin-positive focal adhesions and PPM1F was found to co-localize with FilaminA, we assumed that PPM1F directly affects recruitment or binding of these regulators to integrins.

Wennerberg and colleagues could demonstrate via mutational studies that exchange of the threonine T788/T789 residues within β1 integrin tail to non-phospho-acceptor amino acids (TT/AA) resulted in impaired cell adhesion and integrin activity (Wennerberg, Fassler et al. 1998; Nilsson, Kaniowska et al. 2006). These residues are conserved throughout different β subunits and among various species demonstrating their particular need and function (Fig. 18A). We hypothesized that PPM1F directly dephosphorylates these residues and thereby possibly affects binding of regulators to integrins. In line with this hypothesis, phosphorylation of the threonine residues T788/T789 was increased in PPM1F-depleted HEK cells as well as NHDFs compared to control cells (Fig. 18B, C). To further clarify if PPM1F indeed could dephosphorylate β1 integrin, PPM1F and the phosphatase dead mutant PPM1FD360A were expressed in E. coli (Fig. 18E). First, the fluorogenic substrate 4-methylumbelliferyl phosphate (4-MUP) was employed to analyze the kinetics of the purified phosphatases clearly demonstrating enzymatic activity of the wildtype enzyme (Vmax= 0.1631 µmol/min/mg and Km= 1.324 mM) but no detectable phosphatase activity of the mutant (Fig. 18F). To test if PPM1F directly could dephosphorylate the threonine residues T788/T789, phospho-peptides corresponding to the last 22 amino acids of the β1 integrin tail were used in an in vitro phosphatase assay. Either double or single phosphorylated integrin peptides or single phosphorylated myosin light chain 2 (MLC2) peptide was incubated with the recombinant phosphatases. The double phosphorylated peptide was accepted as substrate but the single phosphorylated peptides were more effectively dephosphorylated by PPM1F whereas MLC2 could not serve as substrate. In contrast, PPM1FD360A mutant did not show enzymatic activity towards any of these substrates (Fig. 18D, G).

37 2. Results

Figure 18. β1 integrinTT788/789 is dephosphorylated by PPM1F. A Alignment of the C-terminal cytoplasmic tail of several β integrins among different species. The conserved NPxY motives (yellow) and the binding sites of Talin1 (red) and FilaminA (blue) are marked. The conserved threonine residues are depicted in red. B Phosphorylation of β1 integrinT788/T789 in a cellular context was determined by subjecting HEK whole cell lysates to western blot analysis and subsequent detection with a phosphorylation-specific anti-β1 integrinT788/T789 antibody. Densitometric analysis was done using ImageJ. The amount of phosphorylated integrin was normalized to total integrin expression. C Analysis of PPM1F knockdown NHDFs done as described for HEK cells in B. D Sequences of double or single phosphorylated integrin peptides as well as the single phosphorylated control peptide MLC2. E Recombinant GST-tagged PPM1F and mutant PPM1FD360A were expressed in E. coli, purified and analyzed via SDS-PAGE. F The activity of the enzymes was determined from the released Pi using the fluorogenic substrate 4-MUP. The indicated curves were obtained by a direct nonlinear fit of the data to

38 2. Results

Michaelis-Menten equation. G Single and double phosphorylated integrin peptides and single phosphorylated MLC peptide were incubated with 500 ng recombinant phosphatase for 1 hour at 30 °C. Malachite green was added and absorption was measured at 615 nm. Background values (puffer + malachite green) were subtracted. Bars represent mean ± SD of 3 independent experiments done in duplicate; unpaired t-test, *** p <0.001.

Not only recombinant PPM1F expressed in bacteria, but also phosphatase expressed and purified from HEK cells could efficiently dephosphorylate the conserved threonine residues T788/T789 within the β1 integrin tail with Vmax= 3.543 µmol/min/mg and Km= 88.83 µM (Fig. 19A-D).

Figure 19. PPM1F expressed and purified from HEK cells and its enzymatic activity. A Immunoblot of recombinant PPM1F wildtype and mutant probed with antibodies against GST. B Dephosphorylation of the indicated concentrations of the double phosphorylated β1 integrin peptide by 150 ng PPM1F. The indicated curve was obtained by direct fit of the data to Michaelis-Menten equation. C Double phosphorylated β1 integrin synthetic peptide was incubated with increasing amounts of GST-PPM1F, 200 ng GST-PPM1FD360A mutant or calf intestine alkaline phosphatase (CIAP) for 1 hour at 30 °C. Detection of free phosphate was conducted via the addition of malachite green and absorption was measured at 615 nm. Background values (puffer + malachite green) were subtracted. w/o: peptide without phosphatase. Shown are mean ± SD of 3 independent experiments; unpaired t-test, * p<0.05, ** p<0.01, *** p<0.001. D Double phosphorylated β1 integrin synthetic peptide was incubated with 100 ng GST-PPM1F or GST-

39 2. Results

PPM1FD360A for the indicated time periods at 30 °C. Detection of free phosphate was conducted via the addition of malachite green as described in C. E 50 ng of wildtype and mutant PPM1F were incubated with the indicated peptides. After 60 min malachite green was added and absorption measured as described in C.

Equivalent to the recombinant phosphatase, PPM1F purified from HEK cells also favored the single phosphorylated peptides compared to the double phosphorylated peptide. Again, loss of substrate activity was observed towards the phosphorylated MLC2 substrate (Fig. 19E).

It was reported before that T788/T789 residues within β1 integrin can be phosphorylated by some kinases such as the Ca2+/calmodulin-dependent protein kinase (CaMKII) (Suzuki and Takahashi 2003).

Figure 20. Dephosphorylation of the recombinant cytoplasmic domain of β1 integrin by PPM1F. A GFP-tagged constitutive active CaMKIIβT287D and the kinase dead mutant CaMKIIβK43R were expressed in HEK cells and pulled down via GFP immuno-precipitation. Kinases were either activated or not with

ATP, calmodulin, and CaCl2 and subsequently incubated with 2 µg of the recombinant GST-tagged

40 2. Results

cytoplasmic tail of β1 integrin (GST-β1-cyto) for 45 min at 30 °C. The reactions were stopped by addition of SDS-sample buffer and subjected to western blot analysis. Phosphorylation of β1 integtinT788/T789 was detected by a phosphorylation-specific anti-β1 integtinT788/T789 antibody. Overexpression of CaMKIIβT287D and CaMKIIβK43R in HEK cells was controlled via preparation of whole cell lysates and subsequent western blot analysis. B GFP-tagged CaMKIIβT287D was expressed in HEK cells, pulled down via GFP immuno-precipitation and incubated with the recombinant GST-tagged cytoplasmic tail of β1 integrin, the non-phosphorylatable β1TTAA mutant or GST, respectively. The reactions were stopped via addition of SDS-sample buffer and subjected to western blot analysis. Phosphorylation of β1 integtinTT788/789 was detected by a phosphorylation-specific anti-β1 integtinT788/T789 antibody. C CaMKIIβ phosphorylated β1 cytoplasmic tail was incubated with 2 µg recombinant GST-tagged PPM1F or PPM1FD360A mutant for 1 hour at 30 °C. The reactions were subjected to SDS-PAGE and immuno-blotted with the indicated antibodies.

Constitutive active CaMKIIβT287D expressed in HEK cells could indeed phosphorylate the recombinant GST-tagged cytoplasmic tail of β1 integrin in an in vitro kinase assay, whereas the kinase dead mutant CaMKIIβK43R did not show enzymatic activity (Fig. 20A). Using the mutated integrin tail T788A/T789A as control clearly demonstrated specific phosphorylation of these threonine residues (Fig. 20B). Purified PPM1F not only dephosphorylated the short phospho-peptides engaging just a part of the cytoplasmic tail of β1 integrin, but was also still active towards a CaMKIIβ phosphorylated β1 integrin GST-fusion protein comprising the whole cytoplasmic domain (Fig. 20C).

2.6. Dephosphorylation of β1 IntegrinT788/T789 Affects Binding of the Integrin Regulators FilaminA and Talin

We observed that loss of PPM1F led to a redistribution of the positive regulator Talin to pronounced peripheral focal adhesions together with a clear co-localization of PPM1F with the negative regulator FilaminA. Furthermore the phosphorylation state of T788/T789 of β1 integrin was enhanced in PPM1F-depleted cells. Thus, we speculated that PPM1F might act upon integrin activity via modulating the binding site for Talin and FilaminA. Accordingly, immuno-precipitation of GFP-tagged β1 integrin overexpressing control and PPM1F knockdown cells revealed association of PPM1F with the β1 integrin cytoplasmic domain (Fig. 21A). Obviously binding of Talin to the β1 integrin cytoplasmic tail in PPM1F-depleted cells was enhanced, whereas association of FilaminA was impaired (Fig. 21A).

41 2. Results

Figure 21. β1 integrin phosphorylation state affects binding of adapter proteins. A GFP-tagged β1 integrin or the empty vector were expressed in control and PPM1F knockdown HEK cells and pulled down via GFP immuno-precipitation. Co-precipitated proteins were detected with the indicated antibodies. Quantification of proteins associated with β1 integrin was conducted via densitometric analysis using ImageJ. The background signals (empty vector transfected cells) were subtracted and values were normalized to amount of precipitated β1 integrin.

To further clarify if the altered binding capability of these two proteins is indeed caused and affected by different phosphorylation profiles, GST-tagged wildtype, pseudo- phosphorylated (T788D/T789D), and non-phosphorylatable (T788A/T789A) mutants of the β1 integrin cytoplasmic domain were spotted on microarray glass slides. The immobilized recombinant proteins were incubated with lysates overexpressing either GFP alone or the GFP-tagged integrin binding domains of FilaminA (Ig domains 19-21). The FilaminA Ig domains 19-21 clearly bound to the wildtype as well as to the non- phosphorylatable TT/AA mutant, whereas association with the pseudo-phosphorylated integrin version was completely reduced to background values (Fig. 22A-C). Modelling of the two phospho-threonine residues T788/T789 of β1 integrin together in complex with FilaminA Ig21 domain (modified from (Kiema, Lad et al. 2006): PDB 2BRQ) showed electrostatic clashes with negatively charged areas on the FilaminA surface, explaining how integrin tail phosphorylation could prevent FilaminA binding (Fig. 22D, E).

In contrast to FilaminA binding that is negatively affected by threonine phosphorylation, Talin seems to prefer binding to the phosphorylated integrin tail. The Opa protein triggered integrin clustering (OPTIC) approach was used to investigate the effect of PPM1F on the Talin-β1 integrin interaction.

42 2. Results

Figure 22. β1 integrin T788D/T789D substitution negatively affects FilaminA binding. A GST alone or GST-tagged wildtype, pseudo-phosphorylated (T788D/T789D), and non-phosphorylatable (T788A/T789A) mutants of the β1 integrin cytoplasmic tail were spotted in dodecaplicates onto glutathione-modified glass slides. The immobilized recombinant proteins were incubated overnight at 4 °C with whole cell lysates from HEK cells either expressing GFP as control or the GFP-tagged integrin binding domains of FilaminA (IgFLN domains 19-21). The slides were intensively washed and bound proteins were detected by GFP immuno-staining. Fluorescence intensities were normalized to the amount of spotted GST-protein. Bars represent mean ± SD of 3 independent experiments; One-way ANOVA, Bonferroni Test; ** p<0.01, *** p<0.001. B HEK cells were transfected as indicated and whole cell lysates were analyzed via western blotting. The amounts of the recombinant GST-fusion proteins were analyzed by SDS-PAGE. C The spotting layout is depicted at the left hand side and representative spots after GFP immuno-staining are shown at the right hand side. D Model of β1 integrin cytoplasmic tail-IgFLNa21 complex modified from (Kiema, Lad et al. 2006) using PyMOL. The accessible surface is colored according to the electrostatic surface potential (blue representing positive charges and red representing negative charges). The β1 peptide is shown as white band on the FilaminA surface; Threonine residues are colored in green, phospho-residues are shown as red sticks. Detail views are shown in E.

The chimeric OPTIC construct consist of the cytoplasmic domain of β1 integrin (INTB-C) and the transmembrane and extracellular part of the CEACAM3 (CC3) receptor, that upon infection with Opa-expressing Neisseria gonorrhoeae (Ngo) induces an

43 2. Results

intracellular clustering of INTB-C and the subsequent recruitment of Talin to sites of bacterial attachment (Fig. 23A).

Figure 23. β1 integrin tail phosphorylation affects binding of Talin. A Schematic representation of the chimeric OPTIC construct consisting of the cytoplasmic domain of β1 integrin and the transmembrane and extracellular domain of the CEACAM3 receptor. Receptor clustering is triggered by binding of the N. gonorrhoeae Opa protein to the extracellular CC3 part. B HEK cells were triple transfected with the corresponding OPTIC construct β1 wildtype or β1T/D mutant, Talin-GFP, and mCherry-tagged PPM1F wildtype or D360A mutant, respectively. The cells were seeded onto Poly-L-lysine-coated coverslips and incubated with N. gonorrhoeae with a MOI (multiplicity of infection) of 40 for 1 h. Cells were fixed, stained for CC3 and analyzed in a blinded fashion using confocal microscopy. Arrows indicate enlarged areas; arrowheads demonstrate same observation within one cell. Scale bar: 10 µm. C Model of β1 integrin cytoplasmic tail-Talin F2-F3 domain complex modified from (Anthis, Wegener et al. 2009) using PyMOL. The accessible surface is colored according to the electrostatic surface potential (blue representing positive charges and red representing negative charges). The β1 peptide is shown as white band (yellow represents the crystalized β1D structure) on the Talin2 surface; Threonine residues are colored in green, phospho-residues are shown as read sticks. Detail view is shown in D.

44 2. Results

Talin recruitment to the clustered β1 integrin tail could be overserved in several cells that additionally overexpress an empty vector control or the PPM1FD360A phosphatase dead version (Fig. 23B, first and third row). In contrast, a Talin-β1 integrin interaction could not be detected in any of PPM1F wildtype overexpressing cells (Fig. 23B, second row), however this effect was abolished when the pseudo-phosphorylated OPTIC β1T/D construct was used (Fig. 23B, fourth row), indicating that the enzymatic activity of PPM1F is needed to displace Talin from the integrin cytoplasmic tail.

Modelling of the phosphorylated threonine T788/T789 residues of β1 integrin in complex with Talin2 F2-F3 domain (modified from (Anthis et al. 2009): PDB 3G9W) illustrated a positively charged pocket encompassing K337, K405 and K406 on the surface of Talin2. The phosphorylated threonine residues within β1 integrin were in close proximity to the positively charged pocket and demonstrate how phosphorylation could support binding of the regulator Talin to integrin (Fig. 23C, D).

2.7. PPM1F Knockout Leads to Developmental Defects and Embryonic Lethality at E10.5 in Mice

We identified the PPM1F phosphatase acting like a molecular switch that conducts binding of integrin regulators to their target. Affecting integrin activity in vitro we further wanted to evaluate PPM1F role in vivo where maintenance of tissue integrity is indispensable. Thus, mice harboring a gene trap mutant for the PPM1F gene were obtained from the Jackson Laboratory. A bacterial lacZ gene was inserted into the PPM1F gene locus such that the endogenous gene promoter drives expression of β- galactosidase (Fig. 24A).

45 2. Results

Figure 24. PPM1F gene trap mutant mice locus. A Schematic representation of the wildtype and targeted null PPM1F locus. Insertion of a lacZ-neomycin-resistance cassette into exon 4 resulted in gene disruption as well as expression of β-galactosidase under the control of the endogenous PPM1F gene promotor. The primers used for genotyping are shown in blue and the resulting PCR fragments in red. E: Exon number; P1: Gene specific primer forward; P2: Gene

specific primer reverse; P3: Targeted primer forward; dashed line: endogenous locus; solid line: targetingkänguru vector. A representative genotyping PCR is shown; WT: wildtype allel; Tg: targeted Allel. B BL.6 wildtype and heterozygous PPM1F+/- mice were mated and their offspring was analyzed. Mice were genotyped post weaning by PCR using DNA extracted from tail biopsies.

Intercro sses of wildtype and heterozygous PPM1F+/- mice identified both genotypes in the expected 50:50 ratio post weaning (Fig. 24B). LacZ staining of cryosections collected from several tissues of adult mice revealed nearly ubiquitous PPM1F promotor activity. Strong β-galactosidase expression was detected in brain, especially in the cortex and the hippocampus (Ammon’s horn pyramidal layer and Dentate gyrus granule cell layer), kidney mainly in the glomerulus, and lung, moderate expression was seen in skin and spleen, and weak expression in thymus, liver, heart, and skeletal muscle (Fig. 25A).

46 2. Results

Figure 25. PPM1F promoter is active in various tissues in adult mice. A Cryosections were made from several tissue including brain, heart, kidney, liver, lung, muscle, skin, spleen, and thymus from adult (> 8- week-old) female wildtype and PPM1F+/- mice. 10 µm thick sections were prepared and stained for β- galactosidase activity.

During embryonic development 10.5 days after conception, the PPM1F promotor was active in multiple tissues like branchial arch, heart, liver, and forebrain (Fig. 26A, B). PPM1F was also expressed in mouse embryonic stem cells and strongly in neuronal stem cells (Fig. 26C). Interestingly, mating of heterozygous mice could not identify homozygous PPM1F-/- offspring perinatal or post weaning. The genotypic ratio of 36:64 wildtype to heterozygous animals suggested embryonic lethality (Fig. 26D). Also, prenatal genotyping of E12.5, E13.5 and E14.5 embryos could not identify PPM1F knockout embryos within the second half of embryogenesis indicating severe developmental defects encompassed by the loss of PPM1F (Fig. 26E).

47 2. Results

Figure 26. PPM1F is expressed in multiple organs during embryogenesis and its complete loss leads to embryonic lethality. A Whole-mount X-gal staining and 14 μm thick sagittal sections of wildtype and PPM1F+/- embryo at E10.5 showing PPM1F promoter activity in various tissues; Scale bar: 500 µm. Details are shown in B. BA: branchial arch; H: heart; Hb: hindbrain; Li: liver; Mc: mesencephalon NL: neural lumen; NT: neural tube; TC: telencephalon. Scale bar: 150 µm. C Whole cell lysates kindly provided by Susanne Kirner and Marcel Leist of mouse embryonic stem cells (mESC), mouse neuronal stem cells (mNSC), mouse astrocytes and MEFs were analyzed by western blotting and stained as indicated. D PPM1F+/- mice were mated and their offspring was analyzed. Pups died after birth and post weaning were genotyped via PCR using DNA extracted from tail biopsies. E PPM1F+/- mice were mated and embryos were isolated and genotyped 12.5, 13.5 and 14.5 days post coitus.

48 2. Results

2.8. PPM1F Knockout Embryos Exhibit an Abnormal Forebrain Structure

We observed that the complete genetic deletion of PPM1F led to serious developmental defects and embryonic lethality. Additionally, E10.5 heterozygous PPM1F+/- embryos obviously displayed a strong PPM1F promoter activity in neuronal tissues especially in the rostral and caudal regions of the telencephalon (Fig. 26B and 27A, B), indicating that PPM1F might affect proper brain development. Accordingly, we could identify homozygous PPM1F knockout embryos at E10.5, the time point where the process of cortex formation is initiated. Not only PCR-based genotyping of mouse embryonic fibroblasts (MEFs) isolated from E10.5 embryos but also the generation of a polyclonal antibody directed against the murine PPM1F were used to identified PPM1F knockout embryos (Fig. 27C-E). Compared to wildtype or heterozygous ones PPM1F-/- embryos were roughly two times smaller in size and apparently displayed a stunted telencephalon organization. Histological analysis via H&E staining of paraffin embedded tissue sections disclosed a disturbed delimitation of the pia mater and the neuroepithelial cells within the ventricular zone in PPM1F-depleted embryos (Fig. 27E). Around E10.5 the formation of the cortex is triggered by neuroepithelial cells within the ventricular zone of the forebrain. Cell division of these neural progenitors is the initial point for the generation of the six cortical layers. Normally, these neuroepithelial cells form a parallel and regularly spaced scaffold that terminates in well-defined endfeet at the pial surface. Nestin staining of PPM1F knockout embryos revealed that this defined organization and orientation of neural progenitor cells within the ventricular zone of the caudal telencephalon was disordered compared to heterozygous embryos (Fig. 27F). Also, staining for the basement membrane protein laminin, separating the meningeal epithelium from the ventricular zone, clearly highlighted a contorted basal lamina in PPM1F-depleted embryos (Fig. 27F). Taken together these findings suggest that PPM1F has an essential role in proper cortex formation during embryonic development.

49 2. Results

Figure 27. Loss of PPM1F leads to brain developmental defects. A Whole-mount X-gal staining and central sagittal sections of PPM1F+/- embryo showing strong β-galactosidase expression in rostral region of the telencephalon. Scale bar: 500 µm. Detail view is shown in B. FV: forebrain vesicle; NL: neural lumen; NT: neural tube; TC: telencephalon. Scale bar: 150 µm. C Macroscopically evaluations of PPM1F-/- embryo display a stunted telencephalon at E10.5. D MEFs isolated from embryos at E10.5 were used to extract genomic DNA. The genotyping PCR identified wildtype, heterozygous and homozygous PPM1F knockout embryos at E10.5. E Stereomicroscopic pictures of PPM1F+/- and PPM1F-/- embryos are shown at the left hand side. Histological samples were fixed in Bouin’s fixative and embedded in paraffin. 3 μm thick sagittal sections were prepared and stained with H&E. Middle panel: overview, scale bar 500 µm; right panel: detail view, scale bar 50 µm. Left over tissue pieces (of IHC analysis  F) were thawed, intensively washed in PBS, boiled in SDS sample buffer and subjected to western blot analysis. F 10.5 dpc embryos were dissected, fixed overnight in 4 % PFA, cryo-protected and embedded in O.C.T. Tissue-Tek. 12 μm 50 2. Results

thick sagittal sections were prepared and IHC of nestin and laminin in PPM1F+/- and -/- embryos was conducted. a-d: overview, scale bar 500 µm; a’-d’: detail view, scale bar 50 µm.

