DOCSLIB.ORG

Spotted Fever Group Rickettsia in Ticks Infesting Humans, Wild and Domesticated Animals of Sri Lanka: One Health Approach

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Spotted Fever Group Rickettsia in Ticks Infesting Humans, Wild and Domesticated Animals of Sri Lanka: One Health Approach Ceylon Journal of Science (Bio. Sci.) 44 (2): 67-74, 2015 DOI: http://dx.doi.org/10.4038/cjsbs.v44i2.7351 RESEARCH ARTICLE Spotted fever group rickettsia in ticks infesting humans, wild and domesticated animals of Sri Lanka: one health approach D. R. Liyanaarachchi1*, R. S. Rajakaruna2, and R. P. V. J. Rajapakse1 1Department of Veterinary Pathobiology, Faculty of Veterinary Medicine and Animal Science, University of Peradeniya, Sri Lanka. 2Department of Zoology, Faculty of Science, University of Peradeniya, Sri Lanka. Accepted December 31, 2015 ABSTRACT Spotted fever group rickettsial infections are considered an emerging infectious disease in Sri Lanka. The present study examined the potential role of tick vectors carrying the infection from sylvatic reservoirs to humans via domesticated animals. Ticks infesting humans, dogs and wild animals were collected island-wide and were identified. Presence of spotted fever group rickettsia in the tick blood meal was determined using PCR in a sub-sample of ticks collected. A total of 30,933 ticks were collected from 30 different hosts and free living stages from the ground. The collection consisted of 25 tick species recording 12 species from humans, 19 from domesticated animals and 22 from wild animals. Of the total collection, randomly selected sub-sample of 80 ticks were used to identify rickettsia pathogens. This comprised of fifty ticks from 50 wild animals belonged to 15 species (wild boar, pangolin, porcupine, barking deer, star tortoise, mouse deer, samber, spotted deer, monkey, civet cat, bandicoot, elephant, fishing cat, rabbit, flying squirrel; and 20 ticks from 15 dogs especially from areas where spotted fever cases were reported and 10 ticks from 10 humans. Results showed that rickettsial infections were found in four tick species, Amblyomma testudinarium collected from a wild boar, Riphicephalus sanguineus from a dog, Amblyomma clypeolatum from a star tortoise and Amblyomma javanense from a pangolin. Except for A. javanense, other three tick species are generalists infesting humans as well as domestic and wild animals. There is a high potential that these infections can spread easily to humans via the domesticated animals. This is the first report of ticks infesting domesticated and wild animals carrying spotted fever rikettsia and it underscores the possibility of spread of infection from wild reservoirs to human in the animal/human health interface. Keywords: ticks, zoonoses, domesticated animals, wildlife, spotted fever rickettsia INTRODUCTION Life cycle of tick-borne pathogens is highly dependent on tick ecology which is one of the most Tick-borne diseases recorded in humans include important factors driving the epidemiology of tick- rickettsioses, ehrlichiosis, babesiosis, Kyasaunur borne diseases (Randolph, 2009). In preventing forest disease, typhus fever varieties, haemoragic emergence of tick-borne diseases, role of wildlife fever varieties, tick borne encephalitis, Lyme as tick hosts and their role in the life cycle of tick- disease and Q fever (Jongejan and Uilenberge, borne pathogens is considered important. Some 2004). Most of these tick-borne infections emerge tick species may be generalists and may feed on from the wild reservoir (Daszak et al., 2001) and different vertebrate species depending on their approximately 10% of the currently known 867 tick availability and abundance (Wilson et al., 1984) species act as vectors of a broad range of pathogens whereas other species may be more specific and of domestic animals (Jongejan and Uilenberge, use a narrow host range (Sonenshine et al., 2002). 