University of Florida Thesis Or Dissertation Formatting

CHARACTERIZATION OF AN ANAPLASMA MUTANT GENERATED BY TRANSPOSON MUTAGENESIS

FRANCY LILIANA CROSBY

A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA

2014

ACKNOWLEDGMENTS

I would like to express my deepest appreciation to my committee chair Dr. Anthony

Barbet for being an extraordinary mentor. His patience, enthusiastic spirit, research integrity and thoroughness inspired me to go through this journey with the idea of someday following his steps. In a similar way, I want to thank Dr. Ulrike Munderloh for her collaboration and generosity. This dissertation owes much to her. Her outstanding work and vast knowledge of the subject were instrumental for this work.

I am also grateful to all members of my PhD advisory committee: Dr. John Dame, Dr.

Paul Gulig, Dr. Jeffrey Abbot and Dr. Michael Dark. Their knowledge, suggestions, comments and insightful discussions about research contributed to this work and to my development as a scientist.

I will be forever thankful to Anna Lundgren for her collaboration, advice, technical support and friendship which were very important during these years. I want to thank to all my friends and family, especially my parents for giving the best education, the greatest example of work ethics and supporting me in every endeavor. To my sister that despite the distance, her cheerful spirit kept me smiling even during hard times. Finally, but not least I would like to thank my husband Joseph Crosby, his encouragement, patience and love were the rock that supported me during these years.

TABLE OF CONTENTS

page

ACKNOWLEDGMENTS ...... 3

LIST OF TABLES ...... 6

LIST OF FIGURES ...... 7

ABSTRACT ...... 8

CHAPTER

1 BACKGROUND AND SIGNIFICANCE ...... 10

Anaplasma marginale as a Significant Pathogen ...... 10 Transmission and Pathology ...... 11 Genome Characteristics ...... 13 Antigenic Variation ...... 18 Superinfection ...... 21 Methods of Diagnosis and Vaccines ...... 22 Genetic Tools ...... 24 Allelic Exchange or Gene Replacement by Homologous Recombination ...... 24 Rickettsia spp...... 25 Anaplasma spp...... 26 Transposon Mutagenesis ...... 27 Rickettsia spp...... 28 Anaplasma spp...... 30 Ehrlichia spp...... 31 Plasmids ...... 31 Central Hypothesis ...... 33

2 KNOCKOUT OF AN OUTER MEMBRANE PROTEIN OPERON OF ANAPLASMA MARGINALE BY TRANSPOSON MUTAGENESIS ...... 36

Introduction ...... 36 Materials and Methods ...... 38 Cultivation of Anaplasma marginale ...... 38 Isolation of the Anaplasma marginale Mutant by Transposon Mutagenesis ...... 39 Preparation of Host Cell-free Anaplasma marginale Wild-Type and omp10::himar1 Mutant from ISE6 Tick Cells...... 40 DNA Isolation and Phi29 Amplification of the Anaplasma marginale Mutant ...... 41 Genome Sequencing and Bioinformatics ...... 41 RNA Isolation ...... 42 RT-PCR and RT-qPCR Experiments ...... 43 RT-qPCR Experiments ...... 43

qPCR amplification efficiencies ...... 44 Relative efficiency plots ...... 45 Western Immunoblots ...... 45 Results...... 46 Transformation of Anaplasma marginale by Transposon Mutagenesis ...... 46 Mapping of Transposon Insertion within the Anaplasma marginale Chromosome ...... 47 Evidence for Expression of omp10 as Part of an Operon ...... 49 RNA Transcript Analysis ...... 50 Western Immunoblot Analysis ...... 52 Discussion ...... 52

3 PHENOTYPICAL CHARACTERIZATION OF AN OUTER MEMBRANE PROTEIN KNOCKOUT GENERATED BY TRANSPOSON MUTAGENESIS ...... 75

Introduction ...... 75 Materials and Methods ...... 77 Cell Lines and Anaplasma marginale Cultivation ...... 77 Western Immunoblots ...... 77 Immuno-Transmission Electron Microscopy ...... 78 Anaplasma marginale Wild-Type and omp10::himar1 Mutant Growth Curves ...... 78 DNA Extraction and qPCR ...... 79 Insert Stability ...... 80 Infection of Endothelial RF/6A cells with Anaplasma marginale omp10::himar1 Mutant ...... 81 Infection of Cattle with Anaplasma marginale omp10::himar1 Mutant ...... 82 Results...... 83 Electron Microscopy of Anaplasma marginale omp10::himar1 Mutant ...... 83 Growth Curves of Anaplasma marginale omp10::himar1 vs. Wild-Type ...... 85 Insert Stability ...... 85 Infectivity of omp10::himar1 Anaplasma marginale to Mammalian Cells In Vitro and In Vivo ...... 86 Discussion ...... 88

4 CONCLUSIONS AND FUTURE RESEARCH ...... 106

LIST OF REFERENCES ...... 110

BIOGRAPHICAL SKETCH ...... 124

LIST OF TABLES

Table page

2-1 PCR and Taqman qPCR oligonucleotides used in this study ...... 57

2-2 PCR conditions for the amplification of transcripts from omp7 through AM1225 intergenic regions ...... 58

2-3 PCR conditions for the amplification of transcripts from omp6 through omp10 from cDNA obtained from ISE6 cells infected with A. marginale wild-type and omp10::himar1 mutant organisms ...... 59

2-4 qPCR reactions and amplification conditions ...... 60

2-5 qPCR amplification efficiencies ...... 61

2-6 Relative amplification efficiencies ...... 62

3-1 Taqman qPCR oligonucleotides used in this study...... 91

3-2 aadA copies/A. marginale omp10::himar1 genome equivalents ...... 92

LIST OF FIGURES

Figure page

2-1 Specificity of primers and probes in RT-qPCR reactions ...... 63

2-2 Transformation of Anaplasma marginale...... 64

2-3 Mapping of Himar1 transposon insertion site ...... 65

2-4 Himar1 transposon insertion site in the A. marginale str. Virginia genome ...... 67

2-5 Characterization of Himar1 transposon insertion site...... 69

2-6 Intergenic regions of omp7 to AM1125 analyzed by RT-PCR...... 70

2-7 Transcriptional analysis of the effect of the insertion of the Himar1 transposon within the omp10 gene by RT-PCR...... 71

2-8 Relative gene expression determined by RT-qPCR...... 72

2-9 Immunoblotting of omp10::himar1 mutant and wild-type Anaplasma marginale using the specific monoclonal antibody against Omp9 ...... 74

3-1 Immunoblotting of host cell free omp10::himar1 mutant and wild-type A. marginale using the specific antibody R883 ...... 93

3-2 Transmission electron microscopy of A. marginale omp10::himar1 mutant ...... 94

3-3 Transmission electron microscopy of A. marginale omp10::himar1 mutant, immunogold labeled with a polyclonal anti-Msp2 antibody R883...... 95

3-4 Growth curves for A. marginale wild-type and omp10::himar1 in infected ISE6 tick cells...... 98

3-5 Infection of RF/6A endothelial cells with A. marginale omp10::himar1 mutant...... 99

3-6 Infection of RF/6A endothelial cells with Anaplasma marginale omp10::himar1 mutant growing in media supplemented with antibiotic treatment...... 100

3-7 Infection of RF/6A endothelial cells with Anaplasma marginale omp10::himar1 mutant growing in media without antibiotic treatment...... 102

3-8 Infection of RF/6A endothelial cells with Anaplasma marginale wild-type...... 104

Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy

CHARACTERIZATION OF AN ANAPLASMA MUTANT GENERATED BY TRANSPOSON MUTAGENESIS

Francy L. Crosby

May 2014

Chair: Anthony F. Barbet Major: Veterinary Medical Sciences

The large amounts of data generated by genomics, transcriptomics and proteomics have increased our understanding of the biology of Anaplasma marginale. However, these data have also led to new assumptions that require testing, ideally through classic genetic mutation. One example is the definition of genes associated with virulence. This dissertation describes the characterization of a red fluorescent and spectinomycin and streptomycin resistant A. marginale mutant generated by Himar1 transposon mutagenesis.

Characterization at the molecular level as shown here using high throughput genome sequencing to determine the Himar1-A.marginale genome junctions established that the transposon sequences were integrated within the coding region of the omp10 gene. This gene is arranged within an operon with AM1225 at the 5’ end and with omp9, omp8, omp7 and omp6 arranged in tandem at the 3’ end. RNA analysis to determine the effects of the transposon insertion on the expression of omp10 and downstream genes revealed that the Himar1 insertion not only reduced the expression of omp10 but also that of downstream genes. Transcript expression from omp9, and omp8 dropped by more than 90% in comparison with their

counterparts in wild-type A. marginale. Immunoblot analysis showed a reduction in the production of Omp9 protein in these mutants compared to wild-type A.marginale.

Transposon insertion within omp10 and alteration of its expression and that of downstream genes did not affect the growth of these omp10 mutants in vitro in tick and endothelial cell culture. However these organisms were unable to infect immunocompetent cattle red blood cells in vivo. This work reports for the first time a method to promote transposon mutagenesis in Anaplasma marginale and a detailed characterization of the first Anaplasma marginale transformants obtained by this method.

CHAPTER 1 BACKGROUND AND SIGNIFICANCE

Anaplasma marginale as a Significant Pathogen

The order Rickettsiales are a group of obligate intracellular bacteria that includes some of the most notable pathogens in the history of infectious diseases, such as epidemic typhus caused by Rickettsia prowazekii, which became one of the biggest plagues to afflict the human race. In

2001 16S rRNA and groESL sequence and antigenic analysis resulted in the re-organization of members of this order into the Rickettsiaceae and Anaplasmataceae families, both containing pathogenic species (1, 2). For example, recognized pathogens in the Rickettsiaceae family are the

Rickettsia spotted fever group (SFG), the thyphus group Rickettsia (TGR) and Orientia tsutsugamushi (2-4). Alternatively, pathogenic members of the Anaplasmataceae family are

Ehrlichia canis, Ehlichia chaffeensis, Ehlichia muris, Ehlichia ruminantium, Neorickettsia helmithoeca, Neorickettsia sennetsu, Neorickettsia risticii, Anaplasma platys, Anaplasma bovis,

Anaplasma phagocytophilum and Anaplasma marginale (1, 2, 5-8).

Anaplasma marginale, the focus of this study, is the etiologic agent of anaplasmosis in cattle and other ruminants (6, 9-11). This bacterium was the first rickettsial pathogen to be identified (9, 10, 12). In the early 1900’s Sr. Arnold Theiler identified A. marginale as “marginal points in the blood of cattle suffering from a specific disease”. Interestingly 15 years earlier previous to Theiler’s identification, Smith and Kilborne reported this organism in stained blood smears as marginal points that correspond to early stages of the infection of erythrocytes with the parasite Babesia bigemina during the course of Redwater disease in cattle (6, 9, 12). Careful epidemiological, clinical and pathohistological studies allowed Theiler to separate both agents and produce pure infections with A. marginale. After this investigation, anaplasmosis was recognized in tropical and subtropical areas throughout the world. In the United States this

disease is found throughout the country. It is also found in Central and South America, the

Caribbean islands, Mediterranean countries, in Europe and regions in Africa and Asia (9, 10).

Bovine anaplasmosis causes important economic loss in most countries, mainly due to the high morbidity and mortality in susceptible cattle herds. Current annual losses in beef cattle in the United States as a result of anaplasmosis morbidity and mortality are estimated to be over

$300 million per year, whereas in Latin America those losses were calculated to be approximately $800 million. More recently, it was reported that bovine anaplasmosis and babesiosis were responsible for causing an economic loss of $875 million in Latin American nations (9, 13).

Transmission and Pathology

Biological transmission of A. marginale to cattle is attributed to Dermacentor spp and

Riphicephalous spp. ticks, although approximately 20 species of ticks have been incriminated as vectors of this bacterium around the world (8, 14). This pathogen can be transmitted mechanically by blood contaminated fomites or mouthparts of biting flies (15, 16). In the tick, transmission occurs from stage to stage or transstadial transmission, from larvae to nymph and from nymph to adult and by adult male ticks transferred from infected to susceptible hosts (10,

17).

Extensive work has described the different morphological stages of A. marginale during its developmental cycle in the tick, beginning when the erythrocytic stage invades the midgut epithelial cells during tick feeding (15, 18). This is followed by infection of other tick tissues and ends with the development of the infective stage in the salivary glands from where A. marginale is transmitted to cattle (18). Electron microscopy studies of tick tissues in experimentally infected ticks and cultured tick cells have described the invasion, development and release of A. marginale from those cells (18, 19). For instance, these organisms enter their host cells by an

endocytic process and grow within membrane-bound vacuoles throughout development. Within this cell structure A. marginale forms a reticulated or vegetative form that multiplies by binary fission, producing large colonies of bacteria known as morulae. Soon after, these reticulated forms of Anaplasma subsequently transform into the dense forms presumed to be the infective form released from the cell for further infection cycles (19).

Mature erythrocytes are the only known mammalian host cell of A. marginale (20). In these cells the organisms grow within membrane-bound inclusions known as initial bodies and which may contain from 4 to 8 organisms (13). Similar reticulated and dense forms of this pathogen described during the tick stage are found in erythrocytes. Throughout the course of infection in cattle, anaplasmosis can be divided into four stages: incubation, development, convalescent and carrier stages (13, 21). During the incubation or pre-patent stage A. marginale replicate and the number of infected erythrocytes increases geometrically (10, 13, 21). This stage may last from 7 to 60 days, with an average of 28 days, and its length is related to the infectious dose inoculated. There are reports that as many as 70% of the erythrocytes may be infected during the acute infection. When higher numbers of Anaplasma have established (~109 bacteria/ml) the animal’s immune system attempts to clear infection resulting in the developmental stage that lasts from 4 to 9 days. During this period the clinical signs of this disease are expressed, since infected erythrocytes are phagocytized and removed from circulation by reticuloendothelial cells and severe anemia occurs. Other clinical signs include fever, weight loss, abortion, lethargy, icterus, rapid decrease of milk production and in some cases death, especially in animals over 3 years old (16, 21, 22).

Cattle that survive acute infection during the developmental stage will slowly recover over a period of 2 or 3 months. This is known as the convalescent stage and is mainly

characterized by erythropoiesis. Cattle that recover remain carriers or reservoirs of this pathogen for the rest of their life and can continue to transmit (21, 23-26). This stage is mainly characterized by cycles of low levels of bacteremia that may fluctuate between 102 and 106 bacteria/mL. Persistently infected “carrier”cattle have lifelong immunity and upon challenge, do not normally develop clinical signs of disease (9).

Erythrocyte turnover is approximately 130 days (27), but together with long pre-patent periods and lifelong persistence of A. marginale in cattle, it has been proposed that some other location could serve as a focus of infection for this pathogen. Some suggest that this organism can be transferred between terminally differentiated erythrocytes, or since these organisms are phagocytized by reticuloendothelial cells, they could shuttle from erythrocytes into extravascular cells (9, 18, 27-30). Some work has favored these suggestions, however conclusive identification of A. marginale within these cells has not been demonstrated, so currently a complete description of the life cycle of A. marginale in mammalian cells is unknown (27, 31, 32).

Genome Characteristics

Until now the A. marginale strains sequenced are the tick transmissible St Maries, South

Idaho, Virginia and Puerto Rico, and the non-tick transmissible strains Florida and Mississippi.

However just the genome sequences of St Maries and Florida are fully assembled and annotated

(33-35).

A. marginale str. St Maries and str. Florida are composed of 1,197,687bp and

1,202,435bp respectively, while both have a 49.86% GC content (33, 34). Although their small genome size is common to obligate intracellular bacteria due to reductive evolution (33, 34, 36-

38), their GC content is unusually high, especially when other related obligate intracellular bacteria such as E. ruminantium, E. chaffeensis, Wolbachia and Rickettsia average 30.47% (5) .

Both genomes contain a single ribosomal RNA operon and 37 transfer RNAs that represent all of

the 20 amino acids. Rho transcription terminator, normally a single copy, is duplicated in these two genomes and in all the Anaplasma and Ehrlichia genomes sequenced to date (5, 33, 34).

Although both genomes have a coding density of 86%, A. marginale str. St Maries contains 949 predicted protein encoding genes while the str Florida contains 942. It is suggested that this difference is due to different split ORF’s and possibly annotation (34). For example mutL, murC, aatA and aspS have interrupted coding sequences in the A. marginale str. St Maries but are intact in A. marginale str Florida. Similarly genes that are intact in the str. St Maries are fused or missing in the str Florida, probably evidence that those ORF’s have split recently (33, 34). This also suggests that these few interrupted coding sequences in these genomes and which are reported as split ORF’s or pseudogenes are probably in the first stage of reductive purging (34,

37). Nevertheless, A. marginale has less pseudogenes than other intracellular bacteria such as

Rickettsia and Mycoplasma (33, 39).

In contrast to classical pseudogenes, A. marginale contains functional pseudogenes of the highly immunodominant and antigenically variable Msp2 and Msp3 proteins. These are truncated copies of msp2 and msp3 genes that are only expressed as part of functional full length proteins after recombination of these copies into the expression site, allowing the switching of different expressed variants of Msp2 and Msp3 surface proteins (6, 13, 25, 33, 34, 40-44). A. marginale str. St Maries carries seven msp2 functional pseudogenes copies, while A. marginale str. Florida carries eight, however 4 are identical to the str. St Maries. Both strains have 7 copies of the pseudogene msp3 copies with two shared between the two strains (33, 34).

Sequencing of A. marginale also revealed that surface proteins of these bacteria include two immunodominant families, the msp2 superfamily and the msp1 superfamily. The msp2 superfamily is formed by Msp2, Msp3, Msp4, Opag1, Opag2, Opag3 and outer membrane

proteins OMP 1 through 15, all these are members of the pfam-01617 family of surface expressed antigens (22, 33, 45-48). Both Msp2 and Msp3 are expressed as part of operons: msp2 is located at the 3´ end of an operon of four genes, with the operon associated genes opag 1, 2 and 3 at the 5´ end (41). The msp3 gene is expressed from an operon of three genes, with the orfX and orfY genes at the 5´ end (47). These orfX and orfY are not members of the pfam01617 superfamily and recently have been designated as homologs of virB2 genes of the Type 4 secretion system (orfX has 12 copies and orfY has 7 copies) (49, 50).

The msp1 superfamily is formed by a dimer of structurally unrelated polypeptides formed by the Msp1a and Msp1b proteins. Msp1a is expressed from the msp1α gene which is used as a genotypic marker of A. marginale strains, since it contain tandem repeats of 85 to 89bp at the 5´ end that vary in sequence and number between strains (51-53). Msp1b is encoded by a small multigene family of 5 short genes (52, 53). Msp1a and Msp1b facilitate adherence to bovine and tick cells, however MSP1a was found to bind tick cells suggesting that this protein was important in transmission (54-56). Studies showed that A. marginale subspecies centrale lack the msp1α repeat region that apparently is required for tick cell binding and yet invades and replicates in

Dermacentor andersoni midgut and salivary glands, showing that this region is not necessarily required for binding (57-59). On the other hand A. marginale str. Mississipi known as non-tick transmissible carries a MSP1a tandem repeat indistinguishable from a transmissible strain but fails to colonize Dermacentor andersoni midguts and consequently it is not transmitted (58).

Genome sequencing also allowed the definition of genes with important predicted metabolic functions. All the genes required for the synthesis of lipid A are missing in A. marginale precluding its ability to synthesize LPS, while a putative exporter for lipid A (msbA2) was found (33).

Although a complete pathway for peptidoglycan biosynthesis is missing, all the genes for diaminopimelic acid (DAP) synthesis are present. This is similar to genes required for the synthesis of murein such as ddlB, glmU, mraYI, murA, B, C (split ORF), D, E, F and G, and the presence as well, of the slt gene, the product of which is required to remove peptidoglycan units from the murein layer for either recycling or shedding from the cell wall. All of this suggests that

A. marginale may synthesize a modified form of peptidoglycan (33, 38).

Common to Rickettsiales genomes, A. marginale does not have complete pathways for the synthesis of the majority of essential amino acids, and only nine genes encoding enzymes for the terminal pathways for the synthesis of serine, glycine, tyrosine, cysteine, phenylalanine, aspartate, glutamate and glutamine were identified. This implies that these organisms must import the majority of amino acids from the host, but only a proline transporter was identified and a putative assignment was made for an alanine transporter (33, 38).

A. marginale does not have the ability to convert glucose to pyruvate since genes encoding for any sugar transport system and the genes encoding enzymes for either the Embdem-

Meyerhof-Parnas or Entner-Doudoroff pathways are missing. However the genes encoding enzymes for the nonoxidative pentose phosphate pathway and most of the enzymes required in gluconeogenesis were identified. Therefore the presence of these pathways in A. marginale suggests that their main function is to supply this pathogen with precursors for the synthesis of glycerol lipids and nucleotides in the absence of glycolysis. All the enzymes for the tricarboxilic acid (TCA) pathway are present (38).

Transporter prediction analysis defined fifty six genes to encode proteins that form transporters. A. marginale contains 11 ATP-dependent transporters. Several transport systems for cations, anions, oligonucleotides, phosphate and ribonucleotides were identified. The Sec

pathway of protein secretion is complete, and tatB and tatC are the only genes predicted to encode proteins for the Tat transport system. Genes encoding proteins for type II, III, V and VI secretion systems are missing but similar to all the Rickettsiales sequenced to date, A. marginale encodes genes for the Type IV secretion system (6, 33, 38).

The prototype of the Type IV Secretion System (T4SS) of A. marginale is Agrobacterium tumefaciens (6, 33, 50). In A. tumefaciens the genes encoding the components of this system are arranged in a single operon and the VirB/D T4SS comprises 12 proteins, named VirB1 to VirB11 and VirD4 that combine to form a transmembrane channel (60). In A. marginale the VirB/D genes are distributed into two clusters, with sodB, virB3, virB4 and virB6 followed by three virB6-like proteins, while the second operon contains virB8, virB9, virB10, virB11 and virD4 (6,

33). A similar arrangement is found in Rickettsiales with the exception of A. phagocytophilum and E. chaffeensis in which the virB/D system is formed by 5 groups: sodB, virB3, virB4, virB6 1 through 4; virB8-1, virB9-1, virB10, virB11, virD4; virB2-1 through 8, virB4-2 (in A. phagocytophilum) or virB2-1 through 4, virB4-2 (in E. chaffeensis); virB8-2 and virB9-2.

