GENETIC CONTROL
OF TESTICULAR GERM CELL TUMOR SUSCEPTIBILITY IN MICE
By
PHILIP DAVID ANDERSON
Submitted in partial fulfillment of the requirements
For the degree of Doctor of Philosophy
Dissertation advisor: Dr. Joseph H. Nadeau
Department of Genetics
CASE WESTERN RESERVE UNIVERSITY
August 2009
CASE WESTERN RESERVE UNIVERSITY
SCHOOL OF GRADUATE STUDIES
We hereby approve the thesis/dissertation of
______
candidate for the ______degree *.
(signed)______(chair of the committee)
______
______
______
______
______
(date) ______
*We also certify that written approval has been obtained for any proprietary material contained therein.
TABLE OF CONTENTS
ABSTRACT ...... 8
1 CHAPTER 1: BACKGROUND AND SIGNIFICANCE ...... 10
1.1 TESTICULAR CANCER IN HUMANS ...... 11
1.1.1 Effect of age on testicular cancer risk ...... 11
1.1.2 Histopathological subtypes are associated with particular age groups ...... 14
1.1.3 Accelerating rates of TGCT diagnoses throughout the First World ...... 15
1.1.4 Risk factors for TGCTs ...... 16
1.1.5 Genetic contributors to TGCTs in humans ...... 17
1.1.6 Genetics of cancer ...... 19
1.2 TESTICULAR CANCER IN MICE ...... 19
1.2.1 TGCTs in strain 129 mice ...... 20
1.2.2 PGC migration and colonization of the genital ridges ...... 21
1.2.3 The Y chromosome and its role in sex determination...... 22
1.2.4 Biology of TGCT tumorigenesis ...... 23
1.2.5 Defects in key developmental pathways may promote TGCTs ...... 24
1.2.6 TGCT susceptibility genes and modifier genes ...... 26
1.2.7 Mapping TGCT loci ...... 29
1.3 RESEARCH AIMS ...... 38
2 CHAPTER 2: TGCT SURVEY IN A RECIPROCAL B6.129 CSS PANEL AND A PARTIAL 129‐
CHRMOLF CSS PANEL ...... 39
2.1 ABSTRACT ...... 40
2.2 INTRODUCTION ...... 40
2.3 MATERIALS AND METHODS ...... 43
1
2.3.1 Backcrosses ...... 43
2.3.2 Genotyping ...... 44
2.3.3 SNP selection and primer design ...... 45
2.3.4 TGCT survey ...... 45
2.4 RESULTS ...... 46
2.4.1 TGCT occurrence in 129‐ChrMOLF backcross mice ...... 46
2.4.2 Evidence for MOLF modifiers in 129‐Chr 2MOLF and 129‐Chr 18MOLF ...... 46
2.4.3 TGCT occurrence in 129‐ChrB6 and B6‐Chr129 backcross mice ...... 51
2.4.4 The model accurately predicted a modifier(s) on MOLF‐18 ...... 52
2.4.5 High bilateral TGCT prevalence in 129‐Chr XMOLF ...... 52
2.5 DISCUSSION ...... 56
3 CHAPTER 3: THREE TGCT QTLS MAPPED TO CHROMOSOME 18 ...... 61
3.1 ABSTRACT ...... 62
3.2 INTRODUCTION ...... 62
3.3 MATERIALS AND METHODS ...... 66
3.3.1 Construction of 129‐Chr 18MOLF ...... 66
3.3.2 Genotyping ...... 67
3.3.3 Construction of congenic strains from 129‐Chr 18MOLF ...... 67
3.3.4 Identification of novel SSR markers ...... 68
3.3.5 Breakpoint mapping ...... 69
3.3.6 TGCT survey ...... 69
3.3.7 Histology...... 69
3.4 RESULTS ...... 70
3.4.1 Evidence for at least three TGCT QTLs on chromosome 18...... 72
3.4.2 Testes of 129‐Chr18MOLF and congenic mice were affected by calcification ...... 73
3.4.3 Does length of the congenic segments influence TGCT prevalence? ...... 75
2
3.5 DISCUSSION ...... 77
4 CHAPTER 4: THE ROLE OF THE MOUSE Y CHROMOSOME ON TGCT SUSCEPTIBILITY ...... 82
4.1 ABSTRACT ...... 83
4.2 INTRODUCTION ...... 83
4.3 MATERIALS AND METHODS ...... 86
4.3.1 CSSs ...... 86
4.3.2 Sox9Ods crosses...... 87
4.3.3 Genotyping ...... 87
4.3.4 TGCT survey ...... 87
4.3.5 Histology and immunohistochemistry ...... 87
4.4 RESULTS ...... 88
4.4.1 The 129/Sv Y chromosome is not necessary for TGCTs ...... 88
4.4.2 The 129/Sv Y chromosome is not sufficient for TGCTs ...... 89
4.4.3 Adult XX sex‐reversed males do not have TGCTs ...... 91
4.4.4 Neonate XY males, but not XX sex‐reversed males, have germ cells at birth ...... 93
4.4.5 Neonate XY males, but not XX sex‐reversed males, have TGCTs at birth ...... 95
4.5 DISCUSSION ...... 95
5 CHAPTER 5: SUMMARY AND FUTURE DIRECTIONS ...... 100
5.1 SUMMARY ...... 101
5.1.1 Three new CSSs with TGCT QTLs ...... 101
5.1.2 Chromosome 18 has multiple factors influencing TGCT susceptibility ...... 103
5.1.3 At least one factor on the Y chromosome is necessary for TGCTs...... 103
5.2 FUTURE DIRECTIONS ...... 104
5.2.1 Is Apobec1 the TGCT gene on B6‐6? ...... 104
5.2.2 How can the TGCT factors in TQ1 – TQ3 be identified? ...... 105
5.2.3 Do TGCTs and ES cell derivation share genetic determinants? ...... 108 3
5.2.4 Are testis calcifications the remains of aborted TGCTs ...... 109
5.2.5 Is Sry the Y‐linked factor that is necessary for TGCTs? ...... 111
5.3 CONCLUSIONS ...... 111
6 CHAPTER 6: APPENDICES ...... 113
7 CHAPTER 7: REFERENCES ...... 120
4
LIST OF TABLES
TABLE 1‐1: MODIFIER GENES AND CHROMOSOMES THAT AFFECT TGCT SUSCEPTIBILITY IN 129/SV MALES...... 27
MOLF TABLE 2‐1: TGCT DATA FROM BACKCROSS 129‐CHR MALES...... 49
B6 TABLE 2‐2: TGCT DATA FROM BACKCROSS 129‐CHR MALES ...... 54
TABLE 2‐3: THE MODEL ACCURATELY PREDICTED A MOLF MODIFIER ON MOLF‐18...... 55
TABLE 3‐1: RATES OF PARENT STRAINS AND CONGENIC STRAINS AFFECTED WITH TESTICULAR CALCIFICATIONS ...... 74
TABLE 3‐2: LENGTH IN MEGABASES (MB) OF THE CONGENIC SEGMENTS, AND THE PERCENT OF MALE ADULTS AFFECTED WITH
TGCTS...... 76
TABLE 4‐1: TGCTS IN CSS MALES WITH ALTERNATE Y CHROMOSOMES...... 90
TABLE 4‐2: TEST FOR TGCTS IN CONTROL AND SEX‐REVERSED MALES...... 90
5
LIST OF FIGURES
FIGURE 1‐1: RISK OF VARIOUS CANCERS AS A FUNCTION OF AGE ...... 13
FIGURE 1‐2: STEPS TO MAKE A CSS ...... 33
FIGURE 1‐3: STEPS TO MAKE A CONGENIC STRAIN FROM A CSS...... 35
FIGURE 3‐1: TGCT DATA FROM ADULT PARENTAL STRAINS AND CONGENIC STRAINS...... 71
FIGURE 4‐1:CROSSES PERFORMED TO PRODUCE SEX‐REVERSED AND CONTROL N2 MALES...... 92
FIGURE 4‐2: COMPARISON OF TESTES FROM NORMAL MALES AND SEX‐REVERSED MALES ...... 94
6
ACKNOWLEDGEMENTS
I would like to thank Annie Baskin and Stephanie Doerner for giving me their
129-ChrB6 and B6-Chr129 CSS males to screen for TGCTs. Those data are reported in
Chapter 2 and Appendix IV.
I would like to thank Vicki Nelson for helping to survey the congenic mice I report on in Chapter 3.
I would also like to thank Jean Kawasoe, Diane Lui, Elaine Leung, Maritza
Rosales and Vicki Nelson for helping to survey the CSS and N2 males I report on in
Chapter 4.
7
Genetic Control of Testicular Germ Cell Tumor Susceptibility in Mice
Abstract
By
PHILIP DAVID ANDERSON
Testicular germ cell tumors (TGCTs) are the most common types of testicular cancer as well as the most common tumor in men aged 15 – 34. Despite their prevalence, the genetic control of susceptibility is poorly understood. Family history suggests a strong genetic component to TGCT susceptibility, but studies have found only one rare, weakly associated Y-linked locus. The 129 family of inbred mouse strains is an established animal model of TGCTs. Linkage studies in mice have been largely unsuccessful, and no genes controlling susceptibility have been found.
The goal of my research was to identify chromosomes and chromosomal regions containing TGCT QTLs (quantitative trait loci) using chromosome substitution strains
(CSSs). My analysis showed that three CSSs have TGCT QTLs. To map the QTLs on chromosome 18, I made a panel of eight congenic strains from 129-Chr 18MOLF. I surveyed congenic males for TGCTs and found evidence for three previously unknown
TGCT QTLs on chromosome 18.
Because studies have shown conflicting evidence for a Y-linked factor(s) promoting TGCTs in humans, I tested the role of this chromosome on TGCT development in mice. Sry, the master sex-determining gene in mammals, is on the Y chromosome and is normally required for testis formation and male development. In the
8 absence of the Y chromosome, mice develop as fertile females. To bypass the requirement for Sry in sexual development, I took advantage of the Odd Sex mutation that causes XX animals to develop as males without the Y chromosome. Sex-reversed XX males develop testes with PGCs, which enabled tests of whether the Y chromosome was required for TGCT tumorigenesis. Although normal males developed TGCTs at an appreciable rate, no TGCTs were found in sex-reversed males. I concluded that at least one factor on the Y chromosome was required for TGCT initiation.
The results of my research support the theory that TGCTs are a highly complex trait, and that CSSs are an effective tool for mapping QTLs with weak effects. A more thorough understanding of the heritable component of TGCTs in mice will improve our understanding of the genetic control of susceptibility to complex diseases.
9
1 CHAPTER 1: Background and Significance
10
1.1 TESTICULAR CANCER IN HUMANS
Testicular cancer is the most common malignancy affecting young men aged 15 -
34, accounting for over 1% of all male cancers (KRAIN 1973; JEMAL et al. 2006). Over
90% of testicular cancers are testicular germ cell tumors (TGCTs) (TALERMAN 1985) and
are derived from germ cells, the pluripotent precursors of gametes. Somatic cell-derived
tumors of the testis (e.g. Leydig cell tumors, Sertoli cell tumors) are rare in comparison to
TGCTs, and approximately 90% of somatic testicular cancers are benign (KUMAR et al.
2005).
1.1.1 Effect of age on testicular cancer risk
Testicular cancer is unusual because the risk for the disease peaks at three different times throughout life, instead of generally increasing with age (NICHOLSON and
HARLAND 1995; FALLON et al. 2006) (Figure 1-1). The first peak occurs in infants less
than two years of age. Risk for TGCTs drops after infancy until approximately the age of
ten. After ten, risk for TGCTs increases, and reaches a second peak at approximately age
thirty. After thirty, risk for TGCTs decreases until approximately age seventy. Starting at age seventy, risk again increases, reaching a third peak at approximately age eighty.
After eighty, risk again decreases.
The presence of distinct peaks suggests the importance of developmental pathways on TGCT risk. For example, the TGCT risk for newborns is higher than the
TGCT risk for five-year-olds. These data may indicate that the TGCTs of early childhood are antagonized by maternal factors such as pregnancy hormones, and after birth TGCT risk decreases because the infant is removed from the source of the hormones. There is some evidence to suggest that dosage of placental hormones affects
11
TGCT risk: dizygotic (DZ) twins are at higher risk than monozygotic (MZ) twins for
TGCTs, perhaps reflecting the presence of two hormone-secreting placentas in DZ pregnancies compared to the usual one placenta in MZ pregnancies (BRAUN et al. 1995;
SWERDLOW et al. 1997).
Risk for TGCTs dramatically increases between ages ten and twenty, which is
correlated with the onset of puberty. These data may suggest the influence of pubertal
hormones on TGCT risk. Although other cancer types are thought to arise mostly
because of DNA mutations in key genes, the presence of three distinct peaks and general
decrease in risk after age thirty suggest TGCTs may be a special class of cancers that are
sensitive to developmental milestones.
12
SEER data (F cancer peaks three times throughout type are indicated by the “all Figure 1-1: Risk of various cancers ALLON et al. 2006). s” suffix. Unlike other cancer t as a function of age. Lines life. This diagram was graphed by the Candidate based on representing more ypes, the risk for testicular than one tumor
13
1.1.2 Histopathological subtypes are associated with particular age groups
Each of the three peaks in TGCT prevalence is associated with particular histopathological subtypes. In infants, the tumors are mostly yolk sac tumors, teratomas, and teratocarcinomas (NICHOLSON and HARLAND 1995; KUMAR et al. 2005). All three
subtypes are thought to develop directly from primordial germ cells (PGCs) or via an
embryonal carcinoma (EC) cell intermediate (EC cells are the malignant counterparts of
PGCs) (DAMJANOV 1984). Whereas yolk sac tumors arise by differentiation along
extraembryonic lines, teratomas result from differentiation along the lines of embryonic
germ layers- endoderm, mesoderm and ectoderm. Teratocarcinomas are a mixed tumor
type consisting of teratomas plus undifferentiated EC cells. The continued presence of
EC cells in teratocarcinomas and other TGCTs is associated with the potential for distant metastasis (MARTIN and EVANS 1974; ANDREWS 2002). Teratomas, on the other hand,
are considered benign and are associated with good prognosis in this age group (MARTIN
and EVANS 1974; ISAACS 2004).
The testicular cancers that occur in the second peak are mostly seminomas, and less commonly, mixed teratomas and yolk sac tumors with embryonal carcinoma
(NICHOLSON and HARLAND 1995; KUMAR et al. 2005). Approximately 50% of all
TGCTs are seminomas, which are the dominant TGCT type in young adults but are very
uncommon in infants (KUMAR et al. 2005). Seminomas result from differentiation of transformed germ cells into sheets of large, uniform “seminoma cells” (KUMAR et al.
2005). Teratomas have a far greater risk of harboring small EC foci in adults than in
infants (KUMAR et al. 2005). Therefore clinicians typically treat mature teratomas in the
adult as if they were malignant, reflecting the increased risk. In contrast to TGCTs in
14 infants, TGCTs in young adults are associated with carcinoma in situ (intratubular germ cell neoplasia), a transformed pre-invasive lesion. Tumor karyotype studies have shown that both carcinoma in situ and TGCTs in young adults are usually aneuploid
(OOSTERHUIS et al. 1989), commonly with deletions in 1p and 6q (BEHRMAN et al. 2004).
Approximately 80% of TGCTs in young adults exhibit isochromosome 12p (SANDBERG
et al. 1996). Gain of 12p material has not been found in carcinoma in situ (ROSENBERG et al. 2000; SUMMERSGILL et al. 2001), suggesting that gain of 12p (or loss of 12q) is
associated with progression from carcinoma in situ to invasive disease.
The testicular cancers that occur in older adult men are mostly spermatocytic
seminomas and lymphomas of the testis (NICHOLSON and HARLAND 1995; KUMAR et al.
2005). Although both spermatocytic seminomas and seminomas are derived from germ cells, spermatocytic seminomas have little in common clinically or histologically with seminomas, and represent a distinct tumor type. Unlike seminomas, spermatocytic seminomas are slow-growing, not associated with carcinoma in situ, and seldom metastasize (KUMAR et al. 2005). All of these characteristics contribute to good
prognosis.
1.1.3 Accelerating rates of TGCT diagnoses throughout the First World
Studies have shown a pattern of increasing TGCT prevalence in Europe and North
America over the last thirty years. In Denmark and Norway, which have the highest rates
of TGCT in the world, men have almost a 1% risk of developing a TGCT in their
lifetimes (SKAKKEBÆK et al. 2007). During the 1990’s, TGCT diagnoses accelerated
2.4% - 4.2% per year in every country studied in Northern Europe except Denmark
(RICHIARDI et al. 2004). In England and Wales, the age-standardized incidence rate grew
15 from 2.9 per 100,000 in 1971 to 5.4 per 100,000 in 1997 (POWER et al. 2001). In three
provinces of Canada, the incidence of seminomas and other TGCTs increased 53% and
91% respectively in the 26 years from 1970 to 1995 (LIU et al. 2000).
Increasing prevalence of TGCTs is mirrored in the USA. In the USA, the
incidence of the disease has been increasing in European-American men for at least the
past fifty years (MCKIERNAN et al. 1999; SHAH et al. 2007), and African-American and
Asian-American men for at least the past thirty five years (MCGLYNN et al. 2005; SHAH
et al. 2007). European-American men are at highest risk of the disease, with 6.36 cases
per 100,000 per year developing a tumor in 2003, a rise of 61% from 1978 (SHAH et al.
2007). Although Asian-American men have a reduced risk (2.23 affected per 100,000 per year in 2003) relative to European-American men, their risk has increased at nearly the same rate, 62.8%, since 1978 (SHAH et al. 2007). African-American men have the
lowest risk (1.30 per 100,000 per year in 2003), although their risk has increased 39.8% since 1978 (SHAH et al. 2007).
1.1.4 Risk factors for TGCTs
In addition to race, there are several other known risk factors for TGCTs. The
greatest risk factors are family history (FORMAN et al. 1992), cryptorchidism (MØLLER et
al. 1996), testicular dysgenesis (KAPLAN et al. 1981; YOUNG and SCULLY 1990), and
prior diagnosis of TGCT (COLLS et al. 1996; HOFF WANDERÅS et al. 1997; RÜTHER et al.
2000). Infertility (JACOBSEN et al. 2000), dizygotic twinship (BRAUN et al. 1995;
SWERDLOW et al. 1997), testicular atrophy (HAUGHEY et al. 1989; MØLLER et al. 1996)
and unusual sex chromosome karyotypes (YOUNG and SCULLY 1990) are also associated
with the development of TGCTs (DIECKMANN and PICHLMEIER 2004). All of these
16 factors relate to abnormal testicular development and prompted Skakkabæk and colleagues to propose the existence of a “testicular dysgenesis syndrome” that includes
TGCTs and is caused by genetic and environmental factors (SKAKKEBÆK et al. 2001).
Environmental and occupational factors have also been proposed to play a role in
TGCT risk. Much of the research in environmental risk factors has focused on the
contribution of estrogenic and anti-androgenic pollutants (endocrine disruptors) to TGCT
risk. Men engaged in the mining, chimney sweeping and food and beverage industries
are at higher risk for nonseminoma, suggesting exposure to occupational antagonists
contributes to TGCT risk (KNIGHT et al. 1996). Although there is debate about the relative importance of environmental risk factors versus genetic risk factors to TGCTs, there is little doubt that both environmental and genetic factors contribute to the disease
(FORMAN et al. 1990; HARDELL et al. 1998; RICHIARDI et al. 2002).
1.1.5 Genetic contributors to TGCTs in humans
Family history of TGCTs is among the most significant risk factors for TGCTs:
sons of affected fathers have a 4- to 6-fold increased risk of developing the disease, and
brothers of affected sibs have an 8- to 10-fold increased risk (FORMAN et al. 1992;
LINDELÖF and EKLUND 2001). Despite the strong family history, identification of
susceptibility genes has been exceedingly difficult in humans. Traditional linkage studies
have been largely unsuccessful because of the limited number of multigenerational
pedigrees containing several affected cases, the sterility that often results from treatment,
and the genetic complexity of the disease. Mapping experiments conducted on families
collected by the International Testicular Cancer Linkage Consortium have revealed only tenuous linkages. Although numerous weak linkages were reported by Bishop (BISHOP
17
1998), only one significant linkage has been reported to Xq27 (RAPLEY et al. 2000;
LUTKE HOLZIK et al. 2006). Unfortunately, later studies failed to confirm the linkage to
Xq27 (CROCKFORD et al. 2006). To date, only one factor involved in susceptibility
(gr/gr) has been described (NATHANSON et al. 2005), and it was found through a
candidate gene approach and not by unbiased linkage. Because of the difficulties in
human linkage studies, mouse models are an attractive alternative and could be used to test individual autosomes or Y-linked loci for TGCT genes.
The gr/gr TGCT factor is a 1.6 megabase deletion within the AZFc region of
Yq11 that had been associated with subfertility in hemizygous men (REPPING et al. 2003;
LYNCH et al. 2005). Because infertility is a risk factor for testicular cancer (JACOBSEN et
al. 2000), Nathanson et al. tested the prevalence of this deletion in a large, international
cohort of men with and without TGCT (NATHANSON et al. 2005). The deletion is present
in 1.3% of unaffected males. However it is present in 2% of males with TGCT who lack
a family history and 3% of males with a family history (NATHANSON et al. 2005). For
that reason, gr/gr is considered a rare, low-penetrance TGCT factor. Interestingly, men with gr/gr and a maternal family history of TGCTs are at over 4-fold greater risk than men with gr/gr and a paternal family history (NATHANSON et al. 2005). Furthermore,
gr/gr does not entirely delete any genes. Rather, it reduces the copy number of three
genes that are duplicated in multiple palindromic repeats on the Y chromosome. gr/gr
deletes two of the four DAZ genes, one of the three BPY2 genes, one of the two CDY1
genes, and several additional transcriptional elements (NATHANSON et al. 2005). All
three genes are expressed in male germ cells with functions in germ cell survival,
development and differentiation (REIJO et al. 1995; KLEIMAN et al. 2003; GINALSKI et al.
18
2004), suggesting that perturbations of these functions in germ cells promote TGCTs. Y chromosome deletions in mouse models could be used to help elucidate the role of the Y in TGCT susceptibility.
1.1.6 Genetics of cancer
Cancer is a heterogeneous disease characterized by inappropriate cell growth and proliferation. Cancers in somatic cells are partly or mostly caused by the inheritance or accumulation of mutations in two types of genes, proto-oncogenes and tumor suppressor genes. Proto-oncogenes promote cancer when inappropriately activated. Genes promoting proliferation and inhibiting apoptosis are affected by oncogenic mutations.
Mutations in proto-oncogenes usually resulting in constitutively active alleles. In contrast, tumor suppressors normally inhibit cell growth and proliferation. Mutations in tumor suppressors are usually involve loss of function of the protein. Therefore, a single functional gene copy is usually sufficient to prevent cancer initiation. For example, p53 normally promotes cell cycle arrest and apoptosis in response to DNA damage.
Inactivation of p53 prevents a damaged cell from inducing apoptosis and simultaneously allows unregulated growth, eliminating a key checkpoint for preventing the accumulation of mutations (MENDELSOHN et al., 2001).
1.2 TESTICULAR CANCER IN MICE
Mice have a closer phylogenetic relationship to humans compared to other
common model organisms (e.g. fruit flies, zebrafish, chick), which is why mice are used
to model human diseases, including testicular cancer. Mice present several advantages
over other mammalian models. Compared to other mammals, mice are physically small,
have large numbers of offspring in frequent litters, and a short generation time. A large
19 number of phenotypically and genotypically-diverse inbred strains are available that have unique sets of characteristics. These phenotypic and genotypic differences are exploited in mapping studies in which strains that vary in a particular phenotype are crossed to map genes involved in susceptibility.
1.2.1 TGCTs in strain 129 mice
Mice from the 129 family of inbred strains spontaneously develop TGCTs and 1-
10% of males have at least one TGCT by 3 weeks of age (STEVENS and HUMMEL 1957).
Males from other inbred strains are rarely affected (STEVENS and HUMMEL 1957;
STEVENS 1967a). Strain 129 mice are grouped into one of several substrains to reflect the
genetic variability within the family (SIMPSON et al. 1997; THREADGILL et al. 1997).