2.9. PPM1F Knockout Fibroblasts Display Enhanced β1 Integrin Activity and β1 Integrin Tail Phosphorylation

Equivalent to results obtained from knockdown HEK cells and NHDFs, fibroblasts isolated from PPM1F knockout embryos 10.5 day after conception (Fig. 27C, D) showed pronounced Talin-positive focal adhesions in the cell periphery consistent with an intense staining for active β1 integrin (Fig. 28A, B).

Figure 28. Gene depletion of PPM1F in fibroblast leads to enhanced integrin affinity and integrin tail phosphorylation. A Whole cell lysates of MEFs isolated from wildtype and PPM1F knockout embryos 10.5 dpc were subjected to western blot analysis and stained as indicated. B Wildtype and PPM1F-/- cells were seeded onto fibronectin (1μg/ml FNIII9-12) coated coverslips for 1 hour. Cells were fixed, stained as indicated and analyzed using wide field microscopy. Insets: Higher magnification; Scale bar: 20 µm C Cells were trypsinized, fixed and either directly stained for total and active β1 integrin or incubated for 15 minutes with 10μg/ml FNIII9-12. Stained cells were analyzed by flow cytometry analysis, 10000 counts. Background values were subtracted from each cell line and MFI was normalized to staining of wildtype

51 2. Results

cells. Bars represent mean ± s.e.m. of 3 independent experiments; unpaired t-test, ** p<0.01. D Whole cell lysates of MEFs isolated from different wildtype PPM1F+/+ embryos 10.5 dpc were analyzed via western blotting and integrin T788/T789 phosphorylation was compared to PPM1F-/- fibroblasts. Densitometric analysis was performed by using ImageJ. The amount of phosphorylated integrin was normalized to total integrin expression.

In line with the enrichment of the positive integrin regulator Talin in focal adhesions quantification of active β1 integrin (9EG7 staining) in PPM1F-depleted fibroblasts also revealed enhanced integrin activity compared to wildtype cells (Fig. 28C). Comparing integrin tail phosphorylation of different wildtype fibroblasts to PPM1F-depleted fibroblasts -all isolated from embryos at E10.5- clearly demonstrated elevated levels of phosphorylated T788/T789 residues within knockout cells while total integrin levels were not modified (Fig. 28D).

2.10. Re-Expression of Wildtype but not the Inactive PPM1F in Knockout Fibroblasts Restores Cell Migration Potential

Western blot analysis clearly demonstrated endogenous PPM1F expression in wildtype mouse embryonic fibroblasts. Accordingly, no expression was detected in knockout cells. PPM1F-depleted cells were successfully reconstituted with the human wildtype or the enzymatic dead mutant PPM1FD360A (Fig. 29A). Importantly, levels of the relevant integrin regulator proteins Talin and FilaminA were not affected (Fig. 29B). Recently, it was reported by Hoon and colleagues (Hoon et al. 2014) that reduction in PPM1F protein expression is accompanied by increasing levels of dynein light intermediate chain 2 (LIC2). LIC2 is a component of the cytoplasmic dynein 1 complex and changes in LIC2 expression levels affect proper centrosome orientation and in turn influences effective cell migration (Schmoranzer et al. 2009). Western blot analysis of wildtype, PPM1F knockout and re-expressing cells revealed no changes in LIC2 expression levels excluding LIC2-dependent migratory effects (Fig. 29B). Tracking of single cells revealed that the velocity of cell migration and the resulting distance was impaired in PPM1F depleted fibroblasts compared to control cells. Re-expression of the enzymatic active phosphatase in knockout cells could restore migration capability whereas

52 2. Results

complementation with the phosphatase dead mutant D360A could not rescue this effect. In contrast to migration distance and velocity cell migration directionality was not affected (Fig. 29C).

Figure 29. Depletion of PPM1F in fibroblasts impairs cell migration capability. A PPM1F+/+ (wildtype) and PPM1F-/- cells were transduced with lentiviral particles encoding for the empty pUltra expression vector (GFP expression). PPM1F-/- cells were further transduced with lentiviral particles encoding for the bi-cistronic expression of the human PPM1F gene (hWT) or the inactive PPM1FD360A (hDA) version and the GFP reporter gene. Transduced cells were enriched via fluorescence-activated cell sorting and whole cell lysates were analyzed via western blotting. B Expression of focal adhesion proteins in wildtype, PPM1F -/- and re-expression cells was evaluated by western blot analysis. C Wildtype, PPM1F knockout and re-expressing MEFs were serum starved overnight. Upon FCS stimulation cells were monitored every 30 minutes for 12 hours using time-lapse microscopy. Single cells were tracked and the covered distance, velocity or directionality was analyzed using ImageJ. Shown is mean ± s.e.m. of 3 independent experiments. Samples were done in duplicates each n=15; Unpaired t-test, * p<0.05, *** p<0.001.

53 2. Results

2.11. PPM1F+/- Mice Exhibit Reduced PPM1F Brain Expression and Display Increased Activity in a 1 h Open Field Test

A genome-wide association study identified a single-nucleotide polymorphism (SNP) in the PPM1F promoter to be associated with attention-deficit/hyperactivity disorder (ADHD) (Lesch et al. 2008). Previous studies have shown that SNPs in promoter regions can affect promoter activity thus leading to reduction in protein expression levels. On the basis that the identified SNP in the PPM1F promoter region leads to a decline in protein expression heterozygous PPM1F+/- mice were considered for being a promising model to study protein level-based behavioral effects. To first clarify if the absence of one functional ppm1f gene in PPM1F+/- mice indeed affects protein expression levels, brain tissue samples were collected from 3-4 month old mice. Subjecting the brain tissue homogenates of wildtype and PPM1F+/- mice to western blot analysis clearly demonstrated reduced protein expression in mice lacking one ppm1f gene (Fig. 30A).

Figure 30. PPM1F+/- mice show behavioral differences accompanied by reduced PPM1F brain expression. A Extract from brain homogenates were prepared from 3-4 months old wildtype and PPM1F+/- mice, subjected to western blot analysis and probed with the indicated antibodies. B 3-4

54 2. Results

months old male wildtype and PPM1F+/- mice were dropped in the center of an arena and the behavior was recorded for 1 hour. The mean path length was analyzed after 15 min, 30 min and 60 min using EthoVision XT software. C The heat maps represent the distribution of the mice within the arena to the indicated time points. D The rearing behavior was manually counted by two observers blinded to the genotype of the mice. Unpaired t-test, shown are mean ± s.e.m. n=5, * p<0.05.

Since the complete loss of PPM1F affects embryonic brain development it was speculated that the reduced PPM1F brain expression might also have consequences on proper brain functions in adult mice and thus influencing their behavior. To this end, 3-4 months old male wildtype and PPM1F+/- mice were analyzed in a 1-h open field test. Every morning at the same time one wildtype and one heterozygous PPM1F+/- mouse were dropped into the center of an individual arena (60 x 40 x 40 cm) and recorded for 1 hour. Analyzing the total distance covered after different time points clearly showed a tendency of PPM1F+/- mice to move more than wildtype animals (Fig. 30B). Regarding the distribution of the mice within the arena such as the time spent in the center also revealed that PPM1F+/- mice exhibit a reduced anxiety-related behavior compared to wildtype littermates. Heterozygous mice often crossed or stayed within the center, whereas wildtype animals avoided the open field and preferred to walk along the arena walls or stayed within the corners (Fig. 30C). Additionally, two observers blinded to the genotype of the mice manually counted the number of rears within the first 10 minutes. Regarding the number of unsupported rears heterozygous PPM1F+/- mice showed again increased activity and exploratory behavior compared to wildtype littermates (Fig. 30D), indicating that PPM1F also supports brain functions in adult mice.

Figure 31. Reduced PPM1F brain expression levels in heterozygous mice does not affect brain mass. A 3-4 months old male wildtype and PPM1F+/- mice display similar body weight. Unpaired t-test,

55 2. Results

shown is mean± s.e.m; n=5; ns: not significant. B Brains of 3-4 months old male wildtype and PPM1F+/- mice were isolated, weighted, and photographed. Scale bar: 1 cm.

Evaluating the body weight as well as the brain mass disclosed no differences between wildtype and heterozygous animals (Fig. 31A, B), suggesting that behavioral changes might originate from brain structural discrepancies.

56 3. Discussion and Outlook

3. Discussion and Outlook

3.1. PPM1F: The Molecular Switch to Inactivate Integrins

This work sought to learn more about the activity regulation of integrins and in particular about the transition from their active to their inactive state. The cytoplasmic tail of integrins represents a small but efficient platform to control integrin activity by providing binding sites for numerous proteins. In turn, association of distinct proteins with the intracellular part of integrins can either stabilize or destabilize their active or inactive conformation, respectively. These various kinds of interactions obviously need a spatiotemporal regulation. Based on previous reports in the literature, we hypothesized that phosphorylation is a promising mechanism controlling protein binding to integrins, thereby regulating integrin activity. Indeed, several studies already pointed to the phosphorylation of integrins themselves as well as phosphorylation of integrin regulating proteins as a mechanism to modulate the activity of these receptors (Wennerberg, Fassler et al. 1998; Bledzka, Bialkowska et al. 2010; Millon-Frémillon, Brunner et al. 2013). Interestingly, in the recent years several kinases have been identified, which either directly or indirectly influence integrin function (Stawowy, Margeta et al. 2005; Gawecka, Young-Robbins et al. 2012). Since their antagonists, the protein phosphatases have long been considered to play only an unspecific role in maintaining phospho-protein homeostasis, little is known about their function in integrin activity control. Thus, we expected phosphatases for being a promising class of proteins, which can affect integrin activity in a negative manner.

In a gain of function screen we hypothesized that depletion of a negative regulator of integrins should result in increased integrin activity and being translated into enhanced cell adhesion capability. We met this goal by identifying the serine/threonine phosphatase PPM1F negatively affecting integrin-mediated cell adhesion. Knockdown of PPM1F in different cell types led to increased cell adhesion (Fig. 13C, 14A-C) accompanied by elevated levels of active β1 integrin (Fig. 15A-B, 28C). In contrast to reduced β1 integrin expression in PPM1F knockdown cancer cells reported by Susila and colleagues (Susila, Chan et al. 2010), we could not detect changes, neither in total integrin expression nor in the presence of integrins on the cell surface (Fig. 14D, E).

57 3. Discussion and Outlook

In line with increased integrin activity, a pronounced clustering of the integrin activating protein Talin in focal adhesions was detected in PPM1F-depleted cells, similar to observations made in FilaminA knockdown cells. Additionally, loss of PPM1F led to the extinction of central focal adhesions, also reported by Koh and colleagues (Zhang, Guo et al. 2013), but in return to an enrichment of peripheral ones, indicating that PPM1F may also affect focal adhesion turnover (Fig. 16A, 28B).

Interestingly, we further observed PPM1F to co-localize with the known negative integrin regulator FilaminA along actin stress fibers (Fig. 17A). Surprisingly, we not only found the inactive β1 integrin to be located in membrane ruffles, which was reported by other groups before (Rantala, Pouwels et al. 2011), but also to be distributed in focal adhesions as well as along actin stress fibers (Fig. 17A-C). Both, PPM1F and FilaminA were observed to co-localize with the inactive β1 integrin along the actin cytoskeleton. All to date identified negative regulators of integrins have never been found to localize with integrins within focal adhesions. Two other integrin inactivating proteins SHARPIN and ICAP1 have been described to accumulate with the inactive integrin in actin-positive ruffles that are not bound to the ECM. These proteins seems to co-localize with integrins and stabilize their “off” state until their recruitment to focal adhesions (Fournier et al. 2002; Rantala, Pouwels et al. 2011) and probably keeping integrins uncoupled from actin. Bouvard and colleagues speculated that this might enable integrin movement to the leading edge of migrating cells, where activation with subsequent adhesion to the substrate and connection to the actin cytoskeleton takes place (Bouvard, Pouwels et al. 2013). Not only activated β1 integrin within focal adhesion is linked to F-actin, but also inactive β1 integrin appears to be connected to F-actin. Accordingly, it was demonstrated that the actin-based motor protein myosin-X provides a motor-based link between integrins and the cytoskeleton via binding with its FERM domain to the proximal NPxY motif within the β integrin subunit and via its motor domain to F-actin (Zhang et al. 2004). Since the binding site of FilaminA engages the inter-NPxY region (Kiema, Lad et al. 2006), it is plausible that both proteins can bind in parallel to the cytoplasmic tail of the β subunit and thereby on the one hand preserve the integrin “off” state and on the other hand transport these receptors to focal adhesions where they finally get activated. Equivalent to SHARPIN and ICAP1 found within membrane ruffles, FilaminA prevents integrin activation as well but we assume that this interaction and

58 3. Discussion and Outlook inhibition takes place throughout the whole cell body at sites where ligand-unoccupied integrins are connected to the actin cytoskeleton. Due to the fact that we also observed PPM1F to co-localize with FilaminA and the inactive integrin, we speculated that PPM1F might regulate this interaction thereby modulating integrin activity (Fig 32).

Figure 32. Model of the subcellular distribution of the inactive β1 integrin summarizing this study’s findings. The inactive β1 integrin is located within membrane ruffles, focal adhesions and along the actin cytoskeleton. Within the lamellipodium the inactive conformation of integrins is stabilized by the negative regulators SHARPIN and ICAP1. It is hypnotized that the inactive integrin on the cell surface is potentially transported by the interaction with myosin-X to focal adhesion. In parallel, the inactive conformation of β1 integrin is stabilized by PPM1F-mediated T788/T789 dephosphorylation and putative FilaminA binding. The inactive conformation of integrins within focal adhesions is potentially preserved by an unknown inactivator.

However, several studies exist that propose another model how inactive integrins are delivered to focal adhesions. It was demonstrated that upon integrin internalization, activators dissociate from integrin cytoplasmic tails and are replaced by sorting nexin 17 in early endosomes, preventing integrins from degradation. The inactivated integrins are finally transported in recycling vesicles back to the membrane to newly forming focal adhesions (Bottcher et al. 2012). Combining both proposed models how inactive

59 3. Discussion and Outlook integrins are delivered to focal adhesions, one could speculate that upon integrin internalization, inactive integrins are packed in recycling vesicles and transported back to the membrane. There, inactivated integrins are potentially stabilized by FilaminA and bound by myosin-X to be transported within the membrane alone actin stress fibres back to focal adhesions. PPM1F, also observed to localize at the actin cytoskeleton, could be responsible to ensure proper FilaminA-integrin binding.

Accordingly, we found PPM1F to directly dephosphorylate the conserved threonine residues 788 and 789 within the β1 integrin tail in vitro (Fig. 18G, 20C). However, the control substrate MLC2, also an actin associated protein involved in cell adhesion and migration, could not or just very poorly be dephosphorylated, demonstrating that the recombinant PPM1F not only receives substrate selectivity in vivo. We further observed PPM1F to affect integrin tail phosphorylation in a cellular context. Knockdown or the complete genetic deletion of this phosphatase in different cell types led to strongly enhanced integrin T788/T789 phosphorylation (Fig. 18B-C, 28D). Asking if indeed phosphorylation of the cytoplasmic tail of β1 integrin alters binding of integrin regulating proteins, we found an increased association of Talin with the precipitated β1 integrin in PPM1F-depleted cells, whereas the integrin-FilaminA interaction was in turn reduced (Fig. 21A). These results suggest that PPM1F might affect integrin activity by dephosphorylating the conserved cytoplasmic threonine residues within β1 integrin thereby providing a suitable binding site for the negative regulator FilaminA. Similar to observation made for the β2 and β7 integrin (Kiema, Lad et al. 2006; Takala, Nurminen et al. 2008), we discovered that substitution of T788/T789 within the β1 integrin tail to phospho-mimicking aspartic acid residues (TT/DD) strongly impaired binding of FilaminA. However, FilaminA binding to the wildtype β1 integrin cytoplasmic tail as well as to the mutated non-phospho-acceptor amino acids version (TT/AA) did not show any differences (Fig. 22A). This finding fits to the assumption that recombinant expressed wildtype β1 integrin will not receive post-translational modifications. Interestingly, Kiema and colleagues could demonstrate that phosphorylation of T784 within β7 integrin had the most severe effect on FilaminA binding (Kiema, Lad et al. 2006). This residue corresponds to the second threonine residue T789 within β1 integrin and was most efficiently dephosphorylated by PPM1F.

60 3. Discussion and Outlook

Using the OPTIC approach we could further demonstrate that not only FilaminA binding is affected by integrin phosphorylation but also Talin is likely to be regulated in a phospho-dependent manner. Overexpression of PPM1F in HEK cells clearly demonstrated the displacement of Talin from its integrin interacting site; this effect could not be observed when the phosphatase dead D360A mutant was overexpressed or when the pseudo-phosphorylated OPTIC β1T/D construct was used (Fig. 23B). These findings strongly suggest that potential scaffold functions of PPM1F are not sufficient but that its enzymatic activity is needed to displace Talin from its integrin binding site. However, the structurally defined FilaminA binding region overlaps with the binding site of Talin and thus, leads to a competition between both proteins for integrin tail association. Therefore, it is not clear if Talin binding to β1 integrin is stabilized by phosphorylation or if the altered Talin-integrin interaction is just an indirect effect due to the displacement of FilaminA. However, modelling the integrin β1 phospho-threonine residues on the surface of the Talin2 F2-F3 domain suggests how phosphorylation could support and stabilize binding of Talin to the integrin cytoplasmic domain. A positively charged pocket involving K337, K405 and K406 on the Talin2 surface could bind the negative phospho-residues and in turn boost integrin binding (Fig. 23C, D). Notably, these lysine residues are highly conserved within the two talin genes (TLN1 and TLN2) and throughout various species (Fig. 33), supporting the idea that they could be involved in proper integrin interaction.

Figure 33. Talin sequence alignment. Sequences of the C-terminal part of the F3 domain of Talin1 and Talin2 throughout different species are depicted. The conserved lysine residues K337, K405 and K406 of the murine Talin2 used for crystallization (Anthis, Wegener et al. 2009) are marked in red.

Although this model would nicely fit our hypothesis that not only FilaminA but also Talin binding is affected by T788/T789 phosphorylation, it has to be considered that the crystal structure of Talin2-β1D integrin is solved up to the inter-NPxY region. For the

61 3. Discussion and Outlook last C-terminal amino acids no secondary structure is assigned, indicating that these amino acids appear to be free rotatable. Thus, the proposed model has to be further tested for example by mutating the conserved lysine residues and evaluating if this indeed affects Talin-integrin binding in a negative manner.

We further observed that depletion of PPM1F not only led to enhanced integrin tail phosphorylation in different cell types but PPM1F was also found to interact with the cytoplasmic tail of β1 integrin in HEK cells. This was on the one hand verified by the immuno-precipitation experiment and on the other hand by the OPTIC approach, strongly indicating that integrin T788/T789 is no unspecific, less meaningful in vitro target, but indeed exhibits physiological relevance (Fig. 21A, 23B). Furthermore, it suggests that T788/T789 is most likely a direct substrate of PPM1F and that the increased T788/T789 integrin phosphorylation in PPM1F knockdown cells is not due to activity changes of other signaling molecules. Nevertheless, it has to be considered that the PPM1F substrate CaMKII is also one of the kinases that have been identified to phosphorylate the threonine residues within β1 integrin tail in vitro. Hence, it can be assumed that PPM1F not only affects integrin activity in a direct manner but also indirectly through the inhibition of the corresponding kinase which among others seems to be responsible for the phosphorylation of the cytoplasmic tail of β1 integrin. Interestingly, regarding the OPTIC approach we only observed the phosphatase dead mutant PPM1FD360A to associate with the clustered cytoplasmic tail of β1 integrin, suggesting that this PPM1F version might function as a trapping mutant. Actually serine/threonine phosphatases are not amenable to substrate-tapping mutant strategies, which have been successfully used for cysteine-dependent PTPs only. As an example, mutation of the nucleophilic cysteine to a serine residue within the catalytic center or changing the aspartic acid within the WPD loop results in substrate trapping versions in many PTPs (Xie et al. 2002). In contrast, serine/threonine phosphatases catalyze dephosphorylation through a different mechanism by the coordination of metal ions and are thus inapt for such trapping strategies. However, Takekawa and colleagues found that substitution of a conserved argine195 for alanine in the catalytic domain of the serine/threonine phosphatase PP2Cα2 inactivated this enzyme without affecting its substrate binding capability. They further observed that the catalytically inactive PP2Cα2 bound more efficiently to its substrate than the fully active enzyme, suggesting

62 3. Discussion and Outlook that this mutation generated a substrate-trapping-like phosphatase (Takekawa et al. 1998). A mutational study with the C. elegans Fem2 phosphatase, the homolog of PPM1F, suggested that the corresponding arginine substitution inactivates the phosphatase without affecting its structure (Chin-Sang and Spence 1996). This arginine residue (R326 in the human PPM1F) as well as an aspartic acid (D360 in the human PPM1F) are highly conserved through different PP2C family members and among various species and have been linked to phosphate binding and metal ion coordination. It is possible that both substitutions lead to substrate-trapping-like mutants that bind to but are not able to dephosphorylate and release their substrate. Integrin immuno-precipitation experiments with PPM1F wildtype and PPM1FD360A overexpressing cells would probably co-precipitate more mutant phosphatase than wildtype enzyme. In contrast to the mutated PPM1FD360A the wildtpye PPM1F was almost never found to localize with the cytoplasmic tail using the OPTIC approach, explicable by the fact that dephosphorylation is a highly dynamic and rapid process, taking as little as a few seconds.