Additionally A. marginale has 12 copies of orfX and 7 copies of orfY which have been defined as paralogs of virB2 (61). Interestingly A. marginale T4SS proteins such as VirB2, VirB4, VirB7,

VirB9-1, VirB9-2, VirB10 and VirB11 are immunogenic in infected or immunized animals (49).

Recently the transcriptome of erythrocyte stage A. marginale str. St Maries and Florida was elucidated using RNA deep sequencing, showing that six previously unannotated genes were transcriptionally active. Similarly, transcription start sites and 70 operon structures that involved

292 genes were defined, showing that at least 30% of A. marginale genes are polycistronic (62).

Comparison of multiple genomes of different strains of a bacterial species is useful to determine interstrain diversity and in this manner define the whole genome repertoire or pan-

genome, which is made up of the core and dispensable genomes. The core genome is the collection of genes that are common to all the strains and which confers the main characteristic traits and are essential for the biology of that bacterial species. The dispensable or accessory genome are those genes that are not present in all the strains of a bacterial species but are important because they may give a particular advantage over the other strains, such as antibiotic resistance, colonization of a new host, etc (63, 64). This is particularly important for pathogenic bacterial species because a better understanding of their diversity may aid in the identification of particular genes that could be associated with virulence traits and which could be targets for drug therapies, or even help with the development of methods for control and production of vaccines

(62, 64).

Accordingly, whole genome sequences of five A. marginale strains: Florida, Mississippi,

St Maries, Virginia and Puerto Rico were used for global comparison to determine interstrain diversity. This work showed that there was a high interstrain diversity at the nucleotide level as determined by single nucleotide polymorphism (SNP’s) analysis (34, 62). For instance, relative to str Florida there were 2028 sites with SNP’s in at least one strain and up to 6000 sites with

SNP’s in pair-wise comparisons between all the strains. However, major gene changes were not found, showing that there is a high degree of conservation between A. marginale strains at this level. Therefore the authors of this work suggested that, in A. marginale species what contributes to their diversity are changes at the nucleotide level or small polymorphisms, rather that major rearrangements in their genomes such as gene deletions or insertions. Consequently A. marginale has a closed-core genome with a SNP profile moderately open (34, 62).

Antigenic Variation

Just as vertebrates have developed different mechanisms of defense against pathogens, so pathogens have evolved ways to overcome these defenses. Antigenic variation is one way in

which infectious agents can evade surveillance by the immune system (65). In persistence mediated by antigenic variation, A. marginale switches exposed variant-specific antigens in a small number of bacteria of the total population before the immune system mounts a predominant response against the specific variants and kill the entire population. Hence, those variants will survive and persist. It is known that new variants arise throughout acute and persistent anaplasmosis, and that the antibody present at a given time point will not recognize variants found at later time point (25, 66, 67). By using this mechanism A. marginale not only guarantees its survival but also its transmission and continued propagation (23, 68).

Extensive and important work has demonstrated that the persistence of A. marginale within an immunocompetent host is achieved by the expression of multigene families which share structural features, and which encode polymorphic immunodominant and antigenically variable outer membrane proteins Msp2 and Msp3 (25, 26, 43, 47, 66, 69, 70). These proteins are characterized by a hypervariable region (HVR) flanked by a highly conserved N- termini and C- termini and which are different in size (Msp2 is 36KDa and Msp3 is 80-90KDa) and in sequence composition (30-40% identity). Despite these differences these two proteins share 138 identical amino acids at the C-termini and short amino acid stretches at the N-termini (26, 47).

Msp2 HVR varies from 60 to 70 amino acids in length and is arranged in three regions known as block 1 to 3. A given strain may contain a few variants each with one of five amino acid triplets at the beginning of the block 1 region and which are KAV, NAV, NAI, TTV or TTI.

Immunological studies showed that this block 1 region contains CD4+ T-cell epitopes, and that switching of one triplet will provide immune scape (33, 71).

Msp2 and Msp3 variants are generated by a unidirectional gene conversion mechanism involving msp2 and msp3 functional pseudogenes or donor alleles. These are transcriptionally

silent and recombine into their respective expression site. The structure of these pseudogenes involves a HVR flanked by 5 ´ and 3´ conserved regions, which are identical to those in the expression site. Also recombination of segments or oligonucleotides from the HVR of the msp2 and msp3 pseudogenes creates unique mosaics in the expression site HVR (26, 40, 42, 44, 47,

67).

An interesting study that analyzed thousands of variants over the course of infection determined that there are different recombination events and defined the “anchoring model”.

This model explains that there is a first recombination event in which the complete HVR from a pseudogene is recombined within the expression site with both recombination sites occurring in the conserved flanking regions. Then a second event occurs when a segment of the HVR from another pseudogene recombines within the HVR of the expression site, without requirement for sequence identity, resulting in mosaic expression sites that serve as the template for additional segmental gene conversion events. So early acute anaplasmosis is composed primarily of simple variants derived from recombination of a single pseudogene into the expression site, while the mosaic variants derived from multiple segmental recombination events from different genes emerge during the persistent phase of A. marginale (67, 68).

Presence of complex variants are due to immune system selection pressure, as shown in a study in which Dermacentor andersoni adult males were allowed to feed on a persistently infected calf and then fed on naïve calves. Analysis of msp2 variants in the infected calves during acute anaplasmosis and from the tick salivary glands demonstrated that the predominant variants were those derived from recombination of whole pseudogenes into the expression site.

Consequently the msp2 mosaics of complex variants have a selective advantage only in the

presence of adaptative immunity and are rapidly replaced by simple variants following transmission (68, 72).

Superinfection

Diversity of alleles involved in antigenic variation is not only important for evasion in an individual’s immunity, but also has an important role during herd immunity. Studies to determine the strain composition of a herd within a region where A. marginale is endemic using the msp1α gene for strain typing, found that despite the prevalence and transmission of genotypically distinct strains within the population, the majority of individuals in the herd were infected with one strain. However very few were infected with more than one strain

(superinfected animals) with very distinct msp1α genotypes. This finding brought up the question whether strains with different msp1α genotypes also have a different msp2 pseudogene repertoire. To determine this, the msp2 pseudogene repertoire in strains with identical, similar and very different msp1α genotypes were analyzed. Results show that strains with identical or similar msp1α genotypes shared identical msp2 pseudogene repertoire, whereas those that had a different msp1α genotype had a different msp2 pseudogene repertoire, and strains in superinfected animals encompassed a different msp2 pseudogene repertoire (73, 74).

Futse and colleagues (74) examined the requirements of the minimal msp2 pseudogene repertoire for superinfection in A. marginale. Either St Maries, 6DE, EMΦ strains were used to establish persistent infection in calves. After persistent infection was confirmed, calves were challenged by tick transmission with one of the other strains. Data analysis shows that the existence of a single unique msp2 pseudogene was enough for superinfection to be established in the presence of a strong immune response to the initial infecting strain.

Methods of Diagnosis and Vaccines

Diagnosis of acute anaplasmosis is based on clinical signs and Giemsa or Diff-Quick stained blood smears. During this phase visualization of A. marginale at the periphery of erythrocytes is facilitated because rickettsemia doubles approximately every 24 hours for 10 to

14 days with 106 infected erythrocytes/ ml of blood. However in chronically infected or carrier cattle the rickettsemia levels are undetectable by this method (9, 13, 24).

Detection of persistently infected animals can be accomplished via detection of A. marginale specific antibodies or by the detection of DNA in blood. Several serological tests are available to detect infections in carrier animals. A card agglutination test (CAT) and complement fixation (CF) were among the first tests to be used to detect persistently infected cattle and were common for interstate or international shipment. However these tests are not very reliable since

CAT has low specificity while CF test has low and variable sensitivity (20%) (75). Other serological tests are a competitive enzyme-linked immunosorbent serologic assay (cELISA), dot

ELISA, and indirect fluorescent antibody (25, 76). C-ELISA uses a recombinant antigen termed rMSP5 and MSP5-specific monoclonal antibody (MAb) ANAF16C1 that recognizes the A. marginale major surface protein 5 (MSP5) and has been validated using true negatives and true positives specified by nested polymerase chain reaction (nPCR). This test is actually recommended for anaplasmosis diagnosis by the USDA and has a sensitivity of 96% and specificity of 95% for diagnosis of this disease relative to nPCR (77). However there are reports of cross-reactivity with A. phagocytophilum and Ehrichial spp in naturally and experimentally infected cattle (78, 79).

DNA-based diagnostic methods have been also developed to identify A. marginale infections and include DNA and RNA probes (80), nPCR and real time PCR targeting one or several genes (81-83).

Due to cross-reactivity with the serological tests, both serological and DNA based methods become useful for anaplasmosis diagnosis in animals that are susceptible to A. marginale and A. phagocytophilum, and regions in which both organisms might be present.

Work on the development of a preventive vaccine against this disease began in the early

1900’s with the isolation of A. marginale subsp. centrale in 1911 (12, 13). This less virulent strain originated from South Africa and is used for immunization of cattle in Africa, Australia,

South America and the Middle East. It remains the most widely-used and practical vaccine against bovine anaplasmosis (13). This vaccine is not approved in the United States because of the risk of transmitting contaminant blood-borne pathogens that will infect cattle since immunization involves infection of a susceptible splecnectomized calf and the use of its blood as a vaccine (9). Recently, comparative genomic studies demonstrated that the proteins that are conserved in US strains were not conserved in A. marginale subsp. centrale (35, 57).

Different vaccination methods have been developed for the control of bovine anaplasmosis range from attenuated live or killed organisms, to DNA and recombinant protein vaccines (13). But A. marginale derived from cell culture, killed organisms and DNA vaccines induce only partial protection (55, 84). Immunization trials using outer membrane proteins or a complex of linked or unlinked outer membrane proteins of A. marginale derived from erythrocytes have demonstrated good protection against high bacteremia, anemia and homologous strain challenge (49, 85-88). However, to promote long lasting protection, several

immunization boosts may be required and in addition to this, production and purification of these components is time-consuming and expensive.

Genetic Tools

Paradoxically, one way to understand the function of a gene is by knowing what happens to the organism when it lacks or has an altered form of that gene. The use of genetic tools such as gene targeting by homologous recombination, transposon mutagenesis to create gene inactivation or alterations may result in the interruption of a cellular process that will provide information about that gene’s biological function. The use of these genetic tools in pathogenic organisms not only provides information about the role that a gene plays in virulence or pathogenesis but also for the development of attenuated organisms that can be used in vaccination trials (89-91).

In contrast to facultative pathogenic bacteria, characterization of virulence determinants in Rickettsiales by genetic transformation is still difficult, especially because of its obligate intracellular biology. For this reason their viability outside of the host may be limited, requiring rapid transfection experiments to maintain a high number of viable and competent organisms to infect host cells. However some advances for the development of genetic tools of these organisms have been made during the past 15 years and are reviewed below.

Allelic Exchange or Gene Replacement by Homologous Recombination

Allelic exchange enables the production of mutants practically in any desired gene by integrating construct sequences into a homologous site of a target gene and interrupting its normal structure (92). This strategy has been widely used for directed mutagenesis of several bacteria whereby a target “normal” or wild-type allele is replaced with an introduced

“alternative” allele. For this, delivery into the bacteria cell of a replication-defective or host specific plasmid bearing DNA sequences identical to the normal allele flanking an antibiotic resistant gene or selectable marker is performed. Since the plasmid cannot replicate, maintenance

of the antibiotic resistance gene under selectable pressure requires homologous recombination of both pairs of identical sequences (double cross-over) to mediate the exchange of the normal gene for the alternative one. In this case the selectable marker that confers antibiotic resistance enables one to specifically select and isolate the desired recombinant bacteria.

One problem with this mechanism is that the frequency of double cross-over events in the same cell is very low (93, 94). It is more likely that the entire plasmid may be integrated by a single cross-over event resulting in the formation of merodiploids (95-98). This type of recombination is leaky, if a second homologous recombination event occurs at the same region the organisms revert to the wild-type or normal allele. If it occurs at another region of homology, the alternative allele will remain stable. Isolating recombinant organisms containing the mutated allele from a two-step homologous recombination can be done by adding a counterselectable marker to the plasmid backbone. Hence the transformants carrying the entire plasmid result of a single cross-over event can therefore be eliminated in the presence of the expressed counterselectable compound. But it should be noted that finding an appropriate counterselectable marker is complex (93).

Transformation by homologous recombination has been described for several pathogenic bacteria such as Francisella tularensis subsp. tularensis, Listeria monocytogenes, Mycoplasma pneumonia, Mycoplasma genitalium, Borrelia burgdorferi, Brucella abortus, Chlamydia psittaci

(99-106). Until now there are very few mutant species of the order Rickettsiales generated by homologous recombination.

Rickettsia spp.

Ratchek et al. (107, 108), described the transformation of Rickettsia prowazekii str

Madrid. The construct developed to promote homologous recombination contained a gene carrying a single base pair mutation that conferred rifampim resistance and was isolated from

spontaneously occurring rifampin-resistant mutants. To differentiate the mutant from the wild- type, two silent mutations were added to this gene. After electroporation, transformation by homologous recombination was demonstrated by DNA sequencing of PCR products containing the Rifr region of the ropB gene and the silent mutations. Troyer et al. (109) generated a transformant of Rickettsia typhi expressing GFPuv. For this an rpoB-GFPuv fusion construct was delivered into host free bacteria. Incorporation of rpoB-GFPuv into the chromosome was confirmed by PCR and RFLP (restriction fragment length polymorphisms) and screening of fluorescent bacteria was done by flow cytometric analysis. However these transformants were unstable during long-term maintenance. These experiments were very important since they presented evidence that foreign DNA could be introduced by electroporation, subsequently recombine into the genome by homologous recombination and be expressed within these organisms.

Over 10 years passed before experiments achieved the deletion of the pld gene in

Rickettsia prowazekii str Madrid E Evir a virulent revertant of the attenuated str Madrid E. The phospholipase D product of the pld gene is thought to enable rickettsia to leave the phagosome.

Successful allelic exchange of this gene with a mutated version containing rifampin resistance was confirmed by PCR, however phenotypical differences were not observed between the mutant and the wild-type during in vitro growth. Even though these mutant organisms infected guinea pigs, they did not produce disease and conferred protection from challenge with R. prowazekii (110).

Anaplasma spp.

In 2007 the first transformed Anaplasma marginale mutants as a result of homologous recombination were described, although their isolation was an unexpected outcome. Since the transformation of A. phagocytophilum was achieved via Himar1 transposon mutagenesis, the

researchers thought that the same could be accomplished for A. marginale. For this, the Himar1 transposon and the transposase were delivered in two separate vectors into A. marginale organisms resulting in the isolation of green fluorescent and spectinomycin and streptomycin resistant bacteria. Molecular characterization of these mutants established that the entire plasmid bearing the transposon was integrated into the A. marginale chromosome by a single cross-over homologous recombination mechanism instead of the transposition mechanism mediated by the transposase. This suggested that A. marginale as well other species of Anaplasma and Ehrlichia could be transformed by homologus recombination. However several parameters toward the optimization of this technology in Rickettsiales and especially in A. marginale remain undefined

(111).

Transposon Mutagenesis

Transposons are DNA elements that move from one locus (donor site) into another one of the same or into another chromosome (target site). This mechanism of recombination is mediated by a transposase and does not requires DNA homology. Mobilization of transposons has had a great impact on the structure and evolution of genes and genomes in eukaryotes and prokaryotes.

For example, upon integration in the chromosome they can activate or inactivate genes, and in some instances produce chromosomal rearrangements that may result in deletion or inversions.

Especially in bacteria, transposons encode additional functions such as antibiotic resistance and virulence factors (112, 113).

Transposons were originally discovered by Barbara McClintock while doing classical genetic experiments in maize during the 1940s. She characterized them as genetic entities that jump in and out of genes, changing the phenotype of corn kernels. As research on these elements advanced, in the mid-1970s scientists began to study transposons as tools to manipulate bacteria, phage and plasmids. Since then, these elements have been used to create insertional mutations in

nonpathogenic and pathogenic bacteria (114, 115). The most common transposon systems used for this goal are the Tn5, Tn10 and the Himar1 (112). Several techniques using transposon mutagenesis have been developed such as genetic footprinting first developed in Salmonella

(115), and more recently signature-tagged mutagenesis that combines whole genome sequencing and the construction of libraries of bacteria containing different transposon insertions to link an observed phenotype to a genotype. These studies were conducted to identify virulence genes in

Staphylococcus aereous, Vibrio chloerae, Streptococcus agalactiae, Listeria monocytogenes and

Streptococcus pneumonie (116).

Transposon mutagenesis in Rickettsiales has proven to be a better tool for the transformation of members of this order (117, 118). Together with a better knowledge of suitable transformation vectors, reporter and selectable markers and the characterization of host specific transcriptional regulatory elements such as promoters, this technology has improved genetic analysis in these organisms. This has allowed the construction of fluorescent mutants that are easily visualized, helping define non-essential genes and the development of gene knockouts.

Achievements specific to this bacterial order using transposon mutagenesis are outlined below.

Rickettsia spp.

Previous experiments in the transformation of Rickettsia prowazekii using homologous recombination show that there was a lack of suitable selectable markers. Based on this, alternate methods of positive selection and transformation were tested. In one case the arr2 gene

(Rifampin ADP-ribosyl transferase) was used and optimized to rickettsial codon usage and in this manner had a better chance that this gene was expressed within these organisms. The product of this gene ADP-ribosylates the antibiotic rifampin destroying its antibacterial activity.

This gene was placed downstream from the strong rickettsial rpsL promoter, and then this transcriptional unit was placed into the epicenter EZ::TN transposome system and delivered into

R. prowazekii by electroporation (118). Following selection, DNA was isolated from rifampin resistant bacteria and used for PCR, Southern blots and rescue cloning to confirm and map the transposon insertion sites. Multiple insertions were identified, three within putative genes and five within intergenic regions. This work showed an improved selection system and identified for the first time non-essential genes for this bacterial species.

Rickettsia monanensis, an endosymbiont isolated from Dermacentor andersoni and

Dermacentor variabilis ticks, was transformed using the same EZ::TN transposome system used for R. prowazekii. In this case the researchers added reporter markers to the plasmid carrying the transposon to assist the screening and visualization of mutant bacteria. Two different transposons for the simultaneous expression of reporter markers GFPuv or DsRed2 and the cat gene

(chloramphenicol acetyl transferase) were designed. The expression of reporter markers and antibiotic resistance were regulated by Rickettsia ompA and ompB promoters. Visualization of fluorescent bacteria demonstrated that reporter markers could be used to track these organisms and this system could be applicable to other Rickettsia. Molecular analysis to identify and map transposon insertions noted the presence of a plasmid carried by these bacteria since one transposon was integrated in it and this was confirmed by PFGE (pulse field gel electrophoresis and Southern blot in wild-type R. monanensis (119) (120).

In order to expand the repertoire of genetic tools for the genetic manipulation of R. prowazelii, the mariner-based Himar1 transposon was used to generate insertional mutants of this pathogen. Multiple insertional mutants were obtained in every experiment performed using this system in contrast to the EZ::TN system in which not all experiments produced recombinant bacteria, demonstrating that the Himar1 was more efficient for the creation of mutants in this bacterial species (121).

Rickettsia rickettsii is a member of the spotted fever group rickettsioses and the etiologic agent of Rocky Mountain spotted fever. Members of this group exploit the host actin polymerization machinery to propel themselves intra and intercellularly as a mechanism of cell spread. Previous work has proposed that the rickettsial protein RickA is directly involved in recruiting actin for their motility (122). Transposon mutagenesis of these organisms was achieved with the Himar1 transposon system. Analysis of clones of recombinant bacteria containing transposon insertions isolated a population of organisms that contained the transposon integrated within the sca2 gene and which had a small plaque morphology during the phenotypical characterization of these mutants. Further analysis determined that the small plaque phenotype was not observed because of slower growth, but because these mutants could not spread to adjacent cells as they could not induce actin polymerization. In the guinea pig model of infection, these sca2 mutants did not induce fever compared to the virulent wild-type counterpart, suggesting that the product of this gene is a virulence determinant of spotter fever

(123).

Anaplasma spp.

Taking into account the successful results using transposon mutagenesis to genetically manipulate Rickettsia species, Felsheim et al. isolated transformants of Anaplasma phagocytophilum via the Himar1 transposon system. Molecular characterization and sequencing determined multiple insertions of the transposon in the pool of mutants (not cloned), and that half of these insertions occurred within coding regions, three in unknown genes and one in the virB6 gene. In vitro analysis of these mutants determined that these organisms had normal growth in cell cultures of RF/6A, HL-60 and ISE6 tick cells and in in vivo experiments with mice. These results demonstrate that these genes were not essential for the survival of A. phagocytophilum in different hosts (124).

However in a different transformation experiment using the Himar1 transposon system a mutant containing a transposon insertion within the APH_0584 (o-methyltransferase gene, omt) exhibited reduced binding and survival in ISE6 tick cells but growth at normal rates in HL-60 and RF-6A cells. Further experiments suggested that this enzyme is required for modification of a protein involved in adhesion of A. phagocytophilum to tick cells (125).

Ehrlichia spp.

Recently the transformation of the human monocytic ehlichiosis agent, Ehrlichia chaffeensis using the Himar1 transposon system was achieved with the isolation of mutants containing multiple insertions in which three were localized within the coding region of transcriptionally active genes. These organisms grew continuously in macrophage and tick cell lines, showing that at least during in vitro growth these genes were not essential. However these mutants failed to infect deer (126).

Plasmids

Several Rickettsia species have been found to carry plasmids, some included in the spotted fever group Rickettsia such as R. amblyommii, R. massiliae, and R. peacockii and some included in the transitional group such as R. felis, R. helvetica, R. hoogstraalii and R. monacensis

(120, 127-129). Many of these plasmids have been sequenced separately after PFGE and

Southern blot analysis (120, 127) and as products of whole genome sequencing of the rickettsial hosts that carry them (128). Sequencing and annotation showed that these plasmids carry genes encoding potential environmental and host adaptive proteins and virulence factors, and exist as low copy number replicons with sizes varying from 12.4 Kbp up to 63Kbp. With the exception of genes necessary for plasmid maintenance such as dnaA like and parA genes these plasmids share little homology (120, 127, 128).