Most of the published experiments pertaining to mouse TGCTs were performed with
mice from the 129/Sv subline, in particular the 129S1/Sv +p +Tyr-c +Kitl-SlJ inbred strain
[129S1/SvImJ, formerly 129S3/SvImJ] (hereafter 129/Sv).
129/Sv males are affected by two different kinds of TGCTs: testicular teratomas
and teratocarcinomas. Teratomas are tumors that arise from complete differentiation of
PGCs or EC cells into cells or tissue derived from ectoderm, mesoderm or endoderm
(STEVENS and HUMMEL 1957). Teratocarcinomas are teratomas that retain some
undifferentiated PGCs or EC cells. The teratomas and teratocarcinomas of mice closely resemble the teratomas and teratocarcinomas of newborn humans (STEVENS and HUMMEL
1957; YOUNGREN et al. 2003): both originate embryonically, both lack carcinoma in situ, and both lack isochromosome 12p. In most cases, the arrangement of tissue types in
TGCTs is random. However, some normal tissue co-associations have been reported,
20 such as glandular epithelium with ducts (STEVENS 1967a), and muscle attachment to
cartilage and bone (STEVENS 1973).
1.2.2 PGC migration and colonization of the genital ridges
TGCTs in mice arise directly or indirectly from primordial germ cells (PGCs), the embryonic precursors to gametes (STEVENS 1967b). PGCs are the first embryonic cell
type to become lineage-restricted, which occurs just prior to gastrulation (embryonic day
[E]6.5 – E8.5). At E6.25, the PGC precursors are localized to the proximal posterior
epiblast as a population of approximately 6 Blimp1-positive cells adjacent to the extra- embryonic ectoderm (OHINATA et al. 2005). Blimp1 expression is important for the survival of the early PGC lineage, as few Blimp1-deficient PGCs survive past E7
(OHINATA et al. 2005). By labeling individual epiblast cells, Lawson and Hage
established that PGCs are derived from the proximal epiblast cells closest to the extra-
embryonic ectoderm (LAWSON and HAGE 1994). Reciprocal transplantations of distal
epiblast and proximal epiblast just prior to gastrulation showed that the position of the
cells within the epiblast is important for PGC determination (TAM and ZHOU 1996), and
not segregation of a maternally-inherited cytoplasmic determinant (e.g. pole plasm in
Drosophila) in the proximal epiblast. Between E7 – E7.5, PGCs reduce their rate of cell
division from once every 7 hours to once every 16-17 hours (LAWSON and HAGE 1994).
In addition, the PGCs up-regulate Stella (SATO et al. 2002) and maintain high levels of
TNAP (GINSBURG et al. 1990), Nanog (CHAMBERS et al. 2003), and Oct3/4 (SCHOLER et al. 1990; NICHOLS et al. 1998), among other genes.
By late gastrulation (E8.5), PGCs are localized to the ventral portion of the
hindgut. From there they migrate to the dorsal side of the hindgut, then through the
21 dorsal mesentery in the direction of the developing genital ridges. The genital ridge is the embryonic precursor to the gonads, kidneys, and adrenals. Throughout their migration the PGCs are dependent on the c-kit signal transduction pathway for their continued proliferation and migration: homozygous mutants in either kit receptor (Kitw/w) or kit
Sl/Sl ligand (Kitl ) have reduced germ cell numbers (COULOMBRE and RUSSEL 1954;
BENNETT 1956), and few PGCs in Kit-null homozygotes arrive at the genital ridges
(BUEHR et al. 1993). Normally, approximately 20,000 PGCs colonize each genital ridge
between E10 and E11 (TAM and SNOW 1981), while the ridges are still forming. It is
important that the PGCs arrive during this narrow window: cells in the midline down-
regulate Kitl at E10.5, and any PGCs still in the midline undergo BAX-dependent
programmed cell death (RUNYAN et al. 2006).
1.2.3 The Y chromosome and its role in sex determination
The Y chromosome is a small, gene-poor sex chromosome on which Sry, the
master sex determining gene in mammals, is located. Between E11 and E11.25, the
epithelial cell derivatives (and only epithelial cell derivatives) in the indifferent gonad express Sry (SINCLAIR et al. 1990, HIRAMATSU et al. 2009). Expression of Sry causes masculinization of the indifferent gonad and the differentiation of the supporting epithelial derivatives into Sertoli cells. In the absence of Sry, the supporting epithelial derivatives differentiate into granulosa cells. Several genes, particularly Sox9, play a crucial downstream role in the sex determination pathway (CHABOISSIER et al. 2004).
Ectopic expression of a Sox9 transgene in XX gonads is sufficient to elicit testis formation in transgenic XX mice lacking Sry and the Y chromosome (VIDAL et al. 2001),
demonstrating that neither Sry nor the Y chromosome are required for sex determination.
22
Odd Sex (Ods) is a dominant insertional mutation that causes complete female to male sex reversal in XX mice lacking the Y chromosome and Sry (BISHOP et al. 2000).
The mutation was created in the TGCT-resistant FVB inbred strain by the integration of a
Tyrosinase minigene ~1 Mb upstream of Sox9 on chromosome 11, which resulted in inappropriate Sox9 expression in XX mice (BISHOP et al. 2000). Adult sex-reversed XX
Sox9Ods/+ mice are morphologically identical to their XY littermates except in the testes,
in which the seminiferous tubules of sex-reversed mice are devoid of germ cells,
precluding spermatogenesis. Although sex-reversed mice have some germ cells in the
gonad until at least birth, complete germ cell death occurs before sexual maturation,
causing sterility. Sterility in the XX Sox9Ods/+ males is consistent with the sterility
observed with other female-to-male sex-reversing mutations (SUTCLIFFE and BURGOYNE
1989).
1.2.4 Biology of TGCT tumorigenesis
The remarkable diversity of cell and tissue types in TGCTs suggested a
pluripotent stem cell origin for the tumors (FRIEDMAN and MOORE 1946; DIXON and
MOORE 1952; MELICOW 1955). In 1967, Leroy Stevens directly tested whether PGCs
were the cells of origin for TGCTs in mice. Working in TGCT-susceptible strain 129
mice, he grafted germ cell-deficient KitlSl/Sl genital ridges and normal Kitl+/+ genital
ridges into normal Kitl+/+ adult testes. He found that wild-type grafts formed TGCTs at a
high rate, whereas germ cell-deficient grafts formed few tumors (STEVENS 1967b). In a
separate experiment, Leroy Stevens used grafting experiments to refine the timing of
TGCT tumorigenesis (STEVENS 1964). Again working in 129/Sv, he transplanted intact genital ridges from E12.5 and E13.5 fetuses into adult testes. Although grafts from E12.5
23 genital ridges formed teratomas in 82% of cases, only 8% of E13.5 grafts formed teratomas. Taken together, these experiments provided strong evidence that PGCs are the cells of origin of TGCTs, and embryonic genital ridges are competent to form teratomas by E12.5.
1.2.5 Defects in key developmental pathways may promote TGCTs
Defects in several cellular processes may explain the origin of TGCTs from
PGCs. In particular, the switch from mitotic to meiotic cell division has generated considerable interest. In C. elegans, deletion of the Notch family member GLP-1 causes premature entry of PGCs into meiosis (BERRY et al. 1997). When a dominant hyper-
morphic allele of GLP-1 was microinjected into adult hermaphrodites, PGCs failed to
enter meiosis and continued to proliferate mitotically, causing tumor-like growths
(BERRY et al. 1997). Mammals have four orthologues of GLP-1, Notch1 – Notch4.
Gene expression studies showed that Notch2 and Notch4 are consistently up-regulated in human seminomas and carcinoma in situ (ADAMAH et al. 2006). In addition to Notch family genes, members of the retinoic acid pathway are also of interest because retinoic acid promotes entry into meiosis in both males and females (CHUNG and WOLGEMUTH
2004; VERNET et al. 2006; BOWLES and KOOPMAN 2007). Retinoic acid stimulates Stra8,
whose expression is correlated with initiation of meiosis (OULAD-ABDELGHANI et al.
1996). The enzyme that degrades retinoic acid, CYP26B1, is down-regulated in PGCs of normal females and up-regulated in PGCs of normal males around E12.5. High levels of
CYP26B1 in male PGCs prevent expression of “meiosis factor” Stra8 and preclude entry into meiosis at E13.5. As a result, perturbations in the expression of Cyp26B1 in male
24
PGCs may play a role in PGC transformation by prolonging mitosis in a manner similar to hypermorphic GLP-1 in C. elegans.
TGCTs have also been hypothesized to arise from mutations in genes that are expressed during meiosis. Attention has been focused the Sycp3 gene in particular, because it maps close to an ‘insignificant’ linkage on human chromosome 12q (RAPLEY
et al. 2003; CROCKFORD et al. 2006), and because 12q is often lost in TGCT patients
(SANDBERG et al. 1996; ROSENBERG et al. 2000; SUMMERSGILL et al. 2001). SYCP3 is a
crucial component of the synaptonemal complex, a protein-DNA structure that forms
between all four sister chromatids during meiotic prophase I. Sycp3 is necessary for
-/- meiosis: Sycp3 males are sterile because of a meiotic defect during zygotene (YUAN et al. 2000). Sycp3 is normally expressed exclusively in meiotic cells. However, it is also expressed in human EC cells, carcinoma in situ, and seminomas (ADAMAH et al. 2006).
In addition, the cohesin Smc1β has attracted attention. Deletion of this gene in mice
results in severe mutant phenotypes including failure to complete meiotic recombination,
aneuploidies and aberrant telomeres (REVENKOVA et al. 2004; HODGES et al. 2005).
Aneuploidies are associated with certain human TGCT subtypes (OOSTERHUIS et al.
1989).
Anomalies in the switch from mitosis to meiosis have been postulated as a potential cause for neoplastic conversion of PGCs (ADAMAH et al. 2006). In male mice,
PGCs enter mitotic arrest at E13.5 and stay arrested until shortly after birth, when they resume proliferation (MCLAREN 1984). Instead of arresting in mitosis, PGCs in females
enter into meiosis at E13.5 (MCLAREN 1984). Co-expression of both mitosis and meiosis
genes may provide the instability that could initiate tumor formation. Because the
25 decision to enter meiosis is sex-dependent, aberrations in the sex determination pathway and Sry may be involved. The timing of Sry expression is very important for normal testis development: delayed Sry expression (E11.3) results in development of intersex gonads (ovotestes) (HIRAMATSU et al. 2009). A delay in testis specification could alter sex-specific gene expression patterns. However, the effect of timing or level of expression of Sry on TGCT initiation has not been evaluated in humans or mice.
1.2.6 TGCT susceptibility genes and modifier genes
Susceptibility genes and modifier genes are distinct types of genes that influence
complex traits, like TGCTs. Susceptibility genes are defined as genes that are necessary
for a disease (HASTON and HUDSON 2005). Modifier genes are not necessary for disease,
but rather influence various aspects of the presentation of disease (HASTON and HUDSON
2005). For example, modifier genes can influence the severity or rate of progression of
disease by affecting the penetrance, dominance, expressivity or pleiotropy of
susceptibility genes (NADEAU 2001). Although no TGCT susceptibility genes have been
discovered in mice, several TGCT modifier genes have been found that affect the
penetrance (the proportion of individuals with the disease genotype that also have the
disease phenotype) of their target susceptibility genes. Modifier genes that increase the
penetrance of susceptibility genes are called ‘enhancers’, and modifier genes that reduce
the penetrance of susceptibility genes are called ‘suppressors’. Table 1-1 lists some
known TGCT modifier genes identified to date. Characterization of TGCT modifier
genes of both types continues to provide insight into the developmental pathways leading
to disease initiation and progression.
26
Process Modifier Type of modifier Nature of mutation (of normal allele) Pten-/- Enhancer Knock-out Regulation of cell cycle Trp53-/- Enhancer Knock-out Regulation of cell cycle Apobec1-/- Enhancer and Knock-out RNA editing suppressor Ay Suppressor Deletion Translation KitlSl Enhancer Deletion PGC migration Kitlgb Enhancer Deletion PGC migration Dnd1Ter Enhancer Opal mutation PGC survival MOLF-19 Enhancer CSS Unknown
Table 1-1: Modifier genes and chromosomes that affect TGCT susceptibility in 129/Sv males.
27
Several TGCT modifier genes enhance the frequency of male 129/Sv mice affected with TGCTs. Mutants in Kitl (Steel) and Kit (White-spotting, [W]) were both first described as dominant coat color mutants with defects in melanogenesis, hematopoiesis and PGC development (DURHAM 1908; SARVELLA and RUSSELL 1956).
Kitl encodes the ligand of kit receptor (Kit). Positional cloning of Kitl in 1990 and
subsequent interval mapping showed that the Steel allele encompasses a 973,366
nucleotide deletion on mouse chromosome 10 that entirely removes Kitl and as many as
six flanking genes (COPELAND et al. 1990; RUNYAN et al. 2006; HEANEY et al. 2008).
SlJ Slgb Sld Other alleles of Kitl (Kitl , Kitl , Kitl ) entail smaller deletions (HEANEY et al. 2008).
KitlSl heterozygotes on the 129/Sv background develop TGCTs at more than double the
+ rate of normal Kitl 129/Sv males (14% vs. 6%, respectively (STEVENS 1967a)) and have
Sl reduced numbers of PGCs (BUEHR et al. 1993; BEDELL et al. 1995). Kitl homozygotes
are almost devoid of PGCs by E12.5 (BENNETT 1956) and show late embryonic lethality
because of severe anemia (SARVELLA and RUSSELL 1956), so the effect of two alleles of
Steel on TGCT prevalence cannot be measured in adult mice.
Teratoma (Ter) is a semi-dominant allele of Dnd1 that enhances the frequency of
129/Sv males with TGCTs. The Ter mutant arose spontaneously while Leroy Stevens
was backcrossing KitW from C57BL6/J onto the 129/Sv inbred background to evaluate its
effect on tumorigenicity (STEVENS 1973). Tumor prevalence is 17% and 94% in Ter
heterozygotes and homozygotes, respectively (NOGUCHI and NOGUCHI 1985). Dnd1 is
important for PGC survival: Dnd1Ter/Ter mice have approximately ten PGCs at E11.5 and
are infertile on all inbred backgrounds tested (BHATTACHARYA et al. 2007).
28
Dnd1 is the mouse orthologue of the zebrafish dead end (dnd) gene which functions in PGC survival and migration (WEIDINGER et al. 2003). Positional cloning of
Ter revealed a single CÆT transition in the Dnd1 ORF on mouse chromosome 18
(YOUNGREN et al. 2005). This point mutation introduces a premature stop codon at amino acids 178 and 190 in protein isoforms DND1-α and DND1-β respectively. DND1 is known to localize to the 3’ end of certain mRNA transcripts to prevent miRNA- mediated binding and repression (KEDDE et al. 2007). That fact suggests Dnd1 promotes
expression of genes that are key to normal germ cell development (KEDDE et al. 2007).
The ways in which Dnd1 blocks miRNA binding and exacerbates TGCT risk remain to be elucidated.
Interestingly, many known modifiers that increase TGCT prevalence also decrease PGC numbers, associating reduced PGC numbers with increased tumorigenesis.
However, PGC-deficient KitW mutants fail to develop TGCTs at greater rates than control
129/Sv males (STEVENS 1967a; STEVENS 1973), demonstrating that reduction of PGCs is
not sufficient for increased rates of tumorigenesis.
1.2.7 Mapping TGCT loci
The number of genes influencing TGCT susceptibility can be estimated based on
backcrosses and intercrosses of susceptible and resistant inbred strains. Backcrosses of
strain 129 mice to seven TGCT-resistant inbred strains produced only one affected mouse
in 11,291 unaffected mice (STEVENS and MACKENSEN 1961). If all susceptibility genes
are assumed to be recessive, equally penetrant, and additive, approximately 23 genes are
required for TGCTs.
29
The advent of genetic markers in the early 1990’s facilitated efforts to distinguish the strain derivation of alleles distributed over most of the mouse genome (DIETRICH et al. 1992). In turn, these markers enabled whole genome linkage studies designed to map susceptibility genes and cancer modifier genes. Whole genome linkage studies are based on a cross between a tumor-susceptible and tumor-resistant inbred strain, followed by intercrossing or backcrossing of F1s to promote segregation of strain-specific alleles influencing tumor susceptibility. Phenotyping and genotyping of F2s or N2s enable mapping of susceptibility loci and cancer modifier loci.
The first whole genome linkage study aimed at mapping TGCT genes was performed by Gayle Collin, who crossed 129T1/Sv-+Oca2 Tyrc-ch Dnd1Ter/+ (hereafter,
129T1/Sv) females to MOLF/EiJ (hereafter MOLF) males and then backcrossed F1
progeny to 129T1/Sv (COLLIN 1994). MOLF is a wild-derived inbred strain of Mus
musculus molossinus and was used as the outcross strain to take advantage of the large
number of polymorphic markers between 129/Sv and MOLF (MATIN et al. 1998).
MOLF also has better intercross reproductive performance than strains derived from Mus
spretus (SILVER 1995) and males of that strain are TGCT-resistant (MATIN et al. 1998).
Arranging the cross in this way facilitated mapping of dominant MOLF enhancers and
recessive 129/Sv susceptibility genes. The cross was sensitized with Dnd1Ter/+ in order to boost the number of affected N2s, thereby increasing the statistical power of the linkage
analysis. Collin found no significant linkages when all tumor-bearing N2s were
considered together, or when the unilateral cases were considered separately from the
bilateral cases (COLLIN 1994; COLLIN et al. 1996). However, the greatest ‘insignificant’
linkage was to an excess of 129-derived markers on chromosome 19. (COLLIN 1994).
30
When bilateral TGCTs were considered separately from unilateral TGCTs, a weak linkage was detected with an excess of MOLF-derived markers on chromosome 19.
These results suggested the presence of at least one TGCT-promoting factor on mouse chromosome 19 (COLLIN 1994). Unfortunately hundreds more (estimated n > 400)
affected N2s would be required to validate these weak linkages. For this reason, TGCT
susceptibility was considered too complex for conventional genetic approaches.
Chromosome substitution strains (CSSs) provide a powerful alternative resource
to segregating crosses for discovering genes involved in TGCT susceptibility.
Chromosome substitution strains, also known as consomic strains, are inbred strains in
which one entire chromosome has been replaced by its homologue from a different strain
of mouse. The steps to make a CSS are illustrated in Figure 1-2, using 129/Sv as the host
strain and MOLF/Ei as the donor strain. CSSs have several advantages that facilitate
studies of complex traits such as TGCTs. For example, to detect chromosomes with
quantitative trait loci (QTLs) affecting a trait, the phenotypes of the CSS and host strain
are compared. If the trait value of the CSS is significantly different from the trait value
of the host strain, then the chromosome must have at least one QTL influencing the trait.
Fine-mapping of QTLs is accomplished by making panels of congenic strains in which
the donor chromosome is partitioned into segments of various lengths on the inbred host
background. The steps to make a congenic strain from a CSS are illustrated in Figure 1-
3. Congenic strains have all the same advantages of CSSs and can be constructed in as
few as three generations, compared to the ten or more generations that are needed to
make traditional congenic strains from a two-strain cross. CSSs accelerate QTL
discovery by removing several time consuming steps inherent to linkage crosses. Unlike
31
N2s or F2s, mice from the same CSS are genetically identical, making genotyping unnecessary. Since genotyping is not required, large numbers of CSS mice can be quickly bred and screened. In addition, tests of dominance are easier in CSSs: Trait values can be measured in both homosomic (two copies of the donor chromosome) and heterosomic (one copy of the donor chromosome, resulting from a backcross of the CSS to its host strain) animals to infer dominance of factors involved in the trait. CSSs also have statistical advantages. Since the entire genome is not segregating in CSS mice, the background “noise” from QTLs on other chromosomes is diminished, and the proportion of the trait variance from QTLs on the donor chromosome is enriched. For that reason, at least 37% fewer animals are needed to detect QTLs in CSSs compared to an F2 intercross
(BELKNAP 2003).
32
Figure 1-2: Steps to make a CSS (NADEAU et al. 2000; SINGER et al. 2004). 129/Sv are mated to MOLF and the N1F1 progeny backcrossed to 129/Sv. N2 mice with non- recombinant MOLF chromosomes are backcrossed to 129/Sv. Selection and backcrossing are repeated until the N10 generation. To identify non-recombinant MOLFchromosomes, the mice are genotyped for at least four loci on each chromosome. As the backcrosses proceed, the genetic background becomes enriched in 129/Sv sequences. At the N10 generation, males and females with non-recombinant MOLF chromosomes are brother-sister mated to make the substituted MOLF chromosome homozygous on the 129/Sv background.
Continued on next page:
33
34
Figure 1-3: Steps to make a congenic strain from a CSS. Heterosomic CSS mice are mated to 129/Sv and progeny are typed at six equally-spaced markers on the substituted chromosome (shown as dashes in the second cross only). Recombinants with congenic segments are backcrossed to 129/Sv and progeny re-genotyped with the six markers to identify mice with the same congenic segments. Males and females with the same congenic segments are brother sister mated. Offspring homozygous for the congenic segments are identified using the same six markers. Finally, mice homozygous for the congenic segments are brother-sister mated to perpetuate the congenic strain.
35
A CSS takes several years and hundreds of mice to construct. Substitution of the donor chromosome is achieved by repeated backcrossing to the host strain with selection for the non-recombinant donor chromosome. After at least ten generations of backcross, mice carrying one copy of the substituted chromosome are brother-sister mated and progeny selected with two copies of the substituted chromosome. So-called ‘homosomic’ mice are then brother-sister mated to perpetuate the CSS. Slight modifications of this process are necessary to substitute the mitochondria and sex chromosomes. Using this technique, entire CSS panels (a set of twenty-two inbred strains in which every chromosome from one inbred strain has been substituted onto the genetic background of a second inbred strain) have been constructed in mice (SINGER et al. 2004) and rats
(MALEK et al. 2006).
Matin made the first mouse autosomal chromosome substitution strain to test whether MOLF chromosome 19 had TGCT QTLs (MATIN et al. 1999), as predicted by
Collin (COLLIN 1994). Chromosome 19 from the MOLF inbred strain was substituted
onto the 129/Sv inbred background and males of the new CSS, 129-Chr 19MOLF, were tested for TGCTs. 80% of the 129-Chr 19MOLF males developed at least one TGCT, but only 5% of the control 129/Sv males developed at least one TGCT (MATIN et al. 1999).
Furthermore, 56% of the 129-Chr19MOLF males developed bilateral disease as opposed to
0% of the 129/Sv control males. These results confirmed Collin’s (1994) linkage to a
QTL on chromosome 19 promoting TGCTs.
A panel of congenic strains was made to map the QTL(s) (YOUNGREN et al.
2003). Interestingly, the position of the MOLF-derived congenic segments on
chromosome 19 did not predict TGCT risk. Ordinarily, trait-promoting genes are located
36 at discrete sites on chromosomes. For that reason, congenic strains of different lengths tend to have similar trait values because they contain the same trait-promoting genes.
With two exceptions (both congenic segments in the sub-telomere), a direct correlation was observed between the length of the congenic segments and increased TGCT susceptibility. That unexpected discovery could be explained by approximately five equally-penetrant enhancers on MOLF chromosome 19 or an epigenetic modification affecting expression of genes on the centromeric and middle regions of chromosome 19.
Misregulation of large numbers of genes could explain the existence of so many apparent modifiers. Similar “length effects” have not been previously described, and future experiments with 129-Chr 19MOLF and other 129.MOLF CSS-derived congenic strains may provide interesting new insights into the epigenetic changes associated with chromosome substitution.
Following the study of Collin (1994), a second whole genome linkage study was performed by Muller and colleagues using C57BL/6 instead of MOLF as the outcross
+/- Ter/+ strain and the Jacks Trp53 mutant instead of Dnd1 as the sensitizer (MULLER et al.
2000). When bilateral and unilateral TGCTs were considered together, one significant linkage was reported in a region of 129-derived markers on chromosome 13. That region was not significant in the cross by Collin (COLLIN 1994). Muller and colleagues failed to
find any significant linkages to chromosome 19. These contrasting results could be
explained by the use of different sensitizers: Trp53+/- acts additively with Dnd1Ter/+ in
interaction tests, suggesting at least two parallel pathways contribute to TGCT
susceptibility (LAM et al. 2007). The results could also be explained by the use of
different outcross strains, or too few affected N2 males.
