DOCSLIB.ORG

Crystal Structure of the Drosophila Mago Nashi–Y14 Complex

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Crystal Structure of the Drosophila Mago Nashi–Y14 Complex Downloaded from genesdev.cshlp.org on September 30, 2021 - Published by Cold Spring Harbor Laboratory Press RESEARCH COMMUNICATION trol. The EJC appears to be a dynamic complex, as the Crystal structure of the composition of EJC varies at different stages of splicing Drosophila Mago nashi–Y14 and export, and various EJC components associate with the spliced mRNA with different affinities (Reichert et complex al. 2002). Two proteins, a human homolog of Drosophila 1,2 1,3 mago nashi, Magoh, and Y14, stably associate with Hang Shi and Rui-Ming Xu spliced mRNAs in the nucleus and in the cytoplasm, and 1W.M. Keck Structural Biology Laboratory, Cold Spring they are thought to be part of the core EJC (Kataoka et al. Harbor Laboratory, Cold Spring Harbor, New York 11724, 2001; Le Hir et al. 2001a). Here, we focus our study on USA; 2Department of Physics, University of Massachusetts at Drosophila Mago and Y14 proteins. Amherst, Amherst, Massachusetts 01002, USA Both Mago and Y14 are highly conserved from Saccha- romyces pombe to human (Fig. 1A,B). In Drosophila me- Pre-mRNA splicing is essential for generating mature lanogaster, both Mago and Y14 are essential for viability mRNA and is also important for subsequent mRNA ex- and required for correct localization of oskar mRNA at port and quality control. The splicing history is im- the posterior pole (Micklem et al. 1997; Newmark et al. printed on spliced mRNA through the deposition of a splic- 1997; Hachet and Ephrussi 2001; Le Hir et al. 2001a), which is critical for generating cell asymmetry and ing-dependent multiprotein complex, the exon junction ∼ specification during embryonic development. Mago in- complex (EJC), at 20 nucleotides upstreamof exon–exon teracts with Y14 stably in vitro and in vivo (Zhao et al. junctions. The EJC is a dynamic structure containing pro- 2000; Hachet and Ephrussi 2001; Kataoka et al. 2001; Le teins functioning in the nuclear export and nonsense-me- Hir et al. 2001a; Mingot et al. 2001). Magoh has also been diated decay of spliced mRNAs. Mago nashi (Mago) and shown to interact with the mRNA export factor TAP Y14 are core components of the EJC, and they form a stable (Kataoka et al. 2001). Y14 is a putative RNA-binding pro- heterodimer that strongly associates with spliced mRNA. tein that shuttles between the nucleus and the cyto- Here we report a 1.85 Å-resolution structure of the Dro- plasm (Kataoka et al. 2000; Mingot et al. 2001). It inter- sophila Mago–Y14 complex. Surprisingly, the structure acts with TAP and other EJC components REF/Aly, shows that the canonical RNA-binding surface of the RNPS1, and hUpf3 (Kataoka et al. 2001; Kim et al. 2001a). The two proteins are stably associated with Y14 RNA recognition motif (RRM) is involved in exten- mRNAs during the export from the nucleus to the cyto- sive protein–protein interactions with Mago. This unex- plasm (Kataoka et al. 2001; Kim et al. 2001b; Le Hir et al. pected finding provides important insights for under- 2001a), and this association persists until the first round standing the molecular mechanisms of EJC assembly of translation (Dostie and Dreyfuss 2002). and RRM-mediated protein–protein interactions. A great deal about the function of Mago and Y14 in Received January 15, 2003; revised version accepted February EJC assembly, mRNA export and decay has been learned 28, 2003. from recent studies. However, the molecular mecha- nisms of the Mago–Y14 interaction and their interac- tions with mRNA and other EJC components are still Pre-mRNA splicing is coupled with subsequent cellular poorly