Burkhardt et al. (130) suggested that these plasmids could offer a good opportunity for the construction of shuttle vectors that could increase the array of tools for the genetic manipulation of Rickettsia especies. Toward this goal, two plasmids derived from R. amblyommii

(pRAM18-pRAM32) were modified for the construction of shuttle vectors. Sequences from these plamids that share homology to the DnaA-like replication initiation protein and partitioning protein parA were ligated into an E. coli plasmid backbone to provide the means of replication and segregation in Rickettsia and also propagation in E. coli. These shuttle vectors contained a cassette for selection and visualization of recombinant bacteria using the arr2 and gfpuv genes under the control of the rpsL promoter of R. prowazekii and the ompA promoter of R. rickettsii respectively. Similarly, an additional vector containing a MCS (multiple cloning site) with 7 restriction enzyme sites instead of the selectable and reporter marker cassettes was constructed.

Interestingly, a transcriptional unit containing the mCherry gene under the control of the A. marginale tr promoter was ligated into that MCS. Electroporation of these plasmids into R. bellii and R. montanensis resulted in the isolation of mutant bacteria carrying these plasmids extrachromosomally and expressing Rifampin ADP-ribosyl transferase and green or red fluorescent proteins. These results showed that the DnaA-like and parA genes were optimal for replication and maintenance of these plasmids within rickettsial cells. However long term maintenance of these plasmids is not stable unless the culture is kept under antibiotic selection.

Recently one of those R. amblyomii pRAM derived plasmids was used for the transformation of the pathogen R. prowazekii (131). Molecular characterization of rifampin resistant and green fluorescent bacteria determined that this plasmid was maintained as a low copy number (1 copy/Rickettsia) episome. Growth curve experiments showed that these mutants grow at rates comparable to that of wild-type R. prowazekii Madrid E strain. So until now, these

recombinant organisms are the first rickettsial pathogens to extrachromosomally maintain and express foreign DNA sequences carried on a replicon.

Until now no plasmids have been found in A. marginale or any Anaplasma species, neither experiments using these Rickettsia shuttle plasmids have been documented. However the information described above suggests that these newly developed vectors could be used in

Anaplasma and that could facilitate genetic analyses that require an extrachromosomal approach.

These might include characterization of regulatory sequences or promoters, testing of potential selectable and new reporter markers and importantly, the development of complementation experiments for the analysis of already genetically modified mutants with an altered phenotype.

Central Hypothesis

Although the complete DNA sequence of A. marginale is available (33-35), about 40% of its protein coding genes have been assigned putative functions, and several of those genes could be important for growth or viability. On the other hand, the increased use of molecular approaches such as whole genome DNA and RNA sequencing, proteomics and comparative genomics of A. marginale has identified potential virulence-associated genes (33-35, 62, 132,

133). This knowledge gap between gene discovery and gene function in A. marginale could be closed by developing genetic tools to generate gene knockouts or insertional mutants. The ability to create and characterize those mutants will be important to define genes that are required for invasion and growth of A. marginale in ticks and mammalian cells. Additionally the selection of characterized mutants with reduced pathogenicity in vitro could be evaluated in vivo as possible candidates for the production of genetically attenuated vaccines for the control of anaplasmosis.

Based on current knowledge one way to create insertional mutations in pathogenic bacteria is via transposon mutagenesis. Recent advances made toward the genetic manipulation of several members of the order Rickettsiales (121, 123), especially those closely related to A.

marginale such as A. phagocytophylum (117, 124) and Ehrlichia chaffeensis (126) have demonstrated that the Himar1 transposon mutagenesis system is the most useful towards this goal.

Nevertheless, previous attempts to transform A. marginale by transposon mutagenesis were not successful. Previously, the Himar1 transposon and transposase were delivered on two separate vectors into A. marginale resulting in the isolation of green fluorescent and antibiotic resistant bacteria, but with the entire plasmid carrying transposon sequences integrated in the A. marginale chromosome by a single crossover homologous recombination mechanism instead of the classical cut and paste mechanism of transposition (111). However the probability that both plasmids from the trans system described above will be introduced into the same cell is much lower than for a single plasmid. An optimized construct carrying in cis the Himar1 transposon and transposase sequences was developed for improving the transformation of A. phagocytophilum (117, 125). However data to support transformation efficiency using two constructs vs. a single one is not available. Based on this, it is important to evaluate if this system can be used in A. marginale. For this, electroporation of host-free Anaplasma marginale using a single plasmid carrying the Himar1 and the transposase sequences was performed by our collaborator Dr. Ulrike Munderloh at the University of Minnesota. These experiments resulted in the isolation of recombinant A. marginale that were characterized herein.

The central hypothesis of this work is that transformation of A. marginale via transposon mutagenesis using the Himar1 transposon/transposase system is achievable and useful for the creation of insertional mutants.

The specific aims to accomplish this are the following:

1. Analyze if mutated A. marginale results from integration of the Himar1 sequences within the chromosome of these organisms in a mechanism mediated by the transposase and map insertion sites.

2. Determine if transposon insertion occurs within a gene and if so, evaluate its effect on the expression of the gene.

3. Determine if Himar1 transposon insertion affects the expression of upstream and downstream sequences adjacent to the insertion site.

4. Evaluate if integration of the Himar1 transposon within A. marginale results in an altered phenotype.

CHAPTER 2 KNOCKOUT OF AN OUTER MEMBRANE PROTEIN OPERON OF ANAPLASMA MARGINALE BY TRANSPOSON MUTAGENESIS

Introduction

Anaplasma marginale is a tick-borne and obligate intracellular bacterium that causes bovine anaplasmosis, a disease that has gained particular attention due to the considerable economic losses for the cattle industry (9, 10, 134, 135). Onset of clinical disease is mainly characterized by a severe hemolytic anemia (9, 10). Cattle that survive acute infection become carriers of A. marginale and organisms can be transmitted to susceptible cattle mechanically or by tick bite (10). A. marginale persists in carrier cattle because of its capability to subvert the immune system using antigenic variation, in which different variants of outer membrane proteins such as Msp2 and Msp3 are expressed (26, 47, 68, 136).

Work on the development of a preventive vaccine against this disease began in the early

1900’s with the isolation of A. marginale subsp. centrale (13, 57). This less virulent strain, originally from South Africa, is used for immunization of cattle in Africa, Australia, South

America and the Middle East and remains the most widely-used and practical vaccine against bovine anaplasmosis (13, 57, 137). This vaccine is not approved in the United States because of the risk of transmitting contaminant blood-borne pathogens that will infect cattle (9). Recently, comparative genomic studies demonstrated that proteins that are conserved in US strains were not conserved in A. marginale subsp. centrale (35, 57, 137).

Different vaccination methods have been developed for the control of bovine anaplasmosis that range from attenuated live or killed organisms, to DNA and recombinant protein vaccines (13). But A. marginale derived from cell culture, killed organisms and DNA vaccines induce only partial protection (55, 84, 138). Immunization trials using outer membrane proteins or a complex of linked or unlinked outer membrane proteins of A. marginale derived

from erythrocytes have demonstrated good protection against high bacteremia, anemia and homologous strain challenge (49, 85-88). However, to promote long lasting protection, several immunization boosts may be required and in addition to this, production and purification of these components is time-consuming and expensive.

The increased use of molecular approaches such as whole genome, RNA sequencing, proteomics and comparative genomics of A. marginale has identified potential virulence- associated targets that can be altered or removed by reverse genetics techniques (33, 35, 62, 132,

133, 139). This could allow the creation of attenuated organisms that have reduced pathogenicity but still elicit cellular and antibody responses that stimulate immunity without causing disease.

Consequently the development of genetic tools to transform A. marginale and generate in-vitro gene knockouts, or insertional mutants that can be tested for attenuation in their in-vivo environment is of great significance.

One way to create insertional mutations in pathogenic bacteria is via transposon mutagenesis, in which a library of recombinant bacteria containing different transposon insertions can be created, allowing for the screening of mutant strains with diverse phenotypes

(114, 140). The Himar1 transposon is a non-replicative class II DNA transposon that is a member of the Tc1/mariner family and is often used for the creation of insertional mutants. Since these types of transposons are horizontally transferred between species, they do not have host restricted functions, making them suitable for use in a wide-range of eukaryotic and prokaryotic hosts (140, 141). In addition to this, the Himar1 transposon does not have DNA target specificity since it is integrated randomly in TA dinucleotide sites (141-143). Because of these advantages, transposon mutagenesis using this system has been successfully developed in other tick-borne pathogens such as Rickettsia rickettsii, Coxiella burnetii, Borrelia burgdoferi, Francisella

tularensis, Ehrlichia chaffeensis and Anaplasma phagocytophilum (123, 124, 126, 144-150).

These previous results suggest that this system could be useful for the transformation of A. marginale.

Nevertheless, previous attempts by our collaborator Dr. Ulrike Munderloh at the

University of Minnesota to transform A. marginale by transposon mutagenesis were not successful. Before , the Himar1 transposon and transposase were delivered in two separate vectors into A. marginale which resulted in the isolation of green fluorescent and antibiotic resistant bacteria. However molecular characterization of these recombinant organisms established that the entire plasmid carrying the transposon sequences was integrated into the A. marginale chromosome by a single crossover homologous recombination mechanism instead of the classical cut and paste mechanism of transposition (111). Recently, transformation experiments carried out by our collaborator using an optimized construct carrying in cis the

Himar1 transposon and transposase sequences resulted in the isolation of red fluorescent and spectinomycin and streptomycin resistant A. marginale. Therefore, the purpose of this work was to evaluate first, if classical transposon mutagenesis using the Himar1 transposon system was the recombination mechanism that allowed the isolation of recombinant A. marginale, and second, if transposon mutagenesis using this system, is useful for the creation of insertional knockout mutations.

Materials and Methods

Cultivation of Anaplasma marginale

Cultures of A. marginale str. Virginia wild-type and omp10::himar1 mutant were maintained in tick ISE6 cells derived from embryonated eggs of the blacklegged tick, Ixodes scapularis at 34C in non-vented 25-cm2 cell culture flasks (NUNC). A. marginale-infected cell cultures were maintained in L15B300 medium supplemented with 5 % fetal bovine serum (FBS,

BenchMark, Gemini Bio-Products), 5 % tryptose phosphate broth (TPB, Difco, Becton

Dickinson), 0.1 % bovine lipoprotein concentrate (LPC, MP-Biomedical), 0.25 % NaHCO3, and

25 mM Hepes buffer, adjusted to pH 7.8, as previously described (151). The cell culture medium for ISE6 cells infected with the A. marginale omp10::himar1 mutant was supplemented with spectinomycin (Sigma Aldrich) and streptomycin (Sigma Aldrich) to a final concentration of 50

g/mL each.

Isolation of the Anaplasma marginale Mutant by Transposon Mutagenesis

Transformation experiments of A. marginale and isolation of mutants were performed in collaborative work with Dr. Ulrike Munderloh at the University of Minnesota.

To maximize chances of obtaining a transformant using transposon mutagenesis, a single plasmid construct that encoded both the transposon and the transposase in cis configuration as described (117) was used, except that the fluorescent marker was replaced by sequences encoding a monomeric red fluorescent protein, mCherry (152). A. marginale bacteria passaged

53 times in ISE6 cells were harvested from one 25-cm2 culture in 5 mL of medium when ~80 % of cells were infected, and many cells were undergoing lysis. The cells were recovered in 2 mL of culture medium, and added to a 2-mL microcentrifuge tube containing 0.3 mL of sterile silicon carbide abrasive (60/90 grit; Lortone, Inc), vortexed at maximum speed for 30 sec, and the lysate transferred to a fresh 2-mL tube on ice. Bacteria were collected by centrifugation at

11,000 g for 10 min at 4 oC, and washed twice in ice-cold 300 mM sucrose. They were then resuspended in 50 µL of 300 mM sucrose containing 3 µg of plasmid DNA, and incubated on ice for 15 min before being electroporated (Biorad Gene Pulser II) at 2 kV, 400 Ohm and 25 µF in a

0.2 cm gap cuvette. The electroporation mixture was recovered in 1.5 mL of an ISE6 cell suspension (~2X106 cells), and centrifuged in a microcentrifuge tube at 1,000 g for 10 min at

room temperature. The tube was left undisturbed for 30 min at room temperature, and the pellet then resuspended in the supernatant medium and added to a 25-cm2 flask containing ~5x106

ISE6 cells in 3 mL of L15B300 medium supplemented as described for Anaplasma-infected cultures.

The culture was incubated at 34 oC in a tightly capped flask. Three days after electroporation, the culture medium was replaced with 5 mL of medium additionally containing

50 µg/mL of spectinomycin and streptomycin (selection medium). Subsequently, the culture was fed twice weekly with selection medium and examined weekly on an inverted microscope

(Diaphot, Nikon) fitted for epifluorescence using a Texas Red filter. The first fluorescent colonies of bacteria were noted 6 wk following electroporation, and the culture was maintained in selection medium with twice-weekly medium changes until ~90 % of cells were infected. At that time, the mutant was passaged (ten-fold dilution) to fresh cells, and the remainder was stored in liquid nitrogen.

Preparation of Host Cell-free Anaplasma marginale Wild-Type and omp10::himar1 Mutant from ISE6 Tick Cells

Isolation of A. marginale wild-type and omp10::himar1 mutant was performed by disruption of ISE6 tick cells with 1mm diameter glass beads (BioSpec Technologies) in a

Minibead beater (BioSpec technologies) as described elsewhere (118), with the exception that cells were shaken only once for 10s and immediately placed on ice. Cell lysates were transferred to 1.5 mL centrifuge tubes and centrifuged at 100g for 5 min at 4 °C to pellet cell debris. The supernatant was then carefully removed and transferred to clean 1.5mL centrifuge tubes. A. marginale organisms (wild-type and omp10::himar1 mutant) were pelleted at 11,000 g for 10 min at 4 °C, and stored at -20°C.

DNA Isolation and Phi29 Amplification of the Anaplasma marginale Mutant

Before DNA isolation, pelleted A. marginale omp10::himar1 mutants were treated with

RNaseA (QIAGEN) and DNase I (Sigma Aldrich) to remove ISE6 host cell contaminant nucleic acids. DNA isolation was performed using the QIAamp DNA Mini kit (QIAGEN) as per manufacturer’s instructions, but in this case the DNA was eluted in 50 µL of 1mM Tris pH 9.0.

DNA concentration was determined using the Qubit dsDNA HS assay kit (Life technologies) on a Qubit fluorometer (Life technologies). 5 reactions of 10 ng of DNA were used for whole genome amplification using the Genomi Phi V2 DNA amplification kit (GE Healthcare) according to manufacturer’s instructions. Following amplification, aliquots were pooled together and the DNA purified with GelElute Extraction Kit (5 PRIME) by adsorption to silica particles and eluted with 10 mM Tris pH8.2.

Genome Sequencing and Bioinformatics

Samples from 2.0 to 3.6 µg of amplified DNA derived from the omp10::himar1 mutant, were provided for library construction and sequencing by the Roche/454 (GS-FLX) method to the Interdisciplinary Center for Biotechnology Research (ICBR) at the University of Florida.

Also, samples of equivalent amounts were provided to the Scripps Research Institute, La Jolla,

California for sequencing by the Illumina (HiSeq) method.

A total of 374,151 and 207,288,916 reads of Roche/454 and Illumina sequencing data, respectively, were obtained. The FASTQ files provided by the sequencing facilities were uploaded to the UF GALAXY web site http://galaxy.hpc.ufl.edu, and analyzed separately.

Uploaded Illumina FASTQ files were groomed, filtered and formatted into FASTA files using the FASTQ Groomer, Filter FASTQ and FASTQ to FASTA converter tools located in the

NGS: QC and manipulation toolbox of GALAXY. FASTA files were then aligned to the A. marginale str. St Maries reference genome sequence (CP000030) using the Megablast alignment

tool (NCBI BLAST+ blastn (version 0.0.12) in GALAXY) to obtain sequencing reads that contained A. marginale sequences.

These A. marginale sequencing reads were then used for a second Megablast alignment using as a reference sequence 28 nucleotides from the Himar1 terminal inverted repeats (TIR).

The transposon insertion locus within the A. marginale chromosome was then determined, since the reads obtained contained the A. marginale-Himar1 TIR junctions.

A similar strategy was used for the analysis of the Roche/454 sequencing reads. CLC

Genomics Workbench, version 6.5 was used for assemblies of Roche/454 and Illumina reads.

GenBank accession numbers: for assembled contigs containing the Himar1 transposon sequences integrated within omp10 and upstream genes (KJ567138) and omp10 (partial 3’ end) and omp9 genes (KJ567139).

RNA Isolation

For RNA isolation, three samples of ISE6 cells infected with A. marginale wild-type and three omp10::himar1 samples were used. Each sample derived from separate cultures grown in

T-25 cell culture flasks. Samples containing approximately equal numbers of infected cells were collected in RNA stabilization reagent RNAlater (AMBION-Life technologies) and stored at -

80°C. Total RNA was isolated using the RNeasy kit (QIAGEN) with an added “on-column”

DNase I treatment (QIAGEN) according to manufacturer’s instructions. Aliquots of extracted

RNA were used to measure contaminant DNA concentration using the Qubit dsDNA HS assay kit (Life technologies). Additionally, RNA was treated three times with RNase-free Dnase I

(AMBION-Life technologies) to remove any trace of contaminant DNA in the sample. RNA concentration was measured with the Qubit RNA assay kit (Life technologies), and samples were stored at -80°C.

RT-PCR and RT-qPCR Experiments

RNA (2 µg) from ISE6 cells infected with A. marginale wild-type and omp10::himar1 mutant was converted to cDNA by random priming using a Omniscript reverse transcriptase kit

(QIAGEN) according to manufacturer’s conditions. Genomic DNA and no-reverse transcriptase reactions were included as controls for each sample and each nucleic acid target. Specific primers (Table 2-1) were designed to amplify transcripts from intergenic regions between omp7- omp8, omp8-omp9, omp9-omp10 and omp10-AM1225 using cDNA from ISE6 cells infected with A. marginale wild-type as template. Similarly, transcripts from within omp6, omp7, omp8, omp9, and omp10 genes were detected by PCR amplification of cDNA from ISE6 cells infected with A. marginale wild-type and the omp10::himar1 mutant using omp6-10 specific primers

(Table 2-1). PCR amplification conditions for each PCR experiment are described in (Table 2-2) and (Table 2-3) respectively and each reaction contained 200ng of cDNA combined with 200µM dNTP’s, 0.3µM of forward and reverse primers and 1.25 units of PrimeSTAR GXL DNA polymerase (Takara). PCR products were electrophoretically separated using a 1 and 2% Seakem

LE (Lonza) Agarose gel, and stained with SYBR Gold nucleic acid gel stain (Life technologies) for UV visualization. Genomic DNA and samples with no reverse transcriptase for each target were used as positive and negative controls respectively.

RT-qPCR Experiments

Transcript differences between omp8, omp9, omp10-5’ end, and omp10-3’ genes in A. marginale wild-type and omp10::himar1 mutant were determined using the comparative 2-∆∆Ct method (153, 154) and the results were based on the mean of three biological samples (individual

RNA extracts). For Taqman quantitative PCR, cDNA obtained from ISE6 cells infected with A. marginale wild-type and the omp10::himar1 was used with primers and probes (Table 2-1) designed to amplify omp8, omp9, omp10-5’ end, omp10-3’ end, msp5, rpoH and the 16S gene

sequences. For relative gene expression data normalization the reference genes used were msp5, rpoH, and 16S. Each reaction was performed in triplicate with 5uL of cDNA in a volume of

25uL containing 1x Quantitect Probe PCR master mix (QIAGEN), 0.4uM of forward and reverse primers, and 0.2uM of probe and cDNA. Amplifications were performed in a Bio-Rad DNA engine Opticon 2 thermal cycler with the following conditions, 95°C for 15 min, and 40 cycles of 94°C for 15s and 60°C for 1 min. qPCR amplification efficiencies

The cDNA obtained from ISE6 cells infected with wild-type A. marginale was used for qPCR amplification with primers and probes targeting omp8, omp9, omp10-5’ end, omp10-3’ end msp5, rpoH and the 16S genes (Table 2-1).

Primer-probe reaction efficiencies were determined for each primer-probe set by performing a ten log range of 5-fold serial dilutions of cDNA for the purpose of generating standard curves from which reaction efficiencies could be calculated. The qPCR reactions were performed in triplicate with 5uL of cDNA from each dilution. Each reaction had a net volume of 25uL containing 1x Quantitect Probe PCR master mix (QIAGEN), 0.4uM of forward and reverse primers, and 0.2uM of probe and cDNA. DNA amplifications were performed in a Bio-Rad

DNA engine Opticon 2 thermal cycler with the following conditions, 95°C for 15 min, and 40 cycles of 94°C for 15s and 60°C for 1 min.

5uL of qPCR product from each target was analyzed in a 2% Seakem LE (Lonza) agarose gel stained with SYBR Gold nucleic acid gel stain (Life-Technologies) for UV visualization and confirmation of primers and probes target specificity (Figure 2-1).

The efficiency of amplification was calculated from the slope of the standard curve plots of Ct values vs. the log of cDNA input, using the formula E = (5-1/slope)-1. Amplification efficiencies for each target are reported on the (Table 2-4).

Relative efficiency plots

For a valid 2-∆∆Ct calculation, the efficiency of target amplification and the reference genes must be approximately similar in value and fall within acceptable efficiency range of 90 and 110%. Relative amplification efficiencies of the target genes (omp8, omp9, omp10-5’ end and omp10-3’ end) versus reference genes (msp5, rpoH, and 16S) were calculated by performing standard curves for each amplicon in the same manner and conditions to those used to determine the amplification efficiencies. The Ct values generated were used to calculate a ∆Ct value (Ct target gene-Ct reference gene) for each sample which corrected for any template loading discrepancy between reactions. Plots of ∆Ct values versus the log of cDNA input were used to determine the slope of standard curve. Relative efficiencies of target vs. reference genes are reported in (Table 2-5).

Significant differences between the A. marginale wild-type and omp10::himar1 mutant were calculated by Student’s t test (P<0.05), comparing ∆Ct values (target gene- reference gene) of the omp10::himar1 mutant and the wild-type. The fold difference was based on ∆∆Ct

(omp10::himar1 mean ∆Ct – wild-type mean ∆Ct) and calculated as 2-∆∆Ct which yields the expression ratio. The expression ratio was then expressed as percentage of expression by multiplying the 2-∆∆Ct values by 100. For normalization of relative gene expression data msp5

(155), rpoH, and 16S were used as reference genes.