37
1.3 RESEARCH AIMS
Although TGCTs have been studied in strain 129 mice for at least 55 years, no susceptibility genes have been discovered. Our understanding of the genetic control of
TGCT formation and progression is therefore poor, and many susceptibility genes and modifier genes remain undiscovered. Identifying these genes would improve our understanding of the etiology of TGCTs in mice and may provide insight into the genetic control of TGCTs in humans.
Matin demonstrated that QTLs controlling highly complex traits like TGCTs can be localized to individual chromosomes using CSSs (MATIN et al. 1999). I therefore
constructed a partial CSS panel in which selected MOLF donor chromosomes were substituted onto the 129/Sv host background. In Chapter 2, I describe how these CSSs were built and surveyed for QTLs affecting TGCTs. Although ten CSSs were constructed, only two (129-Chr 2MOLF and 129-Chr 18MOLF) had dominant QTLs affecting
TGCTs. I therefore prioritized development of these two CSSs and made congenic
strains from one of them (129-Chr 18MOLF) to map the QTLs involved in TGCTs. I
describe how the congenic strains were made and surveyed in Chapter 3.
In Chapter 4, I evaluated the role of the Y chromosome on TGCT susceptibility. I tested two hypotheses: first, whether the 129/Sv Y chromosome is necessary or sufficient
for TGCTs, and second, whether any Y chromosome is necessary for TGCTs. I
determined that although the 129 Y chromosome is not required for TGCTs, at least one
Y chromosome factor is required for TGCTs.
Chapter 5 contains my closing thoughts and ideas for future experiments.
38
2 CHAPTER 2: TGCT survey in a reciprocal B6.129 CSS panel and a partial
129-ChrMOLF CSS panel
39
2.1 ABSTRACT
Despite a strong heritable component, little is known about the genetic control of susceptibility to testicular germ cell tumors (TGCTs) in humans or mice. Although the mouse model of TGCT teratocarcinogenesis has been studied intensely for at least 55 years, TGCT genes remain elusive, a fact in part attributable to the genetic complexity of the disease. Evidence for five QTLs containing TGCT enhancers on chromosome 19 was found using the 129-Chr 19MOLF chromosome substitution strain (CSS), demonstrating
the power of CSSs to map TGCT loci to individual chromosomes. In this Chapter, I
tested whether ten new incipient 129-ChrMOLF CSSs had dominant QTLs affecting TGCT
prevalence at 3 – 5 weeks of age. I surveyed backcross males for TGCTs from the 129-
ChrB6, B6-Chr129 and 129-ChrMOLF panels. The results of this survey indicate the
presence of dominant TGCT QTLs on one B6-derived and two MOLF-derived chromosomes.
2.2 INTRODUCTION
Testicular germ cell tumors (TGCTs) are the most common solid tumors in men aged 20 – 35 years (DIXON and MOORE 1952; BISHOP 1998). Family history is a
significant risk factor, as the risk of developing TGCTs is 8-10 times higher among brothers and four times higher among sons of affected individuals (FORMAN et al. 1992;
LINDELÖF and EKLUND 2001). Unfortunately, traditional linkage studies to identify
genes that control susceptibility have been difficult to perform for at least three reasons: a
shortage of multigenerational pedigrees with sufficient numbers of affected individuals,
the sterility that often results from treatment, and the genetic complexity of the disease.
40
As a result, the genetic factors that contribute to the disease are still poorly understood, and only one low-penetrance susceptibility locus has been identified.
The teratomas and teratocarcinomas of strain 129 mice are an established model of the teratomas and teratocarcinomas of human infants. 129 males spontaneously develop TGCTs at a rate of 1 – 8%, depending on the substrain (STEVENS and HUMMEL
1957). TGCTs in mice are composed of a number of adult and embryonic tissue types,
implying a stem cell origin of the tumors. Indeed, TGCTs fail to form from grafts
derived from mice lacking germ cells, showing that primordial germ cells (PGCs) are the
cells of origin for TGCTs (STEVENS 1967b). Grafts from E10.5 to E12.5 genital ridges
were sufficient to induce TGCTs when introduced into adult testes, whereas ridges from
later developmental timepoints were not sufficient to induce TGCTs, demonstrating that the “critical period” of TGCT formation is between this two day period (STEVENS 1964).
As in humans, control of TGCT formation in mice is complex: segregating crosses
between 129/Sv and other strains yielded one affected mouse in 11,291 mice surveyed,
strongly suggesting multigenic control (STEVENS and MACKENSEN 1961).
A whole genome linkage study was performed to map QTLs containing TGCT
genes (COLLIN 1994; COLLIN et al. 1996). Although the strongest association was to chromosome 19, the study failed to discover statistically significant linkages on any
chromosome (COLLIN 1994). Because traditional genetic approaches lack the power to
locate TGCT QTLs, our lab made the first mouse autosomal chromosome substitution
strain (CSS) to test for TGCT genes on chromosome 19 (MATIN et al. 1999). A CSS is
an inbred strain with an entire chromosome replaced by its homologue from a different
strain of mouse, and is made by repeated backcrossing with selection for the chromosome
41 being substituted. After ten generations of backcross, the CSS is brother-sister mated to make the substituted chromosome homozygous. CSSs that have been backcrossed less than ten generations are called ‘incipient CSSs.’ Several logistical and statistical advantages make CSSs preferable to linkage crosses for finding susceptibility genes for complex diseases such as TGCTs: genotyping is unnecessary because CSS mice are genetically identical, strain background effects are uniform and fixed, CSS mice are quick and easy to breed relative to N2s or F2s used in linkage, there are no dominance effects, and up to 10 times fewer animals are required to achieve significant results
(NADEAU et al. 2000; BELKNAP 2003).
129-Chr 19MOLF was made by substituting chromosome 19 from MOLF/Ei
(MOLF) onto the 129S1/SvImJ (129/Sv) host inbred background. MOLF is a wild-
derived inbred strain of the Japanese species Mus molossinus. Mus molossinus is
genetically distant from Mus domesticus and Mus musculus, the principal ancestral
species of laboratory inbred strains like 129/Sv (YANG et al. 2007). As a result,
MOLF/Ei carries DNA sequence variants that can manifest as modifier alleles on other
inbred backgrounds, making it a good candidate for donor chromosomes in CSS studies
MOLF (MATIN et al. 1998). 82% of 129-Chr 19 males developed at least one TGCT
(MATIN et al. 1999). These results indicate the presence of at least one QTL that
promotes TGCTs on chromosome 19.
Despite the absence of TGCTs in MOLF, at least one factor from MOLF
chromosome 19 enhances TGCTs on the 129/Sv background. That fact, together with
weak linkages to several other MOLF chromosomes (COLLIN 1994), suggest that TGCT
modifiers exist on other MOLF chromosomes. To test for novel TGCT modifiers, I
42 constructed and surveyed ten new incipient 129.MOLF CSSs. The ten MOLF/Ei chromosomes substituted were 2, 3, 7, 11, 13, 16, 18, X, Y and the mitochondrial chromosome. Two of the chromosomes, 13 and X, were selected because QTLs influencing TGCT susceptibility on those chromosomes had been documented previously in mice (MULLER et al. 2000) or humans (RAPLEY et al. 2000), respectively.
Chromosome 7 was selected based on evidence for a recessive 129/Sv-derived TGCT
factor (COLLIN 1994; COLLIN et al. 1996). In the absence of direct evidence for genes
affecting TGCTs, the other chromosomes were selected for diversity in chromosome size
and gene content.
In addition to surveying ten 129-ChrMOLF CSSs, I surveyed nineteen B6-Chr129 and twenty-one 129-ChrB6 CSSs that were being constructed as part of another project in
the Nadeau Laboratory. Although I surveyed males from a total of fifty CSSs for
TCGTs, I found only one CSS (129-Chr 6B6) with dominant TGCT-enhancing QTLs, and
two CSSs (129-Chr 2MOLF and 129-Chr 18MOLF) with dominant TGCT-suppressing QTLs.
2.3 MATERIALS AND METHODS
2.3.1 Backcrosses
MOLF/Ei and 129S1/SvImJ mice were purchased from the Jackson Laboratory
(Stock numbers 000550 and 002448, respectively; Bar Harbor, Maine). MOLF/Ei mice
were maintained on LabDiets 7960 rodent chow (PMI Nutrition International; Saint
Louis, Missouri) and 129/Sv mice were maintained on 5010 rodent chow (PMI Nutrition
International; Saint Louis, Missouri). MOLF/Ei were mated to 129/Sv and the progeny
were backcrossed to 129/Sv. N2 mice were genotyped and mice with non-recombinant
chromosomes of interest were backcrossed to 129/Sv. This step was repeated until at
43 least the N10 generation. Non-recombinant N10+ mice were brother-sister mated to make the substituted chromosome homozygous. This research was approved by the
CWRU Institutional Animal Care and Use Committee.
2.3.2 Genotyping
Mice were genotyped with either the SNaPshot single base extension (SBE) protocol (Applied Biosystems; Foster City, California) or microsatellite markers. For
SBE, SNaPshot was performed as described by the manufacturer’s protocol with the following exceptions. 1 unit of shrimp alkaline phosphatase (USB Corporation;
Cleveland, Ohio) and 0.2 units of Exonuclease I (USB Corporation; Cleveland, Ohio) each were added to 15 ul of PCR product to remove unused dNTPs and PCR primers.
The custom SBE oligonucleotide, which anneals immediately upstream of the SNP, was used at a working concentration of 0.2 uM to 1.0 uM, depending on the efficiency of each primer. Reactions were multiplexed at least four and at most six times. After primer extension, the reactions were subjected to capillary electrophoresis on ABI DNA
Analyzers (Applied Biosystems; Foster City, California) in the CWRU Genomics Core.
The identities of the SNPs and the primers used for genotyping are listed in Appendix I.
For SNP genotyping, at least four and at most six SNPs were typed per chromosome.
Two SNPs were as close to the ends of each chromosome as possible, and two to four
SNPs were evenly spaced in between. There were no gaps >23 cM.
For microsatellite marker genotyping, polymorphic MIT markers were identified
(http://www.cidr.jhmi.edu/mouse/mult_inf.html) and PCR products were resolved in agarose or polyacrylamide gels. Genotypes were inferred by length polymorphism.
Appendix II contains the list of microsatellite markers used for genotyping each
44 chromosome. For microsatellite marker genotyping, four MIT markers were typed per chromosome. Two markers were as close to the ends of each chromosome as possible, and two were evenly spaced in between. There were no gaps >34 cM.
2.3.3 SNP selection and primer design
Polymorphic SNPs for 129/Sv and MOLF were selected from the preliminary release of the Inbred Laboratory Mouse Haplotype Map
(http://www.broad.mit.edu/personal/claire/MouseHapMap/Inbred.htm) and the
Wellcome-CTC Mouse Strain SNP Genotype Set
(http://www.well.ox.ac.uk/mouse/INBREDS/). Genetic map positions of the SNPs were inferred by MIT microsatellite markers surrounding the SNPs. PCR primers were selected and the NCBI BLAST program was used to ensure the PCR primers were specific to the target sequence.
2.3.4 TGCT survey
3-5 week old males (a minority were >5 weeks) were euthanized by CO2 inhalation or cervical dislocation. Incisions were made in the abdomen to expose the testes. TGCTs are identifiable by macroscopic inspection (STEVENS and LITTLE 1954),
by abnormalities in size, color, shape or texture, or a combination of one of more of these
traits. Mice with TGCTs were scored as positive for unilateral or bilateral TGCTs. CSS
TGCT prevalences were analyzed using the chi-square goodness-of-fit test and compared
to the control 129/Sv TGCT prevalence. The significance threshold for all calculations
was set at p < 0.05. The p values reported are after Bonferroni correction for multiple
testing. Female mice lack testes and TGCTs and were not included in these analyses.
45
2.4 RESULTS
2.4.1 TGCT occurrence in 129-ChrMOLF backcross mice
In total, I examined 140 control 129/Sv males and 1,920 post-N2 129-ChrMOLF backcross males for TGCTs. The males were examined at 3 – 5 weeks of age, which is the developmental timepoint used in prior TGCT surveys (STEVENS and LITTLE 1954;
STEVENS and HUMMEL 1957). In Table 2-1, I show the backcross generations sampled
for each CSS, the total number of backcross males screened, the number and percent
affected with unilateral and bilateral TGCTs, and the number and percent of TGCTs
attributable to a segregating modifier (explained in detail below). The percent of affected
control 129/Sv males, 5%, agrees closely with recently published estimates for that strain
(YOUNGREN et al. 2003; LAM et al. 2004; LAM et al. 2007). All backcross progeny in
Table 2-1 were either heterozygous for the substituted chromosome, recombinant for the
substituted chromosome, or non-recombinant for the 129/Sv chromosome. A
disproportionate number of males were screened for the 129-Chr 7MOLF, 129-Chr YMOLF,
and 129-Chr MitoMOLF CSSs either because more cages of those strains were kept or
because they had superior breeding performance. In contrast, 129-Chr 3MOLF, 129-Chr
XMOLF and 129-Chr 13MOLF were remarkably poor breeders and comparatively few males
from these CSSs were surveyed. The poor breeding performance in these CSSs may be
due to MOLF-derived factors on the donor chromosomes that affect fertility.
2.4.2 Evidence for MOLF modifiers in 129-Chr 2MOLF and 129-Chr 18MOLF
The donor chromosomes may have MOLF modifiers affecting TGCT prevalences. To predict which donor chromosomes have factors influencing TGCT prevalence, I tested what affect a dominant MOLF modifier on each donor chromosome
46 would have on TGCT occurrence in the backcross CSSs. Analysis of genotyping data showed that the backcross mice consisted mostly of males that were recombinant with respect to their donor chromosomes. If segregation were normal, each recombinant mouse had a 50% chance of having the MOLF modifier, and each non-recombinant mouse had a 0% or 100% chance of having the modifier, depending on whether the mouse was non-recombinant with respect to the MOLF/Ei chromosome or the 129/Sv chromosome. Both types of non-recombinants have an equal chance of being produced.
Because one type of non-recombinant always has the dominant modifier and the other always lacks it, their effects on the TGCT prevalence statistically cancel one another out.
Finally, both types of non-recombinant are uncommon (approximately 20% of backcross mice, each) relative to the recombinants (approximately 60% of backcross mice)
(NADEAU et al. 2000). For these reasons, estimates of modifier effects take into consideration only the recombinants.
Recombinants that lack the putative MOLF modifier are expected to have TGCTs at the control 129/Sv rate (5%). However, recombinants that have the dominant MOLF modifier are affected with TGCTs at varying rates, depending on the strength and nature of the modifier. For each CSS, I applied the following model, in which the observed frequency of affected males is described as a composite of two different frequencies; the frequency of affected males with the MOLF modifier, and the frequency of affected males without the MOLF modifier. In the equation, m represents the fraction of mice that inherit the MOLF allele. Instead of assuming normal segregation (m = 0.5), we calculated the values of mA by averaging the proportion of mice inheriting the MOLF
47 allele for all microsatellite markers on donor chromosome A. When the MOLF allele was inherited preferentially, m was greater than 0.5:
% % 1 %
Because I know the values of two of the three terms (the total percent affected and the
percent affected without a modifier), I was able to solve for the third term (the percent of
affected males with the MOLF modifier) for each CSS. The percent affected without a
modifier is the baseline 129/Sv TGCT prevalence, which is 5% (Table 2-1).
The observed percent affected in most of the incipient CSSs is reduced relative to
the 129 control, causing the model above to predict that the MOLF modifier is a
suppressor. In cases where the observed percent affected is greater than the control
129/Sv percent affected, the model predicts the modifier is an enhancer. Similarly in
cases where the observed percent affected is less than the control 129/Sv percent affected,
the model predicts the modifier is a suppressor.
For each incipient CSS, I tested whether the frequency of affected males with the
modifier was significantly different from the control 129/Sv rate. The chi-square test
values and corresponding p values, corrected for ten instances of multiple testing, appear
in Table 2-1.
48
Table 2-1: TGCT data from backcross 129-ChrMOLF males. Here I compare TGCT prevalence in control 129/Sv males to TGCT prevalence in ten incipient CSSs. Comparatively few mice from the MOLF-13, MOLF-3 and MOLF–X) CSSs were screened because of breeding difficulties in those lines. # affected and % affected gives the total number and percent of males affected by at least one TGCT; males with bilateral TGCT were counted as one affected mouse. I calculated what effect at least one dominant modifier on each donor chromosome would have on TGCT prevalence (see text). The number and percent of TGCTs attributable to a dominant modifier is given. I tested whether the number of TGCTs attributable to a modifier was significantly different from 129/Sv control using the chi-square goodness- of-fit test. The significance threshold was set at p < 0.05 after correction for ten multiple tests. Bolded p values indicate significant deviations from the control.
49
The frequency of affected males with the MOLF modifier was significantly reduced only in two CSSs, 129-Chr 2MOLF and 129-Chr 18MOLF. These results suggest MOLF-2 and
MOLF-18 each contain at least one dominant TGCT suppressor.
The patterns of inheritance for the Y chromosome and the mitochondrial
chromosome are different from other chromosomes, and predictions of modifier effects
like the one above must take those facts into consideration. The mitochondrial
chromosome is inherited only from the female parent and does not undergo
recombination. In contrast, the Y chromosome is inherited only from the male parent,
and recombines with the X chromosome only in a small region (the pseudoautosomal region). Since the pseudoautosomal region is small and contains few genes, the amount of recombination on the Y is negligible. Therefore, I treated all males surveyed from
129-Chr YMOLF and 129-Chr MitoMOLF as non-recombinant for the donor chromosome.
Since every male surveyed from those two CSSs had a non-recombinant donor
chromosome, every male showed the effects of the MOLF modifiers on those
chromosomes, if the modifiers existed. The above model is a correction for
recombination and therefore not applicable to these two CSSs. Because every 129-Chr
YMOLF and 129-Chr MitoMOLF male surveyed had the putative MOLF modifier, the
percent of TGCTs attributable to a MOLF modifier is equal to the observed percent of
males affected. These two CSSs were still subject to the multiple testing correction applied to the CSSs whose frequencies of affected males were adjusted by the model.
Neither 129-Chr YMOLF nor 129-Chr MitoMOLF developed TGCTs at a greater or lesser
rate than control 129/Sv males, showing that neither MOLF-Y nor MOLF-Mito have
factors affecting TGCTs (Table 2-1).
50
The model above allowed me to test which CSSs had genetic factors affecting
TGCTs. Once identified, I prioritized development of those CSSs. Heterosomic N13
129-Chr 18MOLF mice were brother-sister mated. Two non-recombinant homosomics were identified, and were mated to produce homosomic progeny. Homosomic progeny were obtained and used to establish a large breeding colony. Similarly, heterosomic
N10 129-Chr 2MOLF mice were brother-sister mated. Two non-recombinant homosomics were identified, and mated to produce homosomic progeny. Unfortunately, all three litters of 129-Chr 2MOLF produced to date were found dead in the cage with evidence of
cannibalism, and no homosomic progeny have survived to weaning age. I recently
separated the parents after mating to improve the chances of neonate survival. Because
the model showed no evidence for dominant modifiers, I eliminated all other CSS lines.
2.4.3 TGCT occurrence in 129-ChrB6 and B6-Chr129 backcross mice
I surveyed 392 males from twenty-one incipient 129-ChrB6 CSSs (Table 2-2). All
affected males had unilateral TGCTs except for one 129-Chr 6B6 male that was affected
with bilateral TGCT. I applied the model described above to test which donor B6
chromosomes had dominant modifiers affecting TGCT prevalence. I then tested whether
the frequency of affected males with the modifier was significantly different from the
control 129/Sv rate. The chi-square test values and corresponding p values, corrected for
multiple tests, appear in Table 2-2. The frequency of affected males with the modifier
was significantly elevated in only two CSSs, 129-Chr 5B6 and 129-Chr 6B6. There were
no CSSs with significant reductions in TGCT prevalence. These data are consistent with
the presence of at least one TGCT enhancer on both B6-5 and B6-6.
51
I also surveyed 449 males from twenty incipient B6-Chr129 CSSs (Appendix IV).
Although no B6 control males were surveyed as a dedicated part of this experiment, B6 mice have been used for decades in research and there are no published examples of
TGCTs occurring in that inbred strain. Although TGCTs were common in the 129-
ChrMOLF and 129-ChrB6 CSSs, no TGCTs were observed in the B6-Chr129 CSSs. No statistics were performed because the expected TGCT prevalence in the CSSs was 0%, and the observed TGCT prevalences in the CSSs were 0%.
2.4.4 The model accurately predicted a modifier(s) on MOLF-18
Because the analysis of backcross mice predicted a dominant modifier on chromosome 18, I made MOLF-18 homosomic and surveyed males for TGCTs.
Strikingly, none of the 279 males that were screened for TGCTs were affected (Table 2-
3). To test whether the above model accurately predicted a dominant modifier on
MOLF-18, I used the chi-square goodness-of-fit test to compare the TGCT prevalence in the 129-Chr 18MOLF homosomics and segregating backcross mice to the control 129/Sv
TGCT prevalence (Table 2-3). The TGCT prevalences in both test groups were significantly different from control (p = 0.001 and p = 0.009, respectively) (Table 2-3), indicating that the model accurately predicted a least one TGCT QTL on MOLF-18.
TGCT prevalence in 129-Chr 18MOLF is discussed in more detail in Chapter 3.
2.4.5 High bilateral TGCT prevalence in 129-Chr XMOLF
In 129/Sv, bilateral TGCTs are rare relative to unilateral TGCT, occurring at a
MOLF rate of (0.25%) (STEVENS and LITTLE 1954). However, two 129-Chr X males developed bilateral TGCTs (1.6%). I used the chi-square goodness-of-fit test to determine whether 129-Chr XMOLF males produced bilateral TGCT at a significantly
52 greater rate than 129/Sv. I applied a Yates correction to the chi-square test because the expected number of affected males in the chi-square test was less than five. I found that
129-Chr XMOLF males develop bilateral TGCTs at a greater rate than 129/Sv males (p =
0.035).
53
Table 2-2: TGCT data from backcross 129-ChrB6 males. Here I compare TGCT prevalence in control 129/Sv males to TGCT prevalence in twenty-one incipient CSSs. I calculated what effect a putative dominant modifier on each donor chromosome would have on TGCT prevalence (see text). The number and percent of TGCTs attributable to a dominant modifier is given. I tested whether the number of TGCTs attributable to a putative modifier were significantly different from 129/Sv controls using the chi-square goodness of fit test. The significance threshold was set at p < 0.05 after correction for twenty-one tests. Highlighted p values indicate significant deviations from the control.
54
Table 2-3: The model accurately predicted a MOLF modifier on MOLF-18. Here I compare the TGCT prevalences from homosomic males and segregating backcross males to control 129/Sv. As predicted, homosomic males were affected with TGCTs at a significantly reduced rate relative to control. The p values given are corrected for ten instances of multiple testing. Bolded p values highlighted in pink are significantly different from control.
55
2.5 DISCUSSION
TGCTs are the most common cancer in young men, accounting for 1% of all male cancers (KRAIN 1973; LINDELÖF and EKLUND 2001; JEMAL et al. 2006). The 129/Sv
inbred strain provides a convenient and established system in which to investigate the
genetic components of TGCT susceptibility (STEVENS and LITTLE 1954). A prior study
showed that loci involved in TGCT susceptibility could be mapped using the 129-Chr
19MOLF CSS. I therefore constructed and screened a partial panel of 129-ChrMOLF CSSs to test whether other MOLF chromosomes had genes affecting TGCT prevalence. I also screened 129-ChrB6 and B6-Chr129 CSSs for TGCTs. I found three incipient CSSs with
QTLs affecting TGCT prevalence: 129-Chr 2MOLF, 129-Chr 18MOLF, and 129-Chr 6B6.
Most of the data gathered from autosomal CSSs were from recombinants with
respect to the chromosomes being substituted. To account for genetic recombination in
those chromosomes, I developed a model to test for evidence of a dominant modifier in
each CSS. Because of special inheritance of the mitochondrial and Y chromosomes, all
males surveyed from those CSSs were non-recombinants, and therefore the model
described above is not applicable to those CSSs. Because making CSSs is a costly,
lengthy and labor-intensive process, the results from these tests were used to help inform
which donor chromosomes probably have QTLs affecting TGCTs. I then prioritized
development of CSSs with evidence for TGCT genes.