understood. To understand the structural basis of processes including export and nonsense-mediated decay Mago(h)–Y14 interaction and the mode of protein–RNA (NMD) of spliced mRNAs (Maquat and Carmichael interaction, we have solved a 1.85 Å resolution structure 2001; Dreyfuss et al. 2002; Reed and Hurt 2002; Wagner of a Drosophila Mago–Y14 complex. The structure reveals and Lykke-Andersen 2002). Splicing deposits a multipro- a novel mode of Mago–Y14 interaction through the RNA- tein complex, known as the exon junction complex binding surface of the Y14 RRM (RNA recognition motif), (EJC), on spliced mRNAs at a position ∼20 nucleotides which has important implications for understanding pro- upstream of the exon–exon junctions. These EJC pro- tein–RNA and protein–protein interactions of the EJC. teins have important functions in determining the fate of spliced mRNAs (Kataoka et al. 2000; Le Hir et al. Results and Discussion 2000a,b, 2001b; Kim et al. 2001b). To date, at least eight EJC proteins have been identified. They include Y14, Recombinant Mago–Y14 complex was produced in Esch- Mago, DEK, RNPS1, SRm160, Upf3, UAP56, and REF/ erichia coli by coexpression. Purified Mago–Y14 com- Aly (Mayeda et al. 1999; Kataoka et al. 2000, 2001; Le Hir plex exists as a 1:1 heterodimer in solution as judged by et al. 2000a, 2001a; McGarvey et al. 2000; Zhou et al. dynamic laser scattering (data not shown). Purified Ma- 2000; Hachet and Ephrussi 2001; Kim et al. 2001a; Luo et go–Y14 complex was subjected to endoproteinase Glu-C treatment to produce a core complex containing the full- al. 2001; Lykke-Andersen et al. 2001). These proteins ⌬ have been shown to have distinct and sometimes mul- length Mago and a truncated Y14, Y14 , lacking 46 tiple functions in various aspects of mRNA metabolism amino acids at the N terminus and 10 amino acids at the such as splicing, nuclear export, and mRNA quality con- C terminus as revealed by mass spectrometric analyses (data not shown). The crystal structure of the Mago– Y14⌬ complex was solved by seleno-methionyl (SeMet) [Keywords: Mago; Y14; RNA recognition motif; splicing; nuclear export; multiwavelength anomalous diffraction (MAD; Fig. 1C,D). nonsense-mediated decay] 3 The refined structure contains all but three N-terminal Corresponding author. residues of Mago and amino acids 61–155 of Y14, encom- E-MAIL [email protected]; FAX (516) 367-8873. Article and publication are at http://www.genesdev.org/cgi/doi/10.1101/ passing the entire RRM domain. Detailed statistics of gad.260403. the crystallographic analysis are shown in Table 1. GENES & DEVELOPMENT 17:971–976 © 2003 by Cold Spring Harbor Laboratory Press ISSN 0890-9369/03 $5.00; www.genesdev.org 971 Downloaded from genesdev.cshlp.org on September 30, 2021 - Published by Cold Spring Harbor Laboratory Press Shi and Xu The structure of Y14 Y14 contains a central RRM flanked by highly charged N- and C-terminal regions. As expected, our crystal structure shows that Y14 contains a canonical RRM (amino acids. 72–149), which consists of a four-stranded antiparallel ␤-sheet (␤1–␤4) and two helices (␣A, ␣B) in a ␤1–␣A–␤2–␤3–␣B–␤4 arrangement (Fig. 2A,B). The Y14 RRM structure can be superimposed with the structure of the N-terminal RRM of U1A (Oubridge et al. 1994) with a root-mean-squared deviation of 0.62Å using the C ␣ po- sitions of 23 residues located on ␤1–␤4 for alignment. Most notable differences lie within the loop connecting ␤2and ␤3, and regions outside of the RRM fold. These differences are not unusual, though, as they are the most variable re- gions among different RRMs (Varani and Nagai 1998). The loop connecting ␤2and ␤3 interacts with RNA in some RRMs, and conformational differences of this loop be- tween native and