Western Immunoblots

Expression of the Omp9 protein in A. marginale wild-type and omp10::himar1 mutant was assessed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and immunoblotting using equal amounts (108) of host-free bacteria. Membranes were incubated with three different antibodies; the anti-Omp9 monoclonal antibody 121/1055 (156), the monoclonal antibody

F16C1 (reacts with the Msp5 protein and served as a loading control) (157) and the monoclonal

antibody Tryp1E1 (exhibits specificity for a variable surface glycoprotein of Trypanosome brucei) (157). This last antibody served as a negative control. Final concentrations of each antibody used were 4g/mL, 2g/mL and 4g/mL. Antibody binding was detected with the secondary antibody goat anti-mouse IgG, horseradish peroxidase labeled and diluted to 1:10,000 using the Pierce ECL Western blotting substrate (Thermo scientific) as described in manufacturer’s instructions.

Quantification of the number of A. marginale wild-type and omp10::himar1 organisms was performed by qPCR using the forward and reverse primers AB1242 and B1243 and the probe AB1250 (Table 2-1) that targets the single copy gene opag2 (111).

Triplicate reactions from each duplicate culture at each time point were used. Reactions of 25µL containing 5µLl of DNA from A. marginale wild-type and omp10::himar1 mutant strains, 1X of Quantitect Probe PCR mix (QIAGEN), 0.4uM forward and reverse primers and

0.2uM of probe were used for amplification in a Bio-Rad DNA engine Opticon thermal cycler with the following conditions, 95C for 15 min and 40 cycles of 94C for 1 min, 54C for 15s and

60C for 1min.

Ten-fold serial dilutions of the opag2/pCR-TOPO vector were used for standard curve preparation, and the A. marginale copy number was calculated based on the standard curve. No template control, uninfected cells and DNA from Anaplasma phagocytophilum were used as negative controls.

Results

Transformation of Anaplasma marginale by Transposon Mutagenesis

Attempts to transform A. marginale by transposon mutagenesis using the Himar1 transposon/transposase system delivered in two separate plasmids were not successful. The

probability that two plasmids are introduced at once into A. marginale organisms could be very low, especially when viability in the extracellular environment might be highly compromised, resulting in a low fraction of cells competent to take up DNA.

Therefore in order to promote transposon mutagenesis in these bacteria, the transposase was provided in cis with the Himar1 transposon sequences (R. F. Felsheim unpublished data).

The pHimarcisA7mCherry-SS contains the hyperreactive allele A7 transposase and the Himar1

TIR flanking the mCherry reporter gene and the aadA gene, which confers resistance against spectinomycin and streptomycin. Expression of the transposase and the reporter and antibiotic selection genes is driven by the A. marginale tr promoter (41, 111) (Figure 2-2 panel A).

Antibiotic selection pressure of electroporated bacteria with this construct resulted in the isolation of red fluorescent and antibiotic resistant bacteria (Figure 2-2 panel B).

Mapping of Transposon Insertion within the Anaplasma marginale Chromosome

Roche/454 and Illumina high-throughput genome sequencing methods were used to determine: 1) the location of plasmid sequences within the A. marginale chromosome, 2) the recombination mechanism that allowed the segregation of mutant bacteria and 3) if these recombinant organisms correspond to a population containing insertions in different genomic locations or to a single genome site.

Mutations produced by the integration of the Himar1 transposon into the A. marginale chromosome will generate new junction sequences that are absent in the wild-type. These new sequences should include the Himar1 terminal inverted repeats (TIR) followed by the sequence of the regions in which the transposon is integrated. Based on this, the strategy used to map the

Himar1 insertion site involved alignment of the sequencing reads obtained by Roche/454 and

Illumina methods to two reference sequences, the A. marginale str. St Maries genome sequence

(CP000030) and the Himar1 TIR sequence. The Himar1 TIR-A. marginale genome junctions

were identified by extracting reads that aligned to the A. marginale genome at one end and to the

Himar1 TIR at the other end (Figure 2-3 panel A.).

Analysis using Illumina reads mapped the Himar1 TIR-A. marginale genome junctions into a region of omp6 and omp10 genes. Interestingly these reads contained the same mutated sequence. Omp6 and omp10 share a large stretch of identity 456 nt/459 nt (99%) (156). The short, 100 nt length of the Illumina reads, made it difficult to differentiate which gene contained the Himar1 transposon. Additional analysis using longer reads obtained on the Roche/454 platform revealed that the Himar1 transposon was integrated within the omp10 gene. These reads contained a region of omp10 that is not shared with omp6. Based on this sequencing analysis the genomic location of the Himar1 transposon in the chromosome of the transformed A. marginale, is at nucleotide 245 downstream of the omp10 start codon (Figure 2-3 panel B).

These results were verified by PCR amplification of gDNA from ISE6 cells infected with wild-type and transformed A. marginale using omp6 and omp10 specific primers (Figure 2-3 panels B and C). The size of omp6 amplicons (492 bp) in wild-type and transformed A. marginale was the same. However the size of the omp10 amplicon in transformed A. marginale was increased by 1836bp when compared to the wild-type (969 bp), indicating that the transposon was integrated within the omp10 gene.

Since there is not an A. marginale str. Virginia genome sequence, I wanted to confirm that the transposon location in this strain was the same as the one mapped in the A. marginale str.

St Maries reference genome. For this, combined Roche/454 and Illumina reads were assembled and a contig of 21,324 nucleotides identified. Alignment of this contig with the A. marginale str.

St Maries genome showed that this sequence contained part of omp10 and upstream genes

(Figure 2-4 panel A) and that the transposon insertion site in the A. marginale str. Virginia matches the same region mapped using the reference genome (figure 2-4 panel B).

Further analysis of sequencing reads determined that there is only one transposon insertion in the chromosome of recombinant A. marginale. The reads containing the Himar1

TIR-A. marginale junctions aligned to a single genome site. Although these transformed organisms were not cloned, data suggest that they are isogenic for the transposon insertion site within the omp10 gene.

The mobilization of the Himar1 transposon from one locus to another is mediated by a transposase using a cut and paste mechanism (140, 143). It has been shown previously in other organisms that the Himar1 transposon integrates preferentially into a TA site and leads to duplication of this dinucleotide upon integration into the target site (143). This was found to be true also for A. marginale. Sequencing analysis revealed that the Himar1 transposon targeted a

TA dinucleotide in omp10 (Figure 2-5 panel A) and upon integration it is flanked by a TA dinucleotide sequence (Figure 2-5 panel B). Thus, the mobilization of the Himar1 transposon into the omp10 gene of A. marginale was mediated by means of the A7 transposase in a cut and paste mechanism. This transformant of A. marginale will be referred to as omp10::himar1 mutant.

Evidence for Expression of omp10 as Part of an Operon

During this analysis I hypothesized that the transposon insertion could alter the expression of omp10 and downstream genes. This hypothesis is based on recent work in which the transcriptome profile of A. marginale using RNAseq indicated that omp10 is expressed as part of a six-gene operon in erythrocytes of infected cattle (62). This operon includes AM1225, omp10, omp9, omp8, omp7 and omp6 (Figure 2-6 panel A).

Because of this, it was important to determine if omp10 is expressed within a polycistronic message in A. marginale replicating in ISE6 tick cells. The intergenic region between AM1225 and omp10 is 440 bp long, while intergenic regions between omp10-9, omp9-8, omp8-7 and omp7-6 are 62bp, 63bp, 64bp and 39bp respectively (figure 2-6 panel A). To test whether AM1225 through omp7 are expressed as a single transcriptional unit, total RNA isolated from ISE6 cells infected with wild-type A. marginale was reverse transcribed and template cDNA was used for amplification of intergenic regions with primers that connect neighboring genes (Figure 2-6 panel A). Omp6 was not included during these experiments, because previous work (156) and work in our lab showed that transcripts from this gene are not detected in A. marginale during infection of tick cells. Appropriate size amplicons of the intergenic regions between omp7-8, omp8-9, omp9-10 and omp10-AM1225 gene were detected (Figure 2-6 panel

B), providing evidence that these genes are transcribed as a single mRNA in A. marginale infected tick cells.

RNA Transcript Analysis

Next, I determined if insertion of the Himar1 sequences resulted in alteration of omp10 expression and the expression of genes downstream. For this, total RNA from ISE6 tick cells infected with A. marginale wild-type and omp10::himar1 mutant was reverse transcribed and cDNA used as template for PCR amplification with specific primers that were designed to anneal to omp6, omp7, omp8, omp9, and omp10 in wild-type and omp10::himar1 mutant respectively

(Figure 2-7 panel A). omp10, 9, 8, and 7 but not omp6 are transcriptionally active in wild-type A. marginale, although at low levels (Figure 2-7 panel B). The Himar1 transposon insertion into the coding sequence of omp10, disrupted its expression and that of omp9, omp8, and omp7 since transcripts from these genes were not detected in omp10::himar1 mutants of A. marginale by this method (Figure 2-7 panel B). To ensure integrity, cDNA samples from A. marginale wild-type

and omp10::himar1 mutant were used for amplification with specific primers of a region of 131 bp of the 16S rRNA. Amplicons from this region were detected in both wild-type and omp10::himar1 mutant. No bands were visualized in negative controls (Figure 2-7 panel B).

Since omp10 through omp7 are expressed at low levels in ISE6 tick cells, RT-qPCR was used to quantitatively determine differences of expression between A. marginale wild-type and omp10::himar1 mutant. For this, cDNA generated from ISE6 tick cells infected with A. marginale wild-type and omp10::himar mutant was used for real time PCR amplification using primers and probes targeting omp8, omp9, and the 3’ and 5’ ends of omp10 (Figure 2-8 panel A).

In order to compare these gene expression results between wild-type and omp10:himar1

A. marginale, Ct values were normalized to the rpoH, msp5 and 16S rRNA genes. Changes in expression of these genes were calculated by the 2-ΔΔCt method, and results were expressed as percentage of expression, with a 100 % expression level being assigned to the calibrator or control group, which in this case is wild-type A. marginale.

Although three different reference genes were used, RT-qPCR data normalization led to similar results in which there was a significantly reduced expression for omp8 (98-100 %), omp9

(92-99 %) and omp10 3’ end (85-99%) relative to their counterparts in wild-type A. marginale

(Figure 2-8 panel B). These results show that Himar1 transposon insertion into omp10 affected its expression and the expression of genes downstream, confirming the results obtained by RT-

PCR and agarose gel electrophoresis. A second experiment investigated the possibility of the same effect occurring in regions of omp10 before the Himar1 transposon insertion site. For this a primer and probe set was designed to anneal with a region at the 5’ end of omp10 (Figure 2-8 panel A). Even though there was a significant reduction in the detection of transcripts from this

region (28-58%) relative to the 5’ end of omp10 in wild-type, this reduction was not as great as with the sequences located in omp10 downstream of the Himar1 transposon insertion site.

Western Immunoblot Analysis

To determine if the decreased expression of mRNA in genes downstream of omp10 correlated with protein expression a Western immunoblot analysis using anti Omp9 antibody was performed.

To compare the protein expression of omp9 between A. marginale omp10::himar1 and wild-type, the number of organisms per sample was quantified by qPCR using the opag2 single copy gene to determine the copy number of A. marginale. 108 organisms of A. marginale wild- type and omp10::himar1 mutant were loaded per lane. A. marginale str. Virginia initial bodies and uninfected ISE6 cells were used as positive and negative controls respectively.

Western immunoblot showed a reduced expression of Omp9 in omp10::himar1 A. marginale mutant compared with wild-type (Figure 2-9 panel A). The Omp9 band of 40kDa was present in wild-type and initial bodies but was not detected in the mutant or using negative control antibody Tryp1E1 (Figure 2-9 panel B). Antibody F16C1 that reacts with major surface protein 5 (Msp5) was used as a loading control. Anti-Msp5 detected this protein (19kDa) in wild- type and omp10::himar1 A. marginale (Figure 2-9 panel C).

These results correlated with results obtained from the RNA transcript analysis, showing that the transposon insertion severely affected the expression of both mRNA and protein from downstream genes such as omp9.

Discussion

The possibility of creating insertional mutations in A. marginale not only could provide a broad understanding of gene products required for infectivity, growth or viability of this

pathogen in the mammalian host and the tick vector, but also would allow the generation of genetically attenuated organisms that can be tested in vaccination trials.

Here, this dissertation reports that transposon mutagenesis using the Himar1 transposon/transposase system for A. marginale is achievable and it could be useful for creating insertional mutations in these organisms. High throughput genome sequencing analysis for the characterization of these transformants established that transposon sequences are integrated within the omp10 gene of the A. marginale chromosome and its mobilization within this gene was mediated by the transposase in a cut and paste mechanism, since i.) the transposon sequences were integrated within a TA dinucleotide site ii.) upon integration of the transposon, this sequence was duplicated and is found flanking the transposon TIR at the junctions with the

A. marginale genome and iii.) sequences from the delivering vector outside the transposon were not found.

Although these omp10::himar1 mutant organisms were not cloned, they are isogenic for the transposon insertion within the omp10 because all the sequencing reads containing the transposon- A.marginale genome junctions aligned to the same genome site in the A. marginale str. St. Maries reference genome sequence (CP000030).

The omp10 gene is part of the omp1 through omp14 clusters, members of the msp2 superfamily that correspond to the pfam01617 family of bacterial surface antigens (33). Deep sequencing of cDNA generated from total RNA of erythrocytes infected with A. marginale identified 70 putative operon arrangements. One contained omp10 transcribed as part of an operon of six genes with AM1225 at the 5’ end and with omp9, omp8, omp7 and omp6 arranged in tandem at the 3’ end (62). In order to have a better understanding of the effects of the

transposon insertion in omp10 on adjacent genes it was important to determine if omp10 is also expressed as part of a polycistronic message in A. marginale replicating in tick cell cultures.

RT-PCR of intergenic regions between omp7-8, omp8-9, omp9-10 and omp10-AM1225 provided evidence that omp10 is transcribed within a polycistronic message in A. marginale infected tick cells. However transcripts of omp6 were not detected. Similar results in which omp6 expression was not detected in A. marginale infected IDE8 tick cells and in tick midguts were obtained by others previously (156). A lack of omp6 transcripts suggests that this gene may not be expressed in tick cells or only at very low levels. It has been shown that, in bacteria with reduced genomes such as Mycoplasma pneumonia, gene members of an operon are not always expressed at the same levels and those genes distal from the promoter may have lower expression (158).

RT-PCR and relative gene expression experiments demonstrated that insertion of Himar1 into omp10 at nucleotide 246 from the start of the ORF altered the sequence of this gene. This resulted in the loss of its expression since there was a significant reduction in the detection of transcripts from this gene when compared with the expression of omp10 transcripts from wild- type A. marginale.

It has been shown that in bacteria production and/or stability of mRNA in regions downstream of a transposon insertion is greatly reduced, to the point where very little mRNA corresponding to this region can be isolated (159). Insertion of Himar1 within a gene can affect the expression of neighboring genes, as shown in a variety of bacteria and especially in other tick-borne bacteria (126, 150, 160). Therefore, the effect of the Himar1 insertion on the expression of genes downstream and upstream of omp10 in omp10::himar1 A. marginale was evaluated. Results showed that the transcriptional activities of omp9 and omp8 were negatively

influenced by the insertion of the Himar1 within omp10 since detection of transcripts was significantly decreased in relation to wild-type omp9 and omp8.

Although the transcription activity of regions upstream of the transposon insertion site at the 5’ end of omp10 dropped significantly in relation to wild-type A. marginale, it was not as severe as with genes downstream of omp10. Sequencing analysis determined that the transposon sense strand is found in the opposite orientation to omp10, so it might be possible for transcription to read through the Himar1 sequences and produce anti-sense transcripts that could reduce expression of sequences upstream of omp10, but to demonstrate this further characterization is required.

Western immunoblot analysis showed that the transposon insertion into omp10 markedly reduced protein expression of omp9 in the omp10::himar1 mutant A. marginale when compared to wild-type, corroborating that both mRNA and protein expression from genes downstream of omp10 were disrupted.

The evidence presented here suggests that these genes are not essential for growth of A. marginale in tick cell culture. Significant work on the possible interactions between the expressed proteins in different host environments has accumulated and offers important clues about the possible phenotypic effects of the disruption of these genes in A. marginale. For example omp7, omp8, omp9 and omp10 are differentially expressed in tick and mammalian cells with lower levels in tick midgut and cultured tick cells (156). Detection of proteins from these genes has been reported (156, 161, 162). Omp7, Omp8 and Omp9 are conserved during tick transmission and in acute and persistently infected cattle (156). Characterization of the repertoire of outer membrane surface proteins by mass spectrometry identified Omp10 and Omp7 as immunogenic in cattle (161). Proteome analysis using crosslinking and liquid chromatography–

mass spectrometry (LC-MS/MS) to determine the composition and topological organization of surface proteins in A. marginale in mammalian and tick cells isolated a large protein complex.

Further analysis demonstrated that Omp7, Omp8 and Omp9 are arranged in the outer membrane as near neighbors to Msp2, Msp3, Msp4, Omp1, Opag2, Am779, Am780, Am1011, Am854 and

VirB1 in A. marginale isolated from erythrocytes (87). In contrast a similar sized large protein complex in A. marginale isolated from tick cells was formed only by Msp2, Msp3, Msp4,

Am778 and Am854. Although Omp7, Omp8 and Omp9 were expressed they did not seem to be localized to the surface. This suggests a possible re-arrangement in the topology of the surface of

A. marginale during the transition from the tick cell into the mammalian cell (87).

Interestingly, the number of Msp2 superfamily members such as omp1 to omp15 in A. marginale subsp. centrale, is reduced in comparison with US A. marginale strains (57). For example, closely related sequences to omp8 and omp6 are missing and omp10 is found with omp7 and a reduced omp9 in tandem, which may indicate an important function of these genes in the pathogenicity of A. marginale.

Based on this, further characterization of these omp10::himar1 mutants to understand the effects of the disruption of expression of omp10, 9, 8 and 7 on the phenotype of A. marginale is of critical importance. Phenotypic effects may include infectivity, tick transmissibility, stability under non-selectable conditions, ability to induce immune responses and ability to establish persistent infection within the natural host.

Table 2-1 *PCR and Taqman qPCR oligonucleotides used in this study Oligonucleotide sequence (5' to 3') Target Size Reference PCR AB1553 CTCCAATCGGAGGGGTTGTG omp6 492bp (156) AB1554 GCATAAATCCAGTTTAGCCTCC AB1555 GTGGTTAGATCTTTTCTGTTGGG omp7 399bp (156) AB1556 CGCTCTACCACTGACCTTCATG AB1591 GCTGGAGTTCGAAGCGATGC omp8 259bp This study AB1592 CAGAGCGCCCTGTTTCAGTG AB1559 AGCTGGGGCTCTTGCGTTTG omp9 1096bp (156) AB1560 AACATATTCACTATAATCTGACGCTGC AB1561 TCCTTCGGGTTGCTGCGTTG omp10 969bp (156) AB1562 GCTTACCCCCATTCCAGCAC AB1572 AGGATGATCAGCCACACTGGAA 16S 131bp This study AB1573 TACAACCCTAAGGCCTTCCTCA **qPCR AB1591 GCTGGAGTTCGAAGCGATGC AB1592 CAGAGCGCCCTGTTTCAGTG omp8 259bp This study AB1593 GCGTGAGCACTGCGGTACAGACGG AB1581 GAAGTCACTACACGACCTGACTGT AB1582 TAAAGCATCTTCGCGGGTCGT omp9 145bp (156) AB1583 TATTCAGTGCGCTGAACACTGCGATCCA AB1594 GTGGGTGCTGTACGCACATT AB1595 AAAGACAGCAGGCAGCAACA omp10-5' 170bp This study AB1596 CGCGTGTCCTTCGGGTTGCT AB1569 GGTGCTGAGTTGAAGCTTGC AB1570 GCCACAGACCCACTATCAGC omp10-3' 140bp (156) AB1571 TATCTCGCGCTGCATCGGTG AB1572 AGGATGATCAGCCACACTGGAA AB1573 TACAACCCTAAGGCCTTCCTCA 16S 131bp (41) AB1574 TATTGGACAATGGGCGCAAGCCTGAT AB1606 CTCACAGGCGAAGAAGCAGAC AB1607 GCCCGACATACCTGCCTTT msp5 145bp (155) AB1610 TGGGCGACAAGAAGCCAAGTGA AB1608 ATCAAAGCTATTGCGGAGGA AB1607 ACAGAACTCTCCCCATGCAC rpoH 116bp This study AB1611 TGCCAATCGGGACGTTTCGC AB1243 GGCGTGTAGCTAGGCTCAAAGT opag2 151bp (111) AB1250 CTCTCCTCTGCTCAGGGCTCTGCG * Primers and TaqMan probes used were manufactured at Eurofins MGM Operon. ** Underlined oligonucleotides are labeled with 6-Carboxyfluorescein 6-FAM at the 5’ end and Tetramethylrhodamine TAMRA at the 3’ end

Table 2-2 PCR conditions for the amplification of transcripts from omp7 through AM1225 intergenic regions

Step Temperature Time

Denaturation 94°C 2 minutes

Denaturation 94°C 10 seconds

35 cycles Annealing 60°C 58 seconds Extension 68°C 2 minutes

Extension 68°C 10 minutes

Table 2-3. PCR conditions for the amplification of transcripts from omp6 through omp10 from cDNA obtained from ISE6 cells infected with A. marginale wild-type and omp10::himar1 mutant organisms Step Temperature Time Denaturation 94°C 2 minutes Denaturation 94°C 10 seconds 35 cycles Annealing *60°C/**65°C 58 seconds Extension 68°C 2 minutes Extension 68°C 10 minutes *Annealing temperatures used for the amplification of omp6, omp7, omp8 and 16S ribosomal subunit. **Annealing temperature used for the amplification of omp9 and omp10

Table 2-4 qPCR reactions and amplification conditions Step Temperature Time

Denaturation 95°C 15 minutes

Denaturation 94°C 15 seconds

40 cycles Annealing/Extension 60°C 1 minute

Data collection

Table 2-5 qPCR amplification efficiencies *GOI qPCR efficiency E=(5-1/slope)-1 omp8 0.98 omp9 0.96 omp10-5' end 0.93 omp10-3' end 0.97 msp5 0.95 rpoH 0.90 16S 0.90 *GOI, gene of interest

Table 2-6. Relative amplification efficiencies Reference genes Relative efficiencies slopes omp8 0 .0327 msp5 omp9 0 .0182 omp10-5' end 0 .0267 omp10-3' end 0 .0826

omp8 0 .0273 rpoH omp9 0 .0127 omp10-5' end 0 .0676 omp10-3' end 0 .1211

omp8 0 .0226 16S omp9 0 .0848 omp10-5' end 0 .0061 omp10-3' end 0 .0223

Figure 2-1 Specificity of primers and probes in RT-qPCR reactions. omp8, 259bp, omp9, 145bp, omp10-5’ end, 170bp, omp10-3’ end, 140bp, msp5, 139bp, rpoH, 116bp and 16S, 131bp.

