Nordic Journal of Botany NJB-01778 Tendal, K., Larsen, B., Ørgaard, M

Nordic Journal of Botany NJB-01778 Tendal, K., Larsen, B., Ørgaard, M. and Pedersen, C. 2018. Recurrent hybridization events between Primula vulgaris, P. veris and P. elatior (Primulaceae, Ericales) challenge the species boundaries: Using molecular markers to re-evaluate morphological identifications. - Nordic Journal of Botany 2018: e01778

Appendix 1. Map of collection locations. The map shows the eastern part of Denmark and a bit of Sweden with a single location in Scania. Most samples were from the Islands Møn and Lolland in the southern Denmark. The label for Kisserup is partly covered by the label for Lejre. Map was drawn using http://www.gpsvisualizer.com/. Appendix 2. List of Primula accessions with precise indication of collection location, flower morph, ITS-type (HaeIII and RsaI-digestion profile) and chloroplast type (trnL-type). The accessions from which the trnL-fragments were sequenced are indicated.

Amplified Locatio Geographica for >5 Amplified Sanger Accession Species Morph HaeIII RsaI n l coordinates SSR for trnL sequenced markers Møns Klint 54°57'58.6''N 101 P. ×digenea Thrum A CD Yes P. vulgaris (MK), 12°32'55.4''E Møn MK, 54°57'58.6''N Homo- 102 P. elatior A D Yes P. vulgaris Møn 12°32'55.4''E style MK, 54°57'58.6''N 103 P. elatior Pin D Yes P. elatior Møn 12°32'55.4''E MK, 54°57'58.6''N 104 P. ×digenea Pin A D Yes P. vulgaris Møn 12°32'55.4''E MK, 54°57'58.6''N 105 P. ×digenea Thrum A CD Yes P. vulgaris Møn 12°32'55.4''E MK, 54°57'58.6''N 106 P. ×digenea Thrum A CD Yes P. vulgaris Møn 12°32'55.4''E MK, 54°57'58.6''N 107 P. vulgaris Thrum A C Yes P. vulgaris Møn 12°32'55.4''E MK, 54°57'58.6''N 108 P. elatior A Yes P. vulgaris Møn 12°32'55.4''E MK, 54°57'58.6''N 109 P. ×digenea Pin A CD Yes P. vulgaris Møn 12°32'55.4''E MK, 54°57'58.6''N 110 P. elatior A D Yes P. elatior Møn 12°32'55.4''E MK, 54°57'58.6''N 111 P. elatior Thrum A D Yes P. vulgaris Møn 12°32'55.4''E MK, 54°57'58.6''N 112 P. vulgaris Pin A C Yes P. vulgaris Møn 12°32'55.4''E MK, 54°57'58.6''N 113 P. ×digenea Thrum A CD Yes P. vulgaris Møn 12°32'55.4''E MK, 54°57'58.6''N 114 P. elatior Thrum A CD Yes P. vulgaris Møn 12°32'55.4''E MK, 54°58'16.6''N 201 P. elatior Thrum A D Yes P. elatior Yes Møn 12°32'57.7''E MK, 54°58'16.6''N 202 P. elatior A D Yes P. elatior Møn 12°32'57.7''E MK, 54°58'16.6''N 203 P. elatior Yes P. elatior Møn 12°32'57.7''E MK, 54°58'16.6''N 204 P. elatior A D Yes P. elatior Møn 12°32'57.7''E MK, 54°58'16.6''N 205 P. elatior A D Yes P. elatior Møn 12°32'57.7''E MK, 54°58'16.6''N 206 P. elatior Thrum A D Yes P. elatior Møn 12°32'57.7''E MK, 54°58'16.6''N 207 P. elatior Pin A D Yes P. elatior Møn 12°32'57.7''E MK, 54°58'16.6''N 208 P. vulgaris Thrum A C Yes P. vulgaris Yes Møn 12°32'57.7''E MK, 54°58'16.6''N 209 P. ×digenea Pin A D Yes P. vulgaris Møn 