Together these data established PPM1F as a new negative regulator of β1 integrin activity. PPM1F directly acts on the integrin tail phosphorylation status in order to provide an appropriate binding site for the negative integrin regulator FilaminA and, in turn, the displacement of the integrin activating protein Talin, thereby stabilizing the integrin “off” state (Fig. 34).

63 3. Discussion and Outlook

Figure 34. Model summarizing this study’s findings. A In wildtype cells a balanced ratio of active and inactive integrins is preserved by the interplay of a single or several kinase/s (potentially CamKII and/or PKC) and PPM1F. Phosphorylation of integrin T788/T789 seems to stimulate Talin association, whereas PPM1F-mediated integrin dephosphorylation leads to enhanced FilaminA binding and the displacement of Talin. B In PPM1F- depleted cells the phosphorylation homeostastis is shifted. Constant integrin tail phosphorylation results in hyperactive integrins and affects cellular processes such as adhesion and migration.

3.2. PPM1F and Its Role in Cell Migration

We could demonstrate that depletion of the serine/threonine phosphatase PPM1F in different cell types affects integrin-mediated cell adhesion by negatively regulating β1 integrin activity. Thus, it was obvious to further study integrin-dependent cellular functions such as cell migration. Cell migration is a highly complex and tightly regulated process that among other factors is dependent on the integrin surface expression level or valency, the substrate ligand level, and integrin-ligand binding affinity (Huttenlocher et al. 1996; Palecek, Loftus et al. 1997). It is supposed to be efficient when an intermediate ratio of cell-substratum adhesiveness to intracellular contractile forces is reached, at which the cell can form new focal adhesions at the leading edge but release attachment sites at the rear. We could observe that migration capability of PPM1F-

64 3. Discussion and Outlook depleted human primary fibroblasts is matrix concentration dependent (Fig. 15C). Similar to observations made for the negative regulator SHARPIN (Rantala, Pouwels et al. 2011), knockdown of PPM1F significantly increased the speed of cell migration only on low collagenI concentrations, whereas this effect was inverted when cell were tracked on high matrix concentrations. These findings nicely pinpoint how integrin- ligand interactions affect cell locomotion behavior. Low level of ligands and high integrin affinities lead to appropriate integrin-ligand interactions at the front and result in efficient cell migration. However, high levels of ligands as well as integrin affinities cause more stable cell-matrix interactions at the rear that stick cells to their substrate. In agreement with results obtained from PPM1F knockdown human fibroblasts, also fibroblasts isolated at E10.5 from a PPM1F knockout mouse embryo displayed altered locomotion behavior compared to wildtpye cells (Fig. 29C). However, migration potential of PPM1F knockout cells was not matrix concentration dependent, since the complete loss of PPM1F always resulted in significantly impaired cell locomotion regardless of the level of ligands. Various studies already demonstrated a dominant effect of high affinity integrins in inhibiting cell migration (Huttenlocher, Ginsberg et al. 1996) such as impaired motility in neurons depleted for the negative integrin regulator FilaminA (Zhang et al. 2013). Obviously, there is a difference between PPM1F knockdown, where potential remaining PPM1F can affect integrin activity at the rear in an extenuated manner and the complete genetic deletion. The re-expression of the wildtype PPM1F and the inactive D360A version in PPM1F knockout cells clearly demonstrated that again the enzymatic activity of PPM1F is needed to ensure proper cell migration (Fig. 29A, C).

It has to be considered that cell migration is a highly integrated multistep process that is dependent on a variety of different factors (Ridley et al. 2003). Accordingly, not only integrin-ligand interactions affect cell locomotion ability but also factors that control cytoskeleton dynamics are highly needed to generate forces driving protrusions and cell body translocation. One of these proteins that have been identified as a PPM1F substrate, playing an important role in actin polymerization and cytoskeletal dynamics, is the serine/threonine kinase PAK. PAK binds to and is activated by Rho family GTPases such as Cdc42 and Rac that in turn are regulated by the Rho-GEF βPIX (Lee et al. 2001). Activation of PAK1 appears to promote cell migration/invasion via MAPK- and AKT-

65 3. Discussion and Outlook dependent pathways (Dechert et al. 2001; Huynh et al. 2010). However, PPM1F was described to negatively impact on PAK activity (Koh, Tan et al. 2002), suggesting that PPM1F might regulate cell motility by affecting proteins others than PAK1 such as the formin mDia1. Formins are known to regulate the actin and microtubule cytoskeleton and are further involved in various cellular functions such as cell polarity, cell migration and transcriptional activity of the serum response factor (Faix and Grosse 2006). SRF in turn is known to initiate transcription of several target genes mostly involved in actin dynamics, lamellipodia formation and integrin-cytoskeletal coupling. Xie and colleagues could demonstrate that PPM1F binds to formin mDia1 or to an mDia1-containing complex but only when mDia1 is activated by RhoA. The binding of PPM1F to mDia1 decreases the ability of mDia1 to activate transcription from the serum response element (SRE) (Xie, Tan et al. 2008). Using a luciferase assay they further found that also the phosphatase dead PPM1F was able to inhibit transcription, indicating that PPM1F binding to mDia is sufficient to disturb the activation of transcription. The same group discovered two years later that loss of PPM1F resulted in significantly reduced cell migration and impaired β1 integrin expression levels (Susila, Chan et al. 2010). Since β1 integrin is a SRF target gene it was speculated that PPM1F might regulate β1 integrin levels via SRF-mediated transcription thereby affecting integrin-dependent cellular processes such as migration. However, regarding our findings neither knockdown nor the complete genetic deletion of PPM1F led to reduced β1 integrin expression levels. We further demonstrated that the re-expression of the phosphatase dead PPM1F version in PPM1F knockout fibroblast could not restore migration capability. Thus, we assume that PPM1F-dependent migratory effects are not caused by changes in mDia/RhoA signaling events.

One year later the same group found that overexpression of PPM1F in fibroblasts led to enhanced cell migration and phosphorylation of the activating Thr202/Tyr204 residues of MAPK3 as well as increased phosphorylation of an inhibitory Ser21 residue within GSK3α. They speculated that PPM1F acts upstream of GSK3α, leading to increased phosphorylation and inhibition of GSK3α and that this probably accounts for the elevated MAPK3 activation, which in turn positively affects cell motility (Singh et al. 2011). Another recent publication of that same group found PPM1F to be essential for cancer cell migration and invasion. Knockdown of PPM1F in breast cancer cells led to

66 3. Discussion and Outlook impaired cell motility. They further observed that depletion of PPM1F decreased phosphorylation of Thr202/Tyr204 of MAPK1/3 but contradictory led to increased phosphorylation of Ser9/Ser21 of GSK3α and -β. They speculated that these kinases are inhibited under PPM1F deficient circumstances and that the PPM1F-mediated effects on the MAPK/GSK3 pathway are cell type dependent (Zhang, Guo et al. 2013). They further observed that also stathmin levels were reduced in knockdown cells accompanied by a minor reduction in the stathmin phosphorylation state. Stathmins are regulators of the microtubule filament system by destabilizing microtubules, preventing their assembly and promoting their disassembly. Zhang and colleagues assumed that PPM1F again might be involved in the regulation of transcription and thereby affecting cell migration behavior. Obviously, PPM1F seems to influence and modulate different signaling pathways besides the activity control of β1 integrin. Although MAPK1/3 was not identified for being a direct target of PPM1F (Zhang, Guo et al. 2013), this phosphatase seems to be able to impact on signaling pathways that affect the activity of this kinase. Since also MAPKs are directly phosphorylated and activated by PAKs, it is possible that PPM1F-dependent migratory effects are not only caused by integrin activity changes but also mediated in PAK dependent manner.

3.3. Manipulating PPM1F Phosphatase for Therapeutic Benefits

Integrins are key molecules that contribute to diverse human pathologies, including inflammation, fibrosis, thrombotic diseases and cancer. Thus, these receptors represent a promising target for therapeutic interventions. Many targeting approaches have been attempted, ranging from blocking antibodies, classical small molecules or peptides to antagonists derived from snake venoms. Currently, five integrin specific drugs have been used in the clinics affecting the platelet αIIbβ3 integrin (abciximab, tirofiban, intrifiban), the leukocyte αLβ2/LFA-1 integrin (efalizumab, subsequently withdrawn due to occurrence of progressive multifocal leukoencephalopathy), and the leukocyte α4β1 integrin (natalizumab) to treat multiple sclerosis and Crohn’s disease. Additionally to these registered drugs there are at least 260 compounds currently in clinical trials (Goodman and Picard 2012). To date the majority of compounds are designed for targeting platelet and leukocyte specific integrins. They are supposed to block

67 3. Discussion and Outlook overactive integrins in order to treat diseases such as thrombosis, stroke, and autoimmune defects like Crohn’s disease or multiple sclerosis. However, there are also examples of impaired integrin activation leading to human pathological conditions such as bleeding disorders or leukocyte adhesion deficiencies. Thus, compounds that stimulate integrin activity are also highly desirable.

Integrins also contribute to all steps of cancer progression like adhesion, migration, extravasation, angiogenesis and the establishment of metastatic lesions. Though, studies connecting integrin activity states to the cancer disease pattern led to inconsistent results. Recent studies could demonstrate that expression of a constitutively active β1 integrin drives metastasis in different experimental models (Kato et al. 2012). Also increased expression of the integrin activating proteins Talin and kindlin have been linked to cancer progression and metastasis (Desiniotis and Kyprianou 2011; Gao et al. 2013). Oppositional, genetic deletion of the gene encoding for the integrin inactivating protein FilaminA decreased lung tumor formation (Nallapalli et al. 2012) and up- regulation of the integrin inhibitor SHARPIN has been observed in ovarian and liver carcinoma (Jung et al. 2010). Obviously, the correlation between integrin activity and cancer is not always predictable and integrin activating or inhibiting proteins have an intricate role that might be context dependent. But nevertheless, expanding the knowledge of the regulation of the integrin adhesome helps to identify new promising therapeutic targets in signaling pathways that contribute to disease development such as cancer. In this study we identified the serine/threonine phosphatase PPM1F to play an important role in integrin-mediated cell adhesion and migration by negatively affecting β1 integrin activity. This phosphatase was also found to be expressed in several cancer cell lines and PPM1F expression levels appear to be up-regulated in more invasive breast cancer cells compared to non-invasive ones. Notably, inhibition of PPM1F strongly reduced cancer cell migration and invasion (Susila, Chan et al. 2010). We demonstrated that PPM1F mode of action encompasses its catalytic activity and thus represents a promising druggable enzyme affecting the cytoplasmic tail of β1 integrin. Different strategies have been developed to specifically target protein phosphatases such as substrate-based phospho-peptide inhibitors. Such bioactive and cell-permeable peptide antagonists, specifically disrupting phosphatase complexes have been identified for several complexes (McConnell and Wadzinski 2009). As an example, Guergnon and

68 3. Discussion and Outlook colleagues developed cell-permeable peptides that mimicked the structure of the phosphatase-interacting motifs in specific targets of the PP1 and PP2A phosphatase. They could show that these peptides bind the phosphatase in the same manner as the substrate and that this strategy could be used to deregulate intracellular survival pathways (Guergnon et al. 2006). Also phosphatases of the PPM family such as PPM1D (alias Wip1) have not only been successfully inhibited with substrate-based phospho- peptides (Yamaguchi et al. 2006) but also with small molecule inhibitors. Inhibition of PPM1D as part of the p38 MAPK pathway represents an attractive target for the development of small molecule inhibitors to treat certain cancers. It was shown that PPM1D specific small molecule inhibitors reduced the growth of breast cancer cells and tumor development in mice (Belova et al. 2005). These inhibitors could be used as lead compounds for the design of new cell-permeable inhibitors that are specific for members of the PPM family such as PPM1F. A compound that inhibits the catalytic activity of PPM1F would probably also affect other signaling pathways mediated by this phosphatase. However, a small molecule that interferes with the PPM1F recruitment to β1 integrin would be highly desirable and probably would diminish the risk for unpredicted side effects. The impact on the interaction of PPM1F and β1 integrin and the predicted positive effect on integrin activity and cell migration capability would potentially open up a new starting point for treating diseases such as LAD or for anti- cancer drug development.

3.4. PPM1F and Its Role in Brain Development

The analysis of PPM1F expression during embryonal development and the phenotype of PPM1F-/- embryos established PPM1F as an essential, non-redundant phosphatase during embryogenesis. Currently we are not able to judge why the complete loss of PPM1F results in embryonic lethality at embryonic day E10.5. We found PPM1F to be highly expressed in multiple tissues such as the heart, the liver or strikingly in the developing nervous system as well as in different neuronal cell types (Fig. 26A-C). At this point we just can speculate that a PPM1F-dependent dysregulation of the developing nervous system will have the most serious consequences. Accordingly, we observed that PPM1F-depleted embryos at E10.5 exhibited a depauperate forebrain

69 3. Discussion and Outlook structure accompanied by a disordered radial organization and orientation of neural progenitor cells within the ventricular zone of the telencephalon (Fig. 27C-F). At this early stage, the developing neocortex consists of a single layered epithelium called the neuroepithelium consisting of neuroepithelial cells. As starting point for a proper corticogenesis, normally these neural progenitor cells form a regularly spaced scaffold that terminates in well-defined endfeet at the pia surface, the innermost layer of the meninges. We additionally observed that the basal lamina, which is an important anchoring structure for these neuroepithelial cells and which separates the meningeal epithelium from the ventricular zone was clearly contorted in PPM1F deficient embryos. Obviously, these findings suggest that PPM1F has an important role during embryonic cortex formation, probably by targeting β1 integrin-dependent processes. During the course of cortical development, the spatial and temporal expression of different integrin subunits as well as their ligands is essential for cortical layer generation and plasticity. Notably, besides the β5 integrin, β1 integrin is the major β subunit that is ubiquitously expressed in the developing cerebral cortex (Schmid and Anton 2003). Various α subunits such as α2, α3, α5 or α6 integrin are known to dimerize preferentially or exclusively with β1 integrin. Knockout studies targeting β1, α2 or α5 integrin revealed early embryonic lethality (before E9) and thus preclude the analysis of cortical development. Notably, also β1 integrin T788A/T789A substitution caused peri- implantation lethality in mice (Bottcher et al. 2012). However, Graus-Porta and colleagues could demonstrate by using a conditional β1 knockout approach that β1 deficient mice displayed a defective remodeling of the pial/meningeal basement membrane characterized by obvious interruptions, and consequently a disturbed radial glia endfeet positioning at the pial basement membrane (Graus-Porta et al. 2001). Strikingly, these observations highly resemble the phenotype observed in PPM1F- depleted embryos. Interestingly, also certain cortical malformations have been described in α3, α6 and αv knockout mice again reminding of characteristics discovered in PPM1F knockout embryos. α3 integrin knockout mice died soon after birth with severe defects in the development of the cerebral cortex, lungs, skin and kidneys. The knockout phenotype was again characterized by an abnormal laminar organization of neurons within the cortex and an abnormal neuronal migration (Anton et al. 1999). α6 integrin deficient mice also show analogies to PPM1F knockout animals. Apart from their perinatal lethality α6 integrin knockout mice display a disorganized cortical plate,

70 3. Discussion and Outlook a disorganized basal lamina assembly as well as ectopic neuroepithelial cells within the embryonic cortex (Georges-Labouesse et al. 1996; Georges-Labouesse et al. 1998). Notably, α6 integrin is highly expressed in the ventricular zone and the cortical plate of the developing cerebral wall (Georges-Labouesse, Mark et al. 1998). α6 integrin is concentrated in the basal plasma membrane of the highly polarized neuroepithelial cell and was found to anchor these cells to the basal lamina (Gotz and Huttner 2005). α6 integrin only dimerizes with the β1 or β4 subunit. However, the β4 integrin is not expressed during brain development, indicating that α6β1 is the main integrin responsible for neural precursor anchoring. It is highly plausible that a PPM1F- dependent dysfunctional α6β1 integrin regulation disturbs proper laminin deposition in the marginal zone and consequently affects neuroepithelial cell organization. The significance of the assembly of different ECM proteins in the basement membranes of the developing cortex has also been proven by different knockout approaches. A disturbed corticogenesis have been seen in mice deficient in the ECM components such as Reelin, the nidogen-binding site of laminin (Halfter et al. 2002), and perlecan (Costell et al. 1999), showing characteristic such as an altered laminar architecture due to impaired neuronal migration, an abnormal basal lamina assembly, altered radial glia development or dysplasia of neurons within the developing cortical plate. Interestingly, deficiencies in basal lamina assembly and altered neuronal migration may lead to human diseases like Lissencephaly or Periventricular heterotopia. Thus, considering the lethal effects of the complete deletion of PPM1F, a conditional knockout strategy would be highly desirable. Such approach would aid to further study the effect of PPM1F on neural cell behavior in the developing cerebral cortex and could help to unravel potential links to human neurological disorders.

3.5. Heterozygous PPM1F+/- Mice: A Novel Model to Study ADHD?

We found PPM1F to be strongly expressed in neuronal tissues in adult mice and during embryonic development (Fig. 25A, 27A-B). We further decoded PPM1F as an essential phosphatase involved in mammalian brain development. Consequently, the question arose whether PPM1F might also affect proper brain functions to later time points. Interestingly, a genome-wide association study identified some single-nucleotide

71 3. Discussion and Outlook polymorphisms particular in genes coding for cell adhesion molecules and regulators of synaptic plasticity to be involved in the pathogenesis of adult attention- deficit/hyperactivity disorder. Among others, they found a SNP within the PPM1F promoter region to be positively associated with the neurobehavioral disorder ADHD (Lesch, Timmesfeld et al. 2008). The homozygous SNP occurs with a frequency of 5 % in the European population. At this stage it is unclear whether this SNP within the promotor of PPM1F has an effect on PPM1F expression levels. However, one transcription factor, NKX2.2, probably involved in the morphogenesis of the central nervous system, has been found to directly bind within this promotor region potentially being affected by this particular SNP. Although the etiology of ADHD is induced by various means such as environmental and genetic factors we speculated that altered PPM1F expression levels could be one ADHD trigger and furthermore, that heterozygous PPM1F+/- knockout mice could serve as an appropriate ADHD model. Accordingly, we could demonstrate that the absence of one functional ppm1f gene in PPM1F+/- mice indeed affected brain expression levels (Fig. 30A). Additionally, we observed that heterozygous mice showed increased exploratory activity (rearing) and an impaired anxiety-dependent behavior (distribution within the arena) compared to wildtype animals (Fig. 30C, D). Interestingly, similar observations have been made for heterozygous CaMKII+/- mice that also show a decreased anxiety-like behavior as well as an increased aggressive behavior (Chen et al. 1994). Furthermore, we found PPM1F+/- mice to cover a greater distance than wildtpye littermates (Fig. 30B). Since only five animals per group were analyzed and the variance within one group was relative high, only a tendency of increased activity could be detected. However, tracking more mice would probably led to stronger activity differences as stated before by the Jackson Laboratory namely that heterozygous PPM1F+/- mice indeed display a hyperactive behavior (http://jaxmice.jax.org/strain/005831.html). These findings suggest that PPM1F not only holds an irreplaceable function during early cortical development but also to have distinct role in correct brain function in adult mammals. Notably, β1 integrin is not only ubiquitously expressed during cortical development but its expression also persists in the adult cortex (Graus-Porta, Blaess et al. 2001). Interestingly, integrins and CaMKIIs have been described numerous times to be involved in synaptic plasticity. Shi and colleagues could demonstrate that upon RGD-peptide- induced integrin activation an elongation of existing dendritic spines and the formation

72 3. Discussion and Outlook of new filopodia in hippocampal neurons were primed. These effects were also accompanied by integrin-dependent actin reorganization and synapse remodeling, which could be partially inhibited by the use of function-blocking antibodies against β1 and β3 integrin as well as through the inhibition of CaMKII and the NMDA receptor (NMDAR). They concluded that integrins control ECM-mediated spine remodeling through CaMKII/NMDAR-dependent actin reorganization and thereby affecting synaptic plasticity in the adult brain (Shi and Ethell 2006). Also CaMKII has been consistently linked to synaptic plasticity and neuronal development especially in the hippocampus (Yamasaki et al. 2008; Arruda-Carvalho et al. 2014; Shonesy et al. 2014). Recently, it was demonstrated that new granule cells are continuously integrated into hippocampal circuits throughout adulthood. This process is critically regulated by CaMKII during development but also appears to be conserved in the adult brain, likely to be important for efficient hippocampal function. Deletion of CaMKII by a conditional knockout approach from newly generated dentate granule cells led to increased dendritic complexity and to a reduced number of mature synapses accompanied by impaired hippocampus-dependent learning (Arruda-Carvalho, Restivo et al. 2014). These data suggest that CaMKII regulates the integration of granule cells into the dentate gyrus by arresting dendritic growth and stabilizing input connections. Notably, we observed a strong PPM1F promotor activity in the brain of adult mice, especially in the cortex as well as in the hippocampus and in particular in the pyramidal layer of the Ammon’s horn and strikingly also in the granule cell layer of the dentate gyrus. It is plausible that PPM1F on the one hand by modulating integrin activity and on the other hand by antagonizing CaMKII participates in neuron regulation and synaptic plasticity and that changes in PPM1F expression in turn lead to behavioral abnormalities. The hippocampus as a part of the limbic system has often been implicated in the genesis of ADHD. Various studies exist that demonstrate that animals with hippocampal damage tend to be hyperactive (Lipska et al. 1993) and display an altered anxiety-related behavior. Recently, Kino and colleagues showed that depletion of an RNA binding protein FUS/TLS in mice led to distinct histological alterations including vacuolation in the hippocampus, accompanied by behavioral abnormalities such as hyperactivity and the reduction in anxiety-like behavior (Kino et al. 2015). Thus, it is quite possible that PPM1F-mediated behavioral changes might originate from hippocampal structural discrepancies. As mentioned above it would be highly interesting to generate an

73 3. Discussion and Outlook inducible knockout mouse to further study PPM1F-dependent brain functions at defined developmental ages or stages.