Figure 2-2 Transformation of Anaplasma marginale. A.Plasmid map of pHimarcisA7mCherry- SS used for the electroporation of A. marginale str.Virginia. B. Fluorescent (left) and phase contrast/fluorescence merged (right) images, of red fluorescent A. marginale replicating in ISE6 tick cells.

Figure 2-3 Mapping of Himar1 transposon insertion site. A. Sequencing reads that align at one end with A. marginale genome sequences (grey line), and with the Himar1 TIR (black bars) at the other end. Yellow lines represent the TIR-A.marginale chromosome junctions. B. Location of primer pairs (AB1553-AB1554) and (AB1561-AB1562) designed to target the omp6 and omp10 genes respectively, in wild-type (WT) and transformed A. marginale. Based on sequencing results the Himar1 sequences are integrated in the chromosome of transformed A. marginale at nucleotide 246 from the omp10 start codon (arrows) and mCherry and aadA (Str/Spc resistant) genes are in the opposite orientation to omp10. C. Agarose Gel electrophoresis. gDNA isolated from ISE6 tick cells infected with WT and transformed A. marginale, was used as template for PCR amplification with primers shown in B. (Lane 1) 100bp/1Kb DNA ladder. omp6 amplicons in transformed (lane 2) and WT (lane3) A. marginale were the same 492bp size. The omp10 amplicon in transformed A. marginale (lane 4) was 2805bp, while in wild type was 969bp.

Figure 2-3 Continued

Figure 2-4 Himar1 transposon insertion site in the A. marginale str. Virginia genome. A. ACT (Artemis Comparison Tool) window showing alignment between the A. marginale genome (CP000030) modified by inserting the Himar1 transposon sequences into omp10 at 1093291 nucleotide. This shows the relationship between part of omp10 and upstream genes of A. marginale str. St Maries (reference genome) and the contig formed by Roche/454 and Illumina sequencing reads from the A. marginale str. Virginia mutant. These two sequences share 99% identity (red band) .B. Window showing transposon sequences (black arrows). Yellow line represents omp10 start codon 245 nt from the transposon insertion site.

Figure 2-4 Continued

Figure 2-5 Characterization of Himar1 transposon insertion site. A. Artemis (genome browser and annotation tool) window showing the A. marginale genome (CP000030) used as a reference for the location of the omp10 gene (AM1223, 1092273-1093555), and the TA dinucleotide (1093290-1093291) at the Himar1 tn insertion site (arrow) determined by high throughput genome sequencing analysis. B. Himar1 tn insertion into the omp10 gene was mediated by the A7 transposase in a cut and paste mechanism leading to the duplication of TA dinucleotide sequences. A. marginale genome (underlined uppercase text, TA dinucleotide duplications (enhanced uppercase text) flanking the tn elements (bold lowercase).

Figure 2-6 Intergenic regions of Omp7 to AM1125 analyzed by RT-PCR. A. Diagrammatic representation of the AM1225-Omp6 operon with AM1225, omp10, omp9, omp8, omp7 and omp6 and intergenic regions. Location of primer pairs (AB1556-AB1591), (AB1592-AB1581), (AB1582-AB1569), and (AB1655-AB1595) designed for PCR amplification of omp7-8, omp8-9,omp9-10 and omp10-AM1225 intergenic regions using cDNA from ISE6 cells infected with A. marginale wild-type. B. Agarose gel analysis of amplicons connecting intergenic regions from omp7 through AM1225 (lanes 2, 5, 8, and 11). DNA was used as positive control (lanes 4, 7, 10, and 13). cDNAs from reactions with no reverse transcriptase were used as negative controls (lanes 3, 6, 9 and 12). 100bp/1Kb DNA ladder (lane 1).

Figure 2-7 Transcriptional analysis of the effect of the insertion of the Himar1 transposon within the omp10 gene by RT-PCR. A) Binding sites of primers (AB1553-AB1554), (AB1555-AB1556),(AB1591-AB1592), (AB1559-AB1560), and (AB1561- AB1562), designed to amplify transcripts on omp6, omp7, omp8, omp9 and omp10 respectively in wild-type (WT) and omp10::himar1 mutant. cDNA from WT and omp10::himar1 mutant grown in ISE6 tick cells was used for PCR amplification for omp6 through omp10 with specific primers to evaluate gene expression. B) Agarose gel analysis of PCR products for omp6 through 10 in omp10::himar1 mutant (lanes 2, 8, 14, 20, and 26). PCR products for omp6 through 10 in WT (lanes 5, 11, 17, 23, and 29). DNA was used as positive control (lanes 4, 7, 10, 13, 16, 19, 22, 25, 28, and 31). cDNA from no reverse transcriptase reactions were used as negative controls (lanes, 3, 6, 9, 12, 15, 18, 21, 24, 27, and 30). 100bp/1Kb DNA ladder lane 1). 16S rRNA (AB1572-AB1573) was used as internal control to ensure integrity of cDNA (lanes 32-37).

Figure 2-8 Relative gene expression determined by RT-qPCR. A) Location of binding sites for primers and probes designed to target omp8 (1. AB1591, 2. AB1592, 3. AB1593), omp9 (4. AB1581, 5. AB1582, 6. AB1583), 3’ end of omp10 (7. AB1569, 8. AB1570, 9. AB1571), and the 5’ end of omp10 (10. AB1594, 11. AB1595, 12. AB1596). B) Bar lengths represent the percentage of expression of omp8, omp9, 3’ end of omp10 and 5’ end of omp10 in A. marginale wild-type (red bars) and omp10::himar1 mutant (blue bars). msp5, rpoH and 16S rRNA were used as reference genes for data normalization. Changes in expression of these genes were calculated using the 2-ΔΔCT method. *Significant differences (P0.05) were calculated as described in materials and methods.

Figure 2-8 Continued

Figure 2-9 Immunoblotting of omp10::himar1 mutant and wild-type Anaplasma marginale using the specific monoclonal antibody against Omp9. Proteins from equal amounts of host cell-free wild-type (WT) and omp10::himar1 A. marginale were separated by SDS- PAGE gel electrophoresis. Immunoblot PVDF membranes of transferred proteins were reacted with monoclonal antibodies and reactions were visualized by chemiluminiscence. A) Monoclonal antibody Omp9 (4g/ml) with specificity to Omp9 protein (40kDa) (black arrow). B) Negative control, monoclonal Tryp1E1 (4g/ml) (exhibits specificity for a variable surface glycoprotein of Trypanosome brucei. C) Monoclonal F16C1 (2g/ml), reacts with the Msp5 (19kDa) (blue arrow) protein of A. marginale, was used as loading control. A. marginale str. Virginia and uninfected ISE6 cells were used as positive and negative controls respectively.

CHAPTER 3 PHENOTYPICAL CHARACTERIZATION OF AN OUTER MEMBRANE PROTEIN KNOCKOUT GENERATED BY TRANSPOSON MUTAGENESIS

Introduction

Anaplasma marginale is a tick-associated bacterium and the etiologic agent of bovine anaplasmosis, a disease that causes considerable losses to both dairy and beef industries worldwide (6, 9). Although organisms of this species are principally pathogenic to cattle, they are also found in other ruminants such as water buffalo and deer (11).

The transmission cycle of A. marginale has been well documented and indicates that the success of this pathogen depends on its ability to adapt to its invertebrate and vertebrate hosts. In the tick, during its transit from the midgut up to the salivary glands, A. marginale has to overcome different tissue barriers and defense mechanisms in order to ensure its transmission to the vertebrate host (163-165). In cattle, A. marginale replicates within mature erythrocytes producing an acute disease characterized by hemolytic anemia. However, one of the most important features of the biology of these bacteria is the lifelong persistent infection of its ruminant host. This is achieved by evasion of the immune system using a mechanism of antigenic variation in which different variants of outer membrane proteins such Msp2 and Msp3 are expressed. Therefore persistently infected cattle remain a reservoir of A. marginale organisms for continued tick transmission (14, 23, 26, 47, 165).

Thus the ability of A. marginale to thrive in such diverse environments could indicate that this pathogen uses a variety of genes to facilitate its survival. Hence the identification and characterization of these genes using recombinant DNA technologies is not only central to understanding the biology and pathogenesis of these organisms but also for the development of drug therapies and vaccines for the control of anaplasmosis. Recently, the use of transposon mutagenesis in A. marginale to create insertional knockout mutations was demonstrated (166).

Delivery of a plasmid containing the Himar1 transposon and the A7 transposase into host-cell free A. marginale resulted in the isolation of red fluorescent and spectinomycin and streptomycin resistant bacteria. Molecular characterization of these isolated mutant organisms established that the Himar1 transposon sequences were integrated within the omp10 gene and that its insertion not only altered the expression of this gene but also the expression of the downstream genes omp9, omp8 and omp7. Nevertheless these recombinant A. marginale organisms, referred to as omp10::himar1 mutants, are capable of infecting tick cell cultures suggesting that these genes are not essential for the survival of A. marginale in this environment (166).

In A. marginale omp10, omp9, omp8 and omp7 are outer membrane protein genes and part of the omp1 through omp14 clusters. These members of the msp2 superfamily correspond to the pfam01617 family of bacterial surface antigens (33, 156). RNA sequencing demonstrated that in A. marginale infected erythrocytes, omp10 is transcribed as part of an operon with

AM1225 at the 5’ end and with omp9, omp8, omp7 and omp6 in tandem at the 3’ end (62).

Similarly during infection of tick cells RT-PCR experiments showed that A. marginale expresses these genes as a polycistronic message (166).

Given the potential role of omp10, omp9, omp8 and omp7 in the pathogenesis of A. marginale I hypothesized that the reduction of the expression of these outer membrane protein genes caused by insertion of the Himar1 transposon sequences into omp10 could result in an altered phenotype. Because of this, I wanted to determine if these A. marginale omp10::himar1 mutants have morphological and or growth rate defects when compared to wild-type A. marginale, whether the transposon insert is stable without antibiotic selective pressure and finally, evaluate if these mutant bacteria could infect and colonize mammalian cells.

Materials and Methods

Cell Lines and Anaplasma marginale Cultivation

For this work two cell lines were used. Tick ISE6 cells derived from embryonated eggs of the blacklegged tick Ixodes scapularis were kept at 34 °C in non-vented T-25 cell culture flasks

(Nunc) and maintained in tick L-15B300 media supplemented with 10% heat inactivated Fetal

Bovine Serum (FBS) (Fisher Scientific) and 5% of tryptose phosphate broth (BD diagnostics)

(151). The mammalian cells RF/6A (ATCC CRL-1780) from the retina choroid endothelium of rhesus monkey Macaca mulata were kept at 37°C in vented T-25 cell culture flasks (Corning) and maintained in RPMI 1640 media (Hyclone) supplemented with 10% heat inactivated FBS,

2mM L-Glutamine (Life technologies), 0.25% NaHCO3 (Sigma-Aldrich) and 25mM HEPES

(Sigma-Aldrich) (31).

A. marginale str. Virginia wild-type and omp10::himar1 mutant were maintained in tick

ISE6 cells at 34 °C in tick cell media supplemented with 1% Lipogro (Rocky Mountain

Biologicals), 25mM HEPES (Sigma-Aldrich) and 0.1% NaHCO3 (Sigma-Aldrich). Infected

RF/6A endothelial cells with wild-type and omp10::himar1 A. marginale were maintained in supplemented RPMI 1640 media and incubated at 37 °C in a 5% CO2 environment.

Western Immunoblots

Binding pattern and specificity of the rabbit R883 antibody (monospecific antibody to affinity purified Msp2 (167) in A. marginale wild-type and omp10::himar1 mutant was assessed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and immunoblotting using equal amounts (108) of host-free bacteria. Membranes were incubated with the polyclonal R883 anti-

Msp2 antibody, and the normal rabbit serum (NRS). This last antibody served as a negative control. Final dilutions of each antibody were 1:10,000. Antibody binding was detected with protein G, horseradish peroxidase conjugated (Life technologies) diluted to 1:75,000 and

SuperSignal West Femto Chemiluminescent Substrate (Thermo scientific) as described in manufacturer’s instructions.

Immuno-Transmission Electron Microscopy

Cultures of ISE6 tick cells 50% infected with wild-type and omp10::himar1 mutant A. marginale as estimated by microscopy analysis of slides stained with Diff-Quik were fixed with

Electron Microscopy (EM) grade 4% paraformaldehyde, 1 % glutaraldehyde in 1X PBS, pH

7.24. Fixed cells were processed with the aid of a Pelco BioWave Prolaboratory microwave (Ted

Pella, INC). Samples were washed in 1X PBS pH 7.24, water washed and dehydrated in a graded ethanol series 25%, 50%, 75%, 95%, 100%, 100%, infiltrated in HM20 acrylic resin (Electron

Microscopy Sciences) and UV cured at -10°C for 48 hours. Cured resin blocks were trimmed, ultra-thin sectioned and collected on formvar coated Ni 400 mesh grids (Electron Microscopy

Sciences). Ultrathin sections were immune-labeled at room temperature as follows: grids were treated with 200mM NH4Cl in 1X HST (0.5 M NaCl, 0.02M, 0.1% Tween 20, pH 7.2) for 20 minutes, rinsed in high salt tween (HST), incubated for 1 hour with blocking solution 1.5% BSA,

0.5% cold water fish skin gelatin, 0.01% tween 20 in HST pH 7.2, and incubated with R883/ anti-Msp2 in 1:10,000 dilution, or the normal rabbit serum in 1:10,000 dilution overnight at 4°C.

The following day, the grids were washed in PBS 3X for 10 minutes each and incubated for 1 hour at 21°C in 18-nm colloidal gold affinity-purified goat anti-rabbit IgG (Jackson Immuno

Research) diluted 1:30 in PBS solution. Subsequent washes were in PBS and distilled water, then samples were post-stained with 2% aqueous uranyl acetate and Reynold’s lead citrate. Sections were examined with a Hitachi H-7000 transmission electron microscope.

Anaplasma marginale Wild-Type and omp10::himar1 Mutant Growth Curves

The growth kinetics of A. marginale wild-type and omp10::himar1 mutant were determined by Taqman quantitative real time PCR (qPCR) of genome equivalents (GE). Two

groups of 12 T-25 cell culture flasks, each with confluent monolayers of uninfected ISE6 cells, were inoculated with 1ml of ISE6 >90% infected with A. marginale wild-type and omp10::himar1 mutant. 24 hours after inoculation, the inoculum was removed and replaced with

5ml of fresh supplemented tick cell media and this time was considered 0 h postinfection (p.i.).

Duplicate cultures of infected cells with each A. marginale strain were harvested at different time points (0, 3, 5,9,11 and 13 days) p.i. Infected cells were harvested from the flask surface with a cell scraper into the supernatant, and centrifuged at 100g for 7 mins at room temperature and washed twice in 1X PBS. The final pellet was used for DNA extraction and quantification of A. marginale GE. Statistical differences in growth rates were evaluated using Student’s t-test with

SigmaPlot (Systat Software).

DNA Extraction and qPCR

DNA isolation from tick ISE6 cells infected with A. marginale wild-type and omp10::himar1 mutant was performed using the QIAamp DNA Mini kit (QIAGEN) as per manufacturer’s instructions. DNA concentration of each sample was determined using the Qubit dsDNA HS assay kit (Life technologies) on a Qubit fluorometer (Life technologies).

Quantification of A. marginale wild-type and omp10::himar1 GE was performed by qPCR using the forward and reverse primers AB1242 and B1243 (table 1) and the probe

AB1250 that targets the single copy gene opag2 (111).

Triplicate reactions from each duplicate culture at each time point were used. Reactions of 25µL containing 5µL of DNA from A. marginale wild-type and omp10::himar1 mutant strains, 1X of Quantitect Probe PCR mix (QIAGEN), 0.4M forward and reverse primers and

0.2M of probe were used for amplification in a Bio-Rad DNA engine Opticon thermal cycler

with the following conditions, 95C for 15 min and 40 cycles of 94C for 1 min, 54C for 15s and 60C for 1min.

Insert Stability

The stability of the transposon insertion without antibiotic (spectinomycin-streptomycin) selective pressure in A. marginale omp10::himar1 mutants was evaluated by measuring the variation of the ratio of the aadA (spectinomycin/streptomycin resistance gene-containing insert) copy number over A. marginale GE using qPCR during 7 serial passages. A. marginale GE were calculated using the opag2 single copy gene as previously described and the aadA gene was amplified using the forward and reverse primers AB1345 and AB1346; the probe was AB1347

(Table 3-1).

Ten-fold serial dilutions of the pHimarcisA7mCherry-SS plasmid were used for standard curve preparation, and the aadA gene copy number was calculated based on the standard curve.

Triplicate reactions from cultures at each passage were used. Reactions of 25µL containing 5µL of DNA from A. marginale omp10::himar1 mutant, 1X of Quantitect Probe PCR mix (QIAGEN), 0.4M forward and reverse primers and 0.2M of probe were used for amplification in a Bio-Rad DNA engine Opticon thermal cycler with the following conditions,

95C for 15 min and 40 cycles of 94°C for 1 min, 54°C for 15s and 60°C for 1min.

Infection of Endothelial RF/6A cells with Anaplasma marginale omp10::himar1 Mutant

For infection of RF/6A endothelial cells, A. marginale omp10::himar1 and wild type in

ISE6 were used as primary inoculum. ISE6 cells that were lysing due to heavy infection (>90%) with wild-type or omp10::himar1 A. marginale were transferred into a sterile centrifuge tube and briefly vortexed for 30 seconds to release bacteria. 1mL of inoculum from each strain was added to three wells (triplicate) of a six well plate (Corning) and cultures incubated at 37 °C in a 5%

CO2 environment. 2 days post infection the inoculum was removed and the media was replaced with fresh supplemented RPMI 1640 media. Media was replaced twice a week and infection was monitored daily by phase contrast and fluorescence and once a week by Diff-Quik staining.

Dual immunofluorescence to confirm RF/6A infection with the omp10::himar1 and wild- type A. marginale was performed using the monoclonal ANAF16C1 (anti-Msp5) (76) antibody and the rabbit anti-human von Willebrand factor (27, 32). Ten days after inoculation of RF/6A endothelial cells with A. marginale wild-type and omp10::himar1 mutant maintained with and without antibiotic (spectinomycin-streptomycin) selection, cell monolayers from T-25 cell culture flasks were detached by trypsinization and centrifuged at 100g for 7 minutes at room temp. The supernatant was resuspended in fresh media, then an aliquot was taken for Diff-Quik staining and approximately 500 µL containing of 104 cells were transferred in triplicate into 8 chamber slides (NUNC) and incubated overnight at 37 °C in a 5% CO2 environment. Next morning RPMI 1640 medium was removed and monolayers were washed three times with buffered saline (PBS), pH 7.5 without Ca2+ and Mg2+. Cells were fixed by adding 300 µL of acetone and incubated at room temperature for 10 minutes. Samples were blocked by adding

100µL of 5% BSA diluted in PBS and incubated in a humid atmosphere at room temperature for

1 hour and subsequently washed once with 0.05% tween-20 (Sigma-Aldrich) in PBS.

Samples were then reacted with primary and secondary antibodies as described previously (27, 32, 168). Briefly, samples were incubated for 1 hour at room temperature in a humid atmosphere with either antibody, monoclonal anti-Msp5 (ANAF16C1) 2 µg/mL or polyclonal anti-human von Willebrand antibody (Dako) 1:2dilution or an equal part mixture of mouse monoclonal anti-MSP5 antibody (ANAF16C1) 2µg/mL and rabbit anti-human von

Willebrand factor antibody (Dako). Negative control monoclonal Tryp1E1 antibody that exhibits specificity for a variable surface glycoprotein of Trypanosome brucei was used at a concentration of 2µg/mL and the normal rabbit serum was used at 1:2 dilution. Samples were then washed with 500µL of 0.05% tween-20 (Sigma-Aldrich) in PBS three times for 5 mins at room temperature and then reacted with secondary antibodies, Alexa Fluor 488 Goat Anti-Mouse

IgG antibody (Life technologies) to detect reaction with the primary ANAF16C1 and Alexa

Fluor 568 Goat Anti-Rabbit IgG antibody (life technologies) to detect reaction with von

Willebrand factor. Both secondary antibodies were used at a 1:400 dilution. Afterward, slides were washed as above, air dried and mounted using ProLong Gold Antifade Reagent with DAPI

(4',6-diamidino-2-phenylindole, dihydrochloride (Life Technologies).

Infection of Cattle with Anaplasma marginale omp10::himar1 Mutant

Experiments to evaluate the infectivity of the A. marginale omp10::himar1 mutant for cattle were performed as a collaboration at Washington State University by Dr. Kelly Brayton.

One spleen intact Holstein calf (#42362) was inoculated intravenously with approximately 105 A. marginale omp10::himar1. Cells were scraped from a heavily infected T-

25 culture flask, passed 20 times through a 20 gauge needle prior to injection. The calf was monitored for signs of infection by Giemsa stained blood smears, PCR and Southern analysis to detect Msp5 (169) and by competitive Enzyme-linked immunosorbent assays (cELISA) (77).

Because these tests were negative, a second attempt was made to infect the same calf at day 71

post the initial inoculation. Succesful infection of cattle by intravenous inoclulation of A. marginale has been reported with doses ranging from 104 up to 108 organisms in A. marginale str. St. Maries and the attenuated A. marginale subsp. centrale (88, 137). Based on this a second trial delivered approximately 108 omp10::himar1 mutant A. marginale. The animal was monitored for a further 46 days.

Results

Electron Microscopy of Anaplasma marginale omp10::himar1 Mutant

Transmission electron microscopy of omp10::himar1 A. marginale immunogold labeled with polyclonal anti-Msp2 (R883) antibody could aid in the localization, visualization and analysis of these organisms to determine if their morphology is characteristic of what has been described for wild-type A. marginale. Control reactions for immunogold labeling included ISE6 cells infected with wild-type A. marginale as positive control and normal rabbit serum (NRS) as negative control.