12°32'57.7''E MK, 54°58'16.6''N 210 P. elatior Pin A D Yes P. vulgaris Møn 12°32'57.7''E MK, 54°58'16.6''N 211 P. ×digenea Thrum Yes P. vulgaris Møn 12°32'57.7''E MK, 54°58'16.6''N 212 P. ×digenea Thrum A CD Yes P. vulgaris Møn 12°32'57.7''E MK, 54°58'16.6''N 213 P. vulgaris A C Yes P. vulgaris Møn 12°32'57.7''E MK, 54°58'16.6''N 214 P. vulgaris Thrum A C Yes P. vulgaris Møn 12°32'57.7''E Amplified Geographical for >5 Amplified Sanger Accession Species Location Morph HaeIII RsaI coordinates SSR for trnL sequenced markers MK, Møn 54°58'16.6''N 215 P. elatior Pin A D Yes P. elatior 12°32'57.7''E MK, Møn 54°58'16.6''N 216 P. ×digenea Pin A CD Yes P. vulgaris 12°32'57.7''E MK, Møn 54°58'16.6''N 217 P. ×digenea Yes P. elatior 12°32'57.7''E MK, Møn 54°58'16.6''N 218 P. elatior A D Yes P. elatior 12°32'57.7''E MK, Møn 54°58'15.8''N 219 P. elatior A D Yes P. elatior 12°33'02.0''E MK, Møn 54°58'15.8''N 220 P. vulgaris Thrum A C Yes P. vulgaris 12°33'02.0''E MK, Møn 54°58'15.8''N 221 P. elatior Thrum Yes P. elatior 12°33'02.0''E MK, Møn 54°58'15.8''N 222 P. ×digenea A CD Yes P. elatior 12°33'02.0''E MK, Møn 54°58'15.8''N 223 P. vulgaris A CD Yes P. vulgaris 12°33'02.0''E MK, Møn 54°58'22.6''N 301 P. elatior A D Yes P. elatior 12°33'59.7''E MK, Møn 54°58'22.6''N 302 P. elatior Yes P. elatior 12°33'59.7''E MK, Møn 54°58'22.6''N 303 P. elatior Thrum A D Yes P. elatior 12°33'59.7''E MK, Møn 54°58'22.6''N 304 P. ×digenea Thrum A CD Yes P. elatior 12°33'59.7''E MK, Møn 54°58'22.6''N 305 P. ×digenea Thrum A CD Yes P. elatior 12°33'59.7''E MK, Møn 54°58'22.6''N 306 P. elatior Thrum A D Yes P. elatior 12°33'59.7''E MK, Møn 54°58'22.6''N 307 P. ×digenea Pin A CD Yes P. elatior 12°33'59.7''E MK, Møn 54°58'22.6''N 308 P. ×digenea Pin Yes P. vulgaris 12°33'59.7''E MK, Møn 54°58'22.6''N 309 P. ×digenea Pin A CD Yes P. elatior 12°33'59.7''E MK, Møn 54°58'22.6''N 310 P. vulgaris Pin C Yes P. elatior 12°33'59.7''E MK, Møn 54°58'22.6''N 311 P. vulgaris Thrum A P. vulgaris Yes 12°33'59.7''E MK, Møn 54°58'22.6''N 312 P. ×digenea Thrum A CD Yes P. vulgaris 12°33'59.7''E MK, Møn 54°58'22.6''N 313 P. elatior Thrum A D Yes P. elatior 12°33'59.7''E MK, Møn 54°58'22.6''N 314 P. vulgaris Pin A C Yes P. vulgaris 12°33'59.7''E MK, Møn 54°58'22.6''N 315 P. elatior Thrum A D Yes P. elatior 12°33'59.7''E MK, Møn 54°58'23.1''N 316 P. ×polyantha Thrum B CD Yes P. veris 12°33'02.1''E MK, Møn 54°58'59.9''N 402 P. ×polyantha Thrum B CD Yes P. veris 12°31'51.6''E MK, Møn 54°58'59.9''N 403 P. ×polyantha B CD Yes P. veris 12°31'51.6''E MK, Møn 54°58'59.9''N Homo- 404 P. ×polyantha B Yes P. veris 12°31'51.6''E style MK, Møn 54°58'59.9''N Homo- 405 P. ×polyantha B CD Yes P. veris 12°31'51.6''E style 54°58'59.9''N 406 P. ×polyantha MK, Møn Pin CD Yes P. veris 12°31'51.6''E Amplified Geographical for >5 Amplified Sanger Accession Species Location Morph HaeIII RsaI coordinates