2004).Ticks and tick-borne infections have Wild and domestic cycles are often coevolved with wild reservoirs which often live in complementary. Immature tick stages that a state of equilibrium but constitute a constant parasitize wild and peri-domestic animals can feed reservoir of infections to domesticated animals and later as adults on domesticated animals. Thus, humans. These wild hosts come into contact with investigating the role of wildlife as tick hosts is of domesticated animals when man moves livestock great relevance for understanding the into infested regions, or moved livestock infested epidemiology of tick-borne diseases shared with with the ticks into previously uninfected regions domesticated animals and humans (Ruiz-Fons et (Jongejan and Uilenberge, 2004). al., 2006; Ruiz-Fons and Gilbert, 2010). *Corresponding author’s email: [email protected] 68 Liyanaarachchi et al. The spotted fever rickettsiae are zoonotic where the protein encoded by this gene is referred to as the pathogens circulate in enzoonotic or occasionally genus – common antigen and is found in species of epizoonotic cycles, between wild vertebrates and both the spotted fever and typhus groups. their tick vectors (Walker and Fishbein, 1992). According to Rudakov et al. (2003) the pathogen According to Tzianabos et al. (1989) a nested PCR has natural cycles with parasitic systems that protocol that uses broad range primers R17 – 122 involve many wild mammals, tick vectors, and long (CAGAGTGCTATGAACAAACAA GG) and R17 term reservoirs of rickettsiae. Secondly, they also – 500 (CTTGCCATTGCCCATCAG GTTG) in the have domestic or anthropogenic cycles that involve primary stage and separate pairs of more specific domestic animals, especially dogs. People are an primers are used in the nested stage. TZ15 accidental host in the circulation and maintenance (TTCTCAATTCGGTAAGGGC:208–247 bp) and of the pathogen. These pathogens will mutate TZ16(ATATTGACCAGTGCTATTTC: 208 – 247) quickly and have shown a broad degree of severity are used for detection of R. ricketsii, and several especially in humans (Rudakov et al., 2003). closely related species of the spotted fever group Humans are only occasional hosts for ticks and and RP2 and RP1D for detection of Rickettsia typhi rarely play a role in the subsequent transmission of and Rickettsia prowazeki (Tzianabos et al., 1989). bacteria. Therefore, human should be viewed as a ‘dead end’ host, which plays no role in the maintenance of these bacteria in nature (Parola and MATERIALS AND METHODS Raoult, 2001). Collection of ticks Rickettsial infections have been reported in An island-wide collection of ticks infesting patients from the Central (Kularatne et al., 2003) humans, dogs and wild animals was carried out and Western (Premaratne, 2008) provinces of Sri during January 2009 to August 2011 and were Lanka as an emerging infection. Recently, identified. Of the collection, a sub sample of ticks Weerakoon et al. (2011a; b) recorded 220 IFA was used to analyse the presence of spotted fever confirmed patients with rickettsial infections from rickettsial infections. Ticks were collected from the Teaching Hospital,Peradeniya during 2008 to injured or dead wild animals which were brought 2010.These patients were found positive for three to veterinary hospitals or clinics in Kandy and to ricketsia species namely, Rickettsia conorii, wildlife parks at Minipe, Mihintale, Udawalawa, Orientia tsutsugamushi and Rickettsia typhi of Buttala, Randenigala, Yala and Wasgamuwa. Ticks which 91% being R. conorii with high number of infesting human ear canal were also collected from mixed infections (Weerakoon et al., 2011a,b).The the Ear, Nose, Throat (ENT) clinic at Suwasewana reservoir and the vector of rickettsia in Sri Lanka Private Hospital in Kandy and through civilians in are largely unknown. Some of the tick species the Central Province. Ticks were preserved in 70% reported from Sri Lanka are known vectors of ethanol and brought to the laboratory in the rickettsia in the world. Lack of knowledge in the Department of Veterinary Pathobiology, Faculty of infectious agents carried by tick species of Sri Veterinary Medicine and Animal Health at the Lanka, and sylvatic and domestic reservoirs and the University of Peradeniya, Sri Lanka and identified zoonotic potential of tick-borne spotted fever group using light microscope and available keys and rickettsia prompted us to carry out the present literature (Nuttall et al., 1915; Sharif, 1928; study. Trapido et al., 1963; Seneviratne, 1965).Different stages (larvae, nymphs, and adults) and sex of adult Molecular methods based on polymerase chain ticks were also noted down. reaction (PCR) have enabled the development of sensitive, specific and rapid tools for both detection Identification of spotted fever rickettsial and identification of rickettsiae from various infections in ticks by nested PCR samples. Clinical specimens and arthropod tissues Eighty ticks from the total tick collection including could be used to detect rickettsia by PCR. For 50 ticks from wild animals such as wild boar, rickettsioses, detection strategies based on pangolin, porcupine, barking deer, star tortoise, recognition of sequences within the genes encoding mouse deer, samber, spotted deer, monkey, civet the 17 kDa protein (Paddock et al., 2006; Weinberg cat, bandicoot, elephant, fishing cat, rabbit, flying et al., 2008). PCR assays for rickettsial species are squirrel) and 20 ticks from dogs (n=15) especially carried out amplifying genes 17 kDa for spotted those from spotted fever infected areas and 10 ticks fever group (Eremeeva and Bosserman, 2006). The from human ear canal were used to study the gene encoding 17 kDa protein shows high presence of spotted fever rickettsial infections. homology among the spotted fever group (SFG) and typhus group (TG) rickettsiae and therefore, Isolation of genomic DNA the protocol used to detect spotted fever causing