Currently, we are not able to judge whether the ADHD-associated SNP within the PPM1F promotor region indeed affects PPM1F brain expressions levels. Therefore, luciferase assays to study PPM1F promotor activity would be worthwhile to answer this question. Additionally, behavioral test have to be conducted to further evaluate the primary features of ADHD such as hyperactivity, sustained attention, fear, learning, and impulsivity. It remains to be clarified whether heterozygous PPM1F+/- provide an appropriate ADHD animal model since it should be similar to the disorder it represents in terms of etiology, biochemistry, symptomatology, and treatment.

74 4. Material

4. Material

4.1. Eukaryotic Cells

HEK293T Human embryonic kidney cells

Control HEK 293T HEK293T cells transduced with virus encoding for the empty pLKO.1 shANKRD28 HEK293T cells transduced with virus encoding for shRNA targeting human ANKRD28 shFilaminA HEK293T cells transduced with virus encoding for shRNA targeting human FilaminA shILKAP HEK293T cells transduced with virus encoding for shRNA targeting human ILKAP shPPM1F HEK293T cells transduced with virus encoding for shRNA targeting human PPM1F shPP2A HEK293T cells transduced with virus encoding for shRNA targeting human PP2A shPTP-1B HEK293T cells transduced with virus encoding for shRNA targeting human PTP-1B shPTP-PEST HEK293T cells transduced with virus encoding for shRNA targeting human PTP-PEST shPTPRF HEK293T cells transduced with virus encoding for shRNA targeting human PTPRF shPTPRO HEK293T cells transduced with virus encoding for shRNA targeting human PTPRO shRPTP-α HEK293T cells transduced with virus encoding for shRNA

75 4. Material

targeting human RPTP-α shSHP1 HEK293T cells transduced with virus encoding for shRNA targeting human SHP1 shSHP2 HEK293T cells transduced with virus encoding for shRNA targeting human SHP2 shTCPTP HEK293T cells transduced with virus encoding for shRNA targeting human TCPTP

HT1080 Human keratinocytes

Control HT1080 HT1080 transduced with virus encoding for the empty pLKO.1 shPPM1F/E HT1080 HT1080 transduced with virus encoding for the shRNA targeting human PPM1F/E

MEFs Mouse embryonic fibroblasts

MEF PPM1F+/+ Wildtype MEFs

MEF PPM1F-/- PPM1F knockout MEFs

MEF PPM1F-/- + WT PPM1F knockout MEFs stably re-expressing human PPM1F

MEF PPM1F-/- + DA PPM1F knockout MEFs stably re-expressing human PPM1FD360A

NHDFs Normal human dermal fibroblasts control NHDF NHDFs transduced with virus encoding for the empty pLKO.1 shPPM1F NHDF NHDFs transduced with virus encoding for shRNA targeting human PPM1F shFilaminA NHDF NHDFs transduced with virus encoding for shRNA targeting human FilaminA

76 4. Material

4.2. Media for Eukaryotic Cells

HEK 293T Dulbecco’s modified Eagle’s medium (DMEM; Biochrom) supplemented with 10 % newborn calf serum (CS; Biochrom)

HT1080 DMEM supplemented with 10 % fetal calf serum (FCS; Biochrom), 1 % non-essential amino acids (PAA) and 1 % sodiumpyruvat (PAA)

MEF DMEM supplemented with 10 % fetal calf serum, 1 % non- essential amino acids and 1 % sodiumpyruvat

NHDF Fibroblast growth medium (PromoCell)

Freezing medium DMEM supplemented with 20 % CS or FCS, respectively, and 10 % DMSO

Freezing medium Cryo-SFM (PromoCell) for NHDF

Starvation medium DMEM supplemented with 0.5 % FCS

Suspension medium DMEM supplemented with 0.2 % BSA

4.3. Prokaryotic Cells

E. coli Nova Blue endA1, hsdR17 (rk12- mk12+), supE44, thi-1, recA1, gyrA96, relA1, lac [F´proA+B+ lacIqZ_M15::Tn10 (TetR)] (Novagen)

E. coli BL21 F- dcm ompT hsdS (rB- mB-) gal [malB+]K-12(λS) (Novagen)

E.coli BL21DE3 F- ompT gal dcm lon hsdSB (rB- mB-) λ (DE3 [lacI lacUV5-T7 gene 1 ind1 sam7 nin5])

E. coli BL21DE3 pRosetta F- ompT hsdSB (rB- mB-) gal dcm λ (DE3 [lacI lacUV5-T7 gene 1 ind1 sam7 nin5])

77 4. Material

4.4. Media for Prokaryotic Cells

LB agar plates 1% w/v Tryptone; 0.5% w/v yeast extract; 0.5% w/v NaCl; 10 mM MgCl2; 1.2% w/v Agar-Agar; pH 7.0 with NaOH; autoclaved

LB medium 1% w/v Tryptone; 0.5% w/v yeast extract; 0.5% w/v NaCl; pH 7.0 with NaOH; autoclaved

Freezing medium 50% v/v LB medium; 50% v/v Glycerol (50%)

4.5. Antibiotics

Ampicillin 100 µg/ml

Chloramphenicol 30 µg/ml

Ciprofloxacin 20 µg/ml

Kanamycin 50 µg/ml

Puromycin HEK cells and NHDFs: 0.4 µg/ml; HT1080 cells: 0.8 µg/ml

Plasmocin 25 µg/ml

4.6. Antibodies

4.6.1. Primary Antibodies

Table 2. Overview of the primary antibodies used in this thesis.

Antigen Clone Species Company Dilution Application Reactivity (tested) (tested)

α5 Integrin BIIG2 Rat DSHB; Hauck 1:10 FC Human Laboratory

α5 Integrin MFR5 Rat BD 1:300 FC Mouse

78 4. Material

Pharmingen

αV Integrin P2W7 sc-9969 Mouse Santa Cruz 1:300 FC Human

αV Integrin RMV-7 Rat BD 1:300 FC Mouse Pharmingen

β1 Integrin P5D2 Mouse DSHB; Hauck 1:300 FC Human Laboratory

β1 Integrin HMb1-1 Armen. Bio Legend 1:300; FC; IF Mouse Hamster 1:200

β1 Integrin sc-8978 Rabbit Santa Cruz 1:200 WB Human; Mouse

β1 Integrin AIIB2 Rat DSHB; Hauck 1:600 ELISA Human Laboratory

active β1 9EG7 Rat DSHB; Hauck 1:300; FC; IF; ELISA Human; Integrin Laboratory 1:300; Mouse 1:600 inactive β1 Mab13 Rat BD 1:100 IF Human Integrin Pharmingen

ppTTβ1 44-872G Rabbit Invitrogen 1:1000 WB Human, Integrin Mouse

β3 Integrin H96 sc-14009 Rabbit Santa Cruz 1:300 FC Human; Mouse

Dlx2 ab18188 Rabbit abcam 1:1000 IHC Mouse

Ezrin 4A5 Mouse Millipore 1:200 WB Human

FAK 77 Mouse BD 1:250 WB Human; Mouse

FAKpY397 44-624G Rabbit Invitrogen 1:1000 WB Mouse

FilaminA EP2405Y Rabbit Epitomics 1:250000 WB Human; Mouse

FilaminA PM6/317 Mouse Millipore 1:100 IF Human; Mouse

GFP JL-8 Mouse Clontech 1:3000 WB

GST B-14 sc-138 Mouse Santa Cruz 1:1000 WB

79 4. Material

His H-3 sc-8036 Mouse Santa Cruz 1:1000 WB

Kindlin2 3A3 Mouse Millipore 1:200 WB Human

ILK EP1593Y Rabbit Epitomics 1:800 WB Human

Nestin rat-401 Mouse Millipore 1:200 IHC Mouse

PAK1 #2602 Rabbit Cell Signaling 1:800 WB Human; Mouse

p-Pak1/ p- #2601 Rabbit Cell Signaling 1:1000 WB Human; Pak2 Mouse

Paxillin 177 sc-136297 Mouse Santa Cruz 1:200 WB Human

PPM1F 17020-1-AP Rabbit Protein-tech 1:1000 WB Human

PPM1F Nr8 Mouse Abmart 1:500 IF Human

PPM1F H00009647- Rabbit Novus 1:100 IF Human D01 Biologicals

PPM1F #1147 Rabbit Hauck 1:200 WB Mouse Laboratory

Reelin G10 Mouse Chemicon 1:1000 IHC Mouse

Talin 8d4 Mouse Thermo 1:700; 1:50 WB; IF Human; Fischer Mouse

βTubulin E7 Mouse DSHB; Hauck 1:3000 WB Human; Laboratory Mouse

Vinculin hVIN-1 Mouse Sigma-Aldrich 1:2000 WB Human

Zyxin 164D4 Mouse Synaptic 1:1000 WB Human Systems

4.6.2. Secondary Antibodies

Table 3. Overview of the secondary antibodies used in this thesis.

Antibody Company

HRP-conjugated AffiniPure goat anti-mouse IgG Jackson ImmunoResearch Lab

80 4. Material

HRP-conjugated AffiniPure goat anti-rabbit IgG Jackson ImmunoResearch Lab

HRP-conjugated AffiniPure goat anti rat IgG Santa Cruz

Cy3 conjugated AffiniPure goat anti-mouse IgG Jackson ImmunoResearch Lab

Cy3 conjugated AffiniPure goat anti-rabbit IgG Jackson ImmunoResearch Lab

Rhodamine Red conjugated AffiniPure goat anti- Jackson ImmunoResearch Lab hamster IgG

Rhodamine Red conjugated goat anti rat IgG Jackson ImmunoResearch Lab

Cy5 conjugated AffiniPure goat anti-mouse IgG Jackson ImmunoResearch Lab

Cy5 conjugated AffiniPure goat anti-rabbit IgG Jackson ImmunoResearch Lab

Cy5 conjugated AffiniPure goat anti-rat IgG Jackson ImmunoResearch Lab

4.7. Dyes and Toxins

Table 4. Dyes and toxins used in this thesis.

Reagent Company

Alexa-Fluor546-Phalloidin Mol. Probes

Alexa-Fluor647-Phalloidin Mol. Probes

4.8. Enzymes and Proteins

Table 5. Enzymes and proteins used in this thesis.

Name Company

Bovine Serum Albumin (BSA) AppliChem

81 4. Material

CollagenI Merck

Cre Recombinase Hauck Laboratory

Fibronectin BD Bioscience

FibronectinIII9-12 Hauck Laboratory

Pfu Polymerase Hauck Laboratory

Poly-L-lysine Sigma

Proteinase K AppliChem

Restriction enzymes NEB; Fermentas

Taq Polymerase Hauck Laboratory

T4 DNA Ligase Hauck Laboratory

Trypsin/EDTA PAA Laboratories

4.9. Plasmids

Table 6. Plasmids used in this thesis.

Name Source pBluescript SK(+) Stratagene pDNR-CMV Clontech pDNR-Dual (LIC) Clontech (Hauck Laboratory) pEBG-loxP Clontech pEGFP-C1-loxP Clontech pGEX-4T1-loxP GE Healthcare pET24aHis-Sumo Deuerling Laboratory, University of

82 4. Material

Konstanz pLKO.1 Addgene pLL3.7 Addgene pLPS-3’EGFP Clontech pmCherry-C1-loxP Clontech pUltra Addgene mApple-N1+FilaminA Addgene pBluescript+hPPM1E BioCat pCMV-SPORT6+mPPM1F Source BioScience pOTB7+hPPM1F Source BioScience pRKGFP+mTalin Fässler Laboratory, MPI Martinsried München pCMV-SPORT6+β1integrin RZPD

4.10. Phospho-Peptides

The following phospho-peptides were synthesized by Pepscan:

β1TpTp788/789: Biotin-Ahx-TGENPIYKSAVT(PO3)T(PO3)VVNPKYEGK-OH

β1Tp788: H-TGENPIYKSAVT(PO3)TVVNPKYEGK-OH

β1Tp789: H-TGENPIYKSAVTT(PO3)VVNPKYEGK-OH

MLC2pT10: H- MSSKRAKAKT(PO3)TKKRPQRATS-OH

83 4. Material

4.11. Oligonucleotides

Table 7. Oligonucleotides used in this thesis.

Name Sequence (5 ’ 3’) hANKRD28_shRNA_ ccggaaGCCTTAGGTCCTATTCATActcgagTATGAATAGGACCTAAGG sense Ctttttttg hANKRD28_shRNA_ aattcaaaaaaaGCCTTAGGTCCTATTCATActcgagTATGAATAGGACC anti TAAGGCtt hβ1Integrin_shRNA_ ccggaaTGCAGCACAGATGAAGTTActcgagTAACTTCATCTGTGCTGC sense Atttttttg hβ1Integrin_shRNA_ aattcaaaaaaaTGCAGCACAGATGAAGTTActcgagTAACTTCATCTGT anti GCTGCAtt hFilaminA_shRNA_ ccggaaGACCACCTACTTTGAGATCctcgagGATCTCAAAGTAGGTGGT sense Ctttttttg hFilaminA_shRNA_ aattcaaaaaaaGACCACCTACTTTGAGATCctcgagGATCTCAAAGTAG anti GTGGTCtt hILKAP_shRNA_ ccggaaAGAAAGTTTGTAAAGCCTCctcgagGAGGCTTTACAAACTTTC sense Ttttttttg hILKAP_shRNA_ aattcaaaaaaaAGAAAGTTTGTAAAGCCTCctcgagGAGGCTTTACAAA anti CTTTCTtt hPPM1F_shRNA1_ ccggaaTGGTTGGCCACAAACAATGctcgagCATTGTTTGTGGCCAACC sense Atttttttg hPPM1F_shRNA1_ aattcaaaaaaaTGGTTGGCCACAAACAATGctcgagCATTGTTTGTGGC anti CAACCAtt hPPM1F_shRNA2_ ccggaaCCAGCTCTTCGGCTTGTCTctcgagAGACAAGCCGAAGAGCTG sense Gtttttttg hPPM1F_shRNA2_ aattcaaaaaaaCCAGCTCTTCGGCTTGTCTctcgagAGACAAGCCGAAG

84 4. Material anti AGCTGGtt hPPM1E_shRNA_ ccggaaCAGCCCAAAGTATCATTCTctcgagAGAATGATACTTTGGGCT sense Gtttttttg hPPM1E_shRNA_ aattcaaaaaaaCAGCCCAAAGTATCATTCTctcgagAGAATGATACTTT anti GGGCTGtt hPP2A_shRNA_ ccggaaTGGGAAGAGCAACAGTAACctcgagGTTACTGTTGCTCTTCCC sense Atttttttg hPP2A_shRNA_ aattcaaaaaaaTGGGAAGAGCAACAGTAACctcgagGTTACTGTTGCTC anti TTCCCAtt hPTP1B_shRNA_ ccggaaCTCTCCACTCCATATTTATctcgagATAAATATGGAGTGGAGA sense Gtttttttg hPTP1B_shRNA_ aattcaaaaaaaCTCTCCACTCCATATTTATctcgagATAAATATGGAGT anti GGAGAGtt hPTP_PEST_shRNA_ ccggaaGCCAGATTTATAGTATTCCctcgagGGAATACTATAAATCTG sense GCtttttttg hPTP-PEST_shRNA_ aattcaaaaaaaGCCAGATTTATAGTATTCCctcgagGGAATACTATAAA anti TCTGGCtt hPTPRF_shRNA_ ccggaaTCAGAGAGCCTAGAACATCctcgagGATGTTCTAGGCTCTCTG sense Atttttttg hPTPRF_shRNA_ aattcaaaaaaaTCAGAGAGCCTAGAACATCctcgagGATGTTCTAGGCT anti CTCTGAtt hPTPRO_shRNA_ ccggaaGAAATGGTCATTCTACTTCctcgagGAAGTAGAATGACCATT sense TCtttttttg hPTPRO_shRNA_ aattcaaaaaaaGAAATGGTCATTCTACTTCctcgagGAAGTAGAATGAC anti CATTTCtt hRPTPα_shRNA_ ccggaaTGGATGATGCAGTTCAAATctcgagATTTGAACTGCATCATCC

85 4. Material sense Atttttttg hRPTPα_shRNA_ aattcaaaaaaaTGGATGATGCAGTTCAAATctcgagATTTGAACTGCAT anti CATCCAtt hSHP1_shRNA_ ccggaaCCCTTCTCCTCTTGTAAATctcgagATTTACAAGAGGAGAAGG sense Gtttttttg hSHP1_shRNA_ aattcaaaaaaaCCCTTCTCCTCTTGTAAATctcgagATTTACAAGAGGA anti GAAGGGtt hSHP2_shRNA_ ccggaaCAGACGCAAGAAAGTTTATctcgagATAAACTTTCTTGCGTCT sense Gtttttttg hSHP2_shRNA_ aattcaaaaaaaCAGACGCAAGAAAGTTTATctcgagATAAACTTTCTTG anti CGTCTGtt hTCPTP_shRNA_ ccggaaCCTGCACTTGATATAAGCActcgagTGCTTATATCAAGTGCAG sense Gtttttttg hTCPTP_shRNA_ aattcaaaaaaaCCTGCACTTGATATAAGCActcgagTGCTTATATCAAG anti TGCAGGtt hPPM1F-IF-sense GAAGTTATCAGTCGACACCATGTCCTCTGGAGCCCC hPPM1F-IF-anti ATGGTCTAGAAAGCTTGCCTAGCTTCTTGGTGGAGC

PPM1F-XbaI-sense TGCATCTAGAATGTCCTCTGGAGCCCCAC

PPM1F-BamHI-anti CAGTAAGGATCCCTAGCTTCTTGGTGGAG mTalin1-sense GAAGTTATCAGTCGACACCATGGTTGCACTTTCACTGAAG mTalin1aa1-433-anti ATGGTCTAGAAAGCTTGCTTACTGCAGGACTGTTGACTTTTTGG hβ1Integrin-NheI- GAGGACGCTAGCACCATGAATTTACAACCAATTTTCTG sense hβ1Integrin-AgeI- GTGCGTACCGGTCGTTTTCCCTCATACTTCGG anti

86 4. Material hβ1Integrin-cyto- ATAGAATTCTGGAAGCTTTTAATGATAATTC EcoRI-sense hβ1Integrin-cyto- ATACTCGAGTCATTTTCCCTCATACTTCG XhoI-anti

PPM1F-SalI- GAAGTTATCAGTCGACACCATGTCCTCTGGAGCCCC external-sense

SOEing-PPM1F- CGCTTAATCCAAACAGCTGATTGAAGGAAGGGAGGGACACGTGCC internal-anti

SOEing-PPM1F- TTCAATCAGCTGTTTGGATTAAGCGACCCTGTGAACCGCGCCTAC internal-sense

PPM1F-BamHI- CAGTAAGGATCCCTAGCTTCTTGGTGGAG external-anti hPPM1F-D360A- GACTACCTGCTGCTAGCCTGTGCTGGCTTCTTTGACGTCG sense hPPM1F-D360A-anti GTCAAAGAAGCCAGCACAGGCTAGCAGCAGGTAGTCCTC mPPM1F-BamHI- GCTTTAGGATCCAATGGCCTCTGGAGCCGCACAGAAC sense mPPM1F-HindIII- CGCCCGTCAAGCTTCTTAGCTTCTCTGTGAGGTATTAC anti

Wildtype-sense CAACTCTCCATCATGCCCATCAG

Targeted allel-sense GGGTGGGATTAGATAAATGCCTGCTCT

Common-anti AAGCAGGAAGGGACACGTGTCGGTC

87 4. Material

4.12. Buffers and Solutions

Table 8. Buffers and solutions used in this thesis.