SSR for trnL sequenced markers 55°35'46.7"N 501 P. veris Lejre B D Yes P. veris 11°56'06.8"E 55°35'46.7"N 502 P. elatior Lejre P. elatior 11°56'06.8"E Købelev Skov 54°55'55.9"N 503 P. vulgaris Yes (KS), 11°05'45.8"E Lolland KS, 54°55'55.9"N 504 P. vulgaris C Yes P. vulgaris Lolland 11°05'45.8"E KS, 54°55'55.9"N 505 P. vulgaris Lolland 11°05'45.8"E KS, 54°55'55.9"N 506 P. vulgaris A C Yes P. vulgaris Lolland 11°05'45.8"E KS, 54°55'55.9"N 507 P. vulgaris Yes P. veris Lolland 11°05'45.8"E KS, 54°55'55.9"N 508 P. vulgaris A C Yes P. vulgaris Lolland 11°05'45.8"E KS, 54°55'55.9"N 509 P. vulgaris Yes P. vulgaris Lolland 11°05'45.8"E KS, 54°55'55.9"N 510 P. vulgaris Lolland 11°05'45.8"E KS, 54°55'55.9"N 511 P. vulgaris Lolland 11°05'45.8"E KS, 54°55'55.9"N 512 P. vulgaris P. vulgaris Lolland 11°05'45.8"E KS, 54°55'57.4"N 513 P. veris B D Yes P. veris Lolland 11°05'46.0"E KS, 54°55'57.4"N 514 P. veris B D Yes P. veris Lolland 11°05'46.0"E KS, 54°55'57.4"N 515 P. veris B D Yes P. veris Lolland 11°05'46.0"E KS, 54°55'57.4"N 516 P. veris B D Yes P. veris Lolland 11°05'46.0"E KS, 54°55'57.4"N 517 P. veris B D Yes P. veris Lolland 11°05'46.0"E KS, 54°55'57.4"N 518 P. veris B D Yes P. veris Lolland 11°05'46.0"E KS, 54°55'57.4"N 519 P. veris B D Yes P. veris Lolland 11°05'46.0"E KS, 54°55'57.4"N 520 P. veris B D Yes P. veris Lolland 11°05'46.0"E KS, 54°55'57.4"N 521 P. veris B Yes P. veris Lolland 11°05'46.0"E KS, 54°55'57.4"N 522 P. veris B D Yes P. veris Lolland 11°05'46.0"E KS, 54°56'03.5"N 523 P. vulgaris P. vulgaris Lolland 11°05'42.8"E KS, 54°56'03.5"N 524 P. vulgaris P. vulgaris Lolland 11°05'42.8"E KS, 54°56'03.5"N 525 P. vulgaris P. vulgaris Lolland 11°05'42.8"E KS, 54°56'03.5"N 526 P. vulgaris Lolland 11°05'42.8"E KS, 54°56'03.5"N 527 P. vulgaris Lolland 11°05'42.8"E KS, 54°56'03.5"N 528 P. vulgaris C Yes P. vulgaris Lolland 11°05'42.8"E KS, 54°56'03.5"N 529 P. vulgaris C Yes P. vulgaris Lolland 11°05'42.8"E KS, 54°56'03.5"N 530 P. vulgaris A C Yes P. vulgaris Lolland 11°05'42.8"E Geographic Amplified Amplified Sanger Accession Species Location al Morph HaeIII RsaI for >5 SSR for trnL sequenced coordinates markers 54°56'03.5"N 531 P. vulgaris KS, Lolland P. vulgaris 11°05'42.8"E 54°56'03.5"N 532 P. vulgaris KS, Lolland P. vulgaris 11°05'42.8"E 54°56'03.5"N 533 P. vulgaris KS, Lolland P. vulgaris 11°05'42.8"E 54°55'55.9"N Homo- 534 P. ×polyantha KS, Lolland CD Yes P. veris 11°05'45.8"E style 54°55'55.9"N 535 P. vulgaris KS, Lolland Thrum A C Yes P. vulgaris 11°05'45.8"E 54°55'55.9"N 536 P. ×digenea KS, Lolland Pin A 11°05'45.8"E 54°55'55.9"N 537 P. vulgaris KS, Lolland Pin P. vulgaris 11°05'45.8"E 54°55'55.9"N 538 P. ×polyantha KS, Lolland Pin CD Yes P. veris 11°05'45.8"E 54°55'58.0"N 539 P. ×polyantha KS, Lolland Pin B CD Yes P. veris 11°05'45.5"E 54°55'55.9"N 540 P. vulgaris KS, Lolland Pin C Yes P. vulgaris 11°05'45.8"E 