In backcross mice, there is one copy of the donor chromosome per cell; only after
homozygosis are there two copies of the donor chromosome per cell. Therefore, a survey
of backcross mice is limited to discovering only dominant effects of chromosome
substitution. Recessive effects of chromosome substitution cannot be detected until after
56 homozygosis. However, previous studies of 129-Chr 19MOLF show that homosomics can
have a more extreme phenotype than heterosomics: 129-Chr 19MOLF heterosomics are
affected with TGCTs at a rate of 24%, compared to 82% among 129-Chr 19MOLF
MOLF homosomics (MATIN et al. 1999). Although 129-Chr 19 is just a single case, it may
be that dominant effects of substitution that I observe in the heterosomic CSSs will be
magnified in the homosomic CSSs.
While I was constructing a partial panel of 129.MOLF CSSs, Annie Baskin,
another member of the Nadeau Laboratory, was constructing panels of 129-ChrB6 and
B6-Chr129 CSSs. The 129-ChrB6 and B6-Chr129 panels can also be used to test for
modifiers of TGCT susceptibility, because B6 (like MOLF) is resistant to TGCTs. I
therefore surveyed male 129-ChrB6 and B6-Chr129 backcross mice for TGCTs (Table 2-2
and Appendiv IV, respectively). Unlike the 129-ChrMOLF CSSs (Table 2-1), large
numbers of males were not surveyed in the 129-ChrB6 or B6-Chr129 panels. Despite the
small number of males surveyed, I found statistical evidence for at least one TGCT-
promoting modifier on both 129-Chr 5B6 and 129-Chr 6B6. Interestingly, a known TGCT
modifier gene, Apobec1, maps to chromosome 6 (Table 1-1). There are no known
nonsynonymous coding differences in the Apobec1 ORF between 129/Sv and B6 (Mouse
Genome Informatics SNP Query)1. However, the modifier could entail a gene regulatory
site, affecting the quantitative, temporal or spatial expression of Apobec1. Future
experiments to understand the increased prevalence of TGCTs in B6-Chr6129 should test
whether B6-derived Apobec1 enhances TGCTs.
1 http://www.informatics.jax.org/javawi2/servlet/WIFetch?page=snpQF
57
129-Chr 13MOLF and 129-Chr XMOLF exhibited the worst reproductive
performance of the ten CSSs. In the case of 129-Chr 13MOLF, the problem stemmed from
infrequent and small litters (1 or 2 pups), which explains why only four backcross males
were examined for TGCTs (Appendix III). The poor breeding performance in 129-Chr
13MOLF may be due to gain of MOLF modifiers on chromosome 13 affecting fertility.
However, this phenomenon does not seem limited to substitution of MOLF chromosome
13. Annie Baskin, another member of the Nadeau Laboratory who constructs CSSs, also
reported poor reproductive performance in 129-Chr 13B6 mice (A.B., pers. comm.).
These observations suggest that loss of fertility or compatibility factors on 129/Sv-13
contributed to the poor reproductive performance of this CSS. Efforts to improve breeding performance (e.g. alternating males between cages, removing the dam before
birth) failed, and the line was lost.
129-Chr XMOLF backcross males developed bilateral TGCTs at more than six
times the rate of 129/Sv male controls (2 cases in 125 backcross males). It has been
suggested that genetic control of bilateral TGCT may be distinct from unilateral TGCT
(COLLIN et al. 1996; LAM et al. 2007). No genes or factors controlling bilateral TGCTs have been reported in mice, and this CSS may have been useful for elucidating the genetic control of bilateral TGCTs. Unfortunately, sterility was observed in 129-Chr
XMOLF males beginning with the N3 generation. This phenomenon, known as hybrid breakdown, differs from hybrid sterility in that N1F1 males are viable and fully fertile, with gradual loss of fecundity coming with further inbreeding (ORR 1993; OKA et al.
2004). Hybrid sterility is a dominant trait that is hypothesized to result from interallelic incompatibility between one or more loci. In contrast, hybrid breakdown is thought to
58 result when alleles of interacting loci become homozygous is an improper way. Factors on the X chromosome seem integral to both forms of sterility: Guénet et al mapped a gene causing sterility in a Mus spretus x C57BL/6 cross to the 68 - 72 cM interval on chromosome X (GUÉNET et al. 1990), and Storchavá et al mapped a gene causing sterility
PWD/Ph in a B6-Chr X CSS to the 27 cM interval (STORCHOVÁ et al. 2004). In addition,
substitution of the X chromosome from MSM/Ms (another wild-derived inbred strain from Mus molossinus) onto the C57BL/6 host background caused hybrid breakdown starting at the N3 backcross generation (OKA et al. 2004), the same generation in which I
observed hybrid breakdown in the 129-Chr XMOLF CSS.
In part, these experiments are a test of the uniqueness of 129-Chr 19MOLF, the only
129.MOLF CSS available before I started my experiments. 129-Chr 19MOLF is noteworthy because males are affected by TGCTs at a high rate (24% in the case of heterosomics) (MATIN et al. 1999), and because there may be an incompatibility between
129 and MOLF chromosomes that could cause any MOLF chromosome to elevate TGCT
prevalence on the 129 background (YOUNGREN et al. 2003). In this Chapter I showed the
TGCT prevalences from ten new 129.MOLF CSSs. Using a model to account for genetic
recombination in the backcrosses, I calculated what percent of males would be affected
assuming the presence of a dominant modifier on each donor chromosome (Table 2-1, %
modifier). Although 129-Chr 2MOLF and 129-Chr 18MOLF both showed significantly
reduced TGCT prevalences in the presence of the putative modifier, there were no CSSs
with significantly increased TGCT prevalence. These data are inconsistent with a
hypothesis predicting a global incompatibility between 129 and MOLF chromosomes,
59 and suggests 129-Chr 19MOLF has unique genetic variants that increase TGCT prevalence.
The question of the uniqueness of 129-Chr 19MOLF will be revisited in Chapter 3.
I used the model (shown above) to estimate what effect a dominant modifier on each donor chromosome would have on TGCT prevalence. I also tested whether the predicted TGCT prevalences were statistically different from the control 129/Sv prevalence (Table 2-1). There were no statistically significant increases relative to the control. However there were statistically significant reductions in two CSSs, 129-Chr
2MOLF and 129-Chr 18MOLF. In both CSSs, the model predicted the modifier would
reduce the TGCT prevalence to 0%. I therefore prioritized development of these two
CSSs. Unfortunately, 129-Chr 2MOLF has proven difficult to make homozygous, and no
homosomic males have been surveyed. Nonetheless, the model predicts at least one
dominant suppressor on MOLF-2.
Fortunately, I was able to make MOLF-18 homozygous. Astonishingly, the
TGCT prevalence in homosomic 129-Chr 18MOLF was 0% (Table 2-3), which is a statistically significant reduction from 129/Sv controls (p = 0.001). Although 129-Chr
18MOLF is only a single case, these results validate the predictive power of the model.
129-Chr 18MOLF offers the opportunity to discover new factors involved in the development of TGCTs. To narrow the region of chromosome 18 containing factors
suppressing TGCTs, I made and surveyed a panel of eight congenic strains derived from
129-Chr 18MOLF. These congenic strains are the focus of Chapter 3.
60
3 CHAPTER 3: Three TGCT QTLs mapped to chromosome 18
61
3.1 ABSTRACT
Despite a strong genetic component, little is known about the genetic control of susceptibility to testicular germ cell tumors (TGCTs) in mice. Linkage studies in mice have failed to uncover any statistically significant susceptibility loci, a fact largely attributable to the genetic complexity of the disease. TGCT loci have been successfully mapped using an alternative strategy: chromosome substitution strains (CSSs) and the congenic strains derived from them. In the previous Chapter, I described the construction of a new CSS, 129-Chr 18MOLF. Remarkably, TGCTs were not observed in adult males
of this CSS, which can be explained by the introduction of MOLF suppressors or loss of
129 susceptibility genes. Identification of these genetic variants could improve our
understanding of the genetic susceptibility to TGCTs in mice and perhaps also in humans.
To map these TGCT QTLs, I constructed and surveyed a panel of eight 129-Chr 18MOLF - derived congenic strains. The TGCT prevalence was significantly reduced in adults of three of the congenic strains, whereas TGCTs were not observed in adults of four other congenic strains. Analysis of these congenic strains suggests presence of at least three
TGCT QTLs on chromosome 18.
3.2 INTRODUCTION
Testicular cancer is the most common malignancy affecting young men aged 15 -
34, accounting for over 1% of all male cancers (KRAIN 1973; JEMAL et al., 2006). Over
90% of testicular cancers are testicular germ cell tumors (TGCTs) (TALERMAN 1985) and
are derived from germ cells, the embryonic precursors of gametes. Unfortunately, TGCT
rates have been rising worldwide in the past several decades, making it important to
understand the etiology and pathogenesis of TGCTs. Family history is a significant risk
62 factor, as the likelihood of developing TGCTs is 8-10 times higher among brothers and 4 times higher among sons of affected individuals (FORMAN et al. 1992a; LINDELÖF and
EKLUND 2001). Family history suggests a strong genetic component to susceptibility.
Indeed, the genetic component of TGCT risk is estimated to be among the highest of all
cancers (LINDELÖF and EKLUND 2001)
Despite a strong genetic component, linkage studies in humans have failed to find
any statistically significant reproducible linkages. The only known susceptibility allele, gr/gr, was found not by linkage but through a candidate gene approach (NATHANSON et
al. 2005). Linkage studies have been frustrated by a shortage of multigenerational
pedigrees, the sterility that can result from treatment, and the genetic complexity of the
disease, making a mouse model relevant to mapping genes involved in TGCT
susceptibility.
Strain 129 mice spontaneously develop TGCTs at a rate of 1 – 8%, depending on the substrain (STEVENS and LITTLE 1954; STEVENS and HUMMEL 1957). These TGCTs
are an established model of testicular teratomas and teratocarcinomas seen in human
infants (STEVENS and HUMMEL 1957; YOUNGREN et al. 2003). TGCTs in infants and
mice both arise from primordial germ cells (PGCs) and are thought to lack both
intratubular germ cell neoplasia (carcinoma in situ) and characteristic karyotypic abnormalities (e.g. iso12p) found in adult human TGCTs. Teratomas arise embryonically and are macroscopically detectable in adults between 3 -5 weeks of age.
As in humans, genetic control of TGCT tumorigenesis in mice is complex, and linkage studies have met with only modest success. The first sensitized linkage study failed to uncover any statistically significant associations, although the best of the weak
63 linkages was to distal chromosome 19 (COLLIN 1994). A separate sensitized cross
implicated a ~23 cM region on chromosome 13 in TGCT susceptibility (MULLER et al.
2000). Unfortunately, this chromosome segment contains 409 RefSeq genes (UCSF
Table Browser2), almost half of all the genes on the chromosome (Ensembl Chromosome
Summary3), and as far as I know, no TGCT genes have been identified in that interval.
Chromosome substitution strains (CSSs) are a powerful alternative resource to
segregating crosses for discovering genes involved in TGCT susceptibility. CSSs, also
known as consomic strains, are inbred strains in which an entire chromosome is replaced
by its homologue from a different strain of mouse. Several logistical and statistical
advantages make CSSs preferable to linkage crosses for finding susceptibility genes for
complex diseases like TGCTs. For example, genotyping is unnecessary because CSS
mice are identical, strain background effects are reduced and fixed, CSS mice are quick
and easy to breed relative to N2s or F2s used in linkage studies, tests of dominance are
simplified, and up to 10 times fewer animals are required to achieve significant results
(NADEAU et al. 2000; BELKNAP 2003). Fine-mapping of trait QTLs is accomplished by
making panels of congenic strains in which the donor chromosome is partitioned into
segments of various lengths on the inbred host background. Congenic strains have all the
same advantages of CSSs and can be constructed in as few as three generations,
compared to the ten or more generations that are needed to make traditional congenic
strains from a two-strain cross.
2 http://genome.ucsc.edu/cgi‐bin/hgTables. Accessed April 1 2009.
3 http://www.ensembl.org/Mus_musculus/Location/Chromosome?r=18:1‐999999. Accessed April 1 2009.
64
Based on the weak linkage to chromosome 19, Matin et al. made the first mouse autosomal CSS to test whether chromosome 19 had QTLs involved in TGCTs (MATIN et al. 1999). Matin et al substituted chromosome 19 from the MOLF inbred strain (MOLF-
19) onto the 129/Sv inbred background. 80% of the 129-Chr 19MOLF males developed at
least one TGCT, showing that MOLF-19 had at least one QTL promoting TGCTs
(MATIN et al. 1999). A panel of thirteen congenic strains was made to map the QTLs
(YOUNGREN et al. 2003). TGCT prevalences in the congenic strains showed there were
up to five TGCT QTLs on chromosome 19 (YOUNGREN et al. 2003). As evidence of the
power of CSSs and congenic strains to map TGCT loci, the smallest statistically
significant congenic interval containing a QTL on MOLF-19 is 6 cM (Ensembl
Chromosome Summary4) and contains 93 RefSeq genes (UCSF Table Browser5). This interval is four times smaller and with over four times fewer genes than the smallest significant interval achieved in a linkage cross (MULLER et al. 2000; YOUNGREN et al.
2003).
As discussed in Chapter 2, I surveyed backcross males from ten incipient
129.MOLF CSSs for TGCTs. After applying a mathematical model to test for dominant
modifier gene effects, I found statistically significant evidence for QTLs affecting TGCT
prevalence in adults on two chromosomes, MOLF-2 and MOLF-18 (Table 2-1). The
model predicted a dominant QTL on MOLF-18 that suppresses TGCTs to 0% (Table 2-1,
% modifier). After MOLF-18 was made homosomic, I surveyed adult males for TGCTs.
As expected, 129-Chr 18MOLF males did not have TGCTs as adults (Table 2-3). These
4 http://www.ensembl.org/Mus_musculus/Location/Chromosome?r=18:1‐999999. Accessed April 1 2009.
5 http://genome.ucsc.edu/cgi‐bin/hgTables. Accessed April 1 2009.
65 data are consistent with replacement of at least one 129-derived susceptibility gene or substitution of at least one MOLF-derived TGCT suppressor.
To map the region containing the TGCT QTLs, I made and surveyed a panel of eight congenic strains that together span the length of chromosome 18 (see Figure 3-1 for an illustration of the congenic strains). The TGCT prevalences in adults of two of the eight congenic strains (C1 and C6) were significantly reduced from 129/Sv controls, demonstrating the existence of at least two QTLs, one at each end of the chromosome.
TGCTs were absent in adults from four congenic strains (C3, C4, C5 and C9), consistent with the presence of a third QTL in the middle of the chromosome. Overall, this study provides evidence for at least three TGCT QTLs on chromosome 18.
3.3 MATERIALS AND METHODS
3.3.1 Construction of 129-Chr 18MOLF
129S1/SvImJ (129/Sv, formerly 129S3/SvImJ) and MOLF/EiJ (MOLF) were
purchased from the Jackson Laboratory (Stock numbers 002448 and 000550,
respectively; Bar Harbor, Maine). 129/Sv females were mated to MOLF males, and the
F1 hybrids were backcrossed to 129/Sv to produce N2 progeny. N2s were genotyped at
four polymorphic SSLP markers spanning the 60 cM length of chromosome 18. The four
SSLP markers and their distance in cM and Mb from the centromere were D18Mit64 [2
cM, 6.1 Mb), D18Mit194 (22 cM, 43.8 Mb), D18Mit208 (38 cM, 61.1 Mb) and
D18Mit144 (57 cM, 85.6 Mb). N2 mice that were non-recombinant for MOLF-18 were
backcrossed to 129/Sv to produce N3 progeny. Backcrossing with selection for the non-
recombinant MOLF-18 chromosome was continued until the N13 backcross generation.
N13 males and females heterosomic for MOLF-18 were brother-sister mated and MOLF-
66
18 homosomics were selected. Mice were housed in the CWRU Animal Resource
Center and maintained on a 12:12-hour light/dark cycle. Mice were given water and
LabDiets 5010 chow (PMI Nutrition International; Saint Louis, Missouri) ad libidum.
This research was approved by the CWRU Institutional Animal Care and Use
Committee.
3.3.2 Genotyping
DNA for PCR genotyping was isolated from mouse tail as described (YOUNGREN
et al. 2003) and resuspended in 10 mM Tris. PCR amplification was performed in a 96-
well PTC-225 tetrad thermal cycler (MJ Research; Waltham, Massachusetts). PCR
conditions were as follows: 94°C for 2 minutes followed by 39 cycles of 94°C for 60
seconds, 55°C for 35 seconds, 72°C for 45 seconds. A final extension of 72°C for 5
minutes was performed. PCR products were held at 10°C until they were resolved in a
4% agarose gel (Invitrogen 15510-027; Carlsbad, California) in 1x TAE and visualized
with ethidium bromide.
3.3.3 Construction of congenic strains from 129-Chr 18MOLF
N12 mice heterosomic for MOLF-18 were backcrossed to 129/Sv and N13 progeny were typed at six SSR markers (see below) spanning chromosome 18. N13 mice with crossovers in the desired intervals were backcrossed to 129/Sv and heterozygous progeny were brother-sister mated to produce homozygous congenic mice. Each congenic strain was then maintained by brother-sister mating.
67
3.3.4 Identification of novel SSR markers
The online Mouse Genome SSR Search tool6 was queried to identify simple
sequence repeats (SSRs) on chromosome 18 that could be exploited for genotyping
purposes. SSRs that were polymorphic between 129/Sv and MOLF were used as markers
for genotyping. The PCR primers for the five new SSR markers were: Marker1F:
CATCCCTTTGCCTGCATATT; Marker1R: CTTGACCAAGTCCAGCAGGT;
Marker2F: GGGATGGCTTAAGCTGGTCT; Marker2R:
CAAATGTCTGCTTCCCTTCC; Marker3F: AAGGGCTTGTTTGCATTTCA;
Marker3R: AGCCAAAGAAACAGACACACA; Marker4F:
CCAGAGACTTGGCTCAAAGG; Marker4R: CACCAAGGGGAAGCTGAAAT;
Marker5F: CCCTTCTCATACCCTCACACTC; Marker5R:
GAAAGACACCCAGCAAGTCC.
The genetic map positions for the new markers were inferred using flanking MIT
markers. Flanking MIT markers on the physical map were identified using the Ensembl
Genome Browser7. Marker 1 is located between D18Mit66 [2 cM, 3.8 Mb] and
D18Mit219 [2 cM, 6.0 Mb], Marker 2 is located between D18Mit82 [11 cM, 21.7 Mb]
and D18Mit27 [13 cM, 22.5 Mb], Marker 3 is located between D18Mit180 [24 cM, 45.4
Mb] and D18Mit58 [24 cM, 46.5 Mb], Marker 4 is located between D18Mit187 [47 cM,
75.2 Mb] and D18Mit142 [47 cM, 75.5 Mb], and Marker 5 is distal to D18Mit25 [57 cM,
6 http://danio.mgh.harvard.edu/mouseMarkers/musssr.html. Accessed April 1 2009
7 http://www.ensembl.org/Mus_musculus/Location/Chromosome?r=18. Accessed April 1 2009
68
89.7 Mb]. An existing MIT marker, D18Mit208, was used to genotype the mice at 38 cM
(61.1 Mb).
3.3.5 Breakpoint mapping
I sequenced portions of chromosome 18 to discover SNPs that could be used to map the recombination breakpoints of select congenic strains. The identities of the PCR primers used for breakpoint mapping are listed in Appendix V.
3.3.6 TGCT survey
Males were sacrificed at three weeks of age and testes examined for TGCTs.
TGCT prevalence in 129-Chr 18MOLF and congenic strains derived from 129-Chr 18MOLF
were analyzed using the chi-square goodness-of-fit test and compared to the control
129/Sv TGCT prevalence. The significance threshold for all calculations was set at p <
0.05. The p values reported are after Bonferroni correction for multiple testing.
3.3.7 Histology
Testes were fixed in 10% phosphate-buffered formalin (Fisher Scientific SF100-
4; Pittsburgh, Pennsylvania) at 4°C for at least 48 hours, rinsed once in 1x PBS at room
temperature, and equilibrated in 30% sucrose in 1x PBS at 4°C for at least two days
before embedding and freezing in O.C.T. compound (Sakura Finetek USA 4583;
Torrance, California). Embedded gonads were sectioned at 5 - 10µ with a Leica CM3050
cryostat and slides were dried in the dark at room temperature for 1 hour before staining
with hemotoxylin and eosin.
69
3.4 RESULTS
129-Chr 18MOLF males lack TGCTs as adults, reflecting substitution of MOLF suppressor(s) or replacement of 129-derived susceptibility genes on chromosome 18. I constructed a panel of eight congenic strains from 129-Chr18MOLF to determine the
number and location of TGCT QTLs. Control males were from 129/Sv and test males
were from each of eight congenic strains (C1, C3-C9). In total, I surveyed 1,440 adult
congenic males for TGCTs (Figure 3-1). All but four of the TGCTs were histologically
verified. All TGCT cases were unilateral.
70
Figure 3-1: TGCT data from adult parental strains and congenic strains. The sizes of the congenic intervals are shown relative to the two parent strains. M (MOLF/MOLF) and 1 (129/129) denote genotypes at each marker. The number of adult males surveyed and the number and percent of males affected with TGCTs is shown. The TGCT prevalences in the congenic strains were compared sequentially using the chi-square goodness-of-fit test. The chi-square values and corresponding p values, corrected for eight multiple tests, are shown. p values with differences are highlighted in bold type.
71
I analyzed TGCT prevalences in the congenic strains using a method involving sequential comparisons between two congenic strains (SHAO et al. 2008; MILLWARD et al. 2009). The strains with the smallest, unique, MOLF-derived segments (C1 and C6) were compared with 129/Sv. Then, each of these two strains were compared with the congenic strain containing the next longer MOLF-derived segment (e.g., C1 vs. C3 and separately C6 vs. C7). Significant differences in TGCT prevalences between 129/Sv and congenic strains indicate the presence of QTLs containing modifier genes or susceptibility genes.
3.4.1 Evidence for at least three TGCT QTLs on chromosome 18.
The TGCT prevalences in C1 and C6 were significantly reduced relative to the
129/Sv control (Figure 3-1), suggesting the presence of TGCT QTLs in the MOLF- derived congenic intervals. C1 adults have TGCTs (1.08% of males affected) and define a small (2 cM) QTL near the centromere (Testicular germ cell tumor QTL 1 [TQ1],
Figure 3-1). C6 males are also affected at a significantly reduced rate as adults (2.10%), and although C6 lacks TQ1 near the centromere, C6 has a ≤ 6 cM MOLF-derived interval at the telomere (TQ2, Figure 3-1). The simplest explanation for these results is that there are two independently acting TGCT QTLs at opposite ends of chromosome 18.
Therefore, the sequence variant that suppresses TGCTs in TQ1 cannot be the same as the variant suppressing TGCTs in TQ2, demonstrating at least two different TGCT- suppressing QTLs on chromosome 18.
Interestingly, four of the eight congenic strains (C3, C4, C5 and C9) lack TGCTs as adults, recapitulating the lack of TGCTs in the 129-Chr 18MOLF parent strain. The four
unaffected strains share a ≤4 cM region of chromosome 18 between M21 (21 cM) and
72
M25 (25 cM). This ≤4 cM interval defines the location of a third TGCT QTL on chromosome 18 (TQ3, Figure 3-1).
3.4.2 Testes of 129-Chr18MOLF and congenic mice were affected by calcification
During the TGCT survey, abnormal testes with whitish foci were preserved to
histologically test for TGCTs. Each focus contained seminiferous tubules devoid of cells,
but filled wholly or in part with a crystalline substance that stained darkly with eosin. In
some cases, the entire testis showed crystallization, including the space between tubules.
A pathologist identified the crystals as the calcified remains of dead cells (Dr. Gregory
MacLennan, pers. comm.). The rate of males affected with testicular calcification was low, ranging from 0.53% affected to 2.48% affected (Table 3-1). The calcifications occurred in the congenic strains independent of whether the congenic strains have TGCTs as adults. Interestingly, the deposits may be the remains of aborted TGCTs, as calcifications of this type are seen in human carcinoma in situ cases (Dr. Gregory
MacLennan, pers. comm.).