Anode Buffer (5x) 125 mM Tris-Base, 200 mM 6-Aminohexanoic acid (pH 10.4)

APS 10 % Ammonium persulfate in ddH2O

β-galactosidase fixative PBS pH 7.4, 0.2 % Glutaraldehyde, 1.5 % Formaldehyde, 5

mM EGTA and 2 mM MgCl2

β-galactosidase wash PBS pH 7.4, 2 mM MgCl2, 0.02 % NP40 and 0.01 % Sodium buffer deoxycholate

Birnboim-Doly P1 50 mM Tris-HCl, 10 mM EDTA, 100 mg/ml Rnase A

Birnboim-Doly P2 0.2 mM NaOH, 20 % w/v SDS

Birnboim-Doly P3 3 M Potassium acetate to pH 5.5 with Acetic acid

Blocking solution (IF)/ 10 % heat inactivated CS in PBS, pH 7.4 FACS buffer

Blocking solution (IHC) 1 % BSA, 1 % hiCS, 0.1 % TritonX100 in PBS, pH 7.4

Blotto 2 % BSA, 0.05 % w/v Sodium azide in 1x TBS-T

Borate buffer 0.05 M Disodium tetraborate in H2O (pH 9.2)

Bouin’s fixative 11.7 % v/v Picric acid, 5 % v/v Glacial acetic acid, 8.3 %

v/v formaldehyde in H2O

Cathode Buffer (5x) 125 mM Tris-Base (pH 9.4)

Coomassie staining 25 % v/v Isopropanol, 10 % v/v Acetic acid, 3 % w/v solution Coomassie

Cre Buffer (10x) 33 mM NaCl; 50 mM Tris-HCl (pH 7.5); 10 mM MgCl2

Crystal violet solution 5 % Crystal violet in 96 % Ethanol

88 4. Material

Destaining solution 45.5 % v/v Methanol, 9.1 % v/v Acetic acid

Dilution buffer 10 mM Tris-HCl (pH 7.5); 150 mM NaCl; 10 µg/µl Aprotinin, 10 µM Benzamidine, 5 µg/µl Leupeptin, 10

µg/µl Pefablock, 10 µM PMSF, 100 µM ZnSO4

DNA-ladder 1 kb DNA-Ladder (Fermentas) in 6x GEBS dNTPs 20 mM dGTP; 20 mM dATP; 20 mM dCTP; 20 mM dTTP in

ddH2O

ECL solution 0.225 mM p-Coumaric acid; 1.25 mM Luminol; 0.1 M Tris- Base (pH 8.5)

GEBS 20 % w/v Glycerol; 0.5 % w/v Sarkosyl; 50 mM EDTA; 0.05 % Bromophenol blue

Gelatine 0.1 % w/v Gelatine in 1x PBS

GFP-Trap dilution/wash 10 mM Tris-HCl (pH 7.5), 150 mM NaCl and 0.5 mM EDTA buffer

GST buffer 50 mM Tris-HCl (pH 8), 150 mM NaCl, 1 mM DTT and 5

mM MgCl2

GST-Lysis buffer 20 mM Tris-Base (pH 8), 200 mM NaCl, 50 mM NaF, 0.5 % NP40, 10 µg/µl Aprotinin, 10 µM Benzamidine, 5 µg/µl Leupeptin, 10 µg/µl Pefablock, 10 µM PMSF, 5 µM

Cytochalasin D, 5 µM Latrunculin B, 100 µM ZnSO4

H2O2 30 % v/v H2O2

High-molecular weight 0.5 mg/ml Horseradish-peroxidase (40 kDa), 0.5 mg/ml marker (HMW) BSA (66 kDa), 0.5 mg/ml Lipoxidase (96 kDa), 0.5 mg/ml Galactosidase (116 kDa), 0.5 mg/ml Myosin rabbit muscle (205 kDa) in Triton-buffer

Kinase buffer 50 mM Tris-HCl (pH 7.7), 10 mM MgCl2, 1 mM DTT and

89 4. Material

0.05 % Triton X-100

Laird’s buffer 100 mM Tris-Cl pH 8.1, 200 mM NaCl, 5 mM EDTA and 0.2 % SDS

Low-molecular weight 0.5 mg/ml Lysozym (14.4 kDa), 0.5 mg/ml Soybean marker (LMW) trypsin inhibitor (22 kDa), 0.5 mg/ml Horseradish- peroxidase (40 kDa), 0.5 mg/ml BSA (66 kDa), 0.5 mg/ml Lipoxidase (96 kDa) in Triton-buffer

Lysis buffer 50 mM Tris, pH 8, 1 % TritonX100, 1 mM EDTA and 0.1 % β-Mercaptoethanol

Malachite green 1. 4,2 g Ammonium molybdate in 100 ml 4M HCl

2. 0,135g Malachite green in 300ml H2O + 5 % DMSO Two solutions are mixed and stirred overnight in the dark; filtered and stored in the dark

PBS (10x) 1.37 M NaCl, 26.8 mM KCl, 14.7 mM KH2PO4, 78.1 mM

Na2PO4

PBS++ 1.25 mM CaCl2, 1 mM MgCl2 in 1x PBS

PCR Buffer (10x) 10 mM Tris-HCl (pH 7.5), 50 mM KCl, 1.5 mM MgCl2

PFA 4% 4 % w/v Paraformaldehyde in ddH2O (pH 7.4)

Phosphatase buffer 50 mM Tris-HCl (pH 8), 10 mM MnCl2 and 0.01 % Tween- 20

Potassium ferricyanide 100 mM Potassium ferricyanide [K3Fe(CN6)] in PBS (pH stock solution 7.4), storage in dark

Potassium ferrocyanide 100 mM Potassium ferrocyanide [K4Fe(CN6)] in PBS (pH stock solution 7.4), storage in dark

RIPA Buffer 1 % Triton X-100, 50 mM Hepes, 150 mM NaCl, 10 %

glycerol, 1.5 mM MgCl2, 1 mM EGTA, 10 mM sodium

90 4. Material

pyrophosphate, 100 mM NaF, 1 mM sodium orthovanadate, 5 μg/ml Leupeptin, 10 μg/ml Aprotinin, 10 μg/ml Pefablock, 5 μg/ml Pepstatin, 10 μM Benzamidin, 0.1 % w/v SDS, 1 % v/v Deoxycholic acid

Running Buffer for SDS- 3 % w/v Tris Base, 14.4 % w/v glycine, 1 % w/v SDS PAGE

SDS 20 % w/v Sodium dodecyl sulfate

SDS sample Buffer 4 % w/v SDS, 20 % w/v Glycerol, 125 mM Tris-HCl, (2x/4x) 10/20 % v/v β-Mercaptoethanol, 1 % w/v Bromophenol blue (pH 6.8)

Separation gel buffer 1.5 M Tris-HCl (pH 8.8)

Stacking gel buffer 0.5 M Tris Base (pH 6.8)

T4 Ligase Buffer (10x) 50 mM Tris-HCl (pH 7.5), 10 mM MgCl2, 10 mM Dithiothreitol, 1 mM ATP

TAE Buffer 500 mM Tris Base; 50 mM EDTA; 5.7 % w/v acetic acid

TBS (10x) 500 mM Tris-Base, 1.5 M NaCl (pH 7.5)

TBS-T 0.05 % Tween in 1x TBS

TE-Buffer 10 mM Tris-Base, 1 mM EDTA (pH 8.5)

TMB 120 mg Tetramethylbenzidine, 5 ml Acetone, 45 ml 100 % Ethanol

Wash buffer 10 mM Tris-HCl (pH 7.5); 150 mM NaCl; 10 µg/µl Aprotinin, 10 µM Benzamidine, 5 µg/µl Leupeptin, 10

µg/µl Pefablock, 10 µM PMSF, 100 µM ZnSO4

X-gal dilution buffer 0.02 % NP40, 2 mM MgCl2, 0.01 % Sodium deoxycholat, 5 mM Potassium ferricyanide and 5 mM Potassium ferrocyanide, pH 7.3

91 4. Material

X-gal 40 mg/ml in N,N-Dimethylformamide

4.13. Chemicals

Acetic acid (Roth), acrylamide (AppliChem), Agarose-LE (Roche), aminohexanoic acid (Merck), APS (Serva), bromophenol blue (Roth), calcium chloride (Sigma), coomassie (Merck), DTT (Roth), EDTA (Merck), EGTA (Merck), ethanol (Sigma), ethanolamine (Merck), gelatin (Merck), glycerol (Merck), HEPES (AppliChem), Histoclear (national diagnostics), hydrogen peroxide (Merck), IPTG (Roth), Isofluran (Actavis); isopropanol (Riedel-de Haën), Luminol (Sigma), magnesium chloride (Roth), methanol (Riedel-de Haën), nucleotides (BioLabs), O.C.T Tissue-Tek (Sakura), paraformaldehyde (AppliChem), p-Coumaric acid (Sigma), potassium acetate (Roth), Roti-Histokitt (Roth), sarkosyl (Roth), sodium azide (Riedel-de Haën), sodium chloride (VWR), sodium dodecyl sulfate (Roth), Sodium fluoride (AppliChem), sodium hydrogen carbonate (AppliChem), sodium hydroxide (Riedel-de Haën), sodium orthovanadate (AppliChem), sodium pyrophosphate (AppliChem), sucrose (Roth), TEMED (Roth), Tissuewax (Medite), Tris-base (AppliChem), Tris-HCl (AppliChem), Triton-X-100 (Roth), trypan blue (Merck), trypton (Roth), Tween-20 (Roth), β-Mercaptoethanol (Merck).

4.14. Kits

Nucleobond AX Pc/Midiprep (Macherey-Nagel), Pierce BCA protein assay kit (Thermo scientific), PureLink Genomic DNA Kits (Invitrogen), QIAquick Gel Extraction Kit (Qiagen), QIAprep Spin Miniprep Kit (Qiagen).

4.15. Laboratory Equipment and Consumables

-80°C freezer (New Brunswick Scientific), adhesion microscope slides HistoBond (Marienfeld), autoclave (Sauter), balances (Mettler), centrifuges (Eppendorf, Heraeus, Sorvall), counting Chamber (Neubauer), cryostat CM1900 (Leica), gel documentation, GelDocXR (BioRad), GelRed® (Genaxxon), glass consumables (Schott, VWR Brand), heating block (Roth), incubator for bacteria, Celsius 2005 (Memmert), incubator, Innova

Co 170 CO2 (New Brunswick Scientific), magnetic stirrer (Ika), Leica confocal

92 4. Material microscope TCS SP5 and Leica AF6000 modular widefield system (Leica), mounting medium (Dako), microtome RM2125RT (Leica), NanoDrop 1000 (PeqLab), O.C.T Tissue- Tek (Sakura), PCR cycler, Primus 25 advanced (PeqLab), pH-Meter (Beckman), photometer (Hach), pipette tips (Sarstedt), plastic consumables (Eppendorf, Greiner, Costar), power supplier (BioRad), PVDF-membrane (Millipore), refrigerators (Privileg), SDS-PAGE chambers (BioRad), semi-dry electroblotter (PeqLab), sterile hood (Heraeus), thermomixer (Eppendorf), Varioskan Flash Multimode Reader (Thermo Scientific), Vortex (Ika), water bath (Memmert), Western Blot detection, LAS.

4.16. Software

EthoVision XT Base (Noldus), ImageJ (NIH, Bethesda, ML, USA), Clone Manager 9 (Scientific and Educational Software), Microsoft Office 2010, Leica LAS AF (Leica Microsystems CMS GmbH), Adobe Photoshop, GraphPad Prism (GraphPad, San Diego, CA, USA), FACS Diva (Becton Dickinson), Cyflogic (CyFlo Ltd., Turku, Finland), siRNA selection program of the Whitehead Institute for Biomedical Research (available online at http://jura.wi.mit.edu/bioc/siRNAext/).

93 5. Methods

5. Methods

5.1. Standard Laboratory Work

General procedures (listed below) were conducted according to the “Advanced Laboratory Course; 2015; Christof Hauck; Lehrstuhl Zellbiologie” lecture notes: Transfection of HEK293T cells via calcium-phosphate co-precipitation, Transfection of fibroblasts, SDS-PAGE, Coomassie Blue staining of gels, Western Blot, Direct labelling of antibodies with fluorescent dyes, Plasmid-Miniprep (Birnboim-Doley protocol), Restriction digest of plasmid DNA, PCR approach in 50 µL with hot-start, PCR purification, Isolation of DNA from agarose gel, In-Fusion-cloning (Clontech, Mountain View, CA), Transformation of plasmids in E. coli Nova Blue and E. coli BL-21, Cre-Lox recombination of plasmids, GST-Pulldown, Agarose gel electrophoresis.

5.2. Work with Eukaryotic Cells

5.2.1. Cell Culture, Transfection of Cells and Cell Lysis

HEK 293T cells were grown in DMEM supplemented with 10 % calf serum. NHDFs were obtained from PromoCell and cultured in PromoCell fibroblast growth medium. MEFs and HT1080 cells were cultured in DMEM supplemented with 10 % fetal calf serum, non-essential amino acids and sodiumpyruvat. All cells were maintained at 37 °C, 5 %

CO2 and sub-cultured every 2-3 days. Transfection with expression vectors was accomplished by standard calcium-phosphate co-precipitation using a total amount of 5- 8 µg DNA per 10 cm dish. The cells were used two days after transfection.

To obtain whole cell lysates, equal cell numbers were lysed by treatment with RIPA- buffer. Chromosomal DNA and cell debris were pelleted by addition of sepharose beads and centrifugation for 30 min at 13000 rpm. The protein amount was adjusted via BCA protein assay kit according to manufacturer’s protocol.

94 5. Methods

5.2.2. Isolation of Genomic DNA from Eukaryotic Cells

The isolation of genomic DNA from mouse embryonic fibroblasts was conducted via PureLink Genomic DNA Kits according to manufacturer’s instructions.

5.2.3. Lentivirus Production and Generation of Stable Cell Lines

The lentiviral vectors pUltra, pLKO.1, pMD2.G and psPAX2 were obtained from Addgene. HEK 293T cells were transfected with 7 µg pMD2.G, 10 µg psPAX2 and 13 µg pLKO.1 (harboring the corresponding shRNA) or pUltra, (harboring the gene of interest), respectively, by standard calcium-phosphate co-precipitation. After 72 hours, the virus- containing supernatant was collected, cleared by centrifugation for 7 min at 2000 rpm, and sterile-filtrated. HEK 293T cells and human keratinocytes were directly incubated with the corresponding lentiviral supernatant for 24 hours and afterwards selected with 0.4 µg/ml or 0.8 µg/ml puromycin, respectively. Control cells were generated via transduction with virus encoding for the empty pLKO.1.

For transduction of NHDFs and MEFs the viral particles were concentrated. The virus- containing supernatant was collected, cleared by centrifugation for 7 min at 2000 rpm, and sterile-filtrated. Afterwards, it was loaded on a 20 % w/v sucrose (in PBS) cushion and ultra-centrifuged for 2 hours at 20000 rpm. The supernatant was discarded and the viral pellet was re-suspended in PBS supplemented with 1 % BSA. Aliquots were transferred to liquid nitrogen and stored at -80 °C.

NHDFs and MEFs were incubated with the corresponding viral concentrate for 24 hours. Stable control and knockdown NHDFs were selected with 0.4 µg/ml puromycin for one week. Transduced wildtype and PPM1F-/- MEFs were identified via GFP reporter-gene expression and enriched via fluorescence-activated cell sorting.

5.2.4. Cell Adhesion Assay

A 96-well plate was coated with PBS containing the corresponding concentrations of the following extracellular matrix proteins overnight at 4 °C: 1 µg/ml collagen type I, 5

95 5. Methods

µg/ml human fibronectin, 0.8 µg/ml fibronectin type III repeat 9-12 (fibronectinIII9-12), 5 µg/ml matrigel, 5 µg/ml vitronectin or 10 µg/ml Poly-L-lysine, respectively. The wells were blocked with DMEM supplemented with 0.5 % BSA for 1 hour at 37 °C.

In parallel, cells were trypsinized and kept in suspension medium for 30 min. 6 x 104 HEK cells or 2.5 x 104 NHDFs per well were re-plated and allowed to adhere for the indicated time periods at 37 °C. After incubation time non-adherent cells were removed by gently washing with PBS++ thrice. Adherent cells were fixed with 4 % PFA for 10 min, washed with PBS and stained with 0.1 % crystal violet in 0.1 M borate buffer for 30 min. After intense washing cells were de-stained with 10 mM acetic acid and the absorption was measured at 590 nm using a spectrophotometer.

5.2.5. Re-Plating Assay

10 cm dishes were coated with 10 µg/ml poly-L-lysine or 2 µg/ml fibronectinIII9-12 overnight at 4 °C. The next day the dishes were blocked with DMEM supplemented with 0.2 % BSA for 1 hour at 37 °C. In parallel, cells were trypsinized and kept in suspension medium for 1 hour at 37 °C. Afterwards, same cell numbers were re-plated onto coated dishes and allowed to adhere for 45 min. The dishes were washed with PBS and whole cell lysates were prepared. Finally lysates were supplemented with 4x SDS sample buffer and loaded on a SDS polyacrylamide gel. Proteins were transferred via western blotting and phospho-proteins were detected with phospho-specific antibodies.

5.2.6. Integrin Activity Assay (Adhering Cells)

96-well plates were coated with 0.4 µg/mL fibronectinIII9-12 overnight at 4 °C. The next day, wells were blocked with 0.5 % BSA. In parallel cells were trypsinized and kept in suspension (DMEM + 0.5 % BSA) for 1 h. 5x104 cells per well were then re-plated and allowed to adhere for 40 min. Cells were either treated with 5 mM MnCl2 for 5 min or without. Cells were transferred to ice, fixed with 4 % PFA, washed with PBS and permeabilized with 0.2 % Triton X-100 for 15 min. Afterwards cells were blocked with 2 % BSA in PBS for 20 min and stained with the 9EG7 or AIIB2 (both 1:600) antibody,

96 5. Methods respectively. After incubation with the primary antibody, cells were washed with PBS, blocked with 2 % BSA for 20 min and incubated with the secondary antibody HRP- conjugated goat anti-rat IgG for 1 hour at RT. Finally cells were intensively washed and incubated with 100 µl/well of substrate solution (substrate solution was prepared by mixing 10 ml of 2.4 mg/ml tetramethylbenzidine in 10 % acetone/90 % ethanol with 0.5 ml of 30 mM potassium citrate, pH 4.1). The enzymatic color reaction was stopped using

2 M H2SO4 (100 µl/well) and the absorption was detected via spectrophotometric measurements at 450 nm. As control cells were stained with secondary antibody only.

5.2.7. Integrin Activity Assay (Suspending Cells)

Cells were trypsinized and kept in suspension in DMEM supplemented with 0.5 % BSA and 10 µg/ml fibronectinIII9-12 for 15 min at 4 °C. The suspension medium was removed and cells were fixed with 4 % PFA for 10 min. Cells were washed with PBS, blocked in PBS supplemented with 10 % heat-inactivated CS and either stained for active β1 integrin (9EG7 1:300) or total β1 integrin (HMβ1-1 1:300) for 1 hour at RT under constant rotation. After incubation with the primary antibody, cells were washed thrice with PBS, blocked for 15 min and incubated with the corresponding secondary antibody Rhodamine-conjugated goat anti-rat IgG or anti-armenian hamster IgG (both 1:300) for 1 hour at RT under constant rotation. Finally cells were washed, kept on ice and the mean fluorescence intensity was measured via flow cytometry.

5.2.8. Immunofluorescence Staining for FACS Analysis

Cells were trypsinized, washed with PBS and fixed in 4 % PFA for 10 min at RT. Again cells were washed in PBS with subsequent blocking in PBS + 10 % heat-inactivated CS for 15 min. Afterwards cells were re-suspended in blocking solution supplemented with the first antibody and incubated for 45 min under constant rotation. The cells were washed thrice in PBS, blocked for 15 min and stained with the secondary antibody for 45 min under constant rotation. Finally cells were washed, re-suspended in 1 ml PBS and measured by flow cytometry.

97 5. Methods

5.2.9. Immunofluorescence Staining for Microscopic Preparations

The coverslips were coated with 1-2 µg/ml fibronectinIII9-12 in PBS for 1 h at 37 °C or overnight at 4 °C. The coating solution was removed; cells were seeded onto the coverslips and were allowed to adhere for the corresponding period of time. Afterwards the culture medium was removed and the cells were fixed with 4 % PFA supplemented with 0.1 % Triton X100 for 5 min at RT. The fixative was removed and cells were again fixed with 4 % PFA for 15 min. The cells were washed thrice with PBS and blocked for 20 min in blocking solution. The first antibody incubation was conducted in blocking solution for 1 h at RT. Afterwards the cells were washed thrice in PBS and blocked for another 20 min at RT. Incubation with the secondary antibody (all used 1:200) occurred for 1 h. Finally the cells were washed thrice in PBS and mounted with Dako mounting medium. Samples were imaged using a Leica AF6000 modular wide field system.

5.2.10. Single Cell Tracking

NHDFs were seeded onto collagen coated 24-well plates and were allowed to adhere for 1 hour. Cells were starved in in PromoCell fibroblast growth medium without Supplemented Mix for 4.5 hours. Finally NHDFs were stimulated with regular growth medium and imaged for 17 hours (15 min/frame).

MEFs were seeded in 24 well plates and incubated for 24 hours. Cells were starved in DMEM supplemented with 0.5 % BSA for 12 hours, afterwards stimulated with growth medium and imaged for 12 hours (30 min/frame). Single cells were tracked manually using ImageJ Particle tracking plugin and analyzed using the chemotaxis and migration tool (ibidi GmbH, München).

98 5. Methods

5.3. Work with Mice

5.3.1. Mice and Mice Maintenance

B6.129P2-PPM1Ftm1Dgen/J (PPM1F+/-) mice were obtained from The Jackson Laboratory. The targeted mutant was created and characterized by Deltagen and the construct insert is reported to be Lac0-SA-IRES-lacZ-Neo555G/Kan. Upon arrival at The Jackson Laboratory, these mice have been backcrossed at least 6 generations to C57BL/6 mice. A reporter gene (bacterial lacZ) was inserted into to the PPM1F gene such that the endogenous promoter drives expression of β-galactosidase.

At arrival at the University of Konstanz the mouse colony was maintained through mating of heterozygous PPM1F+/- and wildtype PPM1F+/+ C57BL/6 mice. The mice were kept in a fully air-conditioned room (21 °C and 55 % humidity) with 12 hours light-dark cycle, had access ad libitum to food and water and were housed in groups of 4- 6 animals.

5.3.2. Isolation of Genomic DNA from Tail Biopsies

The tail biopsies were digested overnight at 56 °C under constant shaking at 750 rpm in Laird’s buffer supplemented with 100 µg/ml proteinase K. The next morning the samples were centrifuged for 8 min at 14.000 rpm at RT. The supernatant was transferred into a 1.5 ml reaction tube containing 500 µl isopropanol and inverted several times. The samples were again centrifuged for 15 min at 4 °C at 14.000 rpm. Finally the supernatant was discarded, the DNA was allowed to dry for 3 hours at RT, resolved in 10 mM Tris-Cl pH 8.5 and stored at -20 °C.

5.3.3. Genotyping

Adult mice, pups and embryos were genotyped by amplification of DNA extracted from tail biopsies or isolated from mouse embryonic fibroblasts, respectively. The following PCR primers were used.

99 5. Methods

Wildtype-sense: 5’- CAACTCTCCATCATGCCCATCAG -3‘

Targeted allel-sense: 5’- GGGTGGGATTAGATAAATGCCTGCTCT -3’

Common-anti: 5’- AAGCAGGAAGGGACACGTGTCGGTC -3’

For genotyping a multiplex PCR with 32 cycles was performed with a primer annealing temperature of 59 °C and an elongation time of 40 sec yielding a 200 bps or 450 bps PCR fragment in the case of the wildtype or the targeted allele, respectively.