RNA-bound forms have been docu- mented. The N- and C-terminal extensions to many RRMs are normally disordered in the absence of RNA but become ordered upon nucleic acid binding. In the Mago–Y14⌬ Figure 1. Sequence conservation and structure determination of structure, both regions are stabilized by hydrogen bonding Drosophila Mago nashi and Y14. (A) Sequence alignment of Dro- between residues located at the two termini. For example, sophila melanogaster (dmMGN), human (hsMGN), and S. pombe the two termini interact via mainchain hydrogen bonding (spMGN) Mago proteins. Identical residues among all three species of Pro 65–Lys 152and Glu 67–Phe 150. In addition, the are highlighted in cyan, and similar residues are highlighted in yel- low. Every 10 residues are indicated with a “+” above the sequence. packing of Trp 73, Pro 66, His 124, and Trp 148 provides Secondary structural elements, determined from the crystallo- major stabilization of the terminal regions of Y14. graphic analysis, and their nomenclatures are shown above the se- The most conserved regions in the RRM are the RNP2 quence. (B) Sequence alignment of Y14 proteins of the same three and RNP1 sequence motifs located on ␤1 and ␤3, respec- species. The same criteria and color code as above are used to indi- tively. In all of the RRM–RNA complex structures known cate sequence homology. RNP1 and RNP2sequence motifs are un- to date, the ␤-sheet forms an RNA-binding platform, and derlined and labeled in magenta. Identical residues between Dro- sophila and human Y14 proteins that are not included in the crys- the aromatic residues in the RNP2and RNP1 motifs stack tallized fragment are shown in cyan letters. (C) A section of the 2.8 with RNA bases (Perez-Canadillas and Varani 2001). Y14 Å MAD phased electron density map. The map is calculated using has a perfectly conserved RNP2motif, but a highly con- the RESOLVE program and displayed using O at 1.2␴ contour level. served aromatic residue in RNP1 (most frequently a phe- The refined 1.85 Å structure is superimposed as a bond model. (D) The nylalanine) is absent. Instead, a leucine (Leu 118) occupies 1.85 Å 2F -F map of the same region contoured at 1.5␴ level.
Load more

Recommended publications
  • The Exon Junction Complex Core Represses Caner-Specific Mature Mrna Re-Splicing: a Potential Key Role in Terminating Splicing
    bioRxiv preprint doi: https://doi.org/10.1101/2021.04.01.438154; this version posted April 2, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Communication The Exon Junction Complex Core Represses Caner-specific Mature mRNA Re-splicing: A Potential Key Role in Terminating Splicing Yuta Otani1,2, Toshiki Kameyama1,3 and Akila Mayeda1,* 1 Division of Gene Expression Mechanism, Institute for Comprehensive Medical Science, Fujita Health University, Toyoake, Aichi 470-1192, Japan 2 Laboratories of Discovery Research, Nippon Shinyaku Co., Ltd., Kyoto, Kyoto 601-8550, Japan 3 Present address: Department Physiology, Fujita Health University, School of Medicine, Toyoake, Aichi 470-1192, Japan * Correspondence: [email protected] (A.M.) 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.01.438154; this version posted April 2, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Abstract: Using the TSG101 pre-mRNA, we previously discovered cancer-specific re-splicing of mature mRNA that generates aberrant transcripts/proteins. The fact that mRNA is aberrantly re- spliced in various cancer cells implies there must be an important mechanism to prevent deleterious re-splicing on the spliced mRNA in normal cells. We thus postulated that the mRNA re-splicing is controlled by specific repressors and we searched for repressor candidates by siRNA-based screening for mRNA re-splicing activity.