73
Table 3-1: Rates of parent strains and congenic strains affected with testicular calcifications. Abnormal 129/Sv testes were not saved for histologic analysis.
74
3.4.3 Does length of the congenic segments influence TGCT prevalence?
Youngren and colleagues suggested that the elevated TGCT prevalence in 129-
Chr 19MOLF could be due to an epigenetic defect affecting portions of MOLF-19. In a
panel of congenic strains made from 129-Chr 19MOLF, the length and not the position of
most of the congenic strains predicted the TGCT prevalence in those congenic strains, a
finding consistent with an epigenetic defect (YOUNGREN et al. 2003). The only
exceptional congenic strains were the strains containing the MOLF-derived telomere,
suggesting that if the proposed epigenetic defect did exist, it only affected the
centromeric and middle portions of chromosome 19 (YOUNGREN et al. 2003). In Chapter
2, I showed that if there were such an epigenetic defect, not every MOLF chromosome was affected to the same degree as MOLF-19. However, it is conceivable that if there is a chromosome-wide regulatory defect enhancing the penetrance of TGCT genes on
MOLF-19, it may work in the opposite way on other MOLF chromosomes. For example,
MOLF-19 may contain several weak enhancers whose effects are exacerbated by the
proposed defect. MOLF-18 and MOLF-2 may contain several weak suppressors whose
effects are exacerbated by the same proposed defect, resulting in reduced TGCT
prevalence. Using the panel of eight congenic strains made from 129-Chr 18MOLF, I tested whether length and not position predicts TGCT prevalence in a manner similar to the 129-Chr 19MOLF congenic strains. I report the length of each congenic segment and the corresponding TGCT prevalence (Table 3-2).
.
75
Strain Length of congenic segment (Mb) % affected C6 11.8 2.10 C1 7.9 1.08 C7 29.1 3.89 C8 44.6 1.49 C9 47.5 0.00 C3 59.0 0.00 C4 75.4 0.00 C5 90.2 0.00 129-Chr 18MOLF 90.2 0.00
4.50
4.00
3.50
3.00 TGCTs 2.50 with
2.00
1.50 affected
1.00 % 0.50
0.00 0 20406080100 ‐0.50 Length of congenic segment (Mb)
Table 3-2: Length in megabases (Mb) of the congenic segments, and the percent of male adults affected with TGCTs.
76
3.5 DISCUSSION
TGCTs are the most common cancer in young men, accounting for 1% of all male cancers (KRAIN 1973; LINDELÖF and EKLUND 2001; JEMAL et al. 2006). The incidence
of TGCTs has been increasing, making it important to know which genes influence susceptibility. 129/Sv mice are an established model of some forms of human TGCTs, but few modifier genes and no susceptibility genes have been discovered in mice. In
Chapter 2, I showed that 129-Chr 18MOLF has at least one QTL containing a TGCT
suppressor. A prior study showed that congenics are an effective means of mapping
QTLs involved in susceptibility (YOUNGREN et al. 2003). As a first step in mapping the
QTLs, I constructed and surveyed a panel of eight congenic strains derived from 129-Chr
18MOLF. The results of my study show that chromosome 18 has at least three TGCT
QTLs.
Key to knowing how the QTLs influence TGCT prevalence is knowing which
genes are in each QTL. TQ1 is a 2 cM interval containing ≤27 genes. One of the genes,
Map3k8, is a known protoöncogene: overexpression of Map3k8 in numerous cell lines
promotes proliferation and transformation (MAKRIS et al. 1993; PATRIOTIS et al. 1993;
PATRIOTIS et al. 1994). TQ1 is syntenic to human chromosome 10p, which has not been associated with TGCT risk in prior studies (RAPLEY et al. 2003; CROCKFORD et al. 2006).
TQ2 is a ≤6 cM interval containing ≤49 genes. TQ2 contains Fbxo15, one of the few
-/- known targets of stem cell pluripotency factor Oct3/4 (TOKUZAWA et al. 2003). Fbxo15
mice are viable and fertile, indicating Fbxo15 is not required for fertility (TOKUZAWA et
al. 2003). Interestingly, TQ2 is syntenic to human chromosome 18q22, which has been
weakly associated with human TGCT susceptibility in two linkage studies (max HLOD =
77
1.814, max HLOD = 1.44, respectively) (RAPLEY et al. 2003; CROCKFORD et al. 2006).
TQ3 is a ≤4 cM interval containing ≤48 genes. TQ3 contains Eif1a, a functionally
related gene to Eif2s2, whose mis-expression is linked to TGCT suppression in 129/Sv
males heterozygous for Lethal yellow (Ay) (Jason Heaney, in pub.).
Interestingly, none of the three QTLs contain the dead-end (Dnd1) gene, an allele of which, Ter, is a known modifier of TGCT susceptibility (STEVENS 1973; NOGUCHI and
NOGUCHI 1985; YOUNGREN et al. 2005). Therefore, the genes and factors in the three
QTLs have not been associated with TGCTs before my study.
The calcifications I observed in the testes of some 129-Chr 18MOLF and congenic
males were an unexpected discovery and bring to mind an important question: are the
calcifications the remains of aborted TGCTs? This hypothesis is supported by the
presence of similar deposits in human TGCTs containing carcinoma in situ (Dr. Gregory
MacLennan, pers. commun.). These findings may mean that 129-Chr 18MOLF and some
congenic strains develop TGCTs at an early age, but that the TGCT cells have died and
calcified by adulthood. If so, the TGCT prevalences reported in Figure 3-1 may
underestimate the actual TGCT prevalences.
It is noteworthy that calcifications of this type have not been described in 129/Sv,
one of the parent strains of 129-Chr 18MOLF. However the calcifications are not a unique
phenomenon to 129-Chr 18MOLF: males heterozygous for KitlSlgb and Apobec1KO are also
affected. Because KitlSlgb is a TGCT enhancer, the calcifications are not unique to TGCT
suppressors.
It is also possible that the calcifications are unrelated to TGCTs. This hypothesis is concordant with presence of calcifications in KitlSlgb as well as the congenic data, in
78 which TGCT QTLs map to at least three discrete regions of chromosome 18 when only tumors seen in adults are considered. If TGCTs seen in adults and calcifications are considered together, then there are no statistically significant regions containing TGCT
QTLs. Therefore, an important future experiment is to test whether TGCT-resistant inbred strains (such as C57BL/6) develop testicular calcifications. Presence of calcifications in TGCT-resistant strains would argue against calcifications being the remains of aborted TGCTs.
The congenic panel I constructed allowed the opportunity to test whether length and not position of the congenic fragments determines TGCT prevalence, a hypothesis proposed by Youngren and colleagues to explain the TGCT prevalences in most of the
MOLF 129-Chr 19 congenic strains (YOUNGREN et al. 2003). Although the TGCT
MOLF prevalences in the 129-Chr 19 congenic strains ranged from 4% to 72% (YOUNGREN et al. 2003), there was very little difference between the TGCT prevalences in the 129-
Chr 18MOLF congenic strains, which ranged from 0% to 3.89%. Therefore any “length effects” observed in the 129-Chr 18MOLF congenic strains could be attributed to statistical
fluctuation. Nonetheless, the data showed a correlation between length of the congenic
segments and TGCT prevalence (r = -0.65). These data suggest that TGCT prevalence
decreases linearly as congenic segment length increases. Length correlated well with
TGCT prevalence in the panel of congenic strains made from 129-Chr 19MOLF (r = 0.83).
The congenic strain panel made from 129-Chr 19MOLF benefited from a larger number of
congenic strains, a wider range in TGCT prevalences, and more precise knowledge of the
locations of the recombination breakpoints. Additional congenic strains and finer
breakpoint mapping in the 129-Chr 18MOLF congenic strains could improve the accuracy
79 of the “length effect” estimate above, although the narrow range in TGCT prevalences will likely continue to frustrate analysis.
In the future, subcongenic strains and double congenic strains could be made to test for additive or non-additive interactions between different QTLs. Since TQ1 and
TQ2 are entirely contained in the congenic segments of C1 and C6 respectively, a double congenic strain could be made to test whether the suppressors in TQ1 and TQ2 act additively or non-additively. Additive effects on TGCT prevalence suggest the factors in each QTL suppress TGCTs through separate genetic pathways, whereas non-additive effects on TGCT prevalence suggest the factors interact in the same genetic pathway to suppress TGCTs. Because both models predict TGCT prevalence of 0% in the double congenic strain, this interaction test must be performed with a sensitizer (e.g. Dnd1Ter or
KitlSlJ) to create a high control TGCT prevalence under which the combined effects of
two suppressors can be observed. A potential drawback of using a sensitizer is the
possibility of non-additive interactions with QTL genes. Unfortunately, it is difficult to control for this possibility without creating and surveying several different sensitized double congenic strains.
An exciting conclusion from my study is the possible existence of a TGCT susceptibility gene in TQ3. A subcongenic strain containing just TQ3 could be made and surveyed to test whether the absence of TGCTs in C9 is due to replacement of a susceptibility gene in TQ3 or the combined interaction between a suppressor in TQ3 with the suppressor in TQ1 or TQ2. Presence of TGCTs in the TQ3-only strain would rule out a susceptibility gene in TQ3, although absence of TGCTs in the TQ3-only strain could indicate a susceptibility gene or a strong suppressor. In the latter case, crosses of the
80
TQ3-only strain to strong enhancers could be used to investigate whether TQ3 contains a susceptibility gene or a strong suppressor, as TGCT would be expected in crosses to the strong enhancers.
Previous studies of CSS-derived congenic strains have revealed that CSSs with loci influencing a trait have 3 – 5 QTLs, not just a single QTL. These observations attest to the power of CSS-derived congenic strains to detect QTLs that often escape detection in linkage studies, as well as to the complexity of the traits under study. In a panel of congenic strains derived from 129-Chr 19MOLF, Youngren and colleagues found evidence
for three QTLs enhancing TGCT prevalence (YOUNGREN et al. 2005). Working in congenic strains derived from B6-Chr 6A, Lindsay Burrage detected three QTLs
conferring resistance to diet-induced obesity (BURRAGE 2006). Similarly, I found
evidence for three QTLs affecting TGCT prevalence in the current panel of congenic
strains derived from 129-Chr 18MOLF. The data from my congenic strains and the
congenic strains derived from 129-Chr 19MOLF support the theory that TGCT is complex
in the 129/Sv model, even when the study is narrowed from the entire genome to a single
chromosome. Together with the studies of Youngren and Burrage, my study further demonstrates the value of CSS-derived congenic panels for complex trait mapping.
81
4 CHAPTER 4: The role of the mouse Y chromosome on TGCT susceptibility
82
4.1 ABSTRACT
Testicular germ cell tumors (TGCTs) are sex-limited, occurring only in males with a Y chromosome. Recently the gr/gr deletion on the human Y chromosome was associated with increased risk of TGCTs. In addition, presence of Y chromosome sequences is associated with TGCTs in cases of gonadal dysgenesis. TGCTs in strain
129 males recapitulate many aspects of testicular cancer in human infants and can be used to evaluate the role of the Y chromosome in TGCT risk. I used chromosome substitution strains and a sex-reversing mutant to test the role of the Y chromosome on
TGCT susceptibility. My results show that a Y-linked gene that does not differ among the tested strains is essential for tumorigenesis.
4.2 INTRODUCTION
Testicular cancer is the most common malignancy affecting young men aged 15 –
34 and accounts for over 1% of all male cancers (KRAIN 1973; JEMAL et al. 2006).
Unfortunately, TGCT rates have been rising worldwide in the past several decades,
making it important to understand the etiology and pathogenesis of TGCTs. Family
history is a significant risk factor, with the likelihood of developing TGCTs 8-10 fold
higher among brothers and 4 fold higher among sons of affected individuals (FORMAN et al. 1992; LINDELÖF and EKLUND 2001). Although high heritability suggests a strong
genetic component to susceptibility, only one low penetrance susceptibility variant has
been found.
Growing evidence suggests that genetic factors on the Y chromosome are
involved in the development of TGCTs. Recently, a 1.6-megabase deletion within the
AZFc (Azoospermia factor) region on Yq11 was associated with increased risk of TGCTs
83 in hemizygous men (NATHANSON et al. 2005; LINGER et al. 2007). This deletion, called
gr/gr, confers a 1.5-fold increased risk in men without a family history of TGCT and a
2.3-fold increased risk in men with a family history of TGCT, and is present in 1% of unaffected individuals (NATHANSON et al. 2005). The gr/gr deletion results in loss of three genes (DAZ, BPY2 and CDY1), all of which are expressed in spermatogonia (REIJO
et al. 1995; KLEIMAN et al. 2003; GINALSKI et al. 2004), suggesting that at least one of
these genes normally suppresses TGCT susceptibility. The AZF region has also been
implicated in male-factor infertility (TIEPOLO and ZUFFARDI 1976), which is another risk
factor for TGCTs (SCHOTTENFELD et al. 1980; PETERSEN et al. 1998). Structural
abnormalities of the Y chromosome are a major cause of male-factor infertility (VOGT
2004; RODOVALHO et al. 2008). The strong association between reduced fertility and
TGCTs suggests that they may share genetic and developmental determinants (LILFORD et al. 1994).
Studies of patients with gonadal dysgenesis provide further evidence for involvement of the Y chromosome with TGCTs. Among affected males, those with a normal 46 XY karyotype show increased risk of TGCT relative to sex-reversed individuals with a 45 XO karyotype (HEIMDAL et al. 1996; LEVIN 2000; LUTKE HOLZIK
et al. 2003; LUTKE HOLZIK et al. 2004), suggesting that at least one genetic factor on the
Y chromosome promotes TGCTs. Males with loss of some or all of the Y chromosome could be used to clarify the role of the Y chromosome in TGCT risk. However, individuals with DNA sequence variants or chromosome rearrangements including deletions are uncommon, making a mouse model relevant for testing the role of the Y chromosome on TGCT susceptibility.
84
Strain 129 mice spontaneously develop TGCTs at a rate of 1% – 8%, depending on the substrain (STEVENS and LITTLE 1954; STEVENS and HUMMEL 1957). These
TGCTs are an established model of testicular teratomas and teratocarcinomas of infants.
TGCTs in infants and mice both arise from primordial germ cells (PGCs) and lack both
intratubular germ cell neoplasia (carcinoma in situ) and characteristic karyotypic abnormalities (e.g. iso12p) found in adult TGCTs in humans.
As in humans, control of TGCT tumorigenesis in mice is complex. Crosses between 129/Sv and seven other inbred strains yielded a single affected mouse among
11,292 male mice surveyed, suggesting multigenic control (STEVENS and MACKENSON
1961). In mice, no susceptibility genes have been reported (KIMURA et al. 2003; HEANEY and NADEAU 2008).
Given this background, I evaluated the role of the Y chromosome on TGCT
susceptibility by testing whether the Y chromosome from the 129/Sv strain is sufficient
for tumorigenesis by measuring the frequency of affected males in the B6-Chr Y129 chromosome substitution strain (CSS). CSSs are inbred strains in which a chromosome in the host strain has been replaced by the corresponding chromosome from a donor
129 strain (NADEAU et al. 2000; SINGER et al. 2004). For example, the B6-Chr Y CSS
substitutes the 129/Sv donor Y chromosome on an otherwise inbred C57BL/6J
background. I also tested whether the 129/Sv-derived Y chromosome is necessary for
TGCT tumorigenesis by measuring the frequency of affected males in 129-Chr YB6 and
129-Chr YMOLF/EiJ CSSs.
In addition, I used a sex-reversing mutant, Odd Sex (Ods), to test whether any Y
chromosome is required for tumorigenesis. Ods is a dominant insertional mutant that
85 causes complete female-to-male sex reversal in the absence of the master sex- determining gene, Sry (BISHOP et al. 2000). Apart from the testes, sex-reversed mice are
phenotypically similar to their normal XY littermates. In the testes of sex-reversed mice,
germ cells are present during the critical period of TGCT formation but are lost soon after
birth. Sex-reversed mice therefore provide an opportunity to test for initiation of TGCTs
in the absence of the Y chromosome. Results of both studies of CSS and sex-reversed
males suggest that a Y-linked gene that does not differ among the tested strains is
essential for tumorigenesis.
4.3 MATERIALS AND METHODS
4.3.1 CSSs
129S1/SvImJ (129/Sv), and MOLF/EiJ (MOLF) were purchased from the Jackson
Laboratory (Stock numbers 002448 and 000550, respectively; Bar Harbor, Maine). 129-
Chr YMOLF/EiJ/NaJ (129-Chr YMOLF) was made by backcrossing (129/Sv x MOLF) F1
males to 129/Sv females to generate N2 males, which were then backcrossed to 129/Sv
females to generate N3 males. These backcrosses were continued until the N10
generation and the CSS was maintained thereafter by brother-sister mating. No
genotyping of backcross males was necessary because the non-recombinant portion of the
Y chromosome is transmitted intact from fathers to sons. Similar backcrosses were
performed by Anne Baskin (Nadeau Laboratory) to make the C57BL/6J-Chr Y129/SvImJ/Na
(B6-Chr Y129) CSS. The 129S1/SvImJ-Chr YC57BL/6J/NaJ (129-Chr YB6) has been
described (HAMMOND et al. 2007). All data reported from CSS males were from the N10
backcross generation or later. Mice were housed in the CWRU Animal Resource Center and maintained on a 12:12-hour light/dark cycle. Mice were given water and LabDiets
86
5010 chow (PMI Nutrition International; Saint Louis, Missouri) ad libidum. This research was approved by the CWRU Institutional Animal Care and Use Committee.
4.3.2 Sox9Ods crosses
129T1/Sv-+Oca2 Tyrc-ch Dnd1Ter/+ females were purchased from the Jackson
Laboratory and crossed to FVB/NJ-Sox9Ods/+ males. Y-bearing F1 males that were
heterozygous for Dnd1Ter and Sox9Ods were backcrossed to 129-Chr 19MOLF/EiJ
homosomic females to produce normal (XY) and sex-reversed (XX) N2 males.
4.3.3 Genotyping
All N2 mice were genotyped to validate phenotypes. The following PCR primers
were used: OdsF:
Ter-R:
2720 thermal cycler or a MJ Research DNA ENGINE Tetrad 2. PCR products from Ter
reactions were digested with five units of DdeI (New England Biolabs #R0175L;
Beverly, Massachusetts) for at least two hours at 37ºC before electrophoresis in 4%
UltraPure agarose (Invitrogen 15510-027; Carlsbad, California) in 1x TAE.
4.3.4 TGCT survey
Male CSS and N2 males were sacrificed at 3 – 5 weeks of age and testes examined for TGCTs. Segregation and TGCT data were analyzed using the chi-square goodness-of-fit test. The significance threshold for all calculations was set at p < 0.05.
4.3.5 Histology and immunohistochemistry
Gonads were isolated from neonatal pups within 24h of birth (P1) and from adults
(P21 – P35), fixed overnight at 4ºC in formalin, rinsed once in 1x PBS at room
87 temperature, and equilibrated in 30% sucrose in 1x PBS for at least two days before embedding and freezing in O.C.T. compound (Sakura Finetek USA 4583; Torrance,
California). Embedded gonads were sectioned at 5 - 10μ with a Leica CM3050 cryostat and sections were dried in the dark at room temperature for 1 hour. For histology, sections were stained with hemotoxylin and eosin. For immunohistochemistry, IHC-Fr was conducted according to the manufacturer’s recommended protocol8. Rabbit
polyclonal Mvh primary antibody (Abcam ab13840; Cambridge, Massachusetts) was diluted 1:100. Goat polyclonal to rabbit IgG secondary antibody (Abcam ab6720) was diluted 1:100. An antigen retrieval step was not necessary. Substrate development was performed with the Vector VIP substrate kit (Vector Laboratories SK-4600; Burlingame,
California). Developed slides were dehydrated in an ascending ethanol series, cleared in
xylene and mounted with VectaMount permanent mounting media (Vector Laboratories
H-5000).
4.4 RESULTS
4.4.1 The 129/Sv Y chromosome is not necessary for TGCTs
To test whether the Y chromosome from the susceptible strain has genetic
variants that are necessary for TGCTs, I created a new CSS that produces 129/Sv males
with substituted Y chromosomes derived from the TGCT-resistant MOLF/EiJ inbred strain (129-Chr YMOLF/EiJ, which was also discussed in Chapter 2). I also acquired the
129-Chr YB6 CSS which produces 129/Sv males with substituted Y chromosomes derived
from the TGCT resistant C57BL/6 inbred strain (HAMMOND et al. 2007). I then screened
males of both these CSSs for TGCTs. I expected that if the Y chromosome derived from
8 (http://www.abcam.com/ps/pdf/protocols/ihc_fr.pdf). Accessed April 1 2009
88
129/Sv had genetic variants that are necessary for TGCTs, no TGCTs would be found in
CSS males with alternative Y chromosomes. I report the number and percent of control
(129/Sv) and test (CSS) males affected with at least one TGCT (Table 4-1). The percentage of affected control 129/Sv males, 4.8%, agrees with published estimates for
129/Sv (STEVENS and HUMMEL 1957; YOUNGREN et al. 2003). Among a total of 291
surveyed males in the two CSSs, the frequency of affected males (3.8%) agreed closely
with the percentage of affected 129/Sv control males (129-Chr YB6 vs. 129/Sv: p = 0.97;
129-Chr YMOLF/EiJ vs. 129/Sv: p = 0.24), demonstrating that the 129/Sv Y chromosome
does not carry genetic variants that are necessary for TGCTs.
4.4.2 The 129/Sv Y chromosome is not sufficient for TGCTs
To test whether the 129/Sv Y chromosome has genes that are sufficient for
TGCTs, I surveyed B6-Chr Y129 males for TGCTs. Males from this CSS Y have Y
chromosomes derived from the TGCT-susceptible 129/Sv strain on an otherwise TGCT-
resistant C57BL/6 host background. I expected that if the 129/Sv Y chromosome has
genetic variants that are sufficient for TGCTs, I would find affected B6-Chr Y129 males
(Table 4-1). With a single exception, affected males were not found among the 391 males that were surveyed. Regrettably, the sample for the putative TGCT was lost before histological validation. The exception may represent the action of a weak sufficiency factor or a rare case of TGCT outside the 129 inbred strains, or it may not be a TGCT. It would take thousands of mice to differentiate between these alternative hypotheses.
89
Table 4-1: TGCTs in CSS males with alternate Y chromosomes. The single putative TGCT in the B6-Chr Y129 CSS was lost before it could be verified histologically.
Inbred strain n examined % affected with TGCTs
Control males 129/Sv 146 4.8
CSS males 129-Chr YB6 144 4.9
129-Chr YMOLF 147 2.7
B6-Chr Y129 391 0.3
Table 4-2: Test for TGCTs in control and sex-reversed males. Here I show the number of adult N2 males examined and percent affected with TGCTs. All males are obligate MOLF-19/+ heterosomics.
Phenotype Genotype n examined % affected
Control males XY Sox9Ods/+ Dnd1Ter/+ 146 18 XY Sox9Ods/+ Dnd1+/+ 127 2
Total 273
Sex-reversed males XX Sox9Ods/+ Dnd1Ter/+ 81 0 XX Sox9Ods/+ Dnd1+/+ 56 0
Total 137
90
Nonetheless, this survey rules out a genetic variant on the 129/Sv Y chromosome that acts as a strong sufficiency factor.
4.4.3 Adult XX sex-reversed males do not have TGCTs
I used a female-to-male sex-reversing mutation called Odd Sex to test whether any
Y chromosome is necessary for TGCTs. However, Odd Sex, which was created on the
TGCT-resistant FVB/NJ inbred background, had to be transferred to the TGCT- susceptible 129/Sv background before sex-reversed mice could be surveyed. Initially, I planned to make Odd Sex congenic on the 129/Sv background by repeated backcrossing with selection for at least 10 backcross generations. Unfortunately, approximately 50% of the XX Sox9Ods/+ N2 males failed to show sex-reversal and instead developed as fertile
females with ovaries. Loss of penetrance became more pronounced in subsequent
backcross generations. The same phenomenon has been observed in crosses to C57BL/6J
and A/J (QIN et al. 2003; QIN et al. 2004). Loss of penetrance could be due to gain of
129-derived suppressors of sex-reversal, loss of FVB-derived enhancers of sex-reversal, transgene silencing, or a combination of these factors. I therefore devised an alternative breeding strategy that minimizes the number of backcrosses to 129/Sv but increases the number of males with a TGCT by introducing two genetic variants, namely Dnd1Ter and
MOLF-19, that enhance susceptibility on the 129/Sv background (STEVENS 1973; MATIN et al. 1999) (Figure 4-1).