5.3.4. Generation of PPM1F Knockout Fibroblasts

Heterozygous PPM1F+/- knockout mice were allowed to breed overnight for 14 hours. The next morning the mice were separated and the presents of vaginal plugs were evaluated. Female mice showing a plug were defined as pregnant and this day was counted as embryonic day E0.5. 10.5 dpc the female mice were anesthetized via Isofluran and sacrificed. The uterus was dissected and placed into a PBS containing 10 cm dish. The uterus was cut between the implantation sites along the uterine horn into pieces containing single embryos. Afterwards embryos were isolated via removing the enveloped decidua tissue, the yolk sac and the amniotic sac with forceps. Each embryo was transferred into one well of a 12-well plate containing sterile PBS. Between each embryo preparation forceps were cleaned with ethanol to minimize the possibility of contaminations. The embryos were washed two times in sterile fibroblast growth medium supplemented with penicillin, streptomycin and ciprofloxacin and minced via up and down pipetting. The tissue homogenates were placed into 24-well plates coated with 0.1 % gelatin and 2 µg/ml human fibronectin. Fibroblasts were allowed to grow at

37 °C and 5 % CO2 supply for 24 hours. The day of fibroblast isolation was defined as cell passage number 0. Cells were monitored every day and passaged if necessary. After passage number 2 fibroblasts were immortalized via transduction with SV40 large T containing retrovirus for 36 hours.

At about cell passage number 12 sufficient cell material was present to isolate genomic DNA from all different cell lines. The genomic DNA was used to conduct a genotyping PCR.

100 5. Methods

5.3.5. LacZ Staining of Frozen Tissue Sections

PPM1F+/+ and PPM1F+/- mice were sacrificed and perfused with PBS. The organs were dissected and placed into 4 % PFA in PBS at 4 °C. The fixation time was adjusted to the size of tissue samples. After fixation the tissue was washed with PBS and cryo-protected. The fixed tissue was sequentially transferred to 10 % sucrose in PBS overnight at 4 °C, to 20 % sucrose for 3 hours at 4 °C and into 30 % sucrose for 3 hours at 4 °C. Finally samples were embedded in O.C.T Tissue-Tek using histology moulds and transferred to - 80 °C.

The sections were cut 10 µm thick using a cryostat at -25 °C and transferred to Poly-L- lysine-coated slides. The temperature of the cutting chamber was adjusted ±5 °C according to the tissue specimen. Sections were allowed to dry at 30 °C for 2 hours and transferred to -20 °C for storage.

At the day of use sections were transferred to RT and washed 3 times in PBS and 1 time in ddH2O each for 5 min. The X-gal dilution buffer was pre-warmed up to 37 °C before the substrate X-gal (1 mg/ml in N,N-diemthylformamide) was added. Incubation was conducted overnight at 37 °C in the dark. The next morning sections were washed 2 times in PBS and 1 time in ddH2O each for 5 min, dried and mounted with Dako mounting medium.

5.3.6. Fluorescent Immunohistochemistry Staining of Frozen Mouse Embryonic Tissue Sections

Heterozygous PPM1F+/- knockout mice were allowed to breed overnight for 14 hours. 10.5 dpc the female mouse was anesthetized and sacrificed. The embryos were dissected and placed into a 24-well plate containing PBS. Afterwards the embryos were fixed in 4 % PFA overnight at 4 °C. The embryos were washed with PBS and cryo-protected in 10 % sucrose in PBS until the tissue sinks. The embryos were transferred to a 20 % sucrose solution with subsequent incubation in 30 % sucrose solution each for about 2 hours (until tissue sinks) at 4 °C. The specimens were then incubated in 30 % sucrose and O.C.T Tissue-Tek (1:1) for 1 hour at RT with soft end-to-end rocking. Finally samples

101 5. Methods were embedded in O.C.T Tissue-Tek using histology molds, transferred to dry ice and stored at -80 °C.

Sections were cut using a cryostat (temperature of chamber: -30 °C; temperature of object: -25 °C) at 12 µm thickness and transferred to adhesion microscope slides (HistoBond+). Sections were dried at 30 °C for at least 2 hours and transferred to -20 °C for storage.

At the day of use sections were allowed to thaw at RT for several minutes, washed in PBS for 10 min, blocked in blocking solution (PBS + 1 % BSA + 1 % hiCS + 0.1 % TritonX100) for 30 min and followed by incubation of 1st antibody in blocking solution overnight at 4 °C. The next morning sections were washed thrice in PBS each for 10 min and incubated with the corresponding 2nd antibody (all 1:200) for 1 hour at RT. The slides were again washed 3 times in PBS, subsequently incubated in DAPI solution (1:2000) for 20 min, washed and mounted with Dako mounting medium.

5.3.7. Whole-Mount Histochemical Detection of β-Galactosidase Activity

Heterozygous PPM1F+/- knockout mice were allowed to breed overnight for 14 hours. 10.5 dpc the female mouse was anesthetized and sacrificed. The embryos were dissected and placed into a 24-well plate containing PBS. Afterwards embryos were fixed in β- galactosidase fixative for 90 min at RT. The embryos were washed 3 times in β- galactosidase wash buffer each for 20 min at RT with soft end-to-end rocking. Afterwards the embryos were incubated in β-galactosidase staining solution (β- galactosidase wash buffer supplemented with 1 mg/ml X-gal, 5 mM potassium ferricyanide and 5 mM potassium ferrocyanide) for 18 hours at 30 °C in the dark. The next morning the embryos were washed thrice in PBS each for 20 min and photographed.

102 5. Methods

5.3.8. Paraffin Embedding, Sectioning and Mounting of Whole-Mount Stained Embryos

Stained embryos (see 5.3.7.) were fixed for a second time with 3 % formaldehyde and 2 % glutaraldehyde in PBS pH 7.4 for 2 h at 4 °C. Afterwards the samples were rinsed with running tap water for 4 h at RT. The dehydration procedure was accomplished via the following steps. The samples were incubated in

 50 % isopropylalcohol overnight at 4 °C

 75 % isopropylalcohol for 4 h at 4 °C

 90 % isopropylalcohol for 4 h at 4 °C

 96 % isopropylalcohol overnight at 4 °C

 100 % isopropylalcohol 3 times each 3 h at RT

 Histoclear overnight at 4 °C

 Histoclear : Tissuewax (1:1) 5 h at 65 °C

 Tissuewax 4 h at 65 °C

 Tissuewax 2 days at 65 °C

After this procedure the samples were ready for embedding. The embedding molds were filled with molten paraffin wax and the embryos were immediately transferred to the molds using hot forceps. Afterwards an embedding ring was placed on the molds and filled with paraffin wax. The cast blocks were left at RT to harden completely. Then cast blocks were removed from the embedding molds and stored in a dry place at RT.

14 µm thick tissue sagittal sections were prepared using a microtome. The sections were transferred to adhesion microscope slides (HistoBond+) and allowed to dry for several hours at 30 °C. For dewaxing the slides were passed four times through Histoclear each for 5 min at RT and afterwards were allowed to dry for one day at RT. Finally sections were mounted with Roti-Histokitt, allowed to dry for another day and photographed.

103 5. Methods

5.3.9. Fixation, Paraffin Embedding and Sectioning of E10.5 Embryos

Heterozygous PPM1F+/- knockout mice were allowed to breed overnight for 14 hours. 10.5 dpc the female mouse was anesthetized and sacrificed. The embryos were dissected and placed into a 24-well plate containing sterile PBS. Afterwards embryos were fixed in Bouin’s fixative overnight at 4 °C. The next day the samples were washed four times with 70 % ethanol each for 2 hours at RT. The dehydration procedure was accomplished via the following steps. The samples were incubated in

 70 % isopropylalcohol overnight at 4 °C

 75 % isopropylalcohol for 4 h at 4 °C

 90 % isopropylalcohol for 4 h at 4 °C

 96 % isopropylalcohol overnight at 4 °C

 100 % isopropylalcohol 3 times each 1.5 h at RT

 Histoclear 2 times each 2 h at 4 °C

 Histoclear : Tissuewax (1:1) overnight at 65 °C

 Tissuewax 2 times each 4 h at 65 °C

 Tissuewax 2days at 65 °C

Afterwards the embryos were embedded in paraffin blocks, left at RT to harden completely and stored in a dry place at RT.

3 µm thick tissue sagittal sections were prepared using a microtome. The sections were transferred to adhesion microscope slides, allowed to dry for several hours at 30 °C, stored in a dry place at RT and subsequently H&E stained.

5.3.10. Behavioral Testing: 1-h Open Field Test

The open field test was performed with 3.5-4 months old male mice (littermates) 1.5 hours after the light was turned on in a blinded fashion. Every morning at the same time

104 5. Methods one wildtype and one heterozygous PPM1F+/- mouse were dropped into the center of an individual arena (60 x 40 x 40 cm) containing bedding material (Lignocel hygienic animal bedding, JRS) and recorded with a digital camera (Exilim 60 fps) for 1 hour. After every test the arenas were cleaned in a dish washer and the bedding material was exchanged. The total distance covered and the distribution within the arena was analyzed using EthoVision XT Base (Noldus) software. The rearing was manually counted by two observer blinded to the genotype of the mice.

5.4. Molecular Biological Methods

5.4.1. Generation of DNA Constructs

For the generation of GFP-, mCherry- and GST-tagged PPM1F, respectively, the cDNA of human PPM1F was obtained from Source BioScience (I.M.A.G.E. Full Length cDNA clone IRAUp969F10111D; Sequence accession BC071989). The following primers were used to amplify human PPM1F cDNA: hPPM1F-IF-sense: 5’-GAAGTTATCAGTCGACACCATGTCCTCTGGAGCCCC-3’ hPPM1F-IF-anti: 5’-ATGGTCTAGAAAGCTTGCCTAGCTTCTTGGTGGAGC-3’

The resulting PCR fragment was cloned into pDNR-CMV using the In-Fusion dry-down PCR Cloning Kit. The sequence-verified construct was used as donor vector and the insert was transferred by Cre-mediated recombination into the acceptor vectors pEGFP- C1-loxP, pmCherry-C1-loxP, pEBG-loxP (eukaryotic expression; Clontech) and pGEX- 4T1-loxP (prokaryotic expression; GE Healthcare), respectively, generating amino- terminal tagged fusion proteins.

For the re-expression of PPM1F and PPM1FD360A mutant (see 5.4.3) in PPM1F-/- fibroblasts the human PPM1F cDNA was amplified via the following primers: hPPM1F-XbaI-sense: 5’-TGCATCTAGAATGTCCTCTGGAGCCCCAC-3’ hPPM1F-BamHI-anti: 5’-CAGTAAGGATCCCTAGCTTCTTGGTGGAG-3’

105 5. Methods

The resulting PCR fragments were cloned into pRRL (pUltra; mammalian Expression, Lentiviral; pUltra was a gift from Malcolm Moore (Addgene plasmid # 24129)) and pRRL (pUltra-hot; Mammalian Expression, Lentiviral; pUltra-hot was a gift from Malcolm Moore (Addgene plasmid # 24130)) via XbaI and BamHI restriction sites leading to a bi- cistronic expression of GFP and mCherry, respectively, as well as the gene of interest.

For the construction of mCherry-tagged truncated Talin1 the murine Talin1 cDNA (kindly provided by R.Fässler) was amplified with the following primers: mTalin1-sense: 5’-GAAGTTATCAGTCGACACCATGGTTGCACTTTCACTGAAG-3’ mTalin1aa1-433-anti: 5’-ATGGTCTAGAAAGCTTGCTTACTGCAGGACTGTTGACTTTTTGG- 3’

The resulting PCR fragment was cloned into pDNR-CMV using the In-Fusion dry-down PCR Cloning Kit. The sequence-verified construct was used as donor vector and the insert was transferred by Cre-mediated recombination into the acceptor vector pmCherry-C1-loxP, generating an amino-terminal tagged fusion protein.

For construction of GFP-tagged β1 integrin the human β1 integrin cDNA was amplified with the following primers: hβ1Integrin-NheI-sense: 5’-GAGGACGCTAGCACCATGAATTTACAACCAATTTTCTG-3’ hβ1Integrin-AgeI-anti: 5’-GTGCGTACCGGTCGTTTTCCCTCATACTTCGG-3’

The resulting PCR fragment was cloned in the lentiviral vector pLL3.7 (Addgene) via NheI and AgeI restriction sites generating a C-terminal tagged GFP fusion protein.

For the production of recombinant GST-tagged β1 integrin-cytoplasmic tail was cloned into pGEX-4T1 (performed by Anne Berking).

The generation of the β1 Integrin TT788/789AA and TT788/789DD mutant was achieved via gene synthesis and insertion of the product into pEX-A packaging plasmid by Eurofins Genomics. The cDNA was amplified via the following primers: hβ1Integrin-cyto-EcoRI-sense: 5’-ATAGAATTCTGGAAGCTTTTAATGATAATTC-3’ hβ1Integrin-cyto-XhoI-anti: 5’-ATACTCGAGTCATTTTCCCTCATACTTCG-3’

106 5. Methods

The PCR fragment was cloned into pGEX-4T1 via EcoRI and XhoI restriction sites resulting in an amino-terminal GST-tagged fusion protein.

5.4.2. SOEing (Synthesis by Overlap Extension) PCR for the Generation of a PPM1F Rescue Mutant

For the generation of the PPM1F rescue mutant a SOEing-PCR strategy was employed. In a first standard PCR reaction two intermediate fragments were amplified via two external primers harbouring SalI and BamHI restriction sites as well as two internal SOEing primers. The internal SOEing primers were constructed to have overlapping homologous ends harboring the silent mutations for the shRNA rescue.

PPM1F-SalI-external-sense: 5’-GAAGTTATCAGTCGACACCATGTCCTCTGGAGCCCC-3’

SOEing-PPM1F-internal-anti:

5’-CGCTTAATCCAAACAGCTGATTGAAGGAAGGGAGGGACACGTGCC-3’ and

SOEing-PPM1F-internal-sense:

5’-TTCAATCAGCTGTTTGGATTAAGCGACCCTGTGAACCGCGCCTAC-3’

PPM1F-BamHI-external-anti: 5’-CAGTAAGGATCCCTAGCTTCTTGGTGGAG-3’

In a second SOEing PCR reaction the two intermediate PCR products (first intermediate fragment PPM1Faa1-178 and second intermediate fragment PPM1Faa179-end) were combined, attached to each other due to their short overlap of complementary sequence and again amplified with the external primers.

The mutated full length PPM1F cDNA was finally cloned into pDNR-CMV using SalI and BamHI restriction sites. The sequence-verified construct was used as donor vector and the insert was transferred by Cre-mediated recombination into pmCherry-C1-loxP generating a mCherry- tagged PPM1F rescue mutant.

107 5. Methods

5.4.3. Site Directed Mutagenesis

The truncated PPM1Faa179-end version (see 5.4.2.) was cloned into pBS SK(+) (Stratagene) via PstI/EcoRV and BamHI restriction sites. To generate a phosphatase- dead mutant a point mutation D360A as well as an additional restriction site (NheI) was inserted into the corresponding primer pair. The whole vector was amplified in a touch- down PCR (11 cycles: annealing temperature 65 °C - 1 °C per cycle; 15 cycles: annealing temperature 55 °C) with the following primers:

PPM1F-D360A-sense: 5’-GACTACCTGCTGCTAGCCTGTGCTGGCTTCTTTGACGTCG-3’

PPM1F-D360A-anti: 5’-GTCAAAGAAGCCAGCACAGGCTAGCAGCAGGTAGTCCTC-3’

The template DNA was eliminated via Dpn1 enzyme restriction digestion, positive clones were identified via NheI digestion and the insertion of D360A point mutation was controlled by sequencing. Again in a standard PCR reaction the two intermediate fragments (PPM1Faa1-178 and PPM1Faa179-end D360A (see 5.4.2.)) were amplified via the two external primers and the two internal SOEing primers (see 5.4.2). The second SOEing PCR reaction combined the two intermediate PCR products generating a full- length phosphatase dead mutant. The mutant was cloned into pDNR-CMV using SalI and BamHI restriction sites. By Cre-mediated recombination into pmCherry-C1-loxP and pEBG-loxP, respectively, a mCherry- and GST-tagged PPM1F phosphatase dead mutant was generated also harboring the rescue mutation for the re-expression in PPM1F knockdown cells.

5.4.4. ShRNA Construction and Cloning

For the generation of recombinant, shRNA-expressing lentiviral particles the shRNA vector system pLKO.1 developed by Stewart and colleagues (Stewart et al. 2003) was applied. The different shRNA were designed by using the AAN19 algorithm and a siRNA selection program of the Whitehead Institute for Biomedical Research (available online at http://jura.wi.mit.edu/bioc/siRNAext/). According to the prediction of the siRNA selection program two complementary primers were synthesized. The primers were annealed and cloned via AgeI and EcoRI restriction sites into pLKO.1 (pLKO.1 was a gift

108 5. Methods from Bob Weinberg (Addgene plasmid # 8453)). The correct insertion of the shRNA cassette was verified by sequencing

5.5. Protein Biochemical Methods

5.5.1. Expression and Phosphate-Free Purification of GST-Tagged PPM1F and PPM1FD360A in HEK293T Cells

HEK 293T cells were transfected by standard calcium-phosphate co-precipitation using 8 µg (per 10 cm culture dish) of plasmid DNA encoding for GST-tagged PPM1F or PPM1FD360A, respectively. 48 hours after transfection cells were lysed in 1 ml lysis buffer per 10 cm culture dish. Cleared lysates were incubated with Glutathione- Sepharose beads for 3 hours under constant rotation at 4 °C. Afterwards the beads were pelleted via centrifugation at 2500 rpm for 5 min at 4 °C. The supernatant was discarded and the beads were washed thrice in lysis buffer and once in GST buffer. For the elution of the GST-fusion proteins the beads were incubated in GST buffer supplemented with 10 mM reduced L-glutathione twice for 20 min at 4 °C under constant rotation. Aliquots were transferred to liquid nitrogen and long term storage occurred at -80 °C.

5.5.2. In vitro Kinase Assay

HEK 293T cells were transfected by standard calcium-phosphate co-precipitation using 7 µg (per 10 cm culture dish) of plasmid DNA encoding for GFP-tagged CaMKIIβT287D or CaMKIIβK43R, respectively. 48 hours after transfection cells were lysed in 500 µl Ripa buffer per 10 cm culture dish. Cleared lysates were incubated with GFP-Trap beads (ChromoTek) for 2 hours under constant rotation at 4 °C. Afterwards the beads were pelleted via centrifugation at 2700 g for 3 min. The supernatant was discarded and the beads were washed thrice in GFP-Trap dilution buffer and thrice in kinase buffer. The CaMKIIβ was re-suspended in 40 µl kinase buffer supplemented or not with 200 µM

ATP, 1.2 µM calmodulin and 2 mM CaCl2 and incubated for 10 min at 30 °C. The kinase assay was started by adding 2 µg of purified β1 integrin GST-fusion protein and

109 5. Methods incubated for 30 to 60 min at 30 °C under constant shaking at 1000 rpm. The reaction was stopped via the addition of 4x SDS sample buffer.

5.5.3. In vitro Phosphatase Assay

For the in vitro phosphatase assay the CaMKIIβ phosphorylated cytoplasmic tail of β1 integrin (see 5.5.2.) was incubated with 2 µg bacterial expressed, GST-tagged PPM1F or PPM1FD360A mutant in phosphatase buffer for 1 hour at 30 °C under constant shaking at 1000 rpm. The reactions were stopped via the addition of 4x SDS sample buffer.

For the phosphatase assay with phospho-peptides the following peptides were used:

β1pTpT788/789, β1pT788, β1pT789 and MLC2pT10.

Recombinant GST-tagged PPM1F or PPM1FD360A mutant, respectively, and 100 µM of the corresponding phospho-peptide were incubated in phosphatase buffer for 1h at 30 °C under constant shaking at 750 rpm. Afterwards the same volume of Malachite green solution was added and the OD615 was measured.

5.5.4. Protein Microarray

Recombinant expressed GST-fusion proteins of wild-type β1 Integrin cytoplasmic tail, β1 Integrin TT788/789AA (TT/AA) and TT788/789DD (TT/DD) were immobilized on NHS-modified microarray glass slides (Nexterion H, Schott). Uniform orientation of GST- proteins was achieved via in situ surface immobilization. Purified GST-proteins were diluted in print buffer (150 mM NaHPO4 pH 8.5, 5 % Glycerol, 0.01 % Tween 20, 150 mM GSH) to a final concentration of 1µg/µl and spotted in dodecaplicates onto microarray glass slides using a piezoelectric non-contact microarray printer (NanoPlotter 2.1, GeSim, Dresden, Germany). Each array consisted of 2 x 6 spots of the respective GST- protein and 6 BSA spots with a spot to spot distance of 0.714 mm. After 1 h incubation at 70% humidity, the slide was transferred to a humidity chamber (75 %) for 16 h at 20 °C. Afterwards, slides were attached to a 16 well incubation chamber (16 Pad FAST Slide incubation chamber, Whatman) and quenched in 40 mM Ethanolamine in borate buffer

110 5. Methods

(pH 8.5) for 1 h. Consecutive washing steps were performed (2x PBS 0.01 % Tween, 1x

PBS, 1x ddH2O) and slides were dried by compressed air flow. Slides were incubated overnight at 4 °C with whole cell lysates from HEK293T cells (NP-40 Lysis buffer pH 7.4:

1 % NP-40, 100 mM NaCl 50mM TrisHCL, 1 mM EGTA, 1 mM Na3VO4, 50 mM NaF 1.5 mM MgCL2 0.1 % deoxycholate, inhibitor cocktail) either expressing GFP as control or a GFP-fusion protein of truncated FilaminA (IgFLN19-21). Comparable amounts of GFP- fusion proteins in whole cell lysates were validated by western blotting. The next day, slides were thoroughly washed (2x PBS 0.1 % Tween 20, 2x PBS 0.01 % Tween, 1x PBS,

1x ddH2O) and probed with polyclonal anti-GFP antibody (rabbit, 1:100 in 0.05 % PBS- T) or polyclonal anti-GST antibody (rabbit, 1:1000 in 0.05 % PBS-T) for 1h at RT. After washing (2x PBS 0.1 % Tween 20, 2x PBS 0.01 % Tween, 1x PBS), secondary Cy3-labeled antibody (goat anti rabbit, 1:300 in PBS-T 0.01 %) was applied for 1h at RT. Finally, secondary antibody was aspired, slides were removed from the incubation chamber, washed extensively (2x PBS 0.1 % Tween 20, 2x PBS 0.01 % Tween, 1x PBS, 1x ddH2O) and dried by compressed air. A TECAN® LS-Reloaded microarray scanner was used to scan the printed glass slides.