54°56'02.6"N 541 P. ×polyantha KS, Lolland Thrum B CD Yes P. veris 11°05'43.0"E 54°55'55.9"N 542 P. ×digenea KS, Lolland Pin 11°05'45.8"E Tjennemarke 54°48'32.9"N 543 P. elatior Skov (TS), A D P. elatior 11°20'47.6"E Lolland 54°48'32.9"N 544 P. elatior TS, Lolland Yes P. elatior 11°20'47.6"E 54°48'32.9"N 545 P. elatior TS, Lolland 11°20'47.6"E 54°48'32.9"N 546 P. elatior TS, Lolland A D Yes P. elatior Yes 11°20'47.6"E 54°48'32.9"N 547 P. elatior TS, Lolland P. elatior 11°20'47.6"E 54°48'32.9"N 548 P. elatior TS, Lolland A D Yes P. elatior 11°20'47.6"E 54°48'32.9"N 549 P. elatior TS, Lolland A D P. elatior 11°20'47.6"E 54°48'32.9"N 550 P. elatior TS, Lolland P. elatior 11°20'47.6"E 54°48'32.9"N 551 P. elatior TS, Lolland A D Yes P. elatior 11°20'47.6"E 54°48'32.9"N 552 P. elatior TS, Lolland A D Yes P. elatior 11°20'47.6"E Kisserup, 55°35'39.1"N 601 P. veris P. veris Zealand 11°56'46.0"E Kisserup, 55°35'39.1"N 602 P. veris B D Yes P. veris Zealand 11°56'46.0"E MK, Møn 54°58'15.5''N 701 P. vulgaris P. vulgaris 12°33'04.1''E MK, Møn 54°58'15.5''N 702 P. vulgaris P. vulgaris 12°33'04.1''E MK, Møn 54°58'16.0''N 703 P. vulgaris 12°33'04.7''E MK, Møn 54°58'16.0''N 704 P. veris D Yes P. veris Yes 12°33'04.7''E MK, Møn 54°58'16.0''N 705 P. veris B Yes P. veris 12°33'04.7''E MK, Møn 54°58'17.7''N 706 P. ×polyantha Pin P. veris 12°33'02.4''E MK, Møn 54°58'17.7''N 707 P. ×polyantha Pin B CD Yes P. veris 12°33'02.4''E Amplified Geographical Amplified Sanger Accession Species Location Morph HaeIII RsaI for >5 SSR coordinates for trnL sequenced markers MK, Møn 54°58'17.7''N 708 P. veris B D Yes P. veris Yes 12°33'02.4''E MK, Møn 54°58'17.4''N 709 P. veris Yes P. veris 12°33'02.1''E MK, Møn 54°58'17.4''N 710 P. vulgaris P. vulgaris 12°33'02.1''E MK, Møn 54°58'22.9''N 711 P. vulgaris Thrum Yes P. vulgaris 12°33'02.6''E MK, Møn 54°58'22.9''N 712 P. veris B D Yes P. veris 12°33'02.6''E MK, Møn 54°58'22.9''N 713 P. ×polyantha Thrum Yes P. veris 12°33'02.6''E MK, Møn 54°58'22.9''N 714 P. ×polyantha Pin CD Yes P. veris 12°33'02.6''E MK, Møn 54°58'22.9''N 715 P. ×polyantha Pin B CD Yes P. veris 12°33'02.6''E MK, Møn 54°58'22.9''N 716 P. ×polyantha Thrum CD Yes P. veris 12°33'02.6''E MK, Møn 54°58'23.2''N 717 P. ×polyantha Pin B P. veris 12°33'02.0''E MK, Møn 54°58'23.2''N 718 P. ×polyantha Pin Yes P. veris 12°33'02.0''E MK, Møn 54°58'23.2''N 719 P. veris B Yes P. veris 12°33'02.0''E MK, Møn 54°58'36.7''N 720 P. veris Pin P. veris 12°32'53.8''E MK, Møn 54°58'36.7''N 721 P. veris Pin B Yes P. veris 12°32'53.8''E MK, Møn 54°59'24.3''N 722 P. veris Pin Yes P. veris 12°32'26.9''E MK, Møn 54°59'23.0''N 723 P. veris P. veris 12°32'20.1''E MK, Møn 54°59'23.0''N 724 P. veris Yes P. veris 12°32'20.1''E MK, Møn 54°59'23.0''N 725 P. veris B Yes P. veris 12°32'20.1''E MK, Møn 54°59'23.0''N 726 P. veris P. veris 12°32'20.1''E MK, Møn 54°59'23.0''N 727 P. veris B