Load more

Recommended publications
  • (Batch Learning Self-Organizing Maps), to the Microbiome Analysis of Ticks
    Title A novel approach, based on BLSOMs (Batch Learning Self-Organizing Maps), to the microbiome analysis of ticks Nakao, Ryo; Abe, Takashi; Nijhof, Ard M; Yamamoto, Seigo; Jongejan, Frans; Ikemura, Toshimichi; Sugimoto, Author(s) Chihiro The ISME Journal, 7(5), 1003-1015 Citation https://doi.org/10.1038/ismej.2012.171 Issue Date 2013-03 Doc URL http://hdl.handle.net/2115/53167 Type article (author version) File Information ISME_Nakao.pdf Instructions for use Hokkaido University Collection of Scholarly and Academic Papers : HUSCAP A novel approach, based on BLSOMs (Batch Learning Self-Organizing Maps), to the microbiome analysis of ticks Ryo Nakao1,a, Takashi Abe2,3,a, Ard M. Nijhof4, Seigo Yamamoto5, Frans Jongejan6,7, Toshimichi Ikemura2, Chihiro Sugimoto1 1Division of Collaboration and Education, Research Center for Zoonosis Control, Hokkaido University, Kita-20, Nishi-10, Kita-ku, Sapporo, Hokkaido 001-0020, Japan 2Nagahama Institute of Bio-Science and Technology, Nagahama, Shiga 526-0829, Japan 3Graduate School of Science & Technology, Niigata University, 8050, Igarashi 2-no-cho, Nishi- ku, Niigata 950-2181, Japan 4Institute for Parasitology and Tropical Veterinary Medicine, Freie Universität Berlin, Königsweg 67, 14163 Berlin, Germany 5Miyazaki Prefectural Institute for Public Health and Environment, 2-3-2 Gakuen Kibanadai Nishi, Miyazaki 889-2155, Japan 6Utrecht Centre for Tick-borne Diseases (UCTD), Department of Infectious Diseases and Immunology, Faculty of Veterinary Medicine, Utrecht University, Yalelaan 1, 3584 CL Utrecht, The Netherlands 7Department of Veterinary Tropical Diseases, Faculty of Veterinary Science, University of Pretoria, Private Bag X04, 0110 Onderstepoort, South Africa aThese authors contributed equally to this work. Keywords: BLSOMs/emerging diseases/metagenomics/microbiomes/symbionts/ticks Running title: Tick microbiomes revealed by BLSOMs Subject category: Microbe-microbe and microbe-host interactions Abstract Ticks transmit a variety of viral, bacterial and protozoal pathogens, which are often zoonotic.
    [Show full text]
  • Intraspecies Comparative Genomics of Rickettsia
    AIX ͲMARSEILLE UNIVERSITÉ FACULTÉ DE MÉDECINE DE MARSEILLE ÉCOLE DOCTORALE DES SCIENCES DE LA VIE ET DE LA SANTÉ T H È S E Présentée et publiquement soutenue devant LA FACULTÉ DE MÉDECINE DE MARSEILLE Le 13 décembre 2013 Par M. Erwin SENTAUSA Né le 16 décembre 1979 àMalang, Indonésie INTRASPECIES COMPARATIVE GENOMICS OF RICKETTSIA Pour obtenir le grade de DOCTORAT d’AIX ͲMARSEILLE UNIVERSITÉ SPÉCIALITÉ :PATHOLOGIE HUMAINE Ͳ MALADIES INFECTIEUSES Membres du Jury de la Thèse : Dr. Patricia RENESTO Rapporteur Pr. Max MAURIN Rapporteur Dr. Florence FENOLLAR Membre du Jury Pr. Pierre ͲEdouard FOURNIER Directeur de thèse Unité de Recherche sur les Maladies Infectieuses et Tropicales Émergentes UM63, CNRS 7278, IRD 198, Inserm 1095 Avant Propos Le format de présentation de cette thèse correspond à une recommandation de la spécialité Maladies Infectieuses et Microbiologie, à l’intérieur du Master de Sciences de la Vie et de la Santé qui dépend de l’Ecole Doctorale des Sciences de la Vie de Marseille. Le candidat est amené àrespecter des règles qui lui sont imposées et qui comportent un format de thèse utilisé dans le Nord de l’Europe permettant un meilleur rangement que les thèses traditionnelles. Par ailleurs, la partie introduction et bibliographie est remplacée par une revue envoyée dans un journal afin de permettre une évaluation extérieure de la qualité de la revue et de permettre àl’étudiant de le commencer le plus tôt possible une bibliographie exhaustive sur le domaine de cette thèse. Par ailleurs, la thèse est présentée sur article publié, accepté ou soumis associé d’un bref commentaire donnant le sens général du travail.