    [Show full text]
  • Exon Junction Complexes Can Have Distinct Functional Flavours To
    www.nature.com/scientificreports OPEN Exon Junction Complexes can have distinct functional favours to regulate specifc splicing events Received: 9 November 2017 Zhen Wang1, Lionel Ballut2, Isabelle Barbosa1 & Hervé Le Hir1 Accepted: 11 June 2018 The exon junction complex (EJC) deposited on spliced mRNAs, plays a central role in the post- Published: xx xx xxxx transcriptional gene regulation and specifc gene expression. The EJC core complex is associated with multiple peripheral factors involved in various post-splicing events. Here, using recombinant complex reconstitution and transcriptome-wide analysis, we showed that the EJC peripheral protein complexes ASAP and PSAP form distinct complexes with the EJC core and can confer to EJCs distinct alternative splicing regulatory activities. This study provides the frst evidence that diferent EJCs can have distinct functions, illuminating EJC-dependent gene regulation. Te Exon Junction Complex (EJC) plays a central role in post-transcriptional gene expression control. EJCs tag mRNA exon junctions following intron removal by spliceosomes and accompany spliced mRNAs from the nucleus to the cytoplasm where they are displaced by the translating ribosomes1,2. Te EJC is organized around a core complex made of the proteins eIF4A3, MAGOH, Y14 and MLN51, and this EJC core serves as platforms for multiple peripheral factors during diferent post-transcriptional steps3,4. Dismantled during translation, EJCs mark a very precise period in mRNA life between nuclear splicing and cytoplasmic translation. In this window, EJCs contribute to alternative splicing5–7, intra-cellular RNA localization8, translation efciency9–11 and mRNA stability control by nonsense-mediated mRNA decay (NMD)12–14. At a physiological level, developmental defects and human pathological disorders due to altered expression of EJC proteins show that the EJC dosage is critical for specifc cell fate determinations, such as specifcation of embryonic body axis in drosophila, or Neural Stem Cells division in the mouse8,15,16.
    [Show full text]
  • The Emerging Role of Ncrnas and RNA-Binding Proteins in Mitotic Apparatus Formation
    non-coding RNA Review The Emerging Role of ncRNAs and RNA-Binding Proteins in Mitotic Apparatus Formation Kei K. Ito, Koki Watanabe and Daiju Kitagawa * Department of Physiological Chemistry, Graduate School of Pharmaceutical Science, The University of Tokyo, Bunkyo, Tokyo 113-0033, Japan; [email protected] (K.K.I.); [email protected] (K.W.) * Correspondence: [email protected] Received: 11 November 2019; Accepted: 13 March 2020; Published: 20 March 2020 Abstract: Mounting experimental evidence shows that non-coding RNAs (ncRNAs) serve a wide variety of biological functions. Recent studies suggest that a part of ncRNAs are critically important for supporting the structure of subcellular architectures. Here, we summarize the current literature demonstrating the role of ncRNAs and RNA-binding proteins in regulating the assembly of mitotic apparatus, especially focusing on centrosomes, kinetochores, and mitotic spindles. Keywords: ncRNA; centrosome; kinetochore; mitotic spindle 1. Introduction Non-coding RNAs (ncRNAs) are defined as a class of RNA molecules that are transcribed from genomic DNA, but not translated into proteins. They are mainly classified into the following two categories according to their length—small RNA (<200 nt) and long non-coding RNA (lncRNA) (>200 nt). Small RNAs include traditional RNA molecules, such as transfer RNA (tRNA), small nuclear RNA (snRNA), small nucleolar RNA (snoRNA), PIWI-interacting RNA (piRNA), and micro RNA (miRNA), and they have been studied extensively [1]. Research on lncRNA is behind that on small RNA despite that recent transcriptome analysis has revealed that more than 120,000 lncRNAs are generated from the human genome [2–4].