Yes P. veris 12°32'20.1''E MK, Møn 54°59'23.0''N 728 P. veris Yes P. veris 12°32'20.1''E MK, Møn 54°59'23.0''N 729 P. veris B Yes P. veris 12°32'20.1''E MK, Møn 54°59'23.0''N 730 P. veris Yes P. veris 12°32'20.1''E MK, Møn 54°59'23.0''N 731 P. veris B Yes P. veris 12°32'20.1''E MK, Møn 54°59'23.0''N 732 P. veris Yes P. veris 12°32'20.1''E 55°46'31.9"N 801 P. veris Nexelø D Yes P. veris 11°17'30.6"E 55°46'21.8"N 802 P. veris Nexelø Yes P. veris 11°17'36.7"E 55°46'22.0"N 803 P. veris Nexelø D Yes P. veris 11°17'40.2"E 55°46'11.4"N 901 P. veris Samsø B Yes P. veris 10°33'04.9"E 55°46'11.4"N 902 P. veris Samsø Yes P. veris 10°33'04.9"E 55°46'11.4"N 903 P. veris Samsø B Yes P. veris 10°33'04.9"E 55°46'11.4"N 904 P. veris Samsø B Yes P. veris 10°33'04.9"E Amplified Geographical Amplified Sanger Accession Species Location Morph HaeIII RsaI for >5 SSR coordinates for trnL sequenced markers 55°46'11.4"N 905 P. veris Samsø B Yes P. veris 10°33'04.9"E 55°46'11.4"N 906 P. veris Samsø B Yes P. veris 10°33'04.9"E 55°46'11.4"N 907 P. veris Samsø B Yes P. veris 10°33'04.9"E 55°46'11.4"N 908 P. veris Samsø B Yes P. veris 10°33'04.9"E 55°46'11.4"N 909 P. veris Samsø B Yes P. veris 10°33'04.9"E 55°46'11.4"N 910 P. veris Samsø B P. veris 10°33'04.9"E Tågarp, Scania, 55°56'16.7"N 1001 P. veris B Yes P. veris Sweden 13°01'10.3"E (Scania) 55°56'16.7"N 1002 P. veris Scania P. veris 13°01'10.3"E 55°56'16.7"N 1003 P. veris Scania B Yes P. veris 13°01'10.3"E 55°56'16.7"N 1004 P. veris Scania Yes P. veris 13°01'10.3"E 55°56'16.7"N 1005 P. veris Scania B P. veris 13°01'10.3"E 55°56'16.7"N 1006 P. veris Scania Yes P. veris 13°01'10.3"E Tokkekøb 55°53'33.9"N 1101 P. veris Hegn (TK), B D P. veris 12°23'17.9"E Zealand TK, 55°53'33.5"N 1102 P. veris B D Yes P. veris Zealand 12°22'56.2"E TK, 55°53'28.8"N 1103 P. veris Yes P. veris Zealand 12°23'02.6"E Vestvolden 55°39'06.0"N 1201 P. elatior P. elatior , Zealand 12°25'33.9"E Vestvolden 55°39'06.0"N 1202 P. elatior A D P. elatior , Zealand 12°25'33.9"E Appendix 3. Development of a species-specific TrnL-marker. Alignment of TrnL-sequences from Primula vulgaris, P. elatior and P. veris with the primers sites for amplification of the part including the InDels indicated. The length of the PCR products with the two indicated primers are as follows: P. veris: 137-139 bp, P. elatior: 149-151bp and P. vulgaris: 142-143 bp. When the M13-tail is added to the forward primer and the M13-primer is included for fluorescence detection the final products are about 20 bp longer. The sequences were obtained from NCBI (https://www.ncbi.nlm.nih.gov/), and the accessions are described in Mast et al. (2001), Bremer et al. (2002), Schneeweiss et al (2004), Trift et al. 2004), Mast et al. (2004), Suteu et al. (2011), and Kajtoch et al. 2015). Alignment was done with Multalin (http://multalin.toulouse.inra.fr/multalin/multalin.html)