5.5.5. Generation of a Polyclonal Antibody Directed Against mPPM1F

For the generation of His-Sumo-tagged PPM1F the cDNA of murine PPM1F was obtained from Source BioScience (I.M.A.G.E. Full Length cDNA clone IRAVp968A0987D; Sequence accession BC042570). The following primers were used to amplify murine PPM1F cDNA: mPPM1F-BamHI-sense: 5’-GCTTTAGGATCCAATGGCCTCTGGAGCCGCACAGAAC-3’ mPPM1F-HindIII-anti: 5’-CGCCCGTCAAGCTTCTTAGCTTCTCTGTGAGGTATTAC-3’

The resulting PCR fragment was cloned into pET24aHis-Sumo bacterial expression vector via BamHI and HindIII restriction sites. The sequence-verified construct was transformed into competent E. coli BL21 (DE3) and expression of the recombinant protein was induced at OD580= 0.67 with 0.5 mM IPTG at 30 °C for 4.5 hours. Afterwards the bacteria were lysed in 50 mM sodium phosphate buffer pH 8, 1 M NaCl, Pefabloc, Aprotinin, Leupeptin and PMSF. Cleared lysates were put onto a HisTrap FF crude column (GE Healthcare) and washed with 50 mM sodium phosphate buffer pH 8, 1 M

111 5. Methods

NaCl and 25 mM imidazole. Finally the His-Sumo-tagged protein was eluted with 50 mM sodium phosphate buffer pH 8, 0.5 M NaCl and 0.5 M imidazole.

The His-Sumo-tag was cleaved via addition of 60 µg Ulp1 protease to 12 mg of the His- Sumo-tag recombinant protein overnight at 4 °C. The next day the reaction was put onto a HisTrap FF crude column and the flow-through was collected. The amount as well as the purity of the recombinant mPPM1F was analyzed via SDS-gel electrophoresis.

100 µg purified recombinant mPPM1F was injected subcutaneously in a New Zealand White Rabbit as emulsions in Lipopeptide Adjuvant (EMC microcollections GmbH). The immunization was repeated thrice at 3 weeks interval. The rabbit’s immune status was controlled via collection of pre-immune serum and immune serum after the fourth immunization and used for western blot analysis.

112 6. References

6. References

Alonso, A., J. Sasin, et al. (2004). "Protein tyrosine phosphatases in the human genome." Cell 117(6): 699-711.

Anderson, D. C. and T. A. Springer (1987). "Leukocyte adhesion deficiency: an inherited defect in the Mac-1, LFA-1, and p150,95 glycoproteins." Annu Rev Med 38: 175- 194.

Anthis, N. J., K. L. Wegener, et al. (2009). "The structure of an integrin/talin complex reveals the basis of inside-out signal transduction." EMBO J 28(22): 3623-3632.

Anton, E. S., J. A. Kreidberg, et al. (1999). "Distinct functions of alpha3 and alpha(v) integrin receptors in neuronal migration and laminar organization of the cerebral cortex." Neuron 22(2): 277-289.

Arruda-Carvalho, M., L. Restivo, et al. (2014). "Conditional deletion of alpha-CaMKII impairs integration of adult-generated granule cells into dentate gyrus circuits and hippocampus-dependent learning." J Neurosci 34(36): 11919-11928.

Ashton, G. H., W. H. McLean, et al. (2004). "Recurrent mutations in kindlin-1, a novel keratinocyte focal contact protein, in the autosomal recessive skin fragility and photosensitivity disorder, Kindler syndrome." J Invest Dermatol 122(1): 78-83.

Baba, H., N. Sueyoshi, et al. (2012). "Regulation of Ca(2+)/calmodulin-dependent protein kinase phosphatase (CaMKP) by oxidation/reduction at Cys-359." Arch Biochem Biophys 526(1): 9-15.

Bandyopadhyay, A. and S. Raghavan (2009). "Defining the role of integrin alphavbeta6 in cancer." Curr Drug Targets 10(7): 645-652.

Barczyk, M., S. Carracedo, et al. (2010). "Integrins." Cell Tissue Res 339(1): 269-280.

Belova, G. I., O. N. Demidov, et al. (2005). "Chemical inhibition of Wip1 phosphatase contributes to suppression of tumorigenesis." Cancer Biol Ther 4(10): 1154-1158.

Bledzka, K., K. Bialkowska, et al. (2010). "Tyrosine phosphorylation of integrin beta3 regulates kindlin-2 binding and integrin activation." J Biol Chem 285(40): 30370- 30374.

Bottcher, R. T., C. Stremmel, et al. (2012). "Sorting nexin 17 prevents lysosomal degradation of beta1 integrins by binding to the beta1-integrin tail." Nat Cell Biol 14(6): 584-592.

Bouvard, D., J. Pouwels, et al. (2013). "Integrin inactivators: balancing cellular functions in vitro and in vivo." Nat Rev Mol Cell Biol 14(7): 430-442.

Bouvard, D., L. Vignoud, et al. (2003). "Disruption of focal adhesions by integrin cytoplasmic domain-associated protein-1 alpha." J Biol Chem 278(8): 6567-6574.

113 6. References

Bullard, D. C., K. Scharffetter-Kochanek, et al. (1996). "A polygenic mouse model of psoriasiform skin disease in CD18-deficient mice." Proc Natl Acad Sci U S A 93(5): 2116-2121.

Calderwood, D. A. (2004). "Integrin activation." J Cell Sci 117(Pt 5): 657-666.

Calderwood, D. A. (2004). "Talin controls integrin activation." Biochem Soc Trans 32(Pt3): 434-437.

Calderwood, D. A., R. Zent, et al. (1999). "The Talin head domain binds to integrin beta subunit cytoplasmic tails and regulates integrin activation." Journal of Biological Chemistry 274(40): 28071-28074.

Campbell, I. D. and M. H. Ginsberg (2004). "The talin-tail interaction places integrin activation on FERM ground." Trends Biochem Sci 29(8): 429-435.

Carter, M. D., C. R. Shah, et al. (2011). "Absence of preference for social novelty and increased grooming in integrin beta3 knockout mice: initial studies and future directions." Autism Res 4(1): 57-67.

Chen, C., D. G. Rainnie, et al. (1994). "Abnormal fear response and aggressive behavior in mutant mice deficient for alpha-calcium-calmodulin kinase II." Science 266(5183): 291-294.

Chen, Y. P., I. Djaffar, et al. (1992). "Ser-752-->Pro mutation in the cytoplasmic domain of integrin beta 3 subunit and defective activation of platelet integrin alpha IIb beta 3 (glycoprotein IIb-IIIa) in a variant of Glanzmann thrombasthenia." Proc Natl Acad Sci U S A 89(21): 10169-10173.

Chin-Sang, I. D. and A. M. Spence (1996). "Caenorhabditis elegans sex-determining protein FEM-2 is a protein phosphatase that promotes male development and interacts directly with FEM-3." Genes Dev 10(18): 2314-2325.

Ciobanasu, C., B. Faivre, et al. (2012). "Actin dynamics associated with focal adhesions." Int J Cell Biol 2012: 941292.

Clemetson, K. J. and J. M. Clemetson (1998). "Integrins and cardiovascular disease." Cell Mol Life Sci 54(6): 502-513.

Cohen, P. (2001). "The role of protein phosphorylation in human health and disease. The Sir Hans Krebs Medal Lecture." Eur J Biochem 268(19): 5001-5010.

Costell, M., E. Gustafsson, et al. (1999). "Perlecan maintains the integrity of cartilage and some basement membranes." J Cell Biol 147(5): 1109-1122.

Critchley, D. R. (2004). "Cytoskeletal proteins talin and vinculin in integrin-mediated adhesion." Biochem Soc Trans 32(Pt 5): 831-836.

De Melker, A. A., D. Kramer, et al. (1997). "The two phenylalanines in the GFFKR motif of the integrin alpha6A subunit are essential for heterodimerization." Biochem J 328 ( Pt 2): 529-537.

114 6. References

Dechert, M. A., J. M. Holder, et al. (2001). "p21-activated kinase 1 participates in tracheal smooth muscle cell migration by signaling to p38 Mapk." Am J Physiol Cell Physiol 281(1): C123-132.

Dedhar, S. and G. E. Hannigan (1996). "Integrin cytoplasmic interactions and bidirectional transmembrane signalling." Curr Opin Cell Biol 8(5): 657-669.

Desiniotis, A. and N. Kyprianou (2011). "Significance of talin in cancer progression and metastasis." Int Rev Cell Mol Biol 289: 117-147.

Easty, D., W. Gallagher, et al. (2006). "Protein tyrosine phosphatases, new targets for cancer therapy." Curr Cancer Drug Targets 6(6): 519-532.

Eksioglu, Y. Z., I. E. Scheffer, et al. (1996). "Periventricular heterotopia: an X-linked dominant epilepsy locus causing aberrant cerebral cortical development." Neuron 16(1): 77-87.

Fagerholm, S. C., T. J. Hilden, et al. (2004). "P marks the spot: site-specific integrin phosphorylation regulates molecular interactions." Trends Biochem Sci 29(9): 504- 512.

Faix, J. and R. Grosse (2006). "Staying in shape with formins." Dev Cell 10(6): 693-706.

Feng, Y., M. H. Chen, et al. (2006). "Filamin A (FLNA) is required for cell-cell contact in vascular development and cardiac morphogenesis." Proc Natl Acad Sci U S A 103(52): 19836-19841.

Feng, Y. and C. A. Walsh (2004). "The many faces of filamin: a versatile molecular scaffold for cell motility and signalling." Nat Cell Biol 6(11): 1034-1038.

Fournier, H. N., S. Dupe-Manet, et al. (2002). "Integrin cytoplasmic domain-associated protein 1alpha (ICAP-1alpha ) interacts directly with the metastasis suppressor nm23-H2, and both proteins are targeted to newly formed cell adhesion sites upon integrin engagement." J Biol Chem 277(23): 20895-20902.

Franco, S. J., M. A. Rodgers, et al. (2004). "Calpain-mediated proteolysis of talin regulates adhesion dynamics." Nat Cell Biol 6(10): 977-983.

Friedrichs, K., P. Ruiz, et al. (1995). "High expression level of alpha 6 integrin in human breast carcinoma is correlated with reduced survival." Cancer Res 55(4): 901-906.

Fujisawa, H. (2001). "Regulation of the activities of multifunctional Ca2+/calmodulin- dependent protein kinases." J Biochem 129(2): 193-199.

Gao, J., A. A. Khan, et al. (2013). "A feedback regulation between Kindlin-2 and GLI1 in prostate cancer cells." FEBS Lett 587(6): 631-638.

Gawecka, J. E., S. S. Young-Robbins, et al. (2012). "RSK2 protein suppresses integrin activation and fibronectin matrix assembly and promotes cell migration." J Biol Chem 287(52): 43424-43437.

115 6. References

Gee, C. E. and I. M. Mansuy (2005). "Protein phosphatases and their potential implications in neuroprotective processes." Cell Mol Life Sci 62(10): 1120-1130.

Geiger, B., A. Bershadsky, et al. (2001). "Transmembrane extracellular matrix-- cytoskeleton crosstalk." Nat Rev Mol Cell Biol 2(11): 793-805.

Georges-Labouesse, E., M. Mark, et al. (1998). "Essential role of alpha 6 integrins in cortical and retinal lamination." Curr Biol 8(17): 983-986.

Georges-Labouesse, E., N. Messaddeq, et al. (1996). "Absence of integrin alpha 6 leads to epidermolysis bullosa and neonatal death in mice." Nat Genet 13(3): 370-373.

Giancotti, F. G. and E. Ruoslahti (1990). "Elevated levels of the alpha 5 beta 1 fibronectin receptor suppress the transformed phenotype of Chinese hamster ovary cells." Cell 60(5): 849-859.

Goksoy, E., Y. Q. Ma, et al. (2008). "Structural basis for the autoinhibition of talin in regulating integrin activation." Mol Cell 31(1): 124-133.

Goodman, S. L. and M. Picard (2012). "Integrins as therapeutic targets." Trends Pharmacol Sci 33(7): 405-412.

Gotz, M. and W. B. Huttner (2005). "The cell biology of neurogenesis." Nat Rev Mol Cell Biol 6(10): 777-788.

Grabbe, S., G. Varga, et al. (2002). "Beta2 integrins are required for skin homing of primed T cells but not for priming naive T cells." J Clin Invest 109(2): 183-192.

Graus-Porta, D., S. Blaess, et al. (2001). "Beta1-class integrins regulate the development of laminae and folia in the cerebral and cerebellar cortex." Neuron 31(3): 367-379.

Gruber, G., J. Hess, et al. (2005). "Correlation between the tumoral expression of beta3- integrin and outcome in cervical cancer patients who had undergone radiotherapy." Br J Cancer 92(1): 41-46.

Guergnon, J., F. Dessauge, et al. (2006). "Use of penetrating peptides interacting with PP1/PP2A proteins as a general approach for a drug phosphatase technology." Mol Pharmacol 69(4): 1115-1124.

Halfter, W., S. Dong, et al. (2002). "A critical function of the pial basement membrane in cortical histogenesis." J Neurosci 22(14): 6029-6040.

Harburger, D. S. and D. A. Calderwood (2009). "Integrin signalling at a glance." J Cell Sci 122(Pt 2): 159-163.

Harvey, B. P., S. S. Banga, et al. (2004). "Regulation of the multifunctional Ca2+/calmodulin-dependent protein kinase II by the PP2C phosphatase PPM1F in fibroblasts." J Biol Chem 279(23): 24889-24898.

116 6. References

Herz, C., M. Aumailley, et al. (2006). "Kindlin-1 is a phosphoprotein involved in regulation of polarity, proliferation, and motility of epidermal keratinocytes." J Biol Chem 281(47): 36082-36090.

Hilden, T. J., L. Valmu, et al. (2003). "Threonine phosphorylation sites in the beta 2 and beta 7 leukocyte integrin polypeptides." J Immunol 170(8): 4170-4177.

Hill, C. S., J. Wynne, et al. (1995). "The Rho family GTPases RhoA, Rac1, and CDC42Hs regulate transcriptional activation by SRF." Cell 81: 1159-1170.

Hodivala-Dilke, K. M., K. P. McHugh, et al. (1999). "Beta3-integrin-deficient mice are a model for Glanzmann thrombasthenia showing placental defects and reduced survival." J Clin Invest 103(2): 229-238.

Hoon, J. L., H. Y. Li, et al. (2014). "POPX2 phosphatase regulates cell polarity and centrosome placement." Cell Cycle 13(15): 2459-2468.

Hornbeck, P. V., J. M. Kornhauser, et al. (2012). "PhosphoSitePlus: a comprehensive resource for investigating the structure and function of experimentally determined post-translational modifications in man and mouse." Nucleic Acids Res 40(Database issue): D261-270.

Humphries, J. D., A. Byron, et al. (2006). "Integrin ligands at a glance." J Cell Sci 119(Pt 19): 3901-3903.

Humphries, M. J., E. J. Symonds, et al. (2003). "Mapping functional residues onto integrin crystal structures." Curr Opin Struct Biol 13(2): 236-243.

Huttenlocher, A., M. H. Ginsberg, et al. (1996). "Modulation of cell migration by integrin- mediated cytoskeletal linkages and ligand-binding affinity." J Cell Biol 134(6): 1551-1562.

Huynh, N., K. H. Liu, et al. (2010). "P21-activated kinase 1 stimulates colon cancer cell growth and migration/invasion via ERK- and AKT-dependent pathways." Biochim Biophys Acta 1803(9): 1106-1113.

Hynes, R. O. (2002). "Integrins: bidirectional, allosteric signaling machines." Cell 110(6): 673-687.

Ishida, A., I. Kameshita, et al. (1998). "A novel protein phosphatase that dephosphorylates and regulates Ca2+/calmodulin-dependent protein kinase II." J Biol Chem 273(4): 1904-1910.

Ishida, A., Y. Shigeri, et al. (2003). "Protein phosphatases that regulate multifunctional Ca2+/calmodulin-dependent protein kinases: from biochemistry to pharmacology." Pharmacol Ther 100(3): 291-305.

Ishida, A., K. Tsumura, et al. (2013). "An active C-terminally truncated form of Ca (2+) /calmodulin-dependent protein kinase phosphatase-N (CaMKP-N/PPM1E)." Biomed Res Int 2013: 134813.

117 6. References

Janssens, V., S. Longin, et al. (2008). "PP2A holoenzyme assembly: in cauda venenum (the sting is in the tail)." Trends Biochem Sci 33(3): 113-121.

Jobard, F., B. Bouadjar, et al. (2003). "Identification of mutations in a new gene encoding a FERM family protein with a pleckstrin homology domain in Kindler syndrome." Hum Mol Genet 12(8): 925-935.

Johnson, S. A. and T. Hunter (2005). "Kinomics: methods for deciphering the kinome." Nat Methods 2(1): 17-25.

Jung, J., J. M. Kim, et al. (2010). "Newly identified tumor-associated role of human Sharpin." Mol Cell Biochem 340(1-2): 161-167.

Kameshita, I., A. Ishida, et al. (1999). "Phosphorylation and activation of Ca2+/calmodulin-dependent protein kinase phosphatase by Ca2+/calmodulin- dependent protein kinase II." FEBS Lett 456(2): 249-252.

Kanchanawong, P., G. Shtengel, et al. (2010). "Nanoscale architecture of integrin-based cell adhesions." Nature 468(7323): 580-584.

Kato, H., Z. Liao, et al. (2012). "The primacy of beta1 integrin activation in the metastatic cascade." PLoS One 7(10): e46576.

Kiema, T., Y. Lad, et al. (2006). "The molecular basis of filamin binding to integrins and competition with talin." Mol Cell 21(3): 337-347.

Kim, C., F. Ye, et al. (2012). "Talin activates integrins by altering the topology of the beta transmembrane domain." J Cell Biol 197(5): 605-611.

Kindler, T. (1954). "Congenital poikiloderma with traumatic bulla formation and progressive cutaneous atrophy." Br J Dermatol 66(3): 104-111.

Kino, Y., C. Washizu, et al. (2015). "FUS/TLS deficiency causes behavioral and pathological abnormalities distinct from amyotrophic lateral sclerosis." Acta Neuropathol Commun 3(1): 24.

Kirk, R. I., M. R. Sanderson, et al. (2000). "Threonine phosphorylation of the beta 3 integrin cytoplasmic tail, at a site recognized by PDK1 and Akt/PKB in vitro, regulates Shc binding." J Biol Chem 275(40): 30901-30906.

Koh, C. G., E. J. Tan, et al. (2002). "The p21-activated kinase PAK is negatively regulated by POPX1 and POPX2, a pair of serine/threonine phosphatases of the PP2C family." Curr Biol 12(4): 317-321.

Lammers, T. and S. Lavi (2007). "Role of type 2C protein phosphatases in growth regulation and in cellular stress signaling." Crit Rev Biochem Mol Biol 42(6): 437- 461.

Landen, C. N., T. J. Kim, et al. (2008). "Tumor-selective response to antibody-mediated targeting of alphavbeta3 integrin in ovarian cancer." Neoplasia 10(11): 1259-1267.

118 6. References

Lander, E. S., L. M. Linton, et al. (2001). "Initial sequencing and analysis of the human genome." Nature 409(6822): 860-921.

Larson, R. S., A. L. Corbi, et al. (1989). "Primary structure of the leukocyte function- associated molecule-1 alpha subunit: an integrin with an embedded domain defining a protein superfamily." J Cell Biol 108(2): 703-712.

Lee, H. S., C. J. Lim, et al. (2009). "RIAM activates integrins by linking talin to ras GTPase membrane-targeting sequences." J Biol Chem 284(8): 5119-5127.

Lee, S. H., M. Eom, et al. (2001). "BetaPix-enhanced p38 activation by Cdc42/Rac/PAK/MKK3/6-mediated pathway. Implication in the regulation of membrane ruffling." J Biol Chem 276(27): 25066-25072.

Legate, K. R. and R. Fassler (2009). "Mechanisms that regulate adaptor binding to beta- integrin cytoplasmic tails." J Cell Sci 122(Pt 2): 187-198.

Lenter, M., H. Uhlig, et al. (1993). "A monoclonal antibody against an activation epitope on mouse integrin chain beta 1 blocks adhesion of lymphocytes to the endothelial integrin alpha 6 beta 1." Proc Natl Acad Sci U S A 90(19): 9051-9055.

Lesch, K. P., N. Timmesfeld, et al. (2008). "Molecular genetics of adult ADHD: converging evidence from genome-wide association and extended pedigree linkage studies." J Neural Transm 115(11): 1573-1585.

Lipska, B. K., G. E. Jaskiw, et al. (1993). "Postpubertal emergence of hyperresponsiveness to stress and to amphetamine after neonatal excitotoxic hippocampal damage: a potential animal model of schizophrenia." Neuropsychopharmacology 9(1): 67-75.

Liu, Z., F. Wang, et al. (2008). "Integrin alpha(v)beta(3)-Targeted Cancer Therapy." Drug Dev Res 69(6): 329-339.

Lu, X., D. Lu, et al. (2008). "The role of integrins in cancer and the development of anti- integrin therapeutic agents for cancer therapy." Perspect Medicin Chem 2: 57-73.