    [Show full text]
  • Transcriptional Recapitulation and Subversion Of
    Open Access Research2007KaiseretVolume al. 8, Issue 7, Article R131 Transcriptional recapitulation and subversion of embryonic colon comment development by mouse colon tumor models and human colon cancer Sergio Kaiser¤*, Young-Kyu Park¤†, Jeffrey L Franklin†, Richard B Halberg‡, Ming Yu§, Walter J Jessen*, Johannes Freudenberg*, Xiaodi Chen‡, Kevin Haigis¶, Anil G Jegga*, Sue Kong*, Bhuvaneswari Sakthivel*, Huan Xu*, Timothy Reichling¥, Mohammad Azhar#, Gregory P Boivin**, reviews Reade B Roberts§, Anika C Bissahoyo§, Fausto Gonzales††, Greg C Bloom††, Steven Eschrich††, Scott L Carter‡‡, Jeremy E Aronow*, John Kleimeyer*, Michael Kleimeyer*, Vivek Ramaswamy*, Stephen H Settle†, Braden Boone†, Shawn Levy†, Jonathan M Graff§§, Thomas Doetschman#, Joanna Groden¥, William F Dove‡, David W Threadgill§, Timothy J Yeatman††, reports Robert J Coffey Jr† and Bruce J Aronow* Addresses: *Biomedical Informatics, Cincinnati Children's Hospital Medical Center, Cincinnati, OH 45229, USA. †Departments of Medicine, and Cell and Developmental Biology, Vanderbilt University and Department of Veterans Affairs Medical Center, Nashville, TN 37232, USA. ‡McArdle Laboratory for Cancer Research, University of Wisconsin, Madison, WI 53706, USA. §Department of Genetics and Lineberger Cancer Center, University of North Carolina, Chapel Hill, NC 27599, USA. ¶Molecular Pathology Unit and Center for Cancer Research, Massachusetts deposited research General Hospital, Charlestown, MA 02129, USA. ¥Division of Human Cancer Genetics, The Ohio State University College of Medicine, Columbus, Ohio 43210-2207, USA. #Institute for Collaborative BioResearch, University of Arizona, Tucson, AZ 85721-0036, USA. **University of Cincinnati, Department of Pathology and Laboratory Medicine, Cincinnati, OH 45267, USA. ††H Lee Moffitt Cancer Center and Research Institute, Tampa, FL 33612, USA. ‡‡Children's Hospital Informatics Program at the Harvard-MIT Division of Health Sciences and Technology (CHIP@HST), Harvard Medical School, Boston, Massachusetts 02115, USA.
    [Show full text]
  • Structure of the Y14-Magoh Core of the Exon Junction Complex
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Current Biology, Vol. 13, 933–941, May 27, 2003, 2003 Elsevier Science Ltd. All rights reserved. DOI 10.1016/S0960-9822(03)00328-2 Structure of the Y14-Magoh Core of the Exon Junction Complex Chi-Kong Lau, Michael D. Diem, Gideon Dreyfuss, process also alters the protein composition of the mRNP and Gregory D. Van Duyne* complex in an important way. In conjunction with each Howard Hughes Medical Institute and splicing event, a multisubunit complex of proteins is Department of Biochemistry and Biophysics assembled onto the mRNP particle near the location of University of Pennsylvania School of Medicine the exon-exon splice junction. This protein complex, Philadelphia, Pennsylvania 19104-6059 termed the exon-exon junction complex (EJC), binds ca. 24 bases upstream of the junction and serves to mark the locations of splicing activity and thus the prior loca- Summary tion of introns in the mature mRNA [7–9]. The EJC-mRNA interaction is strictly dependent upon splicing and has Background: Splicing of pre-mRNA in eukaryotes im- positional rather than sequence-based specificity. prints the resulting mRNA with a specific multiprotein The composition of the EJC changes during the complex, the exon-exon junction complex (EJC), at the postsplicing maturation of the mRNA. The core compo- sites of intron removal. The proteins of the EJC, Y14, nents of the complex as it first forms on the 5Ј exon Magoh, Aly/REF, RNPS1, Srm160, and Upf3, play critical [10] during splicing include Aly/REF [11, 12] and the roles in postsplicing processing, including nuclear ex- cytoplasmic shuttling proteins Y14 [7] and Magoh [10, port and cytoplasmic localization of the mRNA, and the 13, 14].