The polyclonal anti-Msp2 R883 antibody binding pattern and specificity was evaluated by Western immunoblot. A. marginale omp10::himar1 and wild-type copy number per sample was quantified by qPCR using the opag2 single copy gene. 108 organisms of A. marginale wild- type and omp10::himar1 mutant were loaded per lane. A. marginale str. Virginia initial bodies and uninfected ISE6 cells were used as positive and negative controls respectively. R883 specifically reacted with the major surface protein Msp2 (36 KDa) in A. marginale omp10::himar1, wild-type, and initial bodies (Figure 3-1). A similar reaction was not detected in the uninfected ISE6 cells or using negative control normal rabbit serum (Fig 3-1).

Immunoelectron microscopy with colloidal gold affinity-purified goat anti-rabbit IgG and rabbit anti-Msp2 antibody revealed gold particles bound to the omp10::himar1 and wild-type A. marginale surface (Figure 3-2 panels A and B). Gold particles were not observed on the

membranes of omp10::himar1 and wild-type A. marginale labeled with normal rabbit serum

(NRS) (Figure 3-2 panels C and D). The typical developmental cycle of A. marginale in tick cells involve two stages; a reticulate or vegetative form and the infective dense form. Upon internalization A. marginale is enclosed within a parasitophorous vacuole where it transitions into a reticulate form that divides by binary fission to produce multiple organisms that subsequently will change into the infective dense forms that will be released to infect adjacent cells (19). Based on electron microscopy analysis morphological defects in the omp10::himar1 mutant that could alter its development in infected ISE6 were not found. Instead, several of the characteristics common to the prototypical wild-type A. marginale were visualized, for example,

A. marginale omp10::himar1 mutant grows within membrane-bound inclusions or intravacuolar microcolonies (morulae) (19, 151) (Figure 3-3 panel A). Also also the ISE6 were infected with several morulae, an indication of multiple omp10::himar1 A. marginale invasion events (Figure

3-3 panels B and C) typical of A. marginale infection (151). We found morulae containing a homogeneous population of only enlarged oval organisms or only round bacteria (Figure 3-3 panel B and C) and some containing a heterogeneous population containing both shapes of bacteria (Figure 3-3 panel C). The two distinct morphological forms of A. marginale were also visualized in ISE6 cells infected with the omp10::himar1 mutant; enlarged oval and electron translucent or reticulate forms (Figure 3-3 panel D) and the round or coccoid electron dense forms (Figure 3-3 panel E). Several reticulated forms of omp10::himar1 A. marginale were undergoing cell division by binary fission consistent with previous TEM descriptions of A. marginale in ISE6 cells (Figure 3-3 panel D) (19). Reticulate and dense forms of omp10::himar1

A. marginale have an outer and inner membrane separated by a periplasmic space (Figure 3-3

panel E). These observations suggest that the morphology and development of A. marginale omp10::himar1 mutant in tick cell culture is similar to what has been observed previously.

Growth Curves of Anaplasma marginale omp10::himar1 vs. Wild-Type

A. marginale omp10::himar1 mutant was further characterized by comparing its in vitro growth rate to wild-type A. marginale. Duplicate cultures of infected ISE6 maintained without antibiotic (spectinomycin-streptomycin) selection were evaluated to determine the increase of genome equivalents by qPCR over a period of 13 days. At day 0 p.i. the genome equivalents mean copy number for omp10::himar1 and wild-type A. marginale were 6.15x105 copies/µl

(95% CI, 5.99x105 to 6.31x105) and 5.88x105 copies/µl (95% CI, 5.3x105 to 6.37x105) respectively. At day 13 p.i. the omp10::himar1 and wild-type genome equivalents copy number were 2.31x107 copies/µl (95% CI, 2.25x107 to 2.36x107) and 2.84x107 copies/µl (95% CI,

2.63x107 to 3.04x107) respectively. Both, A. marginale omp10::himar1 and wild-type had a log increase of genome equivalents of ~1. 27 and 1. 28 respectively (Figure 3-4). The growth rates of the omp10::himar1 mutant and wild-type A. marginale were not significantly different (P=0.763) and, rather, they had indistinguishable doubling times of 59.4 hours (2.5 days) for omp10::himar1 and 55.6 hours (2.3 days) for wild-type A. marginale.

Insert Stability

Stable maintenance of the transposon insertion was evaluated by qPCR to determine the copy number of the transposon insert per omp10::himar1 A. marginale genome with primers and probes (Table 3-2) specific to the transposon-bearing aminoglycoside adenyl transferase gene aadA and the single copy gene opag2. For this purpose, DNA samples obtained from duplicated cultures of ISE6 cells infected with the A. marginale omp10::himar1 mutant maintained during seven serial passages (~3 months) without antibiotic (spectinomycin/streptomycin) selection were analyzed. DNA obtained from similar cultures of ISE6 cells infected with the A. marginale

omp10::himar1 mutant receiving antibiotic selection were used as a positive control for insert maintenance. (Table 3-2) shows the comparison of the copy numbers obtained for the aadA and the opag2 genes in ISE6 cells infected with the mutant with and without antibiotic selection.

During the culture, loss of the insert could be indicated by a decrease in the aadA gene copy number and an increase in the opag2 gene copy number. However, during the seven serial passages of the mutant A. marginale maintained without antibiotic selection the aadA and the opag2 copy numbers were close and had an aadA/opag2 ratio comparable to that in cultures of the mutant receiving antibiotic treatment. These results indicate that the transposon insertion in the A. marginale omp10::himar1 mutant appears to be stable without antibiotic selection for prolonged culture periods.

Infectivity of omp10::himar1 Anaplasma marginale to Mammalian Cells In Vitro and In Vivo

Anaplasma marginale can be propagated in vitro in RF/6A endothelial cells derived from retina choroid of rhesus monkey (27, 31). To investigate if the A. marginale omp10::himar1 mutant can infect RF/6A endothelial cells, triplicate cultures of uninfected RF/6A endothelial cells were infected with lysing ISE6 cells (>90% infected) with A. marginale omp10::himar1 mutant and maintained with and without antibiotic (spectinomycin-streptomycin) selection.

Similarly, and as control for infection of endothelial cells, triplicate cultures of uninfected RF/6A cells were infected similarly with wild-type A. marginale.

Infection of A. marginale omp10::himar1 mutant in RF/6A cells was monitored by increase of red fluorescence emitted by replicating mCherry expressing Anaplasma. By ten days postinfection about 50%-60% of the cells were infected in cultures maintained with and without

(spectinomycin-streptomycin) antibiotic selection (Figure 3-5 panels A- D). Percentage of infection was confirmed by Diff-Quik staining and was similar in RF/6A cells infected with

wild-type A. marginale. The cytoplasm of infected cells contained a single large morula or was filled with small morulae that fluoresced red and which resembled those visualized in Diff-Quik stained cells (Figure 3-5 panels C, D and E).

To confirm omp10::himar1 A. marginale infection of endothelial cells, double immunofluorescence was performed using the monoclonal ANAF16C1 antibody that reacts with the major surface protein 5 (Msp5) of A. marginale (76) and the rabbit anti-human von

Willebrand factor that reacts to this factor present within Weibel–Palade bodies of endothelial cells (27, 32). Binding specificity to A. marginale Msp5 was showed in chapter 2 (Figure 2-9 panel C). Negative controls for the ANAF16C1 and anti-human von Willebrand factor antibodies were the monoclonal antibody Tryp1E1 that exhibits specificity for a variable surface glycoprotein of Trypanosome brucei and normal rabbit serum (NRS) respectively. The samples used for dual labelling were RF/6A cells infected with A. marginale omp10::himar1 mutant maintained with and without antibiotic and RF/6A endothelial cells infected with wild-type A. marginale. Figures 3-6 and 3-7 panels A and B show the immunofluorescence results of the specific binding of the antibodies ANAF16C1 anti-Msp5 to omp10::himar1 A. marginale (green) and the anti-human von Willebrand factor to RF/6A cells (red), that confirms that the entire monolayer was formed by endothelial cells. Juxtaposition of the green and red fluorescence signals showed co-localization of omp10::himar mutant A. marginale (green) within endothelial cells (red). Fluorescence similar to that emitted using these two specific antibodies was not detected in RF/6A endothelial cells infected with omp10::himar1 A. marginale labeled with the monoclonal TrypE1 and the normal rabbit serum respectively. (Figures 3-6 and 3-7 panels D and

E).

Similar results were obtained from RF/6A cells infected with wild-type A. marginale.

Figure 3-8 panel A and B show specific binding of the antibodies ANAF16C1 anti-Msp5 to wild-type A. marginale (green) and the anti-human von Willebrand factor to endothelial cells

(red) respectively. Juxtaposition of green and red fluorescent signals Figure 3-8 panel C show co-localization of wild-type A. marginale organisms within RF/6A endothelial cells.

Fluorescence similar to that emitted by these two specific antibodies was not detected in RF/6A endothelial cells infected with omp10::himar1 A. marginale labeled with the monoclonal TrypE1 and the normal rabbit serum respectively (Figure 3-8 panels D and E).

Assessment of infectivity of the omp10::himar1 A. marginale derived from ISE6 tick cell culture to cattle was performed at Washington State University by Dr. Kelly Brayton’s group.

For this, a calf was inoculated with 105 omp10::himar1 mutant A. marginale but failed to show signs of infection. After 71 days the calf was inoculated with a second dose of omp10::himar1 mutant A. marginale containing 108 organisms. Giemsa stained blood smears, PCR and

Southern blot analysis and competitive Enzyme-linked immunosorbent assays (cELISA) to identify Msp5 did not detect A. marginale omp10::himar1 infection in red blood cells. A final cELISA was negative 112 days post the initial inoculation. Seroconversion is a hallmark of infection with A. marginale, and, thus a negative cELISA is indicative of a lack of infection (76).

Discussion

The ability of A. marginale to cause disease often depends on its ability to invade and replicate within different hosts. During this work we investigated the phenotype of omp10::himar1 A. marginale that carries the Himar1 transposon integrated within the omp10 gene.

Electron microscopy shows that A. marginale omp10::himar1 mutant grows within membrane-bound vacuoles, and develops into reticulate forms that divide by binary fission and

into round dense forms suggesting that these mutant organisms develop in similar fashion to wild-type A. marginale in tick cell culture (15, 18, 19, 151). Msp2 is expressed and localized in the A. marginale outer membrane during tick and erythrocyte infection (87, 157). Results obtained with immunolabeling of Msp2 with anti-Msp2 antibody (R883) also suggest that the gross structure of the outer membrane of these organisms was not affected by disruption in the expression of omp10, omp9, omp8 and omp7 since this antibody localized on the surface of both omp10:himar1 and wild-type A. marginale. Growth curve results support electron microscopy findings since they show that A. marginale omp10::himar1 mutant growth is comparable to wild- type. Stability of the Himar1 insertion under non-antibiotic selectable conditions has been demonstrated in several pathogenic bacterial species (170, 171) and which is also is true for A. marginale omp10::himar1 mutant. Stability of transposon insertion in the omp10::himar1 A. marginale was monitored during seven serial passages over 3 months in cultures of infected

ISE6 kept without antibiotic selection and which was maintained as one Himar1 insert per A. marginale genome. Additionally the red fluorescence phenotype was maintained for the length of the culture period.

Previous work has indicated a possible important role of omp10, omp9, omp8, and omp7 in the pathogenesis of A. marginale. For example, these genes are expressed at lower levels in tick cells than in erythrocytes, and outer membrane proteome analysis and crosslinking experiments showed that although expressed, Omp9, Omp8 and Omp7 proteins are not localized at the surface of A. marginale infecting tick cells (87, 156). On the other hand, in infected erythrocytes, these proteins are localized at the surface of A. marginale suggesting a possible rearrangement in the topology of the surface of A. marginale during the transition from tick to mammalian cells (87). Based on this, I hypothesized that A. marginale omp10::himar1 mutant

was not infective to mammalian cells. To test this, infectivity of A. marginale omp10::himar1 mutant in RF/6A endothelial cell cultures and in cattle was assessed. Surprisingly, A. marginale omp10::himar1 invades and replicates within RF/6A endothelial cells similar to wild type, demonstrating that disruption of omp10 and downstream genes did not affect infectivity of these mutants in endothelial cell cultures in vitro.

However, in a preliminary experiment a spleen intact calf was injected intravenously with two different doses of A. marginale omp10::himar1 organisms, Giemsa stained blood smears,

PCR and Southern blot analysis and competitive Enzyme-linked immunosorbent assays did not detect A. marginale omp10::himar1 infection. These results may suggest a correlation between loss of expression of omp10, omp9, omp8 and omp7 genes caused by the Himar1 transposon insertion within omp10 and lack of infectivity to red blood cells in cattle, reinforcing the hypothesis that these genes could be virulence determinants of Anaplasmosis. One example that supports this idea is the fact that in A. marginale subsp. centrale, a naturally attenuated subtype, closely related sequences to omp8 are missing and omp10 is found with omp7 and a reduced omp9 in tandem (57). Hence, further work to confirm that these A. marginale omp10::himar1 mutant organisms are less infective to cattle is of critical importance to determine its potential utility as a live attenuated vaccine.

In conclusion this work demonstrated that transposon insertion into the coding sequence of omp10 and the disruption of the expression of downstream genes did not affect development and growth of omp10::himar1 in tick cell cultures and that the mutants retain infectivity for endothelial cells in vitro. A spleen intact calf inoculated with two different doses of these omp10::himar1 A. marginale failed to show signs of infection.

Table 3-1 Taqman qPCR oligonucleotides used in this study Oligonucleotide sequence (5' to 3') Target Size Reference AB1242 5'-AAA ACA GGC TTA CCG CTC CAA-3'

AB1243 5'-GGC GTG TAG CTA GGC TCA AAG T-3' opag2 151bp (111) *AB1250 5'-CTC TCC TCT GCT CAG GGC TCT GCG-3'

AB1345 5'-GGTGACCGTAAGGCTTGATG-3'

AB1346 5'-ACCAAGGCAACGCTATGTTC-3' aadA 279bp herein **AB1347 5'-ACCATTGTTGTGCACGACGACA-3' * Oligonucleotide labeled with 6-Carboxyfluorescein (6-FAM) at the 5' end and Tetramethylrhodamine (TAMRA) at the 3' end **Oligonucleotide labeled with Tetrachloro fluorescein (TET) at the 5' end and Black hole quencher 1 (BHQI) at the 3' end

Table 3-2 aadA copies/A. marginale omp10::himar1 genome equivalents Passage 1 Passage 2 Passage 3 Passage 4

Gene *Spc/Str **NT Spc/Str NT Spc/Str NT Spc/Str NT

aadA 106.63 ± 0.07 106.56 ± 0.002 108.45 ± 0.03 108.56 ± 0.05 106.38 ± 0.10 107.76 ± 0.003 107.53 ± 0.03 107.45 ± 0.05

opag2 106.70 ± 0.02 106.75 ± 0.05 108.73 ± 0.05 108.90 ± 0.02 106.55 ± 0.02 108.21 ± 0.07 107.40 ± 0.35 107.63 ± 0.02

Ratio 0.9 0.6 0.5 0.5 0.7 0.4 1.3 0.7

Passage 5 Passage 6 Passage 7

Gene Spc/Str NT Spc/Str NT Spc/Str NT

aadA 107.64 ± 0.07 107.72 ± 0.03 107.83 ± 0.02 107.72 ± 0.03 107.84 ± 0.02 107.94 ± 0.02

opag2 107.86 ± 0.05 107.96 ± 0.01 108.07 ± 0.04 108.02 ± 0.03 107.97 ± 0.01 108.11 ± 0.04

Ratio 0.6 0.6 0.6 0.5 0.7 0.7

* Spc/Str, Spectinomycin and Streptomycin

** NT, Not receiving antibiotic treatment

Figure 3-1 Immunoblotting of host cell free omp10::himar1 mutant and wild-type A. marginale using the specific antibody R883. Proteins from equal amounts of host cell-free wild- type and omp10::himar1 A. marginale were separated by SDS-PAGE gel electrophoresis. Immuno-Blot PVDF membranes of transferred proteins reacted with specific antibodies and reactions were visualized by chemiluminiscence. A) Polyclonal antibody R883 (1:10000) with specificity to Msp2 protein (36KDa) (black arrow). B) Negative control, normal rabbit serum (1:10000). A. marginale str. Virginia initial bodies and uninfected ISE6 cells were used as positive and negative controls respectively.

Figure 3-2 Transmission electron microscopy of A. marginale. A. marginale omp10::himar1 mutant A) and wild-type B) immunogold labeled with a polyclonal anti-Msp2 antibody (R883). Protein G-gold particles (18nm) are localized on the surface of the organisms. No gold particles were visualized in omp10::himar1 C) and wild-type D) Anaplasma labeled with normal rabbit serum as negative controls.

Figure 3-3 Transmission electron microscopy of A. marginale omp10::himar1 mutant, immunogold labeled with a polyclonal anti-Msp2 antibody (R883). A) Anaplasma organisms within membrane-bound vacuole (arrows). B) and C) depict cell infected with multiples colonies (arrowheads). D) Colony formed by RF, reticulated forms with some organisms dividing by binary fission (red arrows). E) Colony formed by DC, dense core organisms, inset showing double layered membrane. N, nucleus.

Figure 3-3 Continued

Figure 3-4 Growth curves for A. marginale wild-type and omp10::himar1 in infected ISE6 tick cells. Growth was measured by determining genome equivalents based on the A. marginale single copy gene opag2. R, Pearson correlation coefficient.

Figure 3-5 Infection of RF/6A endothelial cells with A. marginale omp10::himar1 mutant. Anaplasma marginale expressing mCherry red fluorescent protein in RF/6A endothelial cells with A) and C) and without B) and D) antibiotic (spectinomycin- streptomycin) selection. E) RF/6A cell infected with A. marginale omp10::himar1 mutant, Diff-Quick stained.

Figure 3-6 Infection of RF/6A endothelial cells with Anaplasma marginale omp10::himar1 mutant. Mutant bacteria growing in media supplemented with antibiotic (spectinomycin-streptomycin) selection. A. marginale organisms (green) A) and C), and endothelial cells (red) B) and C) were visualized by indirect immunofluorescence using the monoclonal anti-Msp5 antibody ANAF16C1 and the polyclonal anti-von Willebrand factor antibody respectively. Host cell nuclei were counterstained with DAPI (blue). Similar fluorescence was not detected in infected cells stained with the monoclonal Tryp1E1 antibody (specific for a variable surface glycoprotein of Trypanosome brucei) D) or with normal rabbit serum NRS E).

100

Figure 3-6 Continued

101

Figure 3-7 Infection of RF/6A endothelial cells with Anaplasma marginale omp10::himar1 mutant. Mutant bacteria growing in media without antibiotic treatment. A. marginale organisms (green) A) and C), and endothelial cells (red) B) and C) were visualized by indirect immunofluorescence using the monoclonal anti-Msp5 antibody ANAF16C1 and the polyclonal anti-von Willebrand factor antibody, respectively. Host cell nuclei were counterstained with DAPI (blue). Similar fluorescence was not detected in infected cells stained with the monoclonal Tryp1E1 D) or with normal rabbit serum NRS E).

102

Figure 3-7 Continued

103

Figure 3-8 Infection of RF/6A endothelial cells with Anaplasma marginale wild-type. A. marginale organisms (green) A) and C), and endothelial cells (red) B) and C) were visualized by indirect immunofluorescence using the monoclonal anti-Msp5 antibody ANAF16C1 and the polyclonal anti-von Willebrand factor antibody respectively. Host cell nuclei were counterstained with DAPI (blue). Similar fluorescence was not detected in infected cells stained with the monoclonal TrypE1 antibody D) or with normal rabbit serum NRS E).

104

Figure 3-8 Continued

105

CHAPTER 4 CONCLUSIONS AND FUTURE RESEARCH

As with any genetic system, the initial step in the development of genetic tools necessary to understand the biology of Anaplasma marginale is the capability of introducing and expressing recombinant DNA in this pathogen. Although some work has been developed to create mutations in these bacteria (111), more work is required to establish genetic tools with specific genetic elements and conditions that will ultimately enable routine mutation strategies such as transposon mutagenesis, complementation, and gene replacement by homologous recombination. However the particular physiology of Anaplasma marginale generates serious obstacles in creating useful genetic system tools and developing of protocols for the routine transformation of these pathogens.

In this dissertation the possibility of transformation of A. marginale by transposon mutagenesis using the Himar1 transposon was re-evaluated. Electroporation of A. marginale with a plasmid containing the Himar1 transposon sequence flanking a reporter and a selectable marker and in cis with the A7 hyper reactive transposase resulted in the isolation of red fluorescent and spectinomycin-streptomycin resistant A. marginale.

Whole genome sequencing analysis of transformed A. marginale established that in these recombinant organisms the Himar1 transposon sequences are integrated within the coding region of the outer membrane gene omp10 and such integration resulted from a recombination mechanism mediated by the A7 transposase.

Subsequently, analysis of these omp10::himar1 mutants of A. marginale at the transcriptional level evaluated the effect of the Himar1 insertion within the omp10 gene and of downstream genes such as omp9, omp8, and omp7. This not only demonstrated that these genes are expressed as a single polycistronic message in wild-type A. marginale in tick cell culture, but

106

also showed that insertion of the Himar 1 transposon within omp10 disrupted its expression and that of genes downstream, such as omp9, omp8 and omp7.

Together these findings show that:

Transposon mutagenesis using the Himar1 transposon system is achievable in A. marginale and useful for creating insertional gene knockouts in A. marginale.

Taking into account the possible relevance of omp10, omp9, omp8 and omp7 in the pathogenesis of A. marginale, experiments presented in this dissertation to further characterize the phenotype of these transformants at the level of morphology, growth, stability under non- selectable conditions in tick cells and infectivity in mammalian cells in vitro and in vivo demonstrated that:

A. marginale omp10::himar1 morphology, developmental cycle and growth is similar to wild-type A. marginale in tick cell culture.

The Himar1 transposon insertion and red fluorescent phenotype of these mutant A. marginale organisms is stable under non antibiotic selectable conditions during prolonged periods of culture.