ATTTCAGAAAGGATGCAAAGAT

AGAAGAATTGTTGCGAATCGA Appendix 4. PCR-primer list

M13- Annealing Repeat 5 Primers Use Sequence (5'→3') 4 Expected product length (bp) Source tail temperature °C motif (bp)

ITS1 CAPS1 TCCGTAGGTGAACCTGCGG No 55°C 653-654 (undigested) White et al. (1990) ITS4 CAPS CTCCGCTTATTGATATGC No 55°C White et al. (1990) TrnL196-F LP2) ATTTCAGAAAGGATGCAAAGAT Yes 55°C Ve: 137-139, Vu 142-143, E: 149-151 GenBank sequences TrnL325-R LP TCGATTCGCAACAATTCTTCT 55°C GenBank sequences PRIV-4-F SSR3 CACGACGTTGTAAAACGACACTCTTCTTGTTCCTCTCCCA Yes 55°C GT Vu: 75-116; E: 71-113 Van Geert et al. (2006)

PRIV-4-R SSR ACCTAGTTCCTCGCTCCACA Van Geert et al. (2006)

PRIV-6-F SSR CACGACGTTGTAAAACGACATCTGTTTCTTAGGTGTGTGG Yes 55°C GT Vu: 153-198 Van Geert et al. (2006)

PRIV-6-R SSR ACAAGTAACAACACAATGATG Van Geert et al. (2006)

PRIV-7-F SSR CACGACGTTGTAAAACGACGATTCCAACAACTACGGTTCA Yes 55°C GT Vu: 218-241; E: 205-251 Van Geert et al. (2006)

PRIV-7-R SSR CAATGAAAATCTACATGTTACG Van Geert et al. (2006) Paca-11-F SSR CACGACGTTGTAAAACGACTTCGTGATGAAGTTGACTTTTATG Yes TC Vu: 94-102; E: 94-98; Ve: 94-104 Seino et al. (2014) Paca-11-R SSR AAACAGCAATATCAGAGTCCAGA Seino et al. (2014) Vu: 132-138; E: 145-147; Ve: 121- Paca-78-F SSR CACGACGTTGTAAAACGACTGTGCGACTGCCTCTATCTC Yes CT Seino et al. (2014) 123 Paca-78-R SSR GACTGAGAAGACATATGTTGAAAGA Seino et al. (2014) 10×60s at 57°C; PV23424-F SSR CACGACGTTGTAAAACGACGCAGTGGATGGGTATGAAAG Yes CAA 170 Bickler et al. (2013) 28×30s at 55°C PV23424-R SSR GTGGTAGCTTCTTGTTCAGGG Bickler et al. (2013) 10×60s at 57°C; PV4767-F SSR CACGACGTTGTAAAACGACTGGTATTTCTTCTGCTTCTTTGC Yes CTT 116 Bickler et al. (2013) 28×30s at 55°C PV4767-R SSR ACGGCTAAAGTACCACCACC Bickler et al. (2013) 10×60s at 57°C; PV279-F SSR CACGACGTTGTAAAACGACGTCCACCACCCTCTTATCCG Yes TG 134 Bickler et al. (2013) 28×30s at 55°C PV279-R SSR CCTCGAGTTGGAGTACTTGC Bickler et al. (2013) 10×60s at 57°C; PV26720-F SSR CACGACGTTGTAAAACGACACTCGGCCAATGAAAGCAAC Yes TG 243 Bickler et al. (2013) 28×30s at 55°C PV26720-R SSR AGTCTTGACACACCTTTTGCC Bickler et al. (2013) 10×60s at 57°C; PV19773-F SSR CACGACGTTGTAAAACGACTTCAATTTCTGTGAAGGCTGG Yes GTT 220 Bickler et al. (2013) 28×30s at 55°C PV19773-R SSR TCGGGATATGCCAATCAATGC Bickler et al. (2013)

1CAPS: Cleaved amplified polymorphic sequence, 2 LP: Length Polymorphism, 3SSR: Simple sequence repeat, 4M13-tail: CACGACGTTGTAAAACGAC, 5Vu: P. vulgaris, E: P. elatior, Ve: P. veris Appendix 5. Development of ITS-CAPS markers for species and hybrid identification. Alignment of three ITS sequences representing Primula vulgaris, P. veris and P. elatior with the SNPs developed into CAPS-markers (underlined) using the enzymes HaeIII recognising GGCC (in red) and RsaI recognising GTAC in blue.

HaeIII

HaeIII RsaI

RsaI

Abbreviations used on the following pages for the subspecies: Pvu: P. vulgaris ssp. vulgaris Pvu-sib: P. vulgaris ssp. sibthorpii Pvu-bal: P. vulgaris ssp. balearica Pvu-het: P. vulgaris ssp. heterochroma Pve: P. veris ssp. veris Pve-col: P. veris ssp. columnae Pve-mac: P. veris ssp. macrocalyx Pve-can: P. veris ssp. canescens Pe: P. elatior ssp. elatior Pe-pse: P. elatior ssp. pseudoelatior Pe-leu: P. elatior ssp. leucophylla Pe-lof: P. elatior ssp. lofthousei Pe-int: P. elatior ssp. intricata Pe-cor: P. elatior ssp. cordifolia Pe-pal: P. elatior ssp. pallasii Appendix 5-continued. Development of ITS-CAPS markers for species and hybrid identification. Partial alignment of 118 ITS sequences from Primula vulgaris, P. veris and P. elatior and their subspecies. The SNP marked with an arrow is converted into a CAPS- marker with the restriction enzyme HaeIII recognising GGCC. All sequences obtained from NCBI (https://www.ncbi.nlm.nih.gov/), acc. numbers indicated. Appendix 5-continued. Partial alignment of 118 ITS sequences from Primula vulgaris, P. veris and P. elatior and their subspecies. The SNP marked with an arrow can be converted into a CAPS-marker with the restriction enzyme RsaI recognising GTAC. All sequences obtained from NCBI (https://www.ncbi.nlm.nih.gov/), acc. numbers indicated. Appendix 6. List of references for PCR-primers and DNA sequences

Bickler, C., A’Hara, S., Cottrell, J., Rogers, L., and Bridle, J. 2013. Characterisation of thirteen polymorphic microsatellite markers for cowslip (Primula veris L.) developed using a 454 sequencing approach. – Conservation Genetic resources 5: 1185-1187.