    [Show full text]
  • Genome-Scale Analysis Identifies Paralog Lethality As a Vulnerability of Chromosome 1P Loss in Cancer
    HHS Public Access Author manuscript Author ManuscriptAuthor Manuscript Author Nat Genet Manuscript Author . Author manuscript; Manuscript Author available in PMC 2018 December 28. Published in final edited form as: Nat Genet. 2018 July ; 50(7): 937–943. doi:10.1038/s41588-018-0155-3. Genome-scale analysis identifies paralog lethality as a vulnerability of chromosome 1p loss in cancer Srinivas R. Viswanathan1,2,3, Marina F. Nogueira#1,2, Colin G. Buss#4,5, John M. Krill- Burger2, Mathias J. Wawer6, Edyta Malolepsza2,11, Ashton C. Berger1,2, Peter S. Choi1,2,3, Juliann Shih2, Alison M. Taylor1,2,3, Benjamin Tanenbaum2, Chandra Sekhar Pedamallu1, Andrew D. Cherniack2, Pablo Tamayo2,7, Craig A. Strathdee2, Kasper Lage2,11, Steven A. Carr2, Monica Schenone2, Sangeeta N. Bhatia2,3,4,5,8,9,10, Francisca Vazquez2, Aviad Tsherniak2, William C. Hahn1,2,3, and Matthew Meyerson1,2,3,♦ 1Department of Medical Oncology, Dana-Farber Cancer Institute, Boston, MA, USA 2Broad Institute of MIT and Harvard, Cambridge, MA, USA 3Harvard Medical School, Boston, MA, USA 4Harvard-MIT Department of Health Sciences and Technology, Institute for Medical Engineering and Science, Massachusetts Institute of Technology, Boston, MA USA 5Koch Institute for Integrative Cancer Research, Massachusetts Institute of Technology, Cambridge, MA, USA. 6Chemical Biology and Therapeutics Science Program, Broad Institute of Harvard and MIT, Cambridge, MA, USA 7UCSD Moores Cancer Center and Department of Medicine, University of California, San Diego, La Jolla, California 8Howard Hughes
    [Show full text]
  • Renoprotective Effect of Combined Inhibition of Angiotensin-Converting Enzyme and Histone Deacetylase
    BASIC RESEARCH www.jasn.org Renoprotective Effect of Combined Inhibition of Angiotensin-Converting Enzyme and Histone Deacetylase † ‡ Yifei Zhong,* Edward Y. Chen, § Ruijie Liu,*¶ Peter Y. Chuang,* Sandeep K. Mallipattu,* ‡ ‡ † | ‡ Christopher M. Tan, § Neil R. Clark, § Yueyi Deng, Paul E. Klotman, Avi Ma’ayan, § and ‡ John Cijiang He* ¶ *Department of Medicine, Mount Sinai School of Medicine, New York, New York; †Department of Nephrology, Longhua Hospital, Shanghai University of Traditional Chinese Medicine, Shanghai, China; ‡Department of Pharmacology and Systems Therapeutics and §Systems Biology Center New York, Mount Sinai School of Medicine, New York, New York; |Baylor College of Medicine, Houston, Texas; and ¶Renal Section, James J. Peters Veterans Affairs Medical Center, New York, New York ABSTRACT The Connectivity Map database contains microarray signatures of gene expression derived from approximately 6000 experiments that examined the effects of approximately 1300 single drugs on several human cancer cell lines. We used these data to prioritize pairs of drugs expected to reverse the changes in gene expression observed in the kidneys of a mouse model of HIV-associated nephropathy (Tg26 mice). We predicted that the combination of an angiotensin-converting enzyme (ACE) inhibitor and a histone deacetylase inhibitor would maximally reverse the disease-associated expression of genes in the kidneys of these mice. Testing the combination of these inhibitors in Tg26 mice revealed an additive renoprotective effect, as suggested by reduction of proteinuria, improvement of renal function, and attenuation of kidney injury. Furthermore, we observed the predicted treatment-associated changes in the expression of selected genes and pathway components. In summary, these data suggest that the combination of an ACE inhibitor and a histone deacetylase inhibitor could have therapeutic potential for various kidney diseases.