In Table 4-2, I report the percentage of sex-reversed (test) and wild-type (control)
N2 males that were affected with at least one TGCT. All sex-reversed N2 males were either XX MOLF-19/+ Sox9Ods/+ Dnd1Ter/+ or XX MOLF-19/+ Sox9Ods/+ Dnd1+/+. I
91
Figure 4-1:Crosses performed to produce sex-reversed and control N2 males. In the first cross, Dnd1Ter/+ females were mated to Sox9Ods/+ males. Dnd1Ter/+ Sox9Ods/+ male F1s with the Y chromosome were backcrossed to 129-Chr 19M females homosomic for MOLF-19. The testes of N2 sex-reversed and normal males were then examined for TGCTs. For clarity, I show the strain origin (129/Sv or FVB) of the X and Y chromosomes with a 1 or F, respectively.
92 also present data from two of the four genotypes of normal N2 males in 4- 2 (see
Appendix VI for TGCT data from all genotypes). Since only 13% of the N2 progeny were sex-reversed, large numbers of N2s needed to be screened. Interestingly, neither
Dnd1Ter/+ nor Dnd1+/+ sex-reversed males had TGCTs, whereas both Dnd1Ter/+ and
Dnd1+/+ control males developed TGCTs (p < 3.9 x10-5), suggesting that TGCTs do not occur in the absence of the Y chromosome.
The testes of sex-reversed mice were approximately 1/3 the size of normal testes
(Figure 4-2C), so I considered the possibility TGCTs might also be small. To ensure that
small TGCTs were not overlooked, I examined twenty serially-sectioned sex-reversed
testes histologically, but tumor foci were not found. Although several cases of ovotestes,
with both ovarian and testicular tissue in the same gonad, were observed in sex-reversed
males, most gonads appeared as normal testes.
4.4.4 Neonate XY males, but not XX sex-reversed males, have germ cells at birth
I considered the possibility that PGCs were lost before TGCTs could form in sex-
reversed males. TGCTs in mice initiate from PGCs during a narrow developmental
window, between E11.5 and E13.5 (STEVENS 1964). Embryos that do not develop a
TGCT during this time-period will not have testis tumors as adults. To test for the presence of PGCs, I used an antibody against a PGC marker, Mouse vasa homologue
(Mvh) (HAYASHI et al. 2008; YAMAJI et al. 2008). I confirmed that sex-reversed XX
males had PGCs at birth (Figure 4-2A), albeit fewer than their normal XY littermates
(Figure 4-2A), and that they were germ cell deficient as adults (Figure 4-2B), as is the
case in sex-reversed XX FVB/NJ males (BISHOP et al. 2000). Interestingly, germ cell
deficiency is a predisposing condition for TGCTs, with mutant genes such as KitlSl and
93
Figure 4-2: Comparison of testes from normal males (XY Sox9Ods/+ Dnd1Ter/+ ) and sex- reversed males (XX Sox9Ods/+ Dnd1Ter/+ ). A, germ cells (purple) were present at birth in both normal and sex-reversed testes. Secondary antibody failed to detect germ cells in the absence of primary anti-Mvh antibody in both normal and sex-reversed testes. B, H&E-stained sections through 5 wk old adult testes with and without TGCTs. Normal male testes contained seminiferous tubules with an abundance of germ cells (arrow), whereas adult sex-reversed testes contained Sertoli cells but were devoid of germ cells. A TGCT from a normal XY Sox9Ods/+ Dnd1Ter/+ male was sectioned, revealing muscle, adipose and cartilage. In contrast, no TGCTs were found in adult sex-reversed gonads. C, morphology of normal male testes, TGCTs, and sex-reversed testes. From left to right, a pair of morphologically normal testes, a case of bilateral TGCT, a case of unilateral TGCT with unaffected testis, two pair of sex-reversed testes. Note sex- reversed testes are ~2/3 smaller than normal male testes but are otherwise morphologically normal.
94
DndTer showing both reduced PGC numbers and an increased frequency of
affected males (STEVENS 1967c; NOGUCHI and NOGUCHI 1985).
4.4.5 Neonate XY males, but not XX sex-reversed males, have TGCTs at birth
I expected that if TGCTs form in sex-reversed embryos, they should persist and be macroscopically evident as adults. Because TGCTs were absent in sex-reversed adults, I considered the possibility that TGCT might form but not progress owing to a potentially abnormal hormonal or gonadal environment, e.g. ovotestes were observed in
several sex-reversed XX males. To test this hypothesis, I serially-sectioned the testes of
12 XY Dnd1Ter/+ males, 2 XY Dnd1Ter/Ter males, and 23 XX sex-reversed males at birth
and looked microscopically for tumor foci. TGCT foci were not found in testes from sex-
reversed males, whereas I identified one affected testis in the XY Dnd1Ter/+ males and
one affected testis in the XY Dnd1Ter/Ter males. Together these results show that PGCs are
present during the critical developmental period of tumorigenesis and that sex-reversed
mice do not have TGCTs, or if they do, they have formed and regressed before birth.
4.5 DISCUSSION
TGCTs account for 1% of all male cancers and have an unusually strong genetic
component (KRAIN 1973; LINDELÖF and EKLUND 2001; JEMAL et al. 2006). To date, research into the role of Y-linked factors in TGCT etiology has produced evidence for
TGCT promoting and suppressing genes on the human Y chromosome (HEIMDAL et al.
1996; LEVIN 2000; LUTKE HOLZIK et al. 2003; LUTKE HOLZIK et al. 2004; NATHANSON et
al. 2005; LINGER et al. 2007). By surveying males from several populations of
genetically-engineered mice, I sought to clarify the role of the Y chromosome on TGCT
95 susceptibility in an established mouse model. In doing so, I found that the mouse Y chromosome has at least one genetic factor that is necessary for TGCTs.
In this Chapter, I tested two hypotheses: the first involved testing whether alternative Y chromosomes have genetic variants that affect susceptibility, and the second tested whether presence of a Y chromosome is required for tumorigenesis. By using
CSSs with alternative Y chromosomes, I tested whether the Y chromosome from the susceptible 129/Sv strain is necessary for TGCTs. 129/Sv males with Y chromosomes derived from the C57BL/6J and MOLF/EiJ inbred strains developed TGCTs at the expected frequencies (Table 4-1), showing that the 129/Sv Y chromosome does not have unique or strong genetic variants that are necessary for TGCTs. This test also involved determining whether the Y chromosome from the 129/Sv strain has genetic variants that are sufficient for TGCTs. Absence of several affected B6-Chr Y129 males suggests that a
strong 129-derived sufficiency factor is not involved.
These CSS-based tests depend on the extent of genetic variation between the
tested Y chromosomes. Various evidence shows that Y chromosomes in most inbred
strains of mice, including 129/Sv, C57BL/6J and MOLF/EiJ, are derived from Mus
musculus molossinus (NAGAMINE et al. 1992; TUCKER et al. 1992). However, two of the
inbred strains (129/Sv and C57BL/6J) were derived from wild mice more than 100 years
ago, whereas MOLF/Ei was independently derived within the last 40 years (MORIWAKI
1994; BONHOMME and GUÉNET 1996). The Y chromosome in the MOLF/Ei strain should
therefore show comparable levels of genetic variation with other outbred or recently
inbred molossinus Y chromosomes, whereas the molossinus-derived Y chromosomes
among traditional inbred strains should show only mutational divergence that arose since
96 these inbred strains were established. Unfortunately the Y chromosome has proven difficult to sequence (ALFÖLDI 2008), a consequence of its highly repetitive nature. As a
result it is not yet possible to rigorously evaluate sequence divergence among these Y
chromosomes. However, spontaneous mutants with functional effects between the Y
chromosomes of related inbred strains have been reported. Using a Y chromosome CSS,
Maxson et al. (MAXSON et al. 1979) showed the DBA/1Bg Y chromosome has spontaneous mutants that promote male aggression which the C57BL/10 Y chromosome lacks, despite both having a Mus musculus molossinus – derived Y chromosome
(NAGAMINE et al. 1992; TUCKER et al. 1992). Together these results and observations
suggest that spontaneous Y chromosome mutants on the 129/Sv Y chromosome do not account for the genetic susceptibility to TGCTs in 129/Sv.
The second hypothesis that I tested involved determining whether any Y chromosome was necessary for TGCTs by using a sex-reversing mutant that produces
XX males with testes but lacking Y chromosomes. XY but not XX sex-reversed males had TGCTs (Table 4-2), showing that at least one Y-linked factor is necessary for development of TGCTs. By using crosses that included segregating controls, I was able to control for maternal and genetic background effects.
By surveying N2 males for TGCTs at birth, I partly controlled for potential variables (e.g. hormonal effects and an environment incompatible with male PGC survival) that could adversely affect TGCT progression. However, this does not remove the variables entirely, nor can I envision a way to completely control for them using
existing tools. Importantly, I did not test whether the hormonal profiles of sex-reversed mice appropriately mimics that of normal males, and a few cases of ovotestes were
97 found, raising the possibility that the hormonal profile in sex-reversed males is not fully compatible with normal gonadal function.
Surveying for TGCTs earlier than birth is possible. TGCTs form around E12.5
(STEVENS 1964), three days before the earliest developmental time point at which they
can be detected (STEVENS 1962). However, to my knowledge, no one has demonstrated
how to differentiate a normal PGC from a transformed PGC or EC cell before E15.5. In
the future, advances in the understanding of PGC development may allow for the
identification of novel markers to distinguish PGCs from transformed PGCs or EC cells.
The ability to survey for TGCTs as close to their time of origin as possible will best
control for the aforementioned confounding variables affecting tumor progression.
Evidence from several TGCT modifier genes indicates that germ cell deficiency is
correlated with increased rates of TGCT. For example, XY Dnd1Ter/Ter testes are devoid
of germ cells at birth, but 94% of adult males present with a TGCT (NOGUCHI AND
NOGUCHI 1985). However, not all forms of germ cell deficiency are associated with increased risk for TGCTs. For example, KitW mutants are germ cell deficient
(COULOMBRE and RUSSEL 1954), but develop TGCTs at rates comparable to 129/Sv males (STEVENS 1967c; STEVENS 1973). Because sex-reversed males are severely germ cell deficient (compare normal vs. sex-reversed, Figure 4-2A), sex-reversed males could
show increased risk of TGCT. However, sex-reversed males lack TGCTs, implicating Y chromosome factors in TGCT development.
It is possible that presence of two X chromosomes, rather than loss of the Y
chromosome, accounts for absence of TGCTs in sex-reversed mice. However this
scenario is unlikely because relatively few genes escape X inactivation, and more
98 importantly because 47 XXY individuals with Klinefelter’s syndrome have high rates of germ cell tumors, despite having two X chromosomes (NICHOLS et al. 1987; VÖLKL et al.
2006). My results therefore support the hypothesis that a Y chromosome factor that does not differ between 129/Sv, C57BL/6J and MOLF/EiJ is required for TGCTs.
In my study, sex-reversed XX males, which lacked all Y-derived sequences, failed to develop TGCTs at both time-points tested. In a separate study, Cook et al showed that TGCT foci were evident at E18.5 in XX Dnd1Ter/Ter testes of sex-reversed
males resulting from the action of an autosomal copy of Sry, SryMYC. The manuscript by
Cook et al did not indicate whether adult transgenic males were surveyed for TGCTs.
These results suggest that Sry may be the gene on the Y chromosome that is required for
TGCTs. This in turn implies Sry has another function in the embryonic gonad, aside from activation of Sox9 and male sex determination. Taken together with the data of
Cook et al, my results raise the possibility of a novel role for Sry in the development of
TGCTs.
99
5 CHAPTER 5: Summary and future directions
100
5.1 SUMMARY
TGCTs are the most common tumor in men aged 15 –34 (KRAIN 1973; JEMAL et
al. 2006), but despite decades of research in humans, only one factor involved in susceptibility (gr/gr) has been discovered. Strain 129 mice spontaneously develop
TGCTs of the types seen in human infants, and offer the opportunity to study this complex disease in an established animal model. Although several modifier genes have been found in mice that offer clues to the genetic pathways promoting TGCTs, susceptibility genes have so far been elusive. Identifying susceptibility genes and
additional modifier genes will improve our understanding of the genetic underpinnings of
TGCTs in mice, and may ultimately provide targets for new diagnostic tests or
therapeutic regimens in humans.
The goal of my thesis research was to identify chromosomes and chromosomal
regions involved in TGCT susceptibility in mice. The project involved two separate
components. First, I made and surveyed incipient (pre-N10) CSSs to test for
chromosomes with QTLs affecting TGCT prevalence. Second, I surveyed XX sex-
reversed and XY normal males for TGCTs to test whether the Y chromosome is
necessary for TGCTs. I identified three new CSSs with QTLs influencing TGCT
prevalence, and showed that at least one factor on the Y chromosome is necessary for
TGCTs.
5.1.1 Three new CSSs with TGCT QTLs
Before my thesis research, 129-Chr 19MOLF was the only CSS that was known to
have modifiers affecting TGCT prevalence (MATIN et al. 1999). Modifiers provide clues
to the pathways leading to TGCTs, and identification of additional modifiers can improve
101 our understanding of the pathways involved in TGCT etiology. As the first step in mapping of novel modifiers, I measured the TGCT prevalence in ten new incipient129-
ChrMOLF CSSs to find chromosomes with TGCT QTLs. While I was making the 129-
ChrMOLF CSSs, a colleague in the Nadeau Laboratory (Annie Baskin) was constructing
panels of 129-ChrB6 and B6-Chr129 CSSs. Annie and I collaborated to provide me with
surplus males from her 129-ChrB6 and B6-Chr129 panels. By screening 129-ChrB6 males,
I was able to test twenty-one B6 chromosomes for TGCT modifiers, and by screening
B6-Chr129 males, I was able to test nineteen 129/Sv chromosomes for TGCT sufficiency
factors.
By applying a mathematical model that estimates what effect a dominant
segregating modifier had on TGCT prevalence, I found two MOLF chromosomes and
one B6 chromosome with dominant QTLs affecting susceptibility on the 129/Sv
background. The two MOLF chromosomes, MOLF-2 and MOLF-18, both had QTLs
suppressing TGCTs, whereas two B6 chromosomes (B6-5 and B6-6) had QTLs
enhancing TGCTs. I prioritized development of the first two CSSs, and alerted Annie to
the putative TGCT QTLs on 129-Chr 5B6 and 129-Chr 6B6 so she could prioritize
development of those CSSs.
129-Chr 18MOLF was the first CSS of the three to be made homosomic. I surveyed
homosomic males to test the predictive power of the model. Homosomic 129-Chr
18MOLF males failed to develop TGCTs as adults, demonstrating the existence of at least
one QTL suppressing TGCTs and validating the model as a tool for identifying chromosomes with modifier genes. Unfortunately neither MOLF-2 nor B6-6 is
102 homozygous as of April 1, 2009. Nonetheless, my study proved at least one other MOLF chromosome has TGCT QTLs in addition to MOLF-19.
5.1.2 Chromosome 18 has multiple factors influencing TGCT susceptibility
As a first step in mapping the regions of chromosome 18 containing the TGCT
QTL, I built and surveyed a panel of eight congenic strains derived from 129-Chr 18MOLF.
Interestingly, all congenic strains containing a ≤ 4 cM interval in the middle of
chromosome 18 lacked TGCTs as adults. Absence of TGCTs in these congenic strains
recapitulated the absence of TGCTs in 129-Chr 18MOLF and may suggest replacement of a
129-derived susceptibility gene. This experiment further demonstrates the power of
CSSs and congenic strains to map TGCT loci: the smallest statistically significant congenic interval containing a TGCT QTL in this survey is 2 cM. Analysis of the congenic panel provided evidence for three QTLs influencing susceptibility on chromosome 18.
I tested whether any of the three QTLs are syntenic to regions of the human genome that have been linked to TGCT susceptibility. TQ2 is syntenic to human chromosome 18q22, which has been linked to TGCT susceptibility in two linkage studies
(RAPLEY et al. 2003; CROCKFORD et al. 2006). The other QTLs map to regions of the
human genome that has not been linked to TGCTs: TQ1 is syntenic to 10p and TQ3 is
syntenic to 5q.
5.1.3 At least one factor on the Y chromosome is necessary for TGCTs.
I used a sex-reversing mutant named Odd Sex (Ods) to test whether the Y
chromosome is necessary for TGCT development. Ods is a mutant in Sox9, which is
downstream of Sry in the sex-determination pathway (DA SILVA et al. 1996; KENT et al.
103
1996). Although XX mice normally develop as fertile females, presence of Ods/+ causes them to develop as sterile males with testes (BISHOP et al. 2000) and germ cells, at least
for a time. The sex-reversal caused by Ods offered the opportunity to test whether Y chromosome factors are required for TGCT formation or progression. Normal XY Ods/+ males were affected at a rate of 11%, but XX Ods/+ sex-reversed males were not affected with TGCTs. I concluded that at least one factor on the mouse Y chromosome is necessary for TGCTs.
Cook et al. showed that XX sex-reversed males expressing Sry develop TGCTs in
E18.5 embryos, and I showed that XX Sox9Ods/+ sex-reversed males fail to have TGCTs
at birth or adults. These results suggest that Sry may be the necessary Y-linked factor for
TGCTs in mice. The human orthologue of Sry is SRY and is also localized to the Y
chromosome (SINCLAIR et al. 1990). Studies to investigate the role of SRY in TGCT
susceptibility have not been performed in humans.
5.2 FUTURE DIRECTIONS
5.2.1 Is Apobec1 the TGCT gene on B6-6?
129-Chr 6B6 backcross males are affected with TGCTs at a rate of ~15%, which is
comparable to the rates at which several known TGCT modifiers (e.g. Dnd1Ter/+, MOLF-
19/+) develop tumors. Interestingly, a known TGCT modifier, Apobec1, maps to chromosome 6. Unlike other TGCT modifier genes, Apobec1 enhances tumor prevalence in some crosses and suppresses it in others (Vicki Nelson, unpub. data). The effect on
TGCT prevalence depends on the parent of origin: When Apobec1+/- is contributed by the heterozygous male parent, TGCTs are enhanced in the Apobec1+/- male progeny. But
when Apobec1+/- is contributed by the heterozygous female parent, TGCTs are
104 suppressed in the Apobec1+/- male progeny. It is unknown how Apobec1 could act as
both a suppressor and enhancer. In at least two of the three affected 129-Chr 6B6 males,
Apobec1+/- was contributed by the heterozygous male parent (Annie Baskin, pers.
comm.). Although there are no known non-synonymous coding differences between the
B6 and 129 alleles of Apobec1 (Mouse Genome Informatics SNP Query9), the B6 allele could still have non-coding modifications that affect the spatial, temporal or quantitative expression of the gene. One way to test whether Apobec1 is the TGCT gene involves making a congenic strain from 129-Chr 6B6 in which all of chromosome 6 is derived from
129 except the Apobec1 locus, which is derived from B6. If the enhanced TGCT
prevalence in 129-Chr 6B6 is due to Apobec1, then male congenic strains will be affected
by TGCTs at the same rate as 129-Chr 6B6 males. If Apobec1 is not the enhancer on 129-
Chr 6B6, a panel of congenic strains can be made from 129-Chr 6B6 to map the QTL
modifying TGCT susceptibility.
5.2.2 How can the TGCT factors in TQ1 – TQ3 be identified?
One of the goals of this research was to find QTLs affecting TGCT prevalence in
CSSs and congenic strains derived from CSSs. Using a panel of congenic strains derived
from 129-Chr 18MOLF, I found statistical evidence for three TGCT QTLs on chromosome
18. Several approaches could be used to identify the TGCT gene(s) in each QTL,
including sequence analysis, gene expression studies, transgenic mice, and subcongenic strain analysis. All four approaches have their own unique advantages and disadvantages. However, the best first step would be to more finely map the breakpoints
9 http://www.informatics.jax.org/javawi2/servlet/WIFetch?page=snpQF. Accessed April 1 2009
105 of the congenic strains. Further breakpoint mapping will facilitate a more precise understanding of the size of each QTL and which genes they contain.
The sequences of all genes in the three QTLs should be compared between
129/Sv and MOLF to identify non-synonymous substitutions that could affect the expression or function of the mRNA or protein. Fortunately, the genomes of both 129/Sv and MOLF were sequenced as part of Perlegen’s resequencing effort, which identified over 8 million SNPs between 16 commonly used inbred strains (Perlegen10). The SNP
data produced is the most comprehensive resource available to test for coding differences
in homologous genes between inbred strains and is publicly available (Mouse Genome
Informatics SNP query11). The chief limitation is a change in the coding sequence of the gene may not account for the nature of the modifier. For example, changes in quantitative expression of the gene could account for the modifier effect and may not be detected in analysis of the coding sequence. Therefore, no prospective modifier gene should be ruled out simply because it lacks coding differences between 129/Sv and
MOLF.
The mechanism by which a modifier gene elicits its effect may be through quantitative, temporal or spatial mis-expression. Genes in each QTL could be tested for quantitative mis-expression (e.g. changes in the relative amounts of mRNA) in male
gonads at the time of TGCT formation using qRT-PCR or another method. For example,
to measure the expression of genes in TQ1, timed matings can be established for C1 (test)
and 129/Sv (control). Expression in C1/129 heterozygotes could be measured also, and I
10 http://mouse.perlegen.com/mouse/index.html. Accessed April 1 2009
11 http://www.informatics.jax.org/javawi2/servlet/WIFetch?page=snpQF. Accessed April 1 2009
106 would expect the level of expression in the heterozygotes to be intermediate between the levels of both homozygotes. If using heterozygotes, expression should be measured in
C1/129 gonads as well as reciprocal 129/C1 gonads to test for parent-of-origin effects. If expression is measured only in homozygotes, parent-of-origin effects are negligible because the parents are genetically identical. Temporal alterations in gene expression
(e.g. expression in the right tissues at the wrong time) would involve comparing levels of mRNA from gonads in congenic and control strains at earlier or later timepoints than the time of TGCT formation. Similarly, changes in spatial expression (e.g. expression in the wrong tissues at the right time) could be detected by separating PGCs from other cells in the gonad at the time of TGCT initiation, and comparing expression of QTL genes in non-PGCs from congenic strains and 129/Sv control males. The advantage of expression studies is that changes in gene expression can be measured at the level of transcription.
The chief drawback is that gene expression at the translational level could be altered without being altered at the transcriptional level.
Transgenic mice could be used to directly test whether candidate genes in the three QTLs are involved in TGCT susceptibility. This approach takes advantage of information already known about specific genes in QTLs. For example, TQ2 contains
Fbxo15, whose expression is known to be upregulated by Oct3/4 in embryonic stem cell lines (TOKUZAWA et al. 2003). Oct3/4 is a pluripotency factor that enhances TGCT
prevalence when overexpressed (GIDEKEL et al. 2003). Regulation by Oct3/4 may link
Fxbo15 to TGCT susceptibility. Since TQ2 is defined by the C6 congenic segment,
knock-in mice can be produced that express the 129/Sv-derived allele of Fxbo15 instead
of the MOLF-derived allele on an otherwise isogenic C6 background. If Fxbo15 is the
107
TGCT suppressor in TQ2, the TGCT prevalence in the transgenic males should approximate the TGCT prevalence in 129/Sv males. If Fxbo15 is not the TGCT suppressor, the TGCT prevalence in the knock-in males should approximate the TGCT prevalence in the C6 parent. In either case, transgenic mice could be used to help rule in or rule out specific candidate genes in QTLs. The advantage of this approach is the ability to test the role of particular candidates in TGCT susceptibility. The disadvantage is the time and expense involved in deriving ES cells from the necessary congenic strains.