A. marginale omp10::himar1 is infective for endothelial cells in vitro, however a calf intravenously inoculated with these mutants did not show signs of infection as demonstrated by a lack of seroconversion and negative PCR and Southern blot analysis. This could suggest a correlation between loss of the expression of omp10, omp9, omp8 and omp7 and a possible absence of infectivity to red blood cells in cattle. Nevertheless the lack of a complementation system prevents first, confirmation of the role of these genes in the pathogenesis of cattle and fulfilling Kock’s postulates and second, conferring a specific function on each of those genes.

107

It is also possible that effector mechanisms of the innate immune system such as activation of a complement cascade could promote the killing of these mutant bacteria and may have affected the development of infection.

Importantly, experiments to inoculate A. marginale omp10::himar1 mutant in splenectomized calves, which are known to be less resistant to A. marginale infection than spleen-intact calves and adults (13, 23) are underway and in this manner should confirm whether or not these mutants infect red blood cells in cattle.

Although this work sets the precedent for developing further strategies to transform A. marginale using the Himar1 system, more work has to be done to optimize this method, towards the goal of obtaining saturating levels of mutations. High-throughput transformation would be extremely valuable to identify vector-specific and vertebrate-specific A. marginale genes.

The efficiency of this system for the transformation of A. marginale is still low, especially considering that mutants containing just one insertion within the omp10 gene were recovered. However this observation could arise from several possible causes, For example, A. marginale mutants containing different transposon insertions could have been generated but were not recovered because the insertions disrupted the expression of essential genes or regulatory sequences required for growth in tick cells and which resulted in lethal phenotypes.

On the other hand, transformed bacteria containing a transposon insertion must compete with other transposon insertion mutants and probably with some spontaneous antibiotic resistant bacteria. So there is the possibility that a population of slow-growing bacteria containing different transposon insertions arise during these experiments, but because of their growth disadvantage those bacteria were overgrown by the omp10::himar1 mutants, making their recovery difficult. However, isolation of mutants containing a single insertion in the same region

108

also shows that the efficiency of this system in A. marginale is still very low and more work has to be done for optimization. This may include the development of different vector systems and delivery methods and improved procedures for purification and manipulation of host free A. marginale in order to maintain its viability and infectivity while in the extracellular environment.

Importantly, the application of transposon mutagenesis not only will be useful to define possible virulence determinants of A. marginale but also can be used to define non-essential regions. These could be targets for the characterization of optimal parameters for a gene targeting or homologous recombination approach. Such targeted recombination would be of major relevance for testing of those genes that are suspected to play a role in pathogenesis of A. marginale.

The possibility of transforming A. marginale by transposon mutagenesis as shown here will open new avenues for the definition of genes associated with virulence and the creation of attenuated organisms that could be evaluated in their natural biological system for the development of vaccines.

109

LIST OF REFERENCES

1. Dumler JS, Barbet AF, Bekker CP, Dasch GA, Palmer GH, Ray SC, Rikihisa Y, Rurangirwa FR. 2001. Reorganization of genera in the families Rickettsiaceae and Anaplasmataceae in the order Rickettsiales: unification of some species of Ehrlichia with Anaplasma, Cowdria with Ehrlichia and Ehrlichia with Neorickettsia, descriptions of six new species combinations and designation of Ehrlichia equi and 'HGE agent' as subjective synonyms of Ehrlichia phagocytophila. Int J Syst Evol Microbiol. 51:2145- 2165.

2. Dumler JS, Walker DH. 2005a. Order II Rickettsiales. p 96-145. In Garrity GM, Brenner N.R, and Staley, J.T (ed), Bergey's Manual of Systematic Bacteriology, 2nd edn, vol 2. Springer, New York, NY.

3. Uchiyama, T. 2012. Tropism and Pathogenicity of Rickettsiae. Front Microbiol. 3:230- 241.

4. Kim DM, Chung JH, Yun NR, Kim SW, Lee JY, Han MA, Lee YB. 2013. Scrub typhus meningitis or meningoencephalitis. Am J Trop Med Hyg. 89:1206-1211

5. Dunning Hotopp JC, Lin M, Madupu R, Crabtree J, Angiuoli SV, Eisen JA, Seshadri R, Ren Q, Wu M, Utterback TR, Smith S, Lewis M, Khouri H, Zhang C, Niu H, Lin Q, Ohashi N, Zhi N, Nelson W, Brinkac LM, Dodson RJ, Rosovitz MJ, Sundaram J, Daugherty SC, Davidsen T, Durkin AS, Gwin M, Haft DH, Selengut JD, Sullivan SA, Zafar N, Zhou L, Benahmed F, Foreger H, Halpin R, Mulligan S, Robinson J, White O, Rikihisa Y, Tettelin H. 2006. Comparative genomics of emerging human ehrlichiosis agents. PLoS genetics 2:e21. doi:10.1371/journal.pgen.0020021.

6. Brayton KA, Dark, M J, and Palmer, GH. 2009. Anaplasma. p 85-117. In Nene V, Kole C (ed), Genome Mapping and Genomics in Animal-associated Microbes. Springer- Verla, Berlin, Heiderlberg.

7. Ndung'u LW, Aguirre C, Rurangirwa FR, McElwain TF, McGuire TC, Knowles DP, Palmer GH. 1995. Detection of Anaplasma ovis infection in goats by major surface protein 5 competitive inhibition enzyme-linked immunosorbent assay. J Clin Microbiol 33:675-679.

8. Rymaszewska SG. 2008. Bacteria of the genus Anaplasma– characteristics of Anaplasma and their vectors: a review. Vet Med (Praha). 53:573-584.

9. Kocan KM, de la Fuente J, Blouin EF, Coetzee JF, Ewing SA. 2010. The natural history of Anaplasma marginale. Vet Parasitol. 167:95-107.

10. Kocan KM, de la Fuente J, Blouin EF, Garcia-Garcia JC. 2004. Anaplasma marginale (Rickettsiales: Anaplasmataceae): recent advances in defining host-pathogen adaptations of a tick-borne rickettsia. Parasitol. 129 (Suppl 1):S285-300.

110

11. Kuttler KL. 1984. Anaplasma infections in wild and domestic ruminants: a review. J Wildl Dis. 20:12-20.

12. Palmer GH. 2009. Sir Arnold Theiler and the discovery of Anaplasmosis: a centennial perspective. Onderstepoort J Vet Res. 76:75-79.

13. Kocan KM, de la Fuente J, Guglielmone AA, Melendez RD. 2003. Antigens and alternatives for control of Anaplasma marginale infection in cattle. Clin Microbiol Rev. 16:698-712.

14. Kocan KM, Goff WL, Stiller D, Claypool PL, Edwards W, Ewing SA, Hair JA, Barron SJ. 1992. Persistence of Anaplasma marginale (Rickettsiales: Anaplasmataceae) in male Dermacentor andersoni (Acari: Ixodidae) transferred successively from infected to susceptible calves. J Med Entomol. 29:657-668.

15. Kocan KM. 1992. Recent advances in the biology of Anaplasma spp. in Dermacentor andersoni ticks. Ann N Y Acad Sci. 653:26-32.

16. De la Fuente J, Lew A, Lutz H, Meli ML, Hofmann-Lehmann R, Shkap V, Molad T, Mangold AJ, Almazan C, Naranjo V, Gortazar C, Torina A, Caracappa S, Garcia- Perez AL, Barral M, Oporto B, Ceci L, Carrelli G, Blouin EF, Kocan KM. 2005. Genetic diversity of Anaplasma species major surface proteins and implications for anaplasmosis serodiagnosis and vaccine development. Anim Health Res Rev. 6:75-89.

17. Kocan KM, Barron SJ, Ewing SA, Hair JA. 1985. Transmission of Anaplasma marginale by adult Dermacentor andersoni during feeding on calves. Am J Vet Res. 46:1565-1567.

18. Kocan KM. 1986. Development of Anaplasma marginale Theiler in ixodid ticks: coordinated development of a rickettsial organism and its tick host. p 472-505. In Sauer JR, Hair JA (ed). Morphology, physiology, and behavioral biology of ticks. John Wiley and Sons, New York, NY.

19. Blouin EF, Kocan KM. 1998. Morphology and development of Anaplasma marginale (Rickettsiales: Anaplasmataceae) in cultured Ixodes scapularis (Acari: Ixodidae) cells. J Med Entomol. 35:788-797.

20. Ristic M, Watrach AM. 1963. Anaplasmosis. VI. Studies and a hypothesis concerning the cycle of development of the causative agent. Am J Vet Res. 24:267-277.

21. Richey EJ, Palmer, GH. 1992. Anaplasmosis in beef cattle. p 1-8. In Gregory E (ed). American Association of Bovine Practitioners Annual conference. Galveston, TX.

22. Alleman RA, and Barbet, AF. 1996. Evaluation of Anaplasma marginale Major Surface Protein 3 (MSP3) as a diagnostic test antigen. J Clin Microbiol. 34:270-276.

23. Palmer GH, Brown WC, Rurangirwa FR. 2000. Antigenic variation in the persistence and transmission of the ehrlichia Anaplasma marginale. Microbes infect. 2:167-176.

111

24. Kieser ST, Eriks IS, Palmer GH. 1990. Cyclic rickettsemia during persistent Anaplasma marginale infection of cattle. Infect Immun. 58:1117-1119.

25. French DM, McElwain TF, McGuire TC, Palmer GH. 1998. Expression of Anaplasma marginale major surface protein 2 variants during persistent cyclic rickettsemia. Infect Immun. 66:1200-1207.

26. Meeus PF, Barbet AF. 2001. Ingenious gene generation. Trends Microbiol. 9:353-355.

27. Wamsley HL, Alleman AR, Johnson CM, Barbet AF, Abbott JR. 2011. Investigation of endothelial cells as an in vivo nidus of Anaplasma marginale infection in cattle. Vet Microbiol. 153:264-273.

28. Giardina S, Bretana A, Marquez Q. Ultrastructural aspects of intraerythrocytic development of a Venezuelan strain of Anaplasma marginale. Tropenmedizin und Parasitologie. 1983, 34:7-10.

29. Waghela SD, Cruz D, Droleskey RE, DeLoach JR, Wagner GG. 1997. In vitro cultivation of Anaplasma marginale in bovine erythrocytes co-cultured with endothelial cells. Vet Parasitol. 73:43-52.

30. Waghela SD, Melendy D, Cruz D, Wagner GG. 2000. Antigenic analysis of Anaplasma marginale grown in bovine erythrocytes co-cultured with bovine endothelial cells. Veterinary Parasitology. 94:133-139.

31. Munderloh UG, Lynch MJ, Herron MJ, Palmer AT, Kurtti TJ, Nelson RD, Goodman JL. 2004. Infection of endothelial cells with Anaplasma marginale and Anaplasma phagocytophilum. Vet Microbiol 101:53-64.

32. Carreno AD, Alleman AR, Barbet AF, Palmer GH, Noh SM, Johnson CM. 2007. In vivo endothelial cell infection by Anaplasma marginale. Vet Pathol. 44:116-118.

33. Brayton KA, Kappmeyer LS, Herndon DR, Dark MJ, Tibbals DL, Palmer GH, McGuire TC, Knowles DP, Jr. 2005. Complete genome sequencing of Anaplasma marginale reveals that the surface is skewed to two superfamilies of outer membrane proteins. Proc Natil Acad Sci U S A. 102:844-849.

34. Dark M, Herndon D, Kappmeyer L, Gonzales M, Nordeen E, Palmer G, Knowles D, Brayton K. 2009. Conservation in the face of diversity: multistrain analysis of an intracellular bacterium. BMC genomics. 10:16.

35. Dark MJ, Al-Khedery B, Barbet AF. 2011. Multistrain genome analysis identifies candidate vaccine antigens of Anaplasma marginale. Vaccine 29:4923-4932.

36. Ogata H, Audic S, Renesto-Audiffren P, Fournier PE, Barbe V, Samson D, Roux V, Cossart P, Weissenbach J, Claverie JM, Raoult D. 2001. Mechanisms of evolution in Rickettsia conorii and Rickettsia prowazekii. Science. 293:2093-2098.

112

37. Wixon J. 2001. Featured organism: reductive evolution in bacteria: Buchnera spp. Rickettsia prowazekii and Mycobacterium leprae. Comp Funct Genomics. 2:44-48.

38. Gillespie JJ, Nordberg EK, Azad AF, Sobral WS. 2012. Phylogeny and comparative genomics: the shiftting landscape in the genomic era. p 84-141. In Palmer GH, Azad AF (ed). Intracellular pathogens II. ASM press, Washington, DC.

39. Andersson SG, Zomorodipour A, Andersson JO, Sicheritz-Ponten T, Alsmark UC, Podowski RM, Naslund AK, Eriksson AS, Winkler HH, Kurland CG. 1998. The genome sequence of Rickettsia prowazekii and the origin of mitochondria. Nature. 396:133-140.

40. Barbet AF, Lundgren A, Yi J, Rurangirwa FR, Palmer GH. 2000. Antigenic variation of Anaplasma marginale by expression of MSP2 mosaics. Infect Immun. 68:6133-6138.

41. Barbet AF, Agnes JT, Moreland AL, Lundgren AM, Alleman AR, Noh SM, Brayton KA, Munderloh UG, Palmer GH. 2005. Identification of functional promoters in the msp2 expression loci of Anaplasma marginale and Anaplasma phagocytophilum. Gene. 353:89-97.

42. Brayton KA, Palmer GH, Lundgren A, Yi J, Barbet AF. 2002. Antigenic variation of Anaplasma marginale msp2 occurs by combinatorial gene conversion. Mol Microbiol. 43:1151-1159.

43. Alleman AR, Palmer GH, McGuire TC, McElwain TF, Perryman LE, Barbet AF. 1997. Anaplasma marginale major surface protein 3 is encoded by a polymorphic, multigene family. Infect Immun. 65:156-163.

44. Brayton KA, Knowles DP, McGuire TC, Palmer GH. 2001. Efficient use of a small genome to generate antigenic diversity in tick-borne ehrlichial pathogens. Proc Natl Acad Sci U S A. 98:4130-4135.

45. Oberle SM, Barbet AF. 1993. Derivation of the complete msp4 gene sequence of Anaplasma marginale without cloning. Gene. 136:291-294.

46. Oberle SM, Palmer GH, Barbet AF. 1993. Expression and immune recognition of the conserved MSP4 outer membrane protein of Anaplasma marginale. Infect Immun. 61:5245-5251.

47. Meeus PF, Brayton KA, Palmer GH, Barbet AF. 2003. Conservation of a gene conversion mechanism in two distantly related paralogues of Anaplasma marginale. Mol Microbiol. 47:633-643.

48. Lohr CV, Brayton KA, Shkap V, Molad T, Barbet AF, Brown WC, Palmer GH. 2002. Expression of Anaplasma marginale major surface protein 2 operon-associated proteins during mammalian and arthropod infection. Infect Immun. 70:6005-6012.

113

49. Sutten EL, Norimine J, Beare PA, Heinzen RA, Lopez JE, Morse K, Brayton KA, Gillespie JJ, Brown WC. 2010. Anaplasma marginale type IV secretion system proteins VirB2, VirB7, VirB11, and VirD4 are immunogenic components of a protective bacterial membrane vaccine. Infect Immun. 78:1314-1325.

50. Gillespie JJ, Brayton KA, Williams KP, Diaz MA, Brown WC, Azad AF, Sobral BW. 2010. Phylogenomics reveals a diverse Rickettsiales type IV secretion system. Infect Immun. 78:1809-1823.

51. Allred DR, McGuire TC, Palmer GH, Leib SR, Harkins TM, McElwain TF, Barbet AF. 1990. Molecular basis for surface antigen size polymorphisms and conservation of a neutralization-sensitive epitope in Anaplasma marginale. Proc Natl Acad Sci U S A. 87:3220-3224.

52. Barbet AF, Palmer GH, Myler PJ, McGuire TC. 1987. Characterization of an immunoprotective protein complex of Anaplasma marginale by cloning and expression of the gene coding for polypeptide Am105L. Infect Immun. 55:2428-2435.

53. Bowie MV, de la Fuente J, Kocan KM, Blouin EF, Barbet AF. 2002. Conservation of major surface protein 1 genes of Anaplasma marginale during cyclic transmission between ticks and cattle. Gene. 282:95-102.

54. De la Fuente J, Garcia-Garcia JC, Blouin EF, Kocan KM. 2001. Differential adhesion of major surface proteins 1a and 1b of the ehrlichial cattle pathogen Anaplasma marginale to bovine erythrocytes and tick cells. Int J Parasitol. 31:145-153.

55. De la Fuente J, Kocan KM, Garcia-Garcia JC, Blouin EF, Claypool PL, Saliki JT. 2002. Vaccination of cattle with Anaplasma marginale derived from tick cell culture and bovine erythrocytes followed by challenge-exposure with infected ticks. Vet Microbiol. 89:239-251.

56. De la Fuente J, Garcia-Garcia JC, Barbet AF, Blouin EF, Kocan KM. 2004. Adhesion of outer membrane proteins containing tandem repeats of Anaplasma and Ehrlichia species (Rickettsiales: Anaplasmataceae) to tick cells. Vet Microbiol. 98:313- 322.

57. Herndon DR, Palmer GH, Shkap V, Knowles DP, Jr., Brayton KA. 2010. Complete genome sequence of Anaplasma marginale subsp. centrale. J Bacteriol. 192:379-380.

58. Ueti MW, Reagan JO, Jr., Knowles DP, Jr., Scoles GA, Shkap V, Palmer GH. 2007. Identification of midgut and salivary glands as specific and distinct barriers to efficient tick-borne transmission of Anaplasma marginale. Infect Immun. 75:2959-2964.

59. Ueti MW, Knowles DP, Davitt CM, Scoles GA, Baszler TV, Palmer GH. 2009. Quantitative differences in salivary pathogen load during tick transmission underlie strain-specific variation in transmission efficiency of Anaplasma marginale. Infect Immun. 77:70-75.

114

60. Fronzes R, Christie PJ, Waksman G. 2009. The structural biology of type IV secretion systems. Nature Rev Microbiol. 7:703-714.

61. Carlyon JA. 2012. Establishing Intracellular Infection: Modulation of Host cell functions (Anaplasmataceae). p 175-220. In Palmer GH, Azad AF (ed). Intracellular pathogens II: Ricketssiales. ASM press, Washington, DC.

62. Pierle SA, Dark MJ, Dahmen D, Palmer GH, Brayton KA. 2012. Comparative genomics and transcriptomics of trait-gene association. BMC Genomics. 13:669. doi:10.1186/1471-2164-13-669.

63. Medini D, Donati C, Tettelin H, Masignani V, Rappuoli R. 2005. The microbial pan- genome. Curr Opin Gene Dev. 15:589-594.

64. Mira A, Martin-Cuadrado AB, D'Auria G, Rodriguez-Valera F. 2010. The bacterial pan-genome:a new paradigm in microbiology. Int Microbiol. 13:45-57.

65. Borst P. 1991. Molecular genetics of antigenic variation. Immunol Today. 12: A29-33.

66. French DM, Brown WC, Palmer GH. 1999. Emergence of Anaplasma marginale antigenic variants during persistent rickettsemia. Infect Immun. 67:5834-5840.

67. Futse JE, Brayton KA, Knowles DP, Jr., Palmer GH. 2005. Structural basis for segmental gene conversion in generation of Anaplasma marginale outer membrane protein variants. Mol Microbiol. 57:212-221.

68. Palmer GH, Brayton KA. 2013. Antigenic variation and transmission fitness as drivers of bacterial strain structure. Cell Microbiol. 15:1969-1975.

69. Palmer GH, Eid G, Barbet AF, McGuire TC, McElwain TF. 1994. The immunoprotective Anaplasma marginale major surface protein 2 is encoded by a polymorphic multigene family. Infect Immun. 62:3808-3816.

70. Brayton KA, Meeus PF, Barbet AF, Palmer GH. 2003. Simultaneous variation of the immunodominant outer membrane proteins, MSP2 and MSP3, during Anaplasma marginale persistence in vivo. Infect Immun. 71:6627-6632.

71. Brown WC, Brayton KA, Styer CM, Palmer GH. 2003. The hypervariable region of Anaplasma marginale major surface protein 2 (MSP2) contains multiple immunodominant CD4+ T lymphocyte epitopes that elicit variant-specific proliferative and IFN-gamma responses in MSP2 vaccinates. J Immunol. 170:3790-3798.

72. Palmer GH, Futse JE, Leverich CK, Knowles DP, Jr., Rurangirwa FR, Brayton KA. 2007. Selection for simple major surface protein 2 variants during Anaplasma marginale transmission to immunologically naive animals. Infect Immun. 75:1502-1506.

115

73. Rodriguez JL, Palmer GH, Knowles DP, Jr., Brayton KA. 2005. Distinctly different msp2 pseudogene repertoires in Anaplasma marginale strains that are capable of superinfection. Gene. 361:127-132.

74. Futse JE, Brayton KA, Dark MJ, Knowles DP, Jr., Palmer GH. 2008. Superinfection as a driver of genomic diversification in antigenically variant pathogens. Proc Natl Acad Sci U S A. 105:2123-2127.

75. Bradway DS, Torioni de Echaide S, Knowles DP, Hennager SG, McElwain TF. 2001. Sensitivity and specificity of the complement fixation test for detection of cattle persistently infected with Anaplasma marginale. J Vet Diag Invest. 13:79-81.

76. Knowles D, Torioni de Echaide S, Palmer G, McGuire T, Stiller D, McElwain T. 1996. Antibody against an Anaplasma marginale MSP5 epitope common to tick and erythrocyte stages identifies persistently infected cattle. J Clin Microbiol. 34:2225-2230.

77. Torioni de Echaide S, Knowles DP, McGuire TC, Palmer GH, Suarez CE, McElwain TF. 1998. Detection of cattle naturally infected with Anaplasma marginale in a region of endemicity by nested PCR and a competitive enzyme-linked immunosorbent assay using recombinant major surface protein 5. J Clin Microbiol. 36:777-782.

78. Al-Adhami B, Scandrett WB, Lobanov VA, Gajadhar AA. 2011. Serological cross- reactivity between Anaplasma marginale and an Ehrlichia species in naturally and experimentally infected cattle. J Vet Diag Invest. 23:1181-1188.

79. Dreher UM, De la Fuente J, Hofmann-Lehmann R, Meli ML, Pusterla N, Kocan KM, Woldehiwet Z, Braun U, Regula G, Staerk KD, Lutz H. 2005. Serologic cross- reactivity between Anaplasma marginale and Anaplasma phagocytophilum. Clin Diagn Lab Immunol. 12:1177-1183.