Bremer, B., Bremer, K., Heidari, N., Erixon, P., Olmstead, R.G., Anderberg, A.A., Kallersjo, M. and Barkhordarian, E. 2002. Phylogenetics of asterids based on 3 coding and 3 non-coding chloroplast DNA markers and the utility of non-coding DNA at higher taxonomic levels. – Mol. Phylogenet. Evol. 24: 274-301.

Mast, A., Kelso, S., Richards, A., Lang, D., Feller, D., & Conti, E. 2001. Phylogenetic Relationships in Primula L. and Related Genera (Primulaceae) Based on Noncoding Chloroplast DNA. – International Journal of Plant Sciences, 162: 1381-1400.

Mast, A. R., Feller, D. M. S., Kelso, S. and Conti E. 2004. Buzz-pollinated Dodecatheon originated from within the heterostylous Primula subgenus Auriculastrum (Primulaceae): a seven-region cpDNA phylogeny and its implications for floral evolution. – Am. J. Bot. June 91: 926-942.

Schneeweiss, G.M., Schönswetter, P., Kelso, S. and Niklfeld, H. 2004. Complex biogeographic patterns in Androsace (Primulaceae) and related genera: Evidence from phylogenetic analyses of nuclear internal transcribed spacer and plastid trnL-F sequences. –Systematic Biology 53: 856–876.

Seino, M.M., de Vega, C., Bazaga, P., Jacquemyn, H. and Herrera, C. M. 2014. Development and characterization of microsatellite loci for the primrose Primula vulgaris and successful cross-amplification in the congeneric P. elatior and P. veris. – Conservation Genet Resour 6: 653-655.

Şuteu, D., Puşcaş, M., Băcilă, I., Coste, A., Filipaş, L., Stoica, A., Hurdu, B.-I., Ursu, T. and Coldea, G. 2011. Does Primula intricata Gren. Et Godr. Merit Species Rank? A Taxonomic Revision Based on nrDNA, cpDNA and AFLP Data. – Notulae Botanicae Horti Agrobotanici Cluj-Napoca 39: 24-29.

Trift, I., Liden, M. and Anderberg, A.A.A. 2004. Phylogeny and Biogeography of Dionysia (Primulaceae). – Int. J. Plant Sci. 165: 845-860.

Van Geert, A., Van Rossum, F., Stiers, I., Sierens, T., Barker, J., and Triest, L. 2006. Isolation and characterization of microsatellite loci in primrose (Primula vulgaris). – Belgian Journal of Botany 139: 261-264.

White, T.J., Bruns, T., Lee, S. and Taylor, J. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis, M., Gelfand, D., Sninsky, J. and White, T.J. (eds.) PCR protocols: a guide to methods and application. Academic Press, San Diego, California, USA. Appendix 7. ITS-markers. The table summarizes the distribution of alleles for the two CAPS-markers for the ITS-locus among the Primula species and subspecies. It shows that the markers are suitable for species identifications, but there are some accessions with deviating types.

HaeIII-CAPS marker G A Identity of exceptions P. vulgaris 40 1 1) 1) P. vulgaris ssp. vulgaris: 1

P. veris 4 2) 35 2) P. veris ssp. veris: 3 P. veris ssp. columnae: 1

P. elatior 32 6 3) 3) P. elatior ssp. pseudoelatior: 1 P. elatior ssp. pallasii: 2 P. elatior ssp. intricata: 1 P. elatior ssp. leucophylla: 1 P. elatior ssp. elatior: 1

RsaI-CAPS marker C A T Y Identity of exceptions 1) P. vulgaris ssp. vulgaris P. vulgaris 40 1 1) 9 2) 1 2) P. vulgaris ssp. sibthorpii: 6 P. vulgaris ssp. vulgaris: 3 P. veris 2 3) 37 3) P. veris ssp. veris: 2 4) P. elatior ssp. pseudoelatior: 5 P. elatior 13 4) 24 P. elatior ssp. meyeri: 7 P. elatior ssp. cordifolia: 1 Appendix 8. SSR-markers. Number of alleles, expected heterozygosity and polymorphic information content in species and hybrids for each SSR marker