Subcongenic strains could also be made and surveyed to test candidate genes in each QTL. Subcongenic strains are made in the same way as congenic strains, except the first cross is a backcross of an established congenic strain to the host strain, in this case
129/Sv. A subcongenic strain is genetically identical to its parent congenic strain, except with smaller donor strain substitutions. Subcongenics have the advantage of further defining the location of each QTL and will reduce the number of candidate genes in them. The main disadvantage of this approach is time: it will take at least a year to make the subcongenic strains and another year to survey them for TGCTs.
5.2.3 Do TGCTs and ES cell derivation share genetic determinants?
129 mice are the only strains that develop TGCTs at an appreciable rate, and are also the only strains from which ES cells can be efficiently derived. These observations suggest the defects in 129-derived stem cells that promote TGCTs may be the same defects that allow ES cells to be derived efficiently, linking TGCTs with ES cell derivation. 129-Chr 18MOLF are 129-derived mice that are highly resistant to TGCTs. To
test whether TGCTs and ES cell derivation share genetic determinants, ES cell
derivations can be performed with 129-Chr 18MOLF and 129/Sv controls. If the defects
108 promoting TGCTs and ES cell formation are the same, I expect the ES cell derivation efficiency to be reduced relative to the derivation efficiency of 129/Sv. If the ES cell derivation efficiencies are comparable in both strains, then TGCTs and ES cell formation may have separate genetic determinants.
5.2.4 Are testis calcifications the remains of aborted TGCTs
During the TGCT survey of 129-Chr 18MOLF and the congenic strains made from
it, several unusual testes were observed. I saved the testes to test for TGCTs. I found
calcium deposits in some of the testes, which were either confined to the seminiferous tubules or included the seminiferous tubules and the space between tubules. These calcifications have not been reported before in the mouse TGCT literature. However, calcified lesions like these are seen in human cases of carcinoma in situ, and are the calcified remains of dead cells (Dr. Gregory MacLennan, pers. comm.).
The localization of the deposits and their association with carcinoma in situ in humans suggest the calcifications may be the remains of dead TGCTs. If the calcifications represent the remains of aborted tumors, 129-Chr 18MOLF may have QTLs
that inhibit progression of TGCTs. On the other hand, if the calcifications are the
remains of normal cells, then 129-Chr 18MOLF may have QTLs that suppress initiation of
TGCTs. The key to differentiating between these two competing hypotheses is testing whether tumor cells are dying to form the calcifications.
The most direct way to test whether early TGCTs are aborting in 129-Chr 18MOLF
is to survey for TGCTs at an early age, such as at birth (P1). If 129-Chr 18MOLF males
have TGCTs at birth but not as adults, MOLF-18 has QTLs suppressing progression of
TGCTs. If 129-Chr 18MOLF males lack TGCTs at birth, MOLF-18 has QTLs suppressing
109 initiation of TGCTs. Because TGCTs arise about eight days before birth, tumors may already have formed and died before P1, leaving calcifications. If calcifications are observed at P1 it will be necessary to survey for TGCTs earlier than birth, before the onset of calcification. Nonetheless I recommend screening for TGCTs at P1 first because doing so avoids the timed matings, euthanasia of the dams, and microdissections that are inherent to embryonic studies.
Interestingly, testis calcifications are not unique to 129-Chr 18MOLF or congenic
strains derived from it: I recently showed that testis calcifications also occur in some
Apobec1+/- testes. Presence of calcifications in 129-Chr 18MOLF and Apobec1 males
suggest calcifications may also affect 129/Sv males and 129/Sv males with other modifiers. However, calcifications have not been reported in those males.
129/Sv males should be surveyed for calcifications to test whether the
calcifications are unique to males with TGCT modifiers. Testis calcifications may not
have been reported before either because they are easy to miss in vivo or because calcification is a new phenomenon within 129/Sv and 129-derived mice. Even if 129/Sv and 129-Chr 18MOLF develop calcifications at the same rate, 129-Chr 18MOLF could still be
used to test whether the calcifications are the remains of dead tumors. Because 129-Chr
18MOLF lacks TGCTs as adults, any TGCT observed at birth suggests the calcifications
seen in adults are the remains of dead tumors. If 129/Sv males lack calcifications, their
presence in 129-Chr 18MOLF and Apobec1+/- may suggest those strains have QTLs
inhibiting progression of TGCTs.
110
5.2.5 Is Sry the Y-linked factor that is necessary for TGCTs?
In Chapter 4, I showed that a Y chromosome factor(s) is necessary for TGCTs. In a concurrent report, Cook and colleagues showed that XX males transgenic for a Y- linked gene, Sry, had TGCTs at E18.5. Unfortunately the studies were conducted without knowledge of the other, and the genetic backgrounds of the mice and the methodology of surveying for TGCTs were different in the two reports.
Using transgenic technology, knock-ins for Sry and Sox9 could be made in
129/Sv-derived ES cells to create genetically identical mice that differ only in their transgenes. Presence of TGCTs in XX Sry males and absence of TGCTs in XX Sox9 males would implicate Sry in TGCT susceptibility and resolve the ambiguity in the wake of the two studies.
5.3 CONCLUSIONS
The goal of my thesis research was to identify chromosomes and chromosomal regions involved in TGCT susceptibility in strain 129/Sv mice. To identify chromosomes with TGCT QTLs, I screened 2,527 backcross males from 50 incipient CSSs. I designed a mathematical model to predict the effect of a dominant QTL affecting TGCT prevalence. Using the model, I found statistical support for TGCT QTLs in 3 of the 50
CSSs (129-Chr 2MOLF, 129-Chr 18MOLF, 129-Chr 6B6). I concluded that at least 3 of the
50 incipient CSSs had QTLs affecting TGCT prevalence as adults.
I made a panel of eight overlapping congenic strains from 129-Chr 18MOLF to map
the TGCT QTLs on chromosome 18. I surveyed 1,365 congenic males for TGCTs and
found statistical support for three TGCT QTLs on chromosome 18. I concluded that
chromosome 18 has three loci affecting TGCT prevalence as adults.
111
I also used a sex-reversing mutant (Odd Sex) to evaluate the necessity of the Y chromosome in TGCT development. I surveyed 547 XY normal males and 137 XX sex- reversed males for TGCTs as adults. Although XY males developed TGCTs at an appreciable rate (13%), XX males did not develop TGCTs. I concluded that at least one
factor on the Y chromosome was necessary for TGCTs.
.
112
6 CHAPTER 6: Appendices
113
terrogation primers contain a The sizes of the chromosomes in cM map positions of the markers were inferred from the of map positions n primers are given. Some in r Biotechnology Information [NCBI]’s MapViewer Information r Biotechnology truct the partial 129.MOLF CSS panel. r multiplexing the reactions. the reactions. r multiplexing
114 5’ “leader” sequence used fo were determined using the National Center fo using the National were determined Genetic (http://www.ncbi.nlm.nih.gov/genome/guide/mouse/). interrogatio and reverse The forward, MIT markers. flanking Appendix I: SNP markers used to cons
Appendix II: Microsatellite markers used to construct the partial 129.MOLF CSS panel. The sizes of the chromosomes in cM were determined using the National Center for Biotechnology Information [NCBI]’s MapViewer (http://www.ncbi.nlm.nih.gov/genome/guide/mouse/). The marker names, primer sequences and estimated product sizes were obtained from the Center for Inherited Disease Research website (http://www.cidr.jhmi.edu/mouse/mult_inf.html). Genetic map positions of the markers were obtained at the Sloan-Kettering Mouse Project website (https://mouse.mskcc.org/marker/MIT/query.php).
115
Appendix III: Total number of males surveyed per backcross generation for each incipient CSS. The number of males affected with at least one TGCT is indicated in parentheses.
116
Raw data Strain Generations nn affected % affected B6-Chr129 C129-1 15 0 0.0 129-2 21 0 0.0 129-3 3 0 0.0 129-4 9 0 0.0 129-5 5 0 0.0 129-6 36 0 0.0 129-7 62 0 0.0 129-8 48 0 0.0 129-9 17 0 0.0 129-10 16 0 0.0 129-11 13 0 0.0 129-12 23 0 0.0 129-13 27 0 0.0 129-14 20 0 0.0 129-16 8 0 0.0 129-18 24 0 0.0 129-19 28 0 0.0 129-X 35 0 0.0 129-Y 18 0 0.0 129-Mito 21 0 0.0 129 Appendix IV: TGCT data from backcross B6-Chr males. Here I report TGCT prevalence in nineteen incipient CSSs. No statistical tests were performed because no TGCTs were expected and none were found.
117
Location Nearby gene SNP, if known Forward primer Reverse primer in Mb (cM) Zeb1 rs8254980 GGAGCTCTCCGGTTTTACCT GGTTCTACTTGGGGCTCCTC 5.8 (2) Wac rs30930468 ACTGCTGGACCATCTGCTTT CACAAATATTGAAAGGCAAACAA 7.8 (2) Tcerg1 none known TTCCTTCCTGTGGGTCAGTT GCAGCTGCCACAAACTCATT 42.7 (21) Dmxl1 rs48428156 CGAATGGAGAATCAGCAACA AATGCCAGAATCCAACACTG 50.0 (25) Slc14a2 none known CTGTGCATACATGGGAGCTG TTGTGAGGAGGAGGAAGGTG 78.4 (51) Mbp none known GACACCTCGAACACCACCTC CCAGCTAAATCTGCTGAGGG 82.7 (55)
Appendix V: PCR primers used to sequence portions of chromosome 18. Polymorphic SNPs were discovered in the sequenced regions that enabled mapping of the recombination breakpoints of select congenic strains derived from 129-Chr 18MOLF.
118
Appendix VI: Data collected from adult N2s. For simplicity, I denote Sox9Ods as Ods, Dnd1Ter as Ter, and wild-type alleles as +. In the Genotype data section, I report the total number of mice of each of the eight possible N2 genotypes. In the TGCT data section I report the number, percent affected and laterality of TGCTs for six N2 genotypes. XX N2s lacking Ods are not included in the TGCT data section because they are phenotypic females and so do not develop testicular tumors. Approximately 60% of the XX Ods/+ N2s developed as sex-reversed males and are included in the TGCT data section.
Genotype data
Genotypes n n
Total XX Ods 231 Total XY wt 274 XX Ods/+ Ter/+ 129 XY +/+ Ter/+ 149 XX Ods/+ +/+ 102 XY +/+ +/+ 125
Total XY Ods 273 Total XX wt 244 XY Ods/+ Ter/+ 146 XX +/+ Ter/+ 122 XY Ods/+ +/+ 127 XX +/+ +/+ 122
TGCT data
n n n Genotype n affected % affected bilateral unilateral
XY Ods/+ Ter/+ 146 27 18.49 9 18 XY Ods/+ +/+ 127 3 2.36 0 3 XY +/+ Ter/+ 149 42 28.19 13 29 XY +/+ +/+ 125 1 0.80 0 1
Total XY males 547
XX Ods/+ Ter/+ 81 0 0 0 0 XX Ods/+ +/+ 56 0 0 0 0
Total XX males 137
119
7 CHAPTER 7: References
120
ABELOFF, M., J. ARMITAGE, J. NIEDERHUBER, M. KASTAN and G. MCKENNA, 2004 Testicular Cancer in Clinical Oncology. Elsevier Inc, Philadelphia. ADAMAH, D., P. GOKHALE, D. EASTWOOD, E. RAJPERT DE-MEYTS, J. GOEPEL et al., 2006 Dysfunction of the mitotic:meiotic switch as a potential cause of neoplastic conversion of primordial germ cells. Int. J. Androl. 29: 219-227. ALFÖLDI, J. E., 2008 Sequence of the mouse Y chromosome, pp. 93 in MIT Dept. of Biology. Massachusetts Institute of Technology, Cambridge. ANDREWS, P., 2002 From teratocarcinomas to embryonic stem cells. Philos Trans R Soc Lond B Biol Sci 357: 405-417. BEDELL, M. A., C. I. BRANNAN, E. P. EVANS, N. G. COPELAND, N. A. JENKINS et al., 1995 DNA rearrangements located over 100 kb 5' of the Steel (Sl)-coding region in Steel-panda and Steel-contrasted mice deregulate Sl expression and cause female sterility by disrupting ovarian follicle development. Genes Dev. 9: 455-470. BEHRMAN, R. E., R. M. KLIEGMAN, and H. B. JENSON, 2004 Gonadal and Germ Cell Neoplasms.in Nelson Textbook of Pediatrics. 17 ed. Elsevier Inc, Philadelphia. BELKNAP, J., 2003 Chromosome substitution strains: some quantitative considerations for genome scans and fine mapping. Mamm. Genome 14: 723-732. BENNETT, D., 1956 Developmental analysis of a mutation with pleiotropic effects in the mouse. J. Morphol. 98: 199-233. BERRY, L. W., B. WESTLUND and T. SCHEDL, 1997 Germ-line tumor formation caused by activation of glp-1, a Caenorhabditis elegans member of the Notch family of receptors. Development 124: 925-936. BHATTACHARYA, C., S. AGGARWAL, R. ZHU, M. KUMAR, M. ZHAO et al., 2007 The mouse dead-end gene isoform [alpha] is necessary for germ cell and embryonic viability. Biochem. Biophys. Res. Commun. 355: 194-199. BISHOP, C. E., D. J. WHITWORTH, Y. QIN, A. I. AGOULNIK, I. U. AGOULNIK et al., 2000 A transgenic insertion upstream of Sox9 is associated with dominant XX sex reversal in the mouse. Nat. Genet. 26: 490-494. BISHOP, D., 1998 Candidate regions for testicular cancer susceptibility genes. APMIS 106: 64-70. BONHOMME, F., and J.-L. GUÉNET, 1996 The laboratory mouse and its wild relatives, pp. 1577-1596 in Genetic Variants and Strains of the Laboratory Mouse, edited by S. LYON, S. RASTAN and S. BROWN. Oxford University Press, Oxford. BOWLES, J., and P. KOOPMAN, 2007 Retinoic acid, meiosis and germ cell fate in mammals. Development 134: 3401-3411. BRAUN, M. M., A. AHLBOM, B. FLODERUS, L. A. BRINTON and R. N. HOOVER, 1995 Effect of twinship on incidence of cancer of the testis, breast, and other sites (Sweden). Cancer Causes Control 6: 519-524. BUEHR, M., A. MCLAREN, A. BARTLEY and S. DARLING, 1993 Proliferation and migration of primordial germ cells in We/We mouse embryos. Dev. Dyn. 198: 182-189. BURGER, H., K. NOOTER, A. BOERSMA, K. VAN WINGERDEN, L. LOOIJENGA et al., 1999 Distinct p53-independent apoptotic cell death signalling pathways in testicular germ cell tumour cell lines. Int. J. Cancer 81: 620-628. BURRAGE, L. C., 2006 Genetic resistance to diet-induced obesity in mice, in Genetics. Case Western Reserve University, Cleveland.
121
CHABOISSIER, M.-C., A. KOBAYASHI, V. I. P. VIDAL, S. LUTZKENDORF, H. J. G. VAN DE KANT et al., 2004 Functional analysis of Sox8 and Sox9 during sex determination in the mouse. Development 131: 1891-1901. CHAMBERS, I., D. COLBY, M. ROBERTSON, J. NICHOLS, S. LEE et al., 2003 Functional Expression Cloning of Nanog, a Pluripotency Sustaining Factor in Embryonic Stem Cells. Cell 113: 643-655. CHUNG, S., and D. WOLGEMUTH, 2004 Role of retinoid signaling in the regulation of spermatogenesis. Cytogenet. Genome Res. 105: 189-202. COLLIN, G., 1994 Genetic control of testicular germ cells teratocarcinogenesis in 129/Sv mice, in Microbiology. University of Maine, Fort Kent. COLLIN, G. B., Y. ASADA, D. S. VARNUM and J. H. NADEAU, 1996 DNA pooling as a quick method for finding candidate linkages in multigenic trait analysis: an example involving susceptibility to germ cell tumors. Mamm. Genome 7: 68-70. COLLS, B. M., V. J. HARVEY, L. SKELTON, P. I. THOMPSON and C. M. FRAMPTON, 1996 Bilateral germ cell testicular tumors in New Zealand: experience in Auckland and Christchurch 1978-1994. J. Clin. Oncol. 14: 2061-2065. COPELAND, N. G., D. J. GILBERT, B. C. CHO, P. J. DONOVAN, N. A. JENKINS et al., 1990 Mast cell growth factor maps near the steel locus on mouse chromosome 10 and is deleted in a number of steel alleles. Cell 63: 175-183. COULOMBRE, J. L., and E. S. RUSSEL, 1954 Analysis of the pleiotropism at the W-locus in the mouse: The effects of W and Wv substitution upon postnatal development of germ cells. J. Exp. Zool. 126: 277-296. CROCKFORD, G. P., R. LINGER, S. HOCKLEY, D. DUDAKIA, L. JOHNSON et al., 2006 Genome-wide linkage screen for testicular germ cell tumour susceptibility loci. Hum. Mol. Genet. 15: 443-451. DA SILVA, S. M., A. HACKER, V. HARLEY, P. GOODFELLOW, A. SWAIN et al., 1996 Sox9 expression during gonadal development implies a conserved role for the gene in testis differentiation in mammals and birds. Nat. Genet. 14: 62-68. DAMJANOV, I., 1984 Recent advances in the understanding of the pathology of testicular germ-cell tumors. World J. Urol. 2: 12-17. DIECKMANN, K. P., and U. PICHLMEIER, 2004 Clinical epidemiology of testicular germ cell tumors. World J. Urol. 22: 2-14. DIETRICH, W., H. KATZ, S. E. LINCOLN, H. S. SHIN, J. FRIEDMAN et al., 1992 A Genetic Map of the Mouse Suitable for Typing Intraspecific Crosses. Genetics 131: 423- 447. DIXON, F., and R. MOORE, 1952 Tumors of the male sex organs. Atlas of Tumor Pathology, pp. 50. Armed Forces Institute of Pathology, Washington DC. DONEHOWER, L. A., M. HARVEY, B. L. SLAGLE, M. J. MCARTHUR, C. A. MONTGOMERY et al., 1992 Mice deficient for p53 are developmentally normal but susceptible to spontaneous tumours. Nature 356: 215-221. DURHAM, F., 1908 A preliminary account of the inheritance of coat colour in mice. Rep. Evol. Com. Roy. Soc. 4: 41-53. FALLON, R., A. OLSHAN and S. SAXMAN, 2006 Male Genital Tract Cancer. in Cancer Epidemiology in Older Adolescents and Young Adults 15 to 29 Years of Age, Including SEER Incidence and Survival: 1975-2000., edited by A. BLEYER, M. O'LEARY, R. BARR and L. RIES. NIH, Bethesda, MD.
122
FORMAN, D., R. GALLAGHER, H. MØLLER and T. SWERDLOW, 1990 Aetiology and epidemiology of testicular cancer: report of consensus group. Prog Clin Biol Res 357: 245-253. FORMAN, D., R. OLIVER, A. BRETT, S. MARSH, J. MOSES et al., 1992 Familial testicular cancer: a report of the UK family register, estimation of risk and an HLA class 1 sib-pair analysis. Br. J. Cancer 65: 255-262. FRIEDMAN, N., and R. MOORE, 1946 Tumors of the testis. A report on 922 cases. Mil. Surg. 99: 573-593. GIDEKEL, S., G. PIZOV, Y. BERGMAN and E. PIKARSKY, 2003 Oct-3/4 is a dose-dependent oncogenic fate determinant. Cancer Cell 4: 361-370. GINALSKI, K., L. RYCHLEWSKI, D. BAKER and N. V. GRISHIN, 2004 Protein structure prediction for the male-specific region of the human Y chromosome. PNAS 101: 2305-2310. GINSBURG, M., M. SNOW and A. MCLAREN, 1990 Primordial germ cells in the mouse embryo during gastrulation. Development 110: 521-528. GUÉNET, J.-L., C. M. NAGAMINE, D. SIMON-CHAZOTTES, X. MONTAGUTELLI and F. BONHOMME, 1990 Hst-3: an X-linked hybrid sterility gene. Genet. Res. 56: 163- 165. HAMMOND, S., R. ZHU, K. YOUNGREN, J. LAM, P. ANDERSON et al., 2007 Chromosome X modulates incidence of testicular germ cell tumors in Ter mice. Mamm. Genome 18: 832-838. HARDELL, L., A. NASMAN, C. OHLSON and M. FREDRIKSON, 1998 Case-control study on risk factors for testicular cancer. Int. J. Oncol. 13: 1299-1303. HARTLEY, A. L., J. M. BIRCH, A. M. KELSEY, H. B. MARSDEN, M. HARRIS et al., 1989 Are germ cell tumors part of the Li-Fraumeni cancer family syndrome? Cancer Genet. Cytogenet. 42: 221-226. HARVEY, M., M. J. MCARTHUR, C. A. MONTGOMERY, JR., A. BRADLEY and L. A. DONEHOWER, 1993 Genetic background alters the spectrum of tumors that develop in p53- deficient mice. FASEB J. 7: 938-943. HASTON, C. K., and T. J. HUDSON, 2005 Finding Genetic Modifiers of Cystic Fibrosis. N Engl J Med 353: 1509-1511. HAUGHEY, B. P., S. GRAHAM, J. BRASURE, M. ZIELEZNY, G. SUFRIN et al., 1989 The epidemiology of testicular cancer in upstate New York. Am. J. Epidemiol. 130: 25-36. HAYASHI, K., S. M. CHUVA DE SOUSA LOPES, M. KANEDA, F. TANG, P. HAJKOVA et al., 2008 MicroRNA Biogenesis Is Required for Mouse Primordial Germ Cell Development and Spermatogenesis. PLoS ONE 3: e1738. HEANEY, J. D., M.-Y. J. LAM, M. V. MICHELSON and J. H. NADEAU, 2008 Loss of the Transmembrane but not the Soluble Kit Ligand Isoform Increases Testicular Germ Cell Tumor Susceptibility in Mice. Cancer Res. 68: 5193-5197. HEANEY, J. D., and J. H. NADEAU, 2008 Testicular Germ Cell Tumors in Mice, pp. 211- 231 in Germline Stem Cells. HEIMDAL, K., H. OLSSON, S. TRETLI, P. FLODGREN, A. BØRRESEN et al., 1996 Familial testicular cancer in Norway and southern Sweden. Br. J. Cancer 73: 964-969.
123
HIRAMATSU, R., S. MATOBA, M. KANAI-AZUMA, N. TSUNEKAWA, Y. KATOH-FUKUI et al., 2009 A critical time window of Sry action in gonadal sex determination in mice. Development 136: 129-138. HODGES, C. A., E. REVENKOVA, R. JESSBERGER, T. J. HASSOLD and P. A. HUNT, 2005 SMC1[beta]-deficient female mice provide evidence that cohesins are a missing link in age-related nondisjunction. Nat. Genet. 37: 1351-1355. HOFF WANDERÅS, E., S. D. FOSSÅ and S. TRETLI, 1997 Risk of a second germ cell cancer after treatment of a primary germ cell cancer in 2201 norwegian male patients. Eur. J. Cancer 33: 244-252. HOLLSTEIN, M., D. SIDRANSKY, B. VOGELSTEIN and C. C. HARRIS, 1991 p53 mutations in human cancers. Science 253: 49-53. ISAACS, H., 2004 Perinatal (fetal and neonatal) germ cell tumors. J. Pediatr. Surg. 39: 1003-1013. JACKS, T., L. REMINGTON, B. O. WILLIAMS, E. M. SCHMITT, S. HALACHMI et al., 1994 Tumor spectrum analysis in p53-mutant mice. Curr. Biol. 4: 1-7. JACOBSEN, R., E. BOSTOFTE, G. ENGHOLM, J. HANSEN, J. H. OLSEN et al., 2000 Risk of testicular cancer in men with abnormal semen characteristics: cohort study. BMJ 321: 789-792. JEMAL, A., R. SIEGEL, E. WARD, T. MURRAY, J. XU et al., 2006 Cancer Statistics, 2006. CA Cancer J Clin 56: 106-130. KAPLAN, J., H. KUDISH and S. SACKS, 1981 Testicular tumors of germ cell origin. 1. Epidemiology, pathogenesis, clinical presentation, and diagnosis. Postgrad Med 70: 114-121. KEDDE, M., M. J. STRASSER, B. BOLDAJIPOUR, J. A. F. O. VRIELINK, K. SLANCHEV et al., 2007 RNA-Binding Protein Dnd1 Inhibits MicroRNA Access to Target mRNA. Cell 131: 1273-1286. KENT, J., S. C. WHEATLEY, J. E. ANDREWS, A. H. SINCLAIR and P. KOOPMAN, 1996 A male-specific role for SOX9 in vertebrate sex determination. Development 122: 2813-2822. KERLEY-HAMILTON, J. S., A. M. PIKE, N. LI, J. DIRENZO and M. J. SPINELLA, 2005 A p53-dominant transcriptional response to cisplatin in testicular germ cell tumor- derived human embyronal carcinoma. Oncogene 24: 6090-6100. KERSEMAEKERS, A.-M. F., F. MAYER, M. MOLIER, P. C. VAN WEEREN, J. W. OOSTERHUIS et al., 2002 Role of P53 and MDM2 in Treatment Response of Human Germ Cell Tumors. J. Clin. Oncol. 20: 1551-1561. KIMURA, T., A. SUZUKI, Y. FUJITA, K. YOMOGIDA, H. LOMELI et al., 2003 Conditional loss of PTEN leads to testicular teratoma and enhances embryonic germ cell production. Development 130: 1691-1700. KLEIMAN, S., L. YOGEV, R. HAUSER, A. BOTCHAN, B. BAR-SHIRA MAYMON et al., 2003 Members of the CDY family have different expression patterns: CDY1 transcripts have the best correlation with complete spermatogenesis. Hum. Genet. 113: 486- 492. KNIGHT, J.A., L. MARRETT and H. K. WEIR, 1996 Occupation and risk of germ cell testicular cancer by histologic type in Ontario. J Occup Environ Med 38: 884-890. KRAIN, L., 1973 Testicular cancer in California from 1942 to 1969: the California Tumor Registry Experience. Oncology 27: 45-51.