    [Show full text]
  • Variation in Protein Coding Genes Identifies Information Flow
    bioRxiv preprint doi: https://doi.org/10.1101/679456; this version posted June 21, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Animal complexity and information flow 1 1 2 3 4 5 Variation in protein coding genes identifies information flow as a contributor to 6 animal complexity 7 8 Jack Dean, Daniela Lopes Cardoso and Colin Sharpe* 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 Institute of Biological and Biomedical Sciences 25 School of Biological Science 26 University of Portsmouth, 27 Portsmouth, UK 28 PO16 7YH 29 30 * Author for correspondence 31 [email protected] 32 33 Orcid numbers: 34 DLC: 0000-0003-2683-1745 35 CS: 0000-0002-5022-0840 36 37 38 39 40 41 42 43 44 45 46 47 48 49 Abstract bioRxiv preprint doi: https://doi.org/10.1101/679456; this version posted June 21, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Animal complexity and information flow 2 1 Across the metazoans there is a trend towards greater organismal complexity. How 2 complexity is generated, however, is uncertain. Since C.elegans and humans have 3 approximately the same number of genes, the explanation will depend on how genes are 4 used, rather than their absolute number.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name mago-nashi homolog, proliferation-associated (Drosophila) Gene Symbol MAGOH Organism Human Gene Summary Drosophila that have mutations in their mago nashi (grandchildless) gene produce progeny with defects in germplasm assembly and germline development. This gene encodes the mammalian mago nashi homolog. In mammals mRNA expression is not limited to the germ plasm but is expressed ubiquitously in adult tissues and can be induced by serum stimulation of quiescent fibroblasts. Gene Aliases MAGOH1, MAGOHA RefSeq Accession No. NC_000001.10, NT_032977.9 UniGene ID Hs.421576 Ensembl Gene ID ENSG00000162385 Entrez Gene ID 4116 Assay Information Unique Assay ID qHsaCID0036689 Assay Type SYBR® Green Detected Coding Transcript(s) ENST00000371470, ENST00000371466 Amplicon Context Sequence GTAATTGCTGTTGTTGGCATATCTTAACTTCCCGTCCGGTCGAAACTCAAACTCC AGGAACTCGTGGCCGAACTTGCCCTTGTGCCCCACGTAGTAACGCAGATAAAAG TCACTCTCCATGGCTCCCAAAAGACAACCGAGCC Amplicon Length (bp) 113 Chromosome Location 1:53701276-53704143 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 95 R2 0.9992 cDNA Cq 19.04 cDNA Tm (Celsius) 84.5 gDNA Cq 30.63 Page 1/5 PrimePCR™Assay Validation Report Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 2/5 PrimePCR™Assay Validation Report MAGOH, Human Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard
    [Show full text]
  • Mouse Models of Casc3 Reveal Developmental Functions Distinct from Other Components of the Exon Junction Complex
    Downloaded from rnajournal.cshlp.org on September 30, 2021 - Published by Cold Spring Harbor Laboratory Press REPORT Mouse models of Casc3 reveal developmental functions distinct from other components of the exon junction complex HANQIAN MAO,1 HANNAH E. BROWN,1 and DEBRA L. SILVER1,2,3,4 1Department of Molecular Genetics and Microbiology, Duke University Medical Center, Durham, North Carolina 27710, USA 2Department of Cell Biology, Duke University Medical Center, Durham, North Carolina 27710, USA 3Department of Neurobiology, Duke University Medical Center, Durham, North Carolina 27710, USA 4Duke Institute for Brain Sciences, Duke University Medical Center, Durham, North Carolina 27710, USA ABSTRACT The exon junction complex (EJC) is a multiprotein complex integral to mRNA metabolism. Biochemistry and genetic studies have concluded that the EJC is composed of four core proteins, MAGOH, EIF4A3, RBM8A, and CASC3. Yet recent studies in Drosophila indicate divergent physiological functions for Barentsz, the mammalian Casc3 ortholog, raising the question as to whether CASC3 is a constitutive component of the EJC. This issue remains poorly understood, particularly in an in vivo mammalian context. We previously found that haploinsufficiency for Magoh, Eif4a3,orRbm8a disrupts neuronal viability and neural progenitor proliferation, resulting in severe microcephaly. Here, we use two new Casc3 mouse alleles to demonstrate developmental phenotypes that sharply contrast those of other core EJC components. Homozygosity for either null or hypomorphic Casc3 alleles led to embryonic and perinatal lethality, respectively. Compound embryos lacking Casc3 expression were smaller with proportionately reduced brain size. Mutant brains contained fewer neurons and progenitors, but no apoptosis, all phenotypes explained by developmental delay.