P. P. P. P. P. veris H PIC elatior vulgaris ×digenea ×polyantha Paca11 3 2 4 3 7 0.79 0.79 Paca78 9 4 5 6 4 0.84 0.83 PRIV4 11 5 9 6 10 0.87 0.86 PRIV6 4 8 7 6 5 0.88 0.87 PRIV7 5 3 7 3 5 0.82 0.80 PV279 6 5 11 7 8 0.82 0.81 PV4767 6 4 5 2 3 0.75 0.72 PV23424 4 4 7 4 4 0.67 0.63 PV26720 5 3 8 5 2 0.70 0.67 PV19773 4 7 17 4 8 0.86 0.84 Ʃ 57 45 80 46 56 Appendix 9. PCoAs of species and hybrids. A: P. veris and it hybrid P. ×polyantha, B: P. vulgaris and its hybrids and C: P. elatior and its hybrid, P. ×digenea.

Principal coordinates (PCoA) of P. veris and P. ×polyantha

1004 A 1006 404 730 403 709 402 708715722 514 719732713 729 406 712 1001 727 903704 902901 724 520 905 705 721 707 716 904 539 518 731 728 522 725 519 714 405 517 316 538 516 521 718 1003 534 513 Coord. 2 541 515

906 907 Lolland veris Møn veris 909 Samsø veris Scania veris 908 Møn polyantha Lolland polyantha

Coord. 1 Appendix 9 B and C

Principal coordinates (PCoA) of P. vulgaris and hybrids

Møn vulgaris 208 B Lolland vulgaris 217 Møn polyantha 112105 220 216 104223106 Lolland polyantha 222 109 107 316 Møn digenea 714 312 113 716 309 211 405 212528538 707 305 535 530540 715713 718 402 541

314 101209 213214 308304310 307 534 406 529 507

Coord. Coord. 2 403 539

404 504 508 509

506 711 503

Coord. 1

Principal coordinates (PCoA) of P. elatior and ×digenea

Digenea 546 C Møn elatior 309 202 Lolland elatior 305 308 303 307204 315 221 304 209 548551 312 313203 552 207 101 212 302

201 219 103 215 Coord. Coord. 2 306 113216 206 217 205 544301 114 111 218 110 222 211 104 102 106 105

210 108 109

Coord. 1 Appendix 10. Analyses of molecular variance (AMOVAs) for P. ×polyantha (A) and for each Primula species (B–E) showing how the molecular variance is distributed within and among populations.

Percentages of Molecular Variance Percentages of Molecular Variance P. ×polyantha P. elatior A B Among Among Pops Pops 16% 13%

Within Within Pops Pops 84% 87%

Percentages of Molecular Variance Percentages of Molecular Variance P. veris, Møn and Lolland only P. veris, all populations C D Among Among Pops Pops 25% 22%

Within Within Pops Pops 75% 78%

Percentages of Molecular Variance P. vulgaris E Among Pops 10%

Within Pops 90% Appendix 11. Genomic cline plots from the INTROGRESS analysis for 10 SSR- markers for P. ×digenea with the parental species P. elatior as parent 1 set as 0 and P. vulgaris as parent 2 set as 1. Locus designation and P-values for each locus are indicated. Solid coloured regions represent the 95% confidence intervals for the P. elatior (dark green and solid line) and the P. ×digenea (light green and dashed line) genotypes. The circles indicate the raw genotypic data (P1/P1 on the top line, P1/P2 in the middle and P2/P2 on the bottom line) with the numbers shown to the right. The hybrid index (x-axis) quantifies the fraction of alleles from the P. vulgaris population across all 10 markers.

Hybrid index Hybrid index Hybrid index

Hybrid index Appendix 11. Genomic cline plots from the INTROGRESS analysis for 10 SSR- markers for P. ×polyantha with the parental species P. veris as parent 1 set as 0 and P. vulgaris as parent 2 set as 1. Locus designation and P-values for each locus are indicated. Solid coloured regions represent the 95% confidence intervals for the P. veris (dark green and solid line) and the P. ×polyantha (light green and dashed line) genotypes. The circles indicate the raw genotypic data (P1/P1 on the top line, P1/P2 in the middle and P2/P2 on the bottom line) with the numbers shown to the right. The hybrid index (x-axis) quantifies the fraction of alleles from the P. vulgaris population across all 10 markers.

Hybrid index Hybrid index Hybrid index

Hybrid index