    [Show full text]
  • Chiang Mai Veterinary Journal 2017; 15(3): 127 -136 127
    Chatanun Eamudomkarn, Chiang Mai Veterinary Journal 2017; 15(3): 127 -136 127 เชียงใหม่สัตวแพทยสาร 2560; 15(3): 127-136. DOI: 10.14456/cmvj.2017.12 เชียงใหม่สัตวแพทยสาร Chiang Mai Veterinary Journal ISSN; 1685-9502 (print) 2465-4604 (online) Website; www.vet.cmu.ac.th/cmvj Review Article Tick-borne pathogens and their zoonotic potential for human infection In Thailand Chatanun Eamudomkarn Department of Parasitology, Faculty of Medicine, Khon Kaen University, Khon Kaen, 40002 Abstract Ticks are one of the important vectors for transmitting various types of pathogens in humans and animals, causing a wide range of diseases. There has been a rise in the emergence of tick-borne diseases in new regions and increased incidence in many endemic areas where they are considered to be a serious public health problem. Recently, evidence of tick-borne pathogens in Thailand has been reported. This review focuses on the types of tick-borne pathogens found in ticks, animals, and humans in Thailand, with emphasis on the zoonotic potential of tick-borne diseases, i.e. their transmission from animals to humans. Further studies and future research approaches on tick-borne pathogens in Thailand are also discussed. Keywords: ticks, tick-borne pathogens, tick-borne diseases, zoonosis *Corresponding author: Chatanun Eamudomkarn Department of Parasitology, Faculty of Medicine, Khon Kaen University, Khon Kaen, 40002. Tel: 6643363246; email: [email protected] Article history; received manuscript: 12 June 2017, accepted manuscript: 22 August 2017, published online:
    [Show full text]
  • Ticks of Japan, Korea, and the Ryukyu Islands Noboru Yamaguti Department of Parasitology, Tokyo Women's Medical College, Tokyo, Japan
    Brigham Young University Science Bulletin, Biological Series Volume 15 | Number 1 Article 1 8-1971 Ticks of Japan, Korea, and the Ryukyu Islands Noboru Yamaguti Department of Parasitology, Tokyo Women's Medical College, Tokyo, Japan Vernon J. Tipton Department of Zoology, Brigham Young University, Provo, Utah Hugh L. Keegan Department of Preventative Medicine, School of Medicine, University of Mississippi, Jackson, Mississippi Seiichi Toshioka Department of Entomology, 406th Medical Laboratory, U.S. Army Medical Command, APO San Francisco, 96343, USA Follow this and additional works at: https://scholarsarchive.byu.edu/byuscib Part of the Anatomy Commons, Botany Commons, Physiology Commons, and the Zoology Commons Recommended Citation Yamaguti, Noboru; Tipton, Vernon J.; Keegan, Hugh L.; and Toshioka, Seiichi (1971) "Ticks of Japan, Korea, and the Ryukyu Islands," Brigham Young University Science Bulletin, Biological Series: Vol. 15 : No. 1 , Article 1. Available at: https://scholarsarchive.byu.edu/byuscib/vol15/iss1/1 This Article is brought to you for free and open access by the Western North American Naturalist Publications at BYU ScholarsArchive. It has been accepted for inclusion in Brigham Young University Science Bulletin, Biological Series by an authorized editor of BYU ScholarsArchive. For more information, please contact [email protected], [email protected]. MUS. CO MP. zooi_: c~- LIBRARY OCT 2 9 1971 HARVARD Brigham Young University UNIVERSITY Science Bulletin TICKS Of JAPAN, KOREA, AND THE RYUKYU ISLANDS by Noboru Yamaguti Vernon J. Tipton Hugh L. Keegan Seiichi Toshioka BIOLOGICAL SERIES — VOLUME XV, NUMBER 1 AUGUST 1971 BRIGHAM YOUNG UNIVERSITY SCIENCE BULLETIN BIOLOGICAL SERIES Editor: Stanley L. Welsh, Department of Botany, Brigham Young University, Prove, Utah Members of the Editorial Board: Vernon J.