124
KUMAR, V., A. ABBAS and N. FAUSTO, 2005 Robbins and Cotran Pathologic Basis of Disease. Elsevier, Inc, Philadelphia. LAM, M.-Y. J., J. D. HEANEY, K. K. YOUNGREN, J. H. KAWASOE and J. H. NADEAU, 2007 Trans-generational epistasis between Dnd1Ter and other modifier genes controls susceptibility to testicular germ cell tumors. Hum. Mol. Genet. 16: 2233-2240. LAM, M.-Y. J., K. K. YOUNGREN and J. H. NADEAU, 2004 Enhancers and Suppressors of Testicular Cancer Susceptibility in Single- and Double-Mutant Mice. Genetics 166: 925-933. LAWSON, K., and W. HAGE, 1994 Clonal analysis of the origin of primordial germ cells in the mouse. Ciba Found Symp 182: 68-84. LEVIN, H., 2000 Tumors of the testis in intersex syndromes. Urol. Clin. North Am. 27: 543-551. LILFORD, R., A. M. JONES, D. T. BISHOP, J. THORNTON and R. MUELLER, 1994 Case- control study of whether subfertility in men is familial. Br. Med. J. (Clin. Res. Ed). 309: 570-573. LINDELÖF, B., and G. EKLUND, 2001 Analysis of hereditary component of cancer by use of a familial index by site. Lancet 358: 1696-1698. LINGER, R., D. DUDAKIA, R. HUDDART, D. EASTON, D. T. BISHOP et al., 2007 A physical analysis of the Y chromosome shows no additional deletions, other than Gr//Gr, associated with testicular germ cell tumour. Br. J. Cancer 96: 357-361. LIU, S., R. SEMENCIW, C. WATERS, S. W. WEN, L. S. MERY et al., 2000 Clues to the aetiological heterogeneity of testicular seminomas and non-seminomas: time trends and age-period-cohort effects. Int. J. Epidemiol. 29: 826-831. LUTKE HOLZIK, M. F., H. J. HOEKSTRA, R. H. SIJMONS, D. J. A. SONNEVELD, G. VAN DER STEEGE et al., 2006 Re-analysis of the Xq27-Xq28 region suggests a weak association of an X-linked gene with sporadic testicular germ cell tumour without cryptorchidism. Eur. J. Cancer 42: 1869-1874. LUTKE HOLZIK, M. F., E. A. RAPLEY, H. J. HOEKSTRA, D. T. SLEIJFER, I. NOLTE et al., 2004 Genetic predisposition to testicular germ-cell tumours. Lancet Onc 5: 363- 371. LUTKE HOLZIK, M. F., R. H. SIJMONS, D. T. SLEIJFER, D. J. A. SONNEVELD, J. E. H. M. HOEKSTRA-WEEBERS et al., 2003 Syndromic aspects of testicular carcinoma. Cancer 97: 984-992. LUTZKER, S., R. MATHEW and D. TALLER, 2001 A p53 dose-response relationship for sensitivity to DNA damage in isogenic teratocarcinoma cells. Oncogene 20: 2982-2986. LYNCH, M., D. S. CRAM, A. REILLY, M. K. O'BRYAN, H. W. G. BAKER et al., 2005 The Y chromosome gr/gr subdeletion is associated with male infertility. Mol. Hum. Reprod. 11: 507-512. MAKRIS, A., C. PATRIOTIS, S. E. BEAR and P. N. TSICHLIS, 1993 Genomic organization and expression of Tpl-2 in normal cells and Moloney murine leukemia virus- induced rat T-cell lymphomas: activation by provirus insertion. J. Virol. 67: 4283- 4289. MALEK, R. L., H.-Y. WANG, A. E. KWITEK, A. S. GREENE, N. BHAGABATI et al., 2006 Physiogenomic resources for rat models of heart, lung and blood disorders. Nat. Genet. 38: 234-239.
125
MARTIN, G. R., and M. J. EVANS, 1974 The morphology and growth of a pluripotent teratocarcinoma cell line and its derivatives in tissue culture. Cell 2: 163-172. MATIN, A., G. B. COLLIN, Y. ASADA, D. VARNUM, D. L. MARTONE et al., 1998 Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm. Genome 9: 668-670. MATIN, A., G. B. COLLIN, Y. ASADA, D. VARNUM and J. H. NADEAU, 1999 Susceptibility to testicular germ-cell tumours in a 129.MOLF-Chr 19 chromosome substitution strain. Nat. Genet. 23: 237-240. MAXSON, S. C., B. E. GINSBURG and A. TRATTNER, 1979 Interaction of Y-chromosomal and autosomal gene(s) in the development of intermale aggression in mice. Behav. Genet. 9: 219-226. MCGLYNN, K. A., S. S. DEVESA, B. I. GRAUBARD and P. E. CASTLE, 2005 Increasing Incidence of Testicular Germ Cell Tumors Among Black Men in the United States. J. Clin. Oncol. 23: 5757-5761. MELICOW, M., 1955 Classification of tumors of testis: a clinical and pathological study based on 105 primary and 13 secondary cases in adults, and 3 primary and 4 secondary cases in children. J. Urol. 73: 547-574. MENDELSOHN, J., P. M. HOWLEY, M. A. ISRAEL, and L.A. LIOTTA, 2001 Molecular Basis of Cancer, 2nd ed. W.B. Saunders Company, Philadelphia. MILLWARD, C., L. BURRAGE, H. SHAO, D. SINASAC, J. KAWASOE et al., 2009 Genetic factors for resistance to diet-induced obesity and associated metabolic traits on mouse chromosome 17. Mamm. Genome 20: 71-82. MØLLER, H., A. PRENER and N. SKAKKEBAEK, 1996 Testicular cancer, cryptorchidism, inguinal hernia, testicular atrophy, and genital malformations: case-control studies in Denmark. Cancer Causes Control 7: 264-274. MORIWAKI, K., 1994 Wild mouse from a geneticist's viewpoint, pp. xiii-xxiv in Genetics in Wild Mice; Its Application to Biomedical Research, edited by K. MORIWAKI, T. SHIROISHI and H. YONEKAWA. Japan Scientific Press and Karger, Tokyo. MULLER, A. J., A. K. TERESKY and A. J. LEVINE, 2000 A male germ cell tumor- susceptibility-determining locus, pgct1, identified on murine chromosome 13. PNAS 97: 8421-8426. NADEAU, J. H., 2001 Modifier genes in mice and humans. Nat. Rev. Genet. 2: 165-174. NADEAU, J. H., J. B. SINGER, A. MATIN and E. S. LANDER, 2000 Analysing complex genetic traits with chromosome substitution strains. Nat. Genet. 24: 221-225. NAGAMINE, C. M., Y. NISHIOKA, K. MORIWAKI, P. BOURSOT, F. BONHOMME et al., 1992 The musculus-type Y Chromosome of the laboratory mouse is of Asian origin. Mamm. Genome 3: 84-91. NATHANSON, K. L., P. A. KANETSKY, R. HAWES, D. J. VAUGHN, R. LETRERO et al., 2005 The Y Deletion gr/gr and Susceptibility to Testicular Germ Cell Tumor. Am. J. Hum. Genet. 77: 1034-1043. NICHOLS, C. R., N. A. HEEREMA, C. PALMER, LOEHRER PJ, SR., S. D. WILLIAMS et al., 1987 Klinefelter's syndrome associated with mediastinal germ cell neoplasms. J. Clin. Oncol. 5: 1290-1294. NICHOLS, J., B. ZEVNIK, K. ANASTASSIADIS, H. NIWA, D. KLEWE-NEBENIUS et al., 1998 Formation of Pluripotent Stem Cells in the Mammalian Embryo Depends on the POU Transcription Factor Oct4. Cell 95: 379-391.
126
NICHOLSON, P., and S. HARLAND, 1995 Inheritance and testicular cancer. Br. J. Cancer 71: 421-426. NOGUCHI, T., and M. NOGUCHI, 1985 A recessive mutation (Ter) causing germ cell deficiency and a high incidence of congenital testicular teratomas in 129/Sv-Ter mice. J. Natl. Cancer Inst. 75: 385-392. OHINATA, Y., B. PAYER, D. O'CARROLL, K. ANCELIN, Y. ONO et al., 2005 Blimp1 is a critical determinant of the germ cell lineage in mice. Nature 436: 207-213. OKA, A., A. MITA, N. SAKURAI-YAMATANI, H. YAMAMOTO, N. TAKAGI et al., 2004 Hybrid Breakdown Caused by Substitution of the X Chromosome Between Two Mouse Subspecies. Genetics 166: 913-924. OOSTERHUIS, J., S. CASTEDO, B. DE JONG, C. CORNELISSE, A. DAM et al., 1989 Ploidy of primary germ cell tumors of the testis. Pathogenetic and clinical relevance. Lab. Invest. 60: 14-21. ORR, H. A., 1993 Haldane's rule has multiple genetic causes. Nature 361: 532-533. OULAD-ABDELGHANI, M., P. BOUILLET, D. DECIMO, A. GANSMULLER, S. HEYBERGER et al., 1996 Characterization of a premeiotic germ cell-specific cytoplasmic protein encoded by Stra8, a novel retinoic acid-responsive gene. J. Cell Biol. 135: 469- 477. PATRIOTIS, C., A. MAKRIS, S. E. BEAR and P. N. TSICHLIS, 1993 Tumor progression locus-2 (TPL-2) encodes a protein-kinase involved in the progression of rodent T- cell lymphomas and in T-cell activation. PNAS 90: 2251-2255. PATRIOTIS, C., A. MAKRIS, J. CHERNOFF and P. N. TSICHLIS, 1994 Tpl-2 acts in concert with Ras and Raf-1 to activate mitogen-activated protein kinase. PNAS 91: 9755- 9759. PENG, H.-Q., D. HOGG, D. MALKIN, D. BAILEY, B. L. GALLIE et al., 1993 Mutations of the p53 Gene Do Not Occur in Testis Cancer. Cancer Res. 53: 3574-3578. PETERSEN, P., N. SKAKKEBÆK and A. GIWERCMAN, 1998 Gonadal function in men with testicular cancer: biological and clinical aspects. APMIS 106: 24-34. POWER, D., R. BROWN, C. BROCK, H. PAYNE, A. MAJEED et al., 2001 Trends in testicular carcinoma in England and Wales, 1971-1999. BJU Int 87: 361-365. QIN, Y., L.-K. KONG, C. POIRIER, C. TRUONG, P. A. OVERBEEK et al., 2004 Long-range activation of Sox9 in Odd Sex (Ods) mice. Hum. Mol. Genet. 13: 1213-1218. QIN, Y., C. POIRIER, C. TRUONG, A. SCHUMACHER, A. I. AGOULNIK et al., 2003 A major locus on mouse chromosome 18 controls XX sex reversal in Odd Sex (Ods) mice. Hum. Mol. Genet. 12: 509-515. RAPLEY, E., G. CROCKFORD, D. EASTON, M. STRATTON, D. BISHOP et al., 2003 Localisation of susceptibility genes for familial testicular germ cell tumour. APMIS 111: 128-133. RAPLEY, E. A., G. P. CROCKFORD, D. TEARE, P. BIGGS, S. SEAL et al., 2000 Localization to Xq27 of a susceptibility gene for testicular germ-cell tumours. Nat. Genet. 24: 197-200. REIJO, R., T.-Y. LEE, P. SALO, R. ALAGAPPAN, L. G. BROWN et al., 1995 Diverse spermatogenic defects in humans caused by Y chromosome deletions encompassing a novel RNA-binding protein gene. Nat. Genet. 10: 383-393. REPPING, S., H. SKALETSKY, L. BROWN, S. K. M. VAN DAALEN, C. M. KORVER et al., 2003 Polymorphism for a 1.6-Mb deletion of the human Y chromosome persists
127
through balance between recurrent mutation and haploid selection. Nat. Genet. 35: 247-251. REVENKOVA, E., M. EIJPE, C. HEYTING, C. A. HODGES, P. A. HUNT et al., 2004 Cohesin SMC1[beta] is required for meiotic chromosome dynamics, sister chromatid cohesion and DNA recombination. Nat. Cell Biol. 6: 555-562. RICHIARDI, L., O. AKRE, R. BELLOCCO and A. EKBOM, 2002 Perinatal determinants of germ-cell testicular cancer in relation to histological subtypes. Br. J. Cancer 87: 545-550. RICHIARDI, L., R. BELLOCCO, H.-O. ADAMI, A. TORRANG, L. BARLOW et al., 2004 Testicular Cancer Incidence in Eight Northern European Countries: Secular and Recent Trends. Cancer Epidemiol. Biomarkers Prev. 13: 2157-2166. RODOVALHO, R., J. ARRUDA and K. MOURA, 2008 Tracking microdeletions of the AZF region in a patrilineal line of infertile men. Gen. Mol. Res. 7: 614-622. ROSENBERG, C., R. VAN GURP, E. GEELEN, J. OOSTERHUIS and L. LOOIJENGA, 2000 Overrepresentation of the short arm of chromosome 12 is related to invasive growth of human testicular seminomas and nonseminomas. Oncogene 19: 5858- 5862. RUNYAN, C., K. SCHAIBLE, K. MOLYNEAUX, Z. WANG, L. LEVIN et al., 2006 Steel factor controls midline cell death of primordial germ cells and is essential for their normal proliferation and migration. Development 133: 4861-4869. RÜTHER, U., K. P. DIECKMANN, R. BUSSAR-MAATZ and F. EISENBERGER, 2000 Second Malignancies following Pure Seminoma. Oncology 58: 75-82. SANDBERG, A. A., A. M. MELONI and R. F. SUIJKERBUIJK, 1996 Reviews of Chromosome Studies in Urological Tumors. III. Cytogenetics and Genes in Testicular Tumors. J. Urol. 155: 1531-1556. SARVELLA, P., and L. RUSSELL, 1956 Steel, a new dominant gene in the house mouse. J. Hered. 45: 19-20. SATO, M., T. KIMURA, K. KUROKAWA, Y. FUJITA, K. ABE et al., 2002 Identification of PGC7, a new gene expressed specifically in preimplantation embryos and germ cells. Mech Dev 113: 91-94. SCHOLER, H. R., S. RUPPERT, N. SUZUKI, K. CHOWDHURY and P. GRUSS, 1990 New type of POU domain in germ line-specific protein Oct-4. Nature 344: 435-439. SCHOTTENFELD, D., M. E. WARSHAUER, S. SHERLOCK, A. G. ZAUBER, M. LEDER et al., 1980 The epidemiology of testicular cancer in young adults. Am. J. Epidemiol. 112: 232-246. SHAH, M. N., S. S. DEVESA, K. ZHU and K. A. MCGLYNN, 2007 Trends in testicular germ cell tumours by ethnic group in the United States. Int. J. Androl. 30: 206-214. SHAO, H., L. C. BURRAGE, D. S. SINASAC, A. E. HILL, S. R. ERNEST et al., 2008 Genetic architecture of complex traits: Large phenotypic effects and pervasive epistasis. PNAS 105: 19910-19914. SILVER, L., 1995 Mouse genetics: Concepts and applications. Oxford University Press, New York. SIMPSON, E. M., C. C. LINDER, E. E. SARGENT, M. T. DAVISSON, L. E. MOBRAATEN et al., 1997 Genetic variation among 129 substrains and its importance for targeted mutagenesis in mice. Nat. Genet. 16: 19-27.
128
SINCLAIR, A. H., P. BERTA, M. S. PALMER, J. R. HAWKINS, B. L. GRIFFITHS et al., 1990 A gene from the human sex-determining region encodes a protein with homology to a conserved DNA-binding motif. Nature 346: 240-244. SINGER, J. B., A. E. HILL, L. C. BURRAGE, K. R. OLSZENS, J. SONG et al., 2004 Genetic Dissection of Complex Traits with Chromosome Substitution Strains of Mice. Science 304: 445-448. SKAKKEBÆK, N., E. RAJPERT-DE MEYTS, N. JØRGENSEN, K. MAIN, H. LEFFERS et al., 2007 Testicular cancer trends as 'whistle blowers' of testicular developmental problems in populations. Int. J. Androl. 30: 198-205. SKAKKEBÆK, N. E., E. RAJPERT-DE MEYTS and K. M. MAIN, 2001 Testicular dysgenesis syndrome: an increasingly common developmental disorder with environmental aspects: Opinion. Hum. Reprod. 16: 972-978. STEVENS, L.C., 1962 Testicular teratomas in fetal mice. J. Natl. Cancer Inst. 28: 247-267. STEVENS, L.C., 1964 Experimental production of testicular teratomas in mice. PNAS 52: 654-661. STEVENS, L. C., 1967a The Biology of Teratomas. Adv. Morphog. 6: 1-31. STEVENS, L. C., 1967b Origin of testicular teratomas from primordial germ cells in mice. J. Natl. Cancer Inst. 38: 549-552. STEVENS, L. C., 1973 A new inbred subline of mice (129-TerSv) with a high incidence of spontaneous congenital testicular teratomas. J. Natl. Cancer Inst. 50: 235-239. STEVENS, L. C., and K. P. HUMMEL, 1957 A description of spontaneous congenital testicular teratomas in strain 129 mice. J. Natl. Cancer Inst. 18: 719-747. STEVENS, L. C., and C C. LITTLE, 1954 Spontaneous testicular teratomas in an inbred strain of mice. PNAS 40: 1080-1087. STEVENS, L. C., and J. MACKENSON, 1961 Genetic and environmental influences on teratocarcinogenesis in mice. J. Natl. Cancer Inst. 27: 443-453. STORCHOVÁ, R., S. GREGOROVÁ, D. BUCKIOVÁ, V. KYSELOVÁ, P. DIVINA et al., 2004 Genetic analysis of X-linked hybrid sterility in the house mouse. Mamm. Genome 15: 515-524. SUMMERSGILL, B., P. OSIN, Y. J. LU, R. HUDDART and J. SHIPLEY, 2001 Chromosomal imbalances associated with carcinoma in situ and associated testicular germ cell tumours of adolescents and adults. Br. J. Cancer 85: 213-219. SUTCLIFFE, M. J., and P. S. BURGOYNE, 1989 Analysis of the testes of H-Y negative XOSxrb mice suggests that the spermatogenesis gene (Spy) acts during the differentiation of the A spermatogonia. Development 107: 373-380. SWERDLOW, A. J., B. L. DE STAVOLA, M. A. SWANWICK and N. E. S. MACONOCHIE, 1997 Risks of breast and testicular cancers in young adult twins in England and Wales: evidence on prenatal and genetic aetiology. The Lancet 350: 1723-1728. TALERMAN, A., 1985 Germ cell tumours. Ann. Pathol. 5: 145-157. TAM, P. P. L., and M. H. L. SNOW, 1981 Proliferation and migration of primordial germ cells during compensatory growth in mouse embryos. J Embryol Exp Morphol 64: 133-147. TAM, P. P. L., and S. X. ZHOU, 1996 The Allocation of Epiblast Cells to Ectodermal and Germ-Line Lineages Is Influenced by the Position of the Cells in the Gastrulating Mouse Embryo. Dev. Biol. 178: 124-132.
129
THREADGILL, D. W., D. YEE, A. MATIN, J. H. NADEAU and T. MAGNUSON, 1997 Genealogy of the 129 inbred strains: 129/SvJ is a contaminated inbred strain. Mamm. Genome 8: 390-393. TIEPOLO, L., and O. ZUFFARDI, 1976 Localization of factors controlling spermatogenesis in the nonfluorescent portion of the human y chromosome long arm. Hum. Genet. 34: 119-124. TOKUZAWA, Y., E. KAIHO, M. MARUYAMA, K. TAKAHASHI, K. MITSUI et al., 2003 Fbx15 Is a Novel Target of Oct3/4 but Is Dispensable for Embryonic Stem Cell Self- Renewal and Mouse Development. Mol. Cell. Biol. 23: 2699-2708. TUCKER, P. K., B. K. LEE, B. L. LUNDRIGAN and E. M. EICHER, 1992 Geographic origin of the Y Chromosomes in “old” inbred strains of mice. Mamm. Genome 3: 254- 261. VERNET, N., C. DENNEFELD, C. ROCHETTE-EGLY, M. OULAD-ABDELGHANI, P. CHAMBON et al., 2006 Retinoic Acid Metabolism and Signaling Pathways in the Adult and Developing Mouse Testis. Endocrinology 147: 96-110. VIDAL, V. P. I., M.-C. CHABOISSIER, D. G. DE ROOIJ and A. SCHEDL, 2001 Sox9 induces testis development in XX transgenic mice. Nat. Genet. 28: 216-217. VOGT, P., 2004 Molecular Genetic of Human Male Infertility: From Genes to New Therapeutic Perspectives. Curr. Pharm. Des. 10: 471-500. VÖLKL, T. M. K., T. LANGER, T. AIGNER, H. GREESS, J. D. BECK et al., 2006 Klinefelter syndrome and mediastinal germ cell tumors. Am. J. Med. Genet. A 140A: 471- 481. WEIDINGER, G., J. STEBLER, K. SLANCHEV, K. DUMSTREI, C. WISE et al., 2003 dead end, a Novel Vertebrate Germ Plasm Component, Is Required for Zebrafish Primordial Germ Cell Migration and Survival. Curr. Biol. 13: 1429-1434. YAMAJI, M., Y. SEKI, K. KURIMOTO, Y. YABUTA, M. YUASA et al., 2008 Critical function of Prdm14 for the establishment of the germ cell lineage in mice. Nat. Genet. 40: 1016-1022. YANG, H., T. A. BELL, G. A. CHURCHILL and F. PARDO-MANUEL DE VILLENA, 2007 On the subspecific origin of the laboratory mouse. Nat. Genet. 39: 1100-1107. YOUNG, R., and R. SCULLY, 1990 Testicular tumors. American Society of Clinical Pathologists Press, Chicago. YOUNGREN, K. K., D. COVENEY, X. PENG, C. BHATTACHARYA, L. S. SCHMIDT et al., 2005 The Ter mutation in the dead end gene causes germ cell loss and testicular germ cell tumours. Nature 435: 360-364. YOUNGREN, K. K., J. H. NADEAU and A. MATIN, 2003 Testicular cancer susceptibility in the 129.MOLF-Chr19 mouse strain: additive effects, gene interactions and epigenetic modifications. Hum. Mol. Genet. 12: 389-398. YUAN, L., J.-G. LIU, J. ZHAO, E. BRUNDELL, B. DANEHOLT et al., 2000 The Murine SCP3 Gene Is Required for Synaptonemal Complex Assembly, Chromosome Synapsis, and Male Fertility. Mol. Cell 5: 73-83.
130