Manning, G., D. B. Whyte, et al. (2002). "The protein kinase complement of the human genome." Science 298(5600): 1912-1934.

Manser, E., T. H. Loo, et al. (1998). "PAK kinases are directly coupled to the PIX family of nucleotide exchange factors." Mol Cell 1(2): 183-192.

Martel, V., C. Racaud-Sultan, et al. (2001). "Conformation, localization, and integrin binding of talin depend on its interaction with phosphoinositides." J Biol Chem 276(24): 21217-21227.

Martin, K. H., J. K. Slack, et al. (2002). "Integrin connections map: to infinity and beyond." Science 296(5573): 1652-1653.

McConnell, J. L. and B. E. Wadzinski (2009). "Targeting protein serine/threonine phosphatases for drug development." Mol Pharmacol 75(6): 1249-1261.

119 6. References

McHugh, K. P., K. Hodivala-Dilke, et al. (2000). "Mice lacking beta3 integrins are osteosclerotic because of dysfunctional osteoclasts." J Clin Invest 105(4): 433-440.

Meves, A., C. Stremmel, et al. (2009). "The Kindlin protein family: new members to the club of focal adhesion proteins." Trends Cell Biol 19(10): 504-513.

Millon-Fremillon, A., D. Bouvard, et al. (2008). "Cell adaptive response to extracellular matrix density is controlled by ICAP-1-dependent beta1-integrin affinity." J Cell Biol 180(2): 427-441.

Millon-Frémillon, A., M. Brunner, et al. (2013). "CaMKII-mediated intramolecular opening of Integrin Cytoplasmic domain Associated Protein-1 (ICAP1a) negatively regulates ß1 integrins." JBC.

Montanez, E., S. Ussar, et al. (2008). "Kindlin-2 controls bidirectional signaling of integrins." Genes Dev 22(10): 1325-1330.

Moser, M., B. Nieswandt, et al. (2008). "Kindlin-3 is essential for integrin activation and platelet aggregation." Nat Med 14(3): 325-330.

Nallapalli, R. K., M. X. Ibrahim, et al. (2012). "Targeting filamin A reduces K-RAS-induced lung adenocarcinomas and endothelial response to tumor growth in mice." Mol Cancer 11: 50.

Nelson, E. J., J. Li, et al. (2005). "Three novel beta-propeller mutations causing Glanzmann thrombasthenia result in production of normally stable pro-alphaIIb, but variably impaired progression of pro-alphaIIbbeta3 from endoplasmic reticulum to Golgi." J Thromb Haemost 3(12): 2773-2783.

Nichols, S. A., W. Dirks, et al. (2006). "Early evolution of animal cell signaling and adhesion genes." Proc Natl Acad Sci U S A 103(33): 12451-12456.

Nieves, B., C. W. Jones, et al. (2010). "The NPIY motif in the integrin β1 tail dictates the requirement for talin-1 in outside-in signaling." Journal of Cell Science 123(8): 1216-1226.

Nilsson, S., D. Kaniowska, et al. (2006). "Threonine 788 in integrin subunit beta1 regulates integrin activation." Exp Cell Res 312(6): 844-853.

Nip, J., H. Shibata, et al. (1992). "Human melanoma cells derived from lymphatic metastases use integrin alpha v beta 3 to adhere to lymph node vitronectin." J Clin Invest 90(4): 1406-1413.

Nurden, A. T. (2006). "Glanzmann thrombasthenia." Orphanet J Rare Dis 1: 10.

O'Toole, T. E., Y. Katagiri, et al. (1994). "Integrin cytoplasmic domains mediate inside-out signal transduction." J Cell Biol 124(6): 1047-1059.

Oliva-Trastoy, M., V. Berthonaud, et al. (2007). "The Wip1 phosphatase (PPM1D) antagonizes activation of the Chk2 tumour suppressor kinase." Oncogene 26(10): 1449-1458.

120 6. References

Olsen, J. V., B. Blagoev, et al. (2006). "Global, In Vivo, and Site-Specific Phosphorylation Dynamics in Signaling Networks." Cell 127(3): 635-648.

Oxley, C. L., N. J. Anthis, et al. (2008). "An Integrin Phosphorylation Switch: THE EFFECT OF {beta}3 INTEGRIN TAIL PHOSPHORYLATION ON DOK1 AND TALIN BINDING." J Biol Chem 283(9): 5420-5426.

Palecek, S. P., J. C. Loftus, et al. (1997). "Integrin-ligand binding properties govern cell migration speed through cell-substratum adhesiveness." Nature 385(6616): 537- 540.

Pentikainen, U. and J. Ylanne (2009). "The regulation mechanism for the auto-inhibition of binding of human filamin A to integrin." J Mol Biol 393(3): 644-657.

Phang, H. Q., J. L. Hoon, et al. (2014). "POPX2 phosphatase regulates the KIF3 kinesin motor complex." J Cell Sci 127(Pt 4): 727-739.

Rantala, J. K., J. Pouwels, et al. (2011). "SHARPIN is an endogenous inhibitor of beta1- integrin activation." Nat Cell Biol 13(11): 1315-1324.

Reynolds, L. E., L. Wyder, et al. (2002). "Enhanced pathological angiogenesis in mice lacking beta3 integrin or beta3 and beta5 integrins." Nat Med 8(1): 27-34.

Ridley, A. J., M. A. Schwartz, et al. (2003). "Cell migration: integrating signals from front to back." Science 302(5651): 1704-1709.

Rokas, A. (2008). "The origins of multicellularity and the early history of the genetic toolkit for animal development." Annu Rev Genet 42: 235-251.

Sacco, F., L. Perfetto, et al. (2012). "The human phosphatase interactome: An intricate family portrait." FEBS Lett 586(17): 2732-2739.

Sakai, T., R. Jove, et al. (2001). "Role of the cytoplasmic tyrosines of beta 1A integrins in transformation by v-src." Proc Natl Acad Sci U S A 98(7): 3808-3813.

Scharffetter-Kochanek, K., H. Lu, et al. (1998). "Spontaneous skin ulceration and defective T cell function in CD18 null mice." Journal of Experimental Medicine 188(1): 119-131.

Schmid, R. S. and E. S. Anton (2003). "Role of integrins in the development of the cerebral cortex." Cereb Cortex 13(3): 219-224.

Schmoranzer, J., J. P. Fawcett, et al. (2009). "Par3 and dynein associate to regulate local microtubule dynamics and centrosome orientation during migration." Curr Biol 19(13): 1065-1074.

Schuch, J. B., D. Muller, et al. (2014). "The role of beta3 integrin gene variants in Autism Spectrum Disorders--diagnosis and symptomatology." Gene 553(1): 24-30.

Schweighofer, A., H. Hirt, et al. (2004). "Plant PP2C phosphatases: emerging functions in stress signaling." Trends Plant Sci 9(5): 236-243.

121 6. References

Sebe-Pedros, A., A. J. Roger, et al. (2010). "Ancient origin of the integrin-mediated adhesion and signaling machinery." Proc Natl Acad Sci U S A 107(22): 10142- 10147.

Shattil, S. J., C. Kim, et al. (2010). "The final steps of integrin activation: the end game." Nat Rev Mol Cell Biol 11(4): 288-300.

Shi, Y. (2009). "Serine/threonine phosphatases: mechanism through structure." Cell 139(3): 468-484.

Shi, Y. and I. M. Ethell (2006). "Integrins control dendritic spine plasticity in hippocampal neurons through NMDA receptor and Ca2+/calmodulin-dependent protein kinase II-mediated actin reorganization." J Neurosci 26(6): 1813-1822.

Shonesy, B. C., N. Jalan-Sakrikar, et al. (2014). "CaMKII: a molecular substrate for synaptic plasticity and memory." Prog Mol Biol Transl Sci 122: 61-87.

Singh, P., C. S. Gan, et al. (2011). "Investigation of POPX2 phosphatase functions by comparative phosphoproteomic analysis." Proteomics 11(14): 2891-2900.

Souza, C. M., D. Davidson, et al. (2012). "The phosphatase PTP-PEST/PTPN12 regulates endothelial cell migration and adhesion, but not permeability, and controls vascular development and embryonic viability." J Biol Chem.

Stawowy, P., C. Margeta, et al. (2005). "Protein kinase C epsilon mediates angiotensin II- induced activation of beta1-integrins in cardiac fibroblasts." Cardiovasc Res 67(1): 50-59.

Stewart, S. A., D. M. Dykxhoorn, et al. (2003). "Lentivirus-delivered stable gene silencing by RNAi in primary cells." RNA 9(4): 493-501.

Stossel, T. P., J. Condeelis, et al. (2001). "Filamins as integrators of cell mechanics and signalling." Nat Rev Molecular and Cellular Biology 2(2): 138-145.

Sueyoshi, N., T. Nimura, et al. (2012). "Functional processing of nuclear Ca2+/calmodulin-dependent protein kinase phosphatase (CaMKP-N): evidence for a critical role of proteolytic processing in the regulation of its catalytic activity, subcellular localization and substrate targeting in vivo." Arch Biochem Biophys 517(1): 43-52.

Suga, H., Z. Chen, et al. (2013). "The Capsaspora genome reveals a complex unicellular prehistory of animals." Nat Commun 4: 2325.

Susila, A., H. Chan, et al. (2010). "The POPX2 phosphatase regulates cancer cell motility and invasiveness." Cell Cycle 9(1): 179-187.

Suzuki, K. and K. Takahashi (2003). "Reduced cell adhesion during mitosis by threonine phosphorylation of beta1 integrin." J Cell Physiol 197(2): 297-305.

Tadokoro, S., S. J. Shattil, et al. (2003). "Talin binding to integrin beta tails: a final common step in integrin activation." Science 302(5642): 103-106.

122 6. References

Takagi, J., B. M. Petre, et al. (2002). "Global conformational rearrangements in integrin extracellular domains in outside-in and inside-out signaling." Cell 110(5): 599-511.

Takahashi, K. (2001). "The linkage between beta1 integrin and the actin cytoskeleton is differentially regulated by tyrosine and serine/threonine phosphorylation of beta1 integrin in normal and cancerous human breast cells." BMC Cell Biol 2: 23.

Takala, H., E. Nurminen, et al. (2008). "Beta2 integrin phosphorylation on Thr758 acts as a molecular switch to regulate 14-3-3 and filamin binding." Blood 112(5): 1853- 1862.

Takekawa, M., T. Maeda, et al. (1998). "Protein phosphatase 2Calpha inhibits the human stress-responsive p38 and JNK MAPK pathways." EMBO J 17(16): 4744-4752.

Takeuchi, M., A. Ishida, et al. (2001). "Identification and characterization of CaMKP-N, nuclear calmodulin-dependent protein kinase phosphatase." J Biochem 130(6): 833-840.

Tan, K. M., S. L. Chan, et al. (2001). "The Caenorhabditis elegans sex-determining protein FEM-2 and its human homologue, hFEM-2, are Ca2+/calmodulin-dependent protein kinase phosphatases that promote apoptosis." J Biol Chem 276(47): 44193-44202.

Tonks, N. K. (2006). "Protein tyrosine phosphatases: from genes, to function, to disease." Nat Rev Mol Cell Biol 7(11): 833-846.

Travis, M. A., J. D. Humphries, et al. (2003). "An unraveling tale of how integrins are activated from within." Trends Pharmacol Sci 24(4): 192-197.

Tuckwell, D., D. A. Calderwood, et al. (1995). "Integrin alpha 2 I-domain is a binding site for collagens." J Cell Sci 108 ( Pt 4): 1629-1637.

Virshup, D. M. and S. Shenolikar (2009). "From promiscuity to precision: protein phosphatases get a makeover." Mol Cell 33(5): 537-545. von Wichert, G., G. Jiang, et al. (2003). "RPTP-alpha acts as a transducer of mechanical force on alphav/beta3-integrin-cytoskeleton linkages." J Cell Biol 161(1): 143-153.

Wegener, K. L., A. W. Partridge, et al. (2007). "Structural basis of integrin activation by talin." Cell 128(1): 171-182.

Wennerberg, K., R. Fassler, et al. (1998). "Mutational analysis of the potential phosphorylation sites in the cytoplasmic domain of integrin beta1A. Requirement for threonines 788- 789 in receptor activation." J Cell Sci 111(Pt 8): 1117-1126.

Whittaker, C. A. and R. O. Hynes (2002). "Distribution and evolution of von Willebrand/integrin A domains: widely dispersed domains with roles in cell adhesion and elsewhere." Mol Biol Cell 13(10): 3369-3387.

Winograd-Katz, S. E., R. Fassler, et al. (2014). "The integrin adhesome: from genes and proteins to human disease." Nat Rev Mol Cell Biol 15(4): 273-288.

123 6. References

Xie, L., Y. L. Zhang, et al. (2002). "Design and characterization of an improved protein tyrosine phosphatase substrate-trapping mutant." Biochemistry 41(12): 4032- 4039.

Xie, Y., E. J. Tan, et al. (2008). "Functional interactions between phosphatase POPX2 and mDia modulate RhoA pathways." J Cell Sci 121(Pt 4): 514-521.

Yamaguchi, H., S. R. Durell, et al. (2006). "Development of a substrate-based cyclic phosphopeptide inhibitor of protein phosphatase 2Cdelta, Wip1." Biochemistry 45(44): 13193-13202.

Yamasaki, N., M. Maekawa, et al. (2008). "Alpha-CaMKII deficiency causes immature dentate gyrus, a novel candidate endophenotype of psychiatric disorders." Mol Brain 1: 6.

Ylanne, J. (1998). "Conserved functions of the cytoplasmic domains of integrin beta subunits." Front Biosci 3: d877-886.

Zaidel-Bar, R., M. Cohen, et al. (2004). "Hierarchical assembly of cell-matrix adhesion complexes." Biochem Soc Trans 32(Pt3): 416-420.

Zaidel-Bar, R. and B. Geiger (2010). "The switchable integrin adhesome." J Cell Sci 123(Pt 9): 1385-1388.

Zaidel-Bar, R., S. Itzkovitz, et al. (2007). "Functional atlas of the integrin adhesome." Nat Cell Biol 9(8): 858-867.

Zamir, E. and B. Geiger (2001). "Molecular complexity and dynamics of cell-matrix adhesions." J Cell Sci 114(Pt 20): 3583-3590.

Zhang, H., J. S. Berg, et al. (2004). "Myosin-X provides a motor-based link between integrins and the cytoskeleton." Nat Cell Biol 6(6): 523-531.

Zhang, J., J. Neal, et al. (2013). "Filamin A regulates neuronal migration through brefeldin A-inhibited guanine exchange factor 2-dependent Arf1 activation." J Neurosci 33(40): 15735-15746.

Zhang, S., T. Guo, et al. (2013). "Integrative transcriptome and proteome study to identify the signaling network regulated by POPX2 phosphatase." J Proteome Res 12(6): 2525-2536.

Zhang, Y., H. Zhao, et al. (2013). "Structural insight into Caenorhabditis elegans sex- determining protein FEM-2." J Biol Chem 288(30): 22058-22066.

124 7. Appendix

7. Appendix

7.1. Publications

7.1.1. Publication Part of This Thesis

Dierdorf NI, Timper A, Paone C, Betz K, Diederichs K, and Hauck CR: “The protein phosphatase PPM1F is a novel negative regulator of integrin activity, which is essential for brain development.” To be submitted

7.1.2. External Publications

Agarwal V, Asmat TM, Dierdorf NI, Hauck CR, and Hammerschmidt S (2010): "Polymeric immunoglobulin receptor-mediated invasion of Streptococcus pneumoniae into host cells requires a coordinate signaling of SRC family of protein-tyrosine kinases, ERK, and c-Jun N-terminal kinase." J Biol Chem 285(46): 35615-35623.

7.2. Declaration of Contributions

All experiments presented in this study were conducted by Nina Dierdorf with the exception of:

Figure 22, panel A-C: Experiment designed by Nina Dierdorf and Alexander Timper; conducted by Alexander Timper

Figure 22, panel D-E: Experiment designed by Nina Dierdorf, Karin Betz and Kay Diederichs; conducted by Karin Betz

Figure 23, panel A-B: Experiment designed by Nina Dierdorf and Christoph Paone; conducted by Christoph Paone

Figure 23, panel C-D: Experiment designed by Nina Dierdorf, Karin Betz and Kay Diederichs; conducted by Karin Betz

125 7. Appendix

Figure 29, panel C: Experiment designed by Nina Dierdorf and Christoph Paone; conducted by Christoph Paone

7.3. List of Figures

Figure 1. The integrin family ...... 5

Figure 2. Periventricular heterotopia ...... 8

Figure 3 Integrin structure ...... 10

Figure 4. Integrin conformational changes ...... 11

Figure 5. Images of focal adhesions ...... 12

Figure 6. Bidirectional integrin signaling ...... 13

Figure 7. Integrin inhibitors and their mechanism of action...... 16

Figure 8. Amino acid sequence of some α and β integrin cytoplasmic tails ...... 17

Figure 9. Classification of protein phosphatase superfamily ...... 20

Figure 10. The complexity of PP2A regulation ...... 21

Figure 11. Overall structure of cFem-2 ...... 23

Figure 12. Sequence alignment of different Fem-2 homologs ...... 24

Figure 13. Identification of PPM1F as a negative regulator of integrin activity ...... 29

Figure 14. PPM1F regulates integrin-mediated cell adhesion in NHDFs ...... 31

Figure 15. PPM1F affects β1 integrin activity and cell migration ...... 32

Figure 16. Loss of PPM1F affects Talin clustering and its subcellular distribution in NHDFs ...... 34

Figure 17. PPM1F co-localizes with inactive β1 integrin along actin stress fibers . 36

Figure 18. β1 integrinTT788/789 is dephosphorylated by PPM1F ...... 38

Figure 19. PPM1F expressed and purified from HEK cells and its enzymatic activity...... 39

126 7. Appendix

Figure 20. Dephosphorylation of the recombinant cytoplasmic domain of β1 integrin by PPM1F ...... 40

Figure 21. β1 integrin phosphorylation state affects binding of adapter proteins. 42

Figure 22. β1 integrin T788D/T789D substitution negatively affects FilaminA binding...... 43

Figure 23. β1 integrin tail phosphorylation affects binding of Talin ...... 44

Figure 24. PPM1F gene trap mutant mice locus ...... 46

Figure 25. PPM1F promoter is active in various tissues in adult mice ...... 47

Figure 26. PPM1F is expressed in multiple organs during embryogenesis and its complete loss leads to embryonic lethality...... 48

Figure 27. Loss of PPM1F leads to brain developmental defects ...... 50

Figure 28. Gene depletion of PPM1F in fibroblast leads to enhanced integrin affinity and integrin tail phosphorylation...... 51

Figure 29. Depletion of PPM1F in fibroblasts impairs cell migration capability .... 53

Figure 30 PPM1F+/- mice show behavioral differences accompanied by reduced PPM1F brain expression ...... 54

Figure 31. Reduced PPM1F brain expression levels in heterozygous mice does not affect brain mass...... 55

Figure 32. Model of the subcellular distribution of the inactive β1 integrin summarizing this study’s findings ...... 59

Figure 33. Talin sequence alignment ...... 61

Figure 34. Model summarizing this study’s findings...... 64

7.4. List of Tables

Table 1. Disease caused by mutations in specific protein kinases and phosphatases (Cohen 2001)...... 19

127 7. Appendix

Table 2. Overview of the primary antibodies used in this thesis...... 78

Table 3. Overview of the secondary antibodies used in this thesis...... 80

Table 4. Dyes and toxins used in this thesis...... 81

Table 5. Enzymes and proteins used in this thesis...... 81

Table 6. Plasmids used in this thesis...... 82

Table 7. Oligonucleotides used in this thesis...... 84

Table 8. Buffers and solutions used in this thesis...... 88

7.5. Abbreviations

% Percent µ micro °C Degree Celsius Amp Ampicillin APS Ammonium persulfate ATP Adenosine triphosphate bps Base pairs CS Calf serum C-terminus Carboxy-terminus dCTP Deoxycytidine triphosphate ddH2O Double distilled water DMEM Dulbecco’s modified eagle medium DMSO Dimethyl sulfoxide DNA Deoxyribonucleic acid dpc Days post coitus DTT Dithiothreitol ECL Enhanced chemiluminescence EDTA Ethylenediaminetetraacetic acid EGFP Enhanced green fluorescence protein EGTA Ethylene glycol tetraacetic acid FACS Flow cytometric assisted cell sorter

128 7. Appendix

FAK Focal adhesion kinase FAT Focal adhesion targeting domain FC Flow cytometry FCS Foetal calf serum FERM 4.1. band/ezrin/radixin/moesin g Gramm GST Glutathione S-transferase h Hours H&E Hematoxylin and eosin

HMW High molecular weight marker IF Immunofluorescence Ig Immunoglobulin IHC Immunohistochemistry IPTG Isopropyl thiogalactopyranoside Kan Kanamycin kDa Kilo Dalton l Liter LB Lysogeny broth; Luria Bertani LD Leucine aspartate LMW Low molecular weight marker M Molar mA Milliampere min Minute ml Milliliter mM Millimolar MOI Multiplicity of infection nm Nanometer Ngo Neisseria gonorrhoeae N-terminus Amino-terminus OD Optical density PAGE Polyacrylamide gel electrophoresis PBS Phosphate-buffered saline PCR Polymerase chain reaction PFA Paraformaldehyde

129 7. Appendix

PVDF Polyvinylidene fluoride pS Phosphorylated serine pT Phosphorylated threonine pY Phosphorylated tyrosine RNA Ribonucleic acid rpm Rotations per minute RT Room temperature SDS Sodium dodecyle sulfate sec Seconds Ser Serine SFK Src-family kinases SH Src-homology shRNA Small hairpin RNA TEMED Tetramethylethylenediamine Thr Threonine UV Ultraviolet V Volt

130