    [Show full text]
  • 1 the Exon Junction Complex Undergoes a Compositional Switch
    The exon junction complex undergoes a compositional switch that alters mRNP structure and nonsense-mediated mRNA decay activity Justin W. Mabin1,5,6, Lauren A. Woodward1,5,6, Robert Patton3,5,6, Zhongxia Yi1,5, Mengxuan Jia2, Vicki Wysocki2,5, Ralf Bundschuh3,4,5, Guramrit Singh1,5,7* 1Department of Molecular Genetics, The Ohio State University, Columbus, OH 43210 2Department of Chemistry and Biochemistry, The Ohio State University, Columbus, OH 43210 3Department of Physics, The Ohio State University, Columbus, OH 43210 4Division of Hematology, Department of Internal Medicine, The Ohio State University, Columbus, OH 43210 5Center for RNA Biology, The Ohio State University, Columbus, OH 43210 6These authors equally contributed to this work 7Lead contact *Correspondence: Guramrit Singh ([email protected]) 1 SUMMARY The exon junction complex (EJC) deposited upstream of mRNA exon junctions shapes structure, composition and fate of spliced mRNA ribonucleoprotein particles (mRNPs). To achieve this, the EJC core nucleates assembly of a dynamic shell of peripheral proteins that function in diverse post-transcriptional processes. To illuminate consequences of EJC composition change, we purified EJCs from human cells via peripheral proteins RNPS1 and CASC3. We show that EJC originates as an SR-rich mega-dalton sized RNP that contains RNPS1 but lacks CASC3. After mRNP export to the cytoplasm and before translation, the EJC undergoes a remarkable compositional and structural remodeling into an SR-devoid monomeric complex that contains CASC3. Surprisingly, RNPS1 is important for nonsense-mediated mRNA decay (NMD) in general whereas CASC3 is needed for NMD of only select mRNAs. The promotion of switch to CASC3-EJC slows down NMD.
    [Show full text]
  • Regulation of Mrna Export by the PI3 Kinase / AKT Signal Transduction Pathway
    University of Massachusetts Medical School eScholarship@UMMS Cell and Developmental Biology Publications Cell and Developmental Biology 2013-04-15 Regulation of mRNA Export by the PI3 kinase / AKT Signal Transduction Pathway Alexandre Jose Christino Quaresma University of Massachusetts Medical School Et al. Let us know how access to this document benefits ou.y Follow this and additional works at: https://escholarship.umassmed.edu/cellbiology_pp Part of the Cell and Developmental Biology Commons, Enzymes and Coenzymes Commons, Genetics and Genomics Commons, Molecular Biology Commons, and the Nucleic Acids, Nucleotides, and Nucleosides Commons Repository Citation Quaresma AJ, Sievert R, Nickerson JA. (2013). Regulation of mRNA Export by the PI3 kinase / AKT Signal Transduction Pathway. Cell and Developmental Biology Publications. https://doi.org/10.1091/ mbc.E12-06-0450. Retrieved from https://escholarship.umassmed.edu/cellbiology_pp/120 Creative Commons License This work is licensed under a Creative Commons Attribution-Noncommercial-Share Alike 3.0 License. This material is brought to you by eScholarship@UMMS. It has been accepted for inclusion in Cell and Developmental Biology Publications by an authorized administrator of eScholarship@UMMS. For more information, please contact [email protected]. M BoC | ARTICLE Regulation of mRNA export by the PI3 kinase/AKT signal transduction pathway Alexandre Jose Christino Quaresma, Rachel Sievert, and Jeffrey A. Nickerson Department of Cell and Developmental Biology, University of Massachusetts Medical School, Worcester, MA 01655 ABSTRACT UAP56, ALY/REF, and NXF1 are mRNA export factors that sequentially bind at Monitoring Editor the 5′ end of a nuclear mRNA but are also reported to associate with the exon junction com- A.
    [Show full text]