80. Eriks IS, Palmer GH, McGuire TC, Allred DR, Barbet AF. 1989. Detection and quantitation of Anaplasma marginale in carrier cattle by using a nucleic acid probe. J Clin Microbiol. 27:279-284.

81. Carelli G, Decaro N, Lorusso A, Elia G, Lorusso E, Mari V, Ceci L, Buonavoglia C. 2007. Detection and quantification of Anaplasma marginale DNA in blood samples of cattle by real-time PCR. Vet Microbiol. 124:107-114.

82. Decaro N, Carelli G, Lorusso E, Lucente MS, Greco G, Lorusso A, Radogna A, Ceci L, Buonavoglia C. 2008. Duplex real-time polymerase chain reaction for simultaneous detection and quantification of Anaplasma marginale and Anaplasma centrale. J Vet Diagn Invest. 20:606-611.

83. Reinbold JB, Coetzee JF, Sirigireddy KR, Ganta RR. 2010. Detection of Anaplasma marginale and Anaplasma phagocytophilum in bovine peripheral blood samples by duplex real-time reverse transcriptase PCR assay. J Clin Microbiol. 48:2424-2432.

116

84. Kano FS, Tamekuni K, Coelho AL, Garcia JL, Vidotto O, Itano EN, Vidotto MC. 2008. Induced immune response of DNA vaccine encoding an association MSP1a, MSP1b, and MSP5 antigens of Anaplasma marginale. Vaccine. 26:3522-3527.

85. Brown WC, Shkap V, Zhu D, McGuire TC, Tuo W, McElwain TF, Palmer GH. 1998. CD4(+) T-lymphocyte and immunoglobulin G2 responses in calves immunized with Anaplasma marginale outer membranes and protected against homologous challenge. Infect Immun. 66:5406-5413.

86. Brown WC, Zhu D, Shkap V, McGuire TC, Blouin EF, Kocan KM, Palmer GH. 1998. The repertoire of Anaplasma marginale antigens recognized by CD4(+) T- lymphocyte clones from protectively immunized cattle is diverse and includes major surface protein 2 (MSP-2) and MSP-3. Infection and Immunity. 66:5414-5422.

87. Noh SM, Brayton KA, Brown WC, Norimine J, Munske GR, Davitt CM, Palmer GH. 2008. Composition of the surface proteome of Anaplasma marginale and its role in protective immunity induced by outer membrane immunization. Infect Immun. 76:2219- 2226.

88. Noh SM, Turse JE, Brown WC, Norimine J, Palmer GH. 2013. Linkage between Anaplasma marginale outer membrane proteins enhances immunogenicity but is not required for protection from challenge. Clin and Vaccine Immunol. 20:651-656.

89. Pérez Brandan C, Basombrío M. 2012. Genetically attenuated Trypanosoma cruzi parasites as a potential vaccination tool. Bioengineered. 3:242-246.

90. Dey R, Dagur PK, Selvapandiyan A, McCoy JP, Salotra P, Duncan R, Nakhasi HL. 2013. Live attenuated Leishmania donovani p27 gene knockout parasites are nonpathogenic and elicit long-term protective immunity in BALB/c mice. J Immunol. 190:2138-2149.

91. Bozue J, Cote CK, Webster W, Bassett A, Tobery S, Little S, Swietnicki. 2012. A Yersinia pestis YscN ATPase mutant functions as a live attenuated vaccine against bubonic plague in mice. FEMS Microbiol Lett. 332:113-121.

92. Zimmer A. 1992. Manipulating the genome by homologous recombination in embryonic stem cells. Annu Rev Neurosci. 15:115-137.

93. Faulds-Pain A, Wren BW. 2013. Improved bacterial mutagenesis by high-frequency allele exchange, demonstrated in Clostridium difficile and Streptococcus suis. Appl Environ Microbiol. 79:4768-4771.

94. Reyrat JM, Pelicic V, Gicquel B, Rappuoli R. 1998. Counterselectable markers: untapped tools for bacterial genetics and pathogenesis. Infect Immun. 66:4011-4017.

95. Krishnakumar R, Assad-Garcia N, Benders GA, Phan Q, Montague MG, Glass JI. 2010.Targeted chromosomal knockouts in Mycoplasma pneumoniae. Appl Environl Microbiol. 76:5297-5299.

117

96. Camerini-Otero RD, Hsieh P. 1995. Homologous recombination proteins in prokaryotes and eukaryotes. Annu Rev Genet. 29:509-552.

97. Court DJ, Sawitzke JA, Thomason LC. 2002. Genetic engineering using homologos recombination. Annu Rev Genet. 36:361-388.

98. Dresser AR, Hardy PO, Chaconas G. 2009. Investigation of the genes involved in antigenic switching at the vlsE locus in Borrelia burgdorferi: an essential role for the RuvAB branch migrase. PLoS Pathogens. 5:e1000680.doi:10.1371/journal.ppat.1000680.

99. LoVullo ED, Sherrill LA, Perez LL, Pavelka MS, Jr. 2006. Genetic tools for highly pathogenic Francisella tularensis subsp. tularensis. Microbiol. 152:3425-3435.

100. Wallecha A, Maciag PC, Rivera S, Paterson Y, Shahabi V. 2009. Construction and characterization of an attenuated Listeria monocytogenes strain for clinical use in cancer immunotherapy. Clin Vaccine Immunol. 16:96-103.

101. Bae D, Seo KS, Zhang T, Wang C. 2013. Characterization of a potential Listeria monocytogenes virulence factor associated with attachment to fresh produce. Appl Environ Microbiol. 79:6855-6861.

102. Pashley CA, Parish T, McAdam RA, Duncan K, Stoker NG. 2003. Gene replacement in mycobacteria by using incompatible plasmids. Appl Environ Microbiol. 69:517-523.

103. Burgos R, Pich OQ, Querol E, Pinol J. 2008. Deletion of the Mycoplasma genitalium MG_217 gene modifies cell gliding behavior by altering terminal organelle curvature. Mol Microbiol. 69:1029-1040.

104. Bono JL, Elias AF, Kupko JJ, 3rd, Stevenson B, Tilly K, Rosa P. 2000. Efficient targeted mutagenesis in Borrelia burgdorferi. J Bacteriol. 182:2445-2452.

105. Halling SM, Detilleux PG, Tatum FM, Judge BA, Mayfield JE. 1991. Deletion of the BCSP31 gene of Brucella abortus by replacement. Infection and immunity. 59:3863- 3868.

106. Binet R, Maurelli AT. 2009. Transformation and isolation of allelic exchange mutants of Chlamydia psittaci using recombinant DNA introduced by electroporation. Proc Natl Acad Scie U S A. 106:292-297.

107. Rachek LI, Tucker AM, Winkler HH, Wood DO. 1998.Transformation of Rickettsia prowazekii to rifampin resistance. J Bacteriol. 180:2118-2124.

108. Rachek LI, Hines A, Tucker AM, Winkler HH, Wood DO. 2000. Transformation of Rickettsia prowazekii to erythromycin resistance encoded by the Escherichia coli ereB gene. J Bacteriol. 182:3289-3291.

109. Troyer JM, Radulovic S, Azad AF. 1999. Green fluorescent protein as a marker in Rickettsia typhi transformation. Infect Immun. 67:3308-3311.

118

110. Driskell LO, Yu XJ, Zhang L, Liu Y, Popov VL, Walker DH, Tucker AM, Wood DO. 2009. Directed mutagenesis of the Rickettsia prowazekii pld gene encoding phospholipase D. Infect Immun. 77:3244-3248.

111. Felsheim RF, Chavez AS, Palmer GH, Crosby L, Barbet AF, Kurtti TJ, Munderloh UG. 2010. Transformation of Anaplasma marginale. Vet Parasitol. 167:167-174.

112. Snyder L, Champness W. 2007.Transposition, Site-specific recombination, and families of recombinases. p 377-426. Molecular Genetics of Bacteria, 3rd edition. ASM press, Washington, DC.

113. Craig NL. 1997. Target site selection in transposition. Annu Rev Biochem. 66:437-474.

114. Van Opijnen T, Camilli A. 2013. Transposon insertion sequencing: a new tool for systems-level analysis of microorganisms. Nature Rev Microbiol. 11:435-442.

115. Smith V, Botstein D, Brown PO. 1995. Genetic footprinting: a genomic strategy for determining a gene's function given its sequence. Proc Natl Acad Sci U S A. 92:6479- 6483.

116. Mazurkiewicz P, Tang CM, Boone C, Holden DW. 2006. Signature-tagged mutagenesis: barcoding mutants for genome-wide screens. Nature Revs Genet. 7:929- 939.

117. Munderloh UG FR, Burkhardt NY, Herron MJ, Olivia Chavez AS, Nelson CM and Kurtti TJ. 2012. The way forward: improving genetic systems. p 416-432. In Palmer GH, Azad AF (ed). Intracellular Pathogens II. ASM Press, Washington, DC.

118. Qin A, Tucker AM, Hines A, Wood DO. 2004. Transposon mutagenesis of the obligate intracellular pathogen Rickettsia prowazekii. Appl Environ Microbiol. 70:2816-2822.

119. Baldridge GD, Burkhardt N, Herron MJ, Kurtti TJ, Munderloh UG. 2005. Analysis of fluorescent protein expression in transformants of Rickettsia monacensis, an obligate intracellular tick symbiont. Appl Environ Microbiol. 71:2095-2105.

120. Baldridge GD, Burkhardt NY, Felsheim RF, Kurtti TJ, Munderloh UG. 2007. Transposon insertion reveals pRM, a plasmid of Rickettsia monacensis. Appl Environ Microbiol. 73:4984-4995.

121. Liu ZM, Tucker AM, Driskell LO, Wood DO. 2007. Mariner-based transposon mutagenesis of Rickettsia prowazekii. Appl Environ Microbiol. 73:6644-6649.

122. Walker DH. 2007. Rickettsiae and rickettsial infections: the current state of knowledge. Clin Infect Dis. 45 (Suppl 1):S39-44.

123. Kleba B, Clark TR, Lutter EI, Ellison DW, Hackstadt T. 2010. Disruption of the Rickettsia rickettsii Sca2 autotransporter inhibits actin-based motility. Infect Immun. 78:2240-2247.

119

124. Felsheim RF, Herron MJ, Nelson CM, Burkhardt NY, Barbet AF, Kurtti TJ, Munderloh UG. 2006. Transformation of Anaplasma phagocytophilum. BMC Biotechnol. 6:42. doi:10.1186/1472-6750-6-42.

125. Munderloh UG, Chavez AO, Herron MJ, Felsheim RF, Kurtti TJ. 2012. An Anaplasma phagocytophilum OMT mutant is unable to infect ticks. 25th American Society for Rickettsiology Conference., abstr 138. Park City, UT.

126. Cheng C, Nair AD, Indukuri VV, Gong S, Felsheim RF, Jaworski D, Munderloh UG, Ganta RR. 2013. Targeted and random mutagenesis of Ehrlichia chaffeensis for the identification of genes required for in vivo infection. PLoS Patho. 9: e1003171. doi: 10.1371/journal.ppat.1003171.

127. Baldridge GD, Burkhardt NY, Felsheim RF, Kurtti TJ, Munderloh UG. 2008. Plasmids of the pRM/pRF family occur in diverse Rickettsia species. Appl Environ Microbiol. 74:645-652.

128. Ogata H, Renesto P, Audic S, Robert C, Blanc G, Fournier PE, Parinello H, Claverie JM, Raoult D. 2005. The genome sequence of Rickettsia felis identifies the first putative conjugative plasmid in an obligate intracellular parasite. PLoS Biol. 3:e248. doi: 10.1371/journal.pbio.0030248.

129. Gillespie JJ, Beier MS, Rahman MS, Ammerman NC, Shallom JM, Purkayastha A, Sobral BS, Azad AF. 2007. Plasmids and rickettsial evolution: insight from Rickettsia felis. PloS One. 2:e266. doi: 10.1371/journal.pone.0000266.

130. Burkhardt NY, Baldridge GD, Williamson PC, Billingsley PM, Heu CC, Felsheim RF, Kurtti TJ, Munderloh UG. 2011. Development of shuttle vectors for transformation of diverse Rickettsia species. PloS One. 6:e29511. doi: 10.1371/journal.pone.0029511

131. Wood DO, Hines A, Tucker AM, Woodard A, Driskell LO, Burkhardt NY, Kurtti TJ, Baldridge GD, Munderloh UG. 2012. Establishment of a replicating plasmid in Rickettsia prowazekii. PloS One. 7:e34715. doi: 10.1371/journal.pone.0034715

132. Dark MJ, Lundgren AM, Barbet AF. 2012, Determining the repertoire of immunodominant proteins via whole-genome amplification of intracellular pathogens. PloS One. 7: e36456. doi: 10.1371/journal.pone.0036456

133. Brayton KA, Palmer GH, Brown WC. 2006. Genomic and proteomic approaches to vaccine candidate identification for Anaplasma marginale. Expert Rev Vaccines. 5:95- 101.

134. Morley RS, Hugh-Jones ME. 1989. The cost of anaplasmosis in the Red River Plains and south-east areas of Louisiana. Vet Res Commun. 13:349-358.

135. Goodger WJ, Carpenter T, Riemann H. 1979. Estimation of economic loss associated with anaplasmosis in California beef cattle. J Am Vet Med Assoc. 174:1333-1336.

120

136. Palmer GH, Futse JE, Knowles DP, Jr., Brayton KA. 2006. Insights into mechanisms of bacterial antigenic variation derived from the complete genome sequence of Anaplasma marginale. Ann N Y Acad Sci. 1078:15-25.

137. Agnes JT, Brayton KA, LaFollett M, Norimine J, Brown WC, Palmer GH. 2011. Identification of Anaplasma marginale outer membrane protein antigens conserved between A. marginale sensu stricto strains and the live A. marginale subsp. centrale vaccine. Infect Immun. 79:1311-1318.

138. Rodriguez SD, Garcia Ortiz MA, Hernandez Salgado G, Santos Cerda NA, Aboytes Torre R, Canto Alarcon GJ. 2000. Anaplasma marginale inactivated vaccine: dose titration against a homologous challenge. Comp Immunol, Microbiol Infect Dis. 23:239- 252.

139. Palmer GH, Brown WC, Noh SM, Brayton KA. 2012. Genome-wide screening and identification of antigens for rickettsial vaccine development. FEMS Immunol Med Microbiol. 64:115-119.

140. Claeys Bouuaert C, Chalmers RM. 2010. Gene therapy vectors: the prospects and potentials of the cut-and-paste transposons. Genetica. 138:473-484.

141. Picardeau M: 2010. Transposition of fly mariner elements into bacteria as a genetic tool for mutagenesis. Genetica. 138:551-558.

142. Lampe DJ, Grant TE, Robertson HM. 1998. Factors affecting transposition of the Himar1 mariner transposon in vitro. Genetics. 149:179-187.

143. Plasterk RH, Izsvak Z, Ivics Z. 1999. Resident aliens: the Tc1/mariner superfamily of transposable elements. Trends Genet. 15:326-332.

144. Clark TR, Ellison DW, Kleba B, Hackstadt T. 2011. Complementation of Rickettsia rickettsii RelA/SpoT restores a nonlytic plaque phenotype. Infect Immun. 79:1631-1637.

145. Clark TR, Lackey AM, Kleba B, Driskell LO, Lutter EI, Martens C, Wood DO, Hackstadt T. 2011. Transformation frequency of a mariner-based transposon in Rickettsia rickettsii. J Bacteriol. 193:4993-4995.

146. Beare PA, Sandoz KM, Omsland A, Rockey DD, Heinzen RA. 2011. Advances in genetic manipulation of obligate intracellular bacterial pathogens. Front Microbiol. 2:97. doi: 10.3389/fmicb.2011.00097.

147. Beare PA. 2012. Genetic manipulation of Coxiella burnetii. Adv Exp Med Biol. 984:249-271.

148. Botkin DJ, Abbott AN, Stewart PE, Rosa PA, Kawabata H, Watanabe H, Norris SJ. 2006.Identification of potential virulence determinants by Himar1 transposition of infectious Borrelia burgdorferi B31. Infect and Immun.74:6690-6699.

121

149. Stewart PE, Hoff J, Fischer E, Krum JG, Rosa PA. 2004. Genome-wide transposon mutagenesis of Borrelia burgdorferi for identification of phenotypic mutants. Appl Environ Microbiol. 70:5973-5979.

150. Maier TM, Casey MS, Becker RH, Dorsey CW, Glass EM, Maltsev N, Zahrt TC, Frank DW. 2007. Identification of Francisella tularensis Himar1-based transposon mutants defective for replication in macrophages. Infect Immun. 75:5376-5389.

151. Munderloh UG, Blouin EF, Kocan KM, Ge NL, Edwards WL, Kurtti TJ. 1996. Establishment of the tick (Acari:Ixodidae)-borne cattle pathogen Anaplasma marginale (Rickettsiales:Anaplasmataceae) in tick cell culture. J Med Entomol. 33:656-664.

152. Shanner N, Campbell RE, Steinbach, PA, Giepmans BN, Palmer AE, Tsien RY. 2004. Improved monomeric red, orange and yellow fluorescent proteins derived from Discosoma sp. red fluorescent protein. Nature Biotechnol. 22:1567-1572.

153. Schmittgen TD, Livak KJ. 2008. Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc. 3(6):1101-1108.

154. Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data using real- time quantitative PCR and the 2-ΔΔCt method. Methods. 25:402-408.

155. Lohr CV, Rurangirwa FR, McElwain TF, Stiller D, Palmer GH. 2002. Specific expression of Anaplasma marginale major surface protein 2 salivary gland variants occurs in the midgut and is an early event during tick transmission. Infect Immun. 70:114-120.

156. Noh SM, Brayton KA, Knowles DP, Agnes JT, Dark MJ, Brown WC, Baszler TV, Palmer GH. 2006. Differential expression and sequence conservation of the Anaplasma marginale msp2 gene superfamily outer membrane proteins. Infect Immun. 74:3471- 3479.

157. Barbet AF, Blentlinger R, Yi J, Lundgren AM, Blouin EF, Kocan KM. 1999.Comparison of surface proteins of Anaplasma marginale grown in tick cell culture, tick salivary glands, and cattle. Infect Immun. 67:102-107.

158. Guell M, van Noort V, Yus E, Chen WH, Leigh-Bell J, Michalodimitrakis K, Yamada T, Arumugam M, Doerks T, Kuhner S, Rode M, Suyama M, Schmidt S, Gavin AC, Bork P, Serrano L. 2009.Transcriptome complexity in a genome-reduced bacterium. Science. 326:1268-1271.

159. Kleckner N. 1977. Translocatable elements in procaryotes. Cell. 11:11-23.

160. Beare PA, Gilk SD, Larson CL, Hill J, Stead CM, Omsland A, Cockrell DC, Howe D, Voth DE, Heinzen RA. 2011. Dot/Icm type IVB secretion system requirements for Coxiella burnetii growth in human macrophages. mBio. 2:e00175-11. doi: 10.1128/mBio.00175-11. Print 2011

122

161. Lopez JE, Siems WF, Palmer GH, Brayton KA, McGuire TC, Norimine J, Brown WC. 2005. Identification of novel antigenic proteins in a complex Anaplasma marginale outer membrane immunogen by mass spectrometry and genomic mapping. Infect Immun. 73:8109-8118.

162. Riding G, Hope M, Waltisbuhl D, Willadsen P. 2003. Identification of novel protective antigens from Anaplasma marginale. Vaccine. 21:1874-1883.

163. Kazimirova M, Stibraniova I. 2013. Tick salivary compounds: their role in modulation of host defences and pathogen transmission. Front Cell Infect Microbiol. 3:43-50

164. Singhgh SK, Girschick HJ. 2003. Tick-host interactions and their immunological implications in tick-borne diseases. Curr Science. 85:1284-1298.

165. Kocan KM, De La Fuente J, Blouin EF, Garcia-Garcia JC. 2002. Adaptations of the tick-borne pathogen, Anaplasma marginale, for survival in cattle and ticks. Expl Appl Acarol. 28:9-25.

166. Crosby FL, Munderloh UG, Wamsley HL, Pate MG, Noh SM, Brown WC, Barbet AF. 2013. Characterization of an Anaplasma marginale mutant generated by transposon mutagenesis. 26th American Society for Rickettsiology Conference., abstr 5. Portland, ME.

167. Palmer GH, Oberle SM, Barbet AF, Goff WL, Davis WC, McGuire TC: 1988. Immunization of cattle with a 36-kilodalton surface protein induces protection against homologous and heterologous Anaplasma marginale challenge. Infect Immun. 56:1526- 1531.

168. Wamsley HL, Barbet AF. 2008. In situ detection of Anaplasma spp. by DNA target- primed rolling-circle amplification of a padlock probe and intracellular colocalization with immunofluorescently labeled host cell von Willebrand factor. Journal of Clin Microbiol. 46:2314-2319.

169. Futse JE, Ueti MW, Knowles DP, Jr., Palmer GH. 2003. Transmission of Anaplasma marginale by Boophilus microplus: retention of vector competence in the absence of vector-pathogen interaction. J Clin Microbiol. 41:3829-3834.

170. Rholl DA, Trunck LA, Schweizer HP. 2008, In vivo Himar1 transposon mutagenesis of Burkholderia pseudomallei. Appl Environ Microbiol. 74:7529-7535.

171. Pelicic V, Morelle S, Lampe D, Nassif X. 2000. Mutagenesis of Neisseria meningitidis by in vitro transposition of Himar1 mariner. J Bacteriol. 182:5391-5398.

123

BIOGRAPHICAL SKETCH

Francy L Crosby graduated from Agustin Nieto Caballero High School in Cali, Colombia and began her undergraduate study as biochemistry major at Santiago de Cali University. After graduation, in 2001 she began her master’s degree at the Javeriana University in Bogota,

Colombia. Her research focused on the development of an in vitro model based on primary cell cultures of neurons and astrocytes to evaluate the effects of different metabolic substrates during the development of the brain. In 2008 she joined the laboratory of Dr. Anthony Barbet in the

Department of Infectious Diseases and Pathology at the College of Veterinary Medicine at the

University of Florida to work on her doctoral research with emphasis on the study of the Tick- borne pathogen Anaplasma marginale. Francy L Crosby received her doctoral degree in May of

2014.

124