    [Show full text]
  • I RESEARCH DISSERTATION for Msc Degree in Life Sciences Submitted
    INVESTIGATION OF TICK-BORNE PATHOGENS RESISTANCE MARKERS USING NEXT GENERATION SEQUENCING RESEARCH DISSERTATION for MSc degree in Life Sciences Submitted to the DEPARTMENT OF LIFE AND CONSUMER SCIENCES UNIVERSITY OF SOUTH AFRICA by AUBREY D CHIGWADA Student No: 61366943 SUPERVISOR: DR TM MASEBE CO-SUPERVISOR: DR NO MAPHOLI JULY 2021 i DECLARATION Name: Aubrey Dickson Chigwada Student number: 61366943 Degree: Master of Science in Life Sciences Dissertation title: INVESTIGATION OF TICK-BORNE PATHOGENS RESISTANCE MARKERS USING NEXT GENERATION SEQUENCING I, Aubrey D Chigwada, declare that investigation of tick-borne pathogens resistance markers using next-generation sequencing is my work, and sources I have used have been acknowledged by complete references. I submit this thesis for a Master of Science in life science at the college of agriculture and environmental science at the University of South Africa and have not been submitted to any other university. JULY 2021 -------------------------------- --------------------------- Aubrey Dickson Chigwada Date ii ACKNOWLEDGEMENTS Firstly, I would like to thank God almighty for the strength to carry on and a gift of life. Words cannot express my deepest gratitude to my supervisor Dr. TM Masebe for her professional guidance, encouragement, support, corrections, instructions, patience, and technical skills thought- out this work. I am forever indebted to your mentorship; you are a role model and an inspiration to me. I would like to extend my sincere appreciation to my Co-supervisor Dr. NO Mapholi for her insightful comments and suggestions. To the woman in research funds used for this project, I am grateful. Much gratitude to Dr. Ramganesh Selvarajan for his mentorship and training from the basics to the actual Miseq sequencing, which made it possible to sequence for this work.
    [Show full text]
  • Emerging Tick-Borne Infections in Mainland China: an Increasing Public Health Threat
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE HHS Public Access provided by IUPUIScholarWorks Author manuscript Author ManuscriptAuthor Manuscript Author Lancet Infect Manuscript Author Dis. Author Manuscript Author manuscript; available in PMC 2016 May 18. Published in final edited form as: Lancet Infect Dis. 2015 December ; 15(12): 1467–1479. doi:10.1016/S1473-3099(15)00177-2. Emerging tick-borne infections in mainland China: an increasing public health threat Li-Qun Fang#, Kun Liu#, Xin-Lou Li, Song Liang, Yang Yang, Hong-Wu Yao, Ruo-Xi Sun, Ye Sun, Wan-Jun Chen, Shu-Qing Zuo, Mai-Juan Ma, Hao Li, Jia-Fu Jiang, Wei Liu, X Frank Yang, Gregory C Gray, Peter J Krause, and Wu-Chun Cao State Key Laboratory of Pathogen and Biosecurity, Beijing Institute of Microbiology and Epidemiology, Beijing, China (L-Q Fang PhD, K Liu MS, X-L Li MS, H-W Yao MS, R-X Sun BS, Y Sun BS, W-J Chen BS, S-Q Zuo PhD, M-J Ma PhD, H Li PhD, J-F Jiang PhD, Prof W Liu PhD, Prof W-C Cao PhD); College of Public Health and Health Professions, and Emerging Pathogens Institute, University of Florida, Gainesville, FL, USA (S Liang PhD, Y Yang PhD); Department of Microbiology and Immunology, Indiana University School of Medicine, Barnhill, IN, USA (Prof X F Yang PhD); Duke University School of Medicine, Durham, NC, USA (Prof G C Gray MD); and Department of Epidemiology of Microbial Diseases, Yale School of Public Health, and Department of Medicine and Department of Pediatrics, Yale School of Medicine, New Haven, CT, USA (P J Krause MD) # These authors contributed equally to this work.
    [Show full text]
  • Downloaded from Genbank Through the Viral Pathogen Database and Analysis Resource ( on April 2, 2020
    viruses Article A Model for the Production of Regulatory Grade Viral Hemorrhagic Fever Exposure Stocks: From Field Surveillance to Advanced Characterization of SFTSV 1, 2, 1 2 3 Unai Perez-Sautu y , Se Hun Gu y, Katie Caviness , Dong Hyun Song , Yu-Jin Kim , Nicholas Di Paola 1, Daesang Lee 2, Terry A. Klein 4, Joseph A. Chitty 1, Elyse Nagle 1, Heung-Chul Kim 4 , Sung-Tae Chong 4, Brett Beitzel 1, Daniel S. Reyes 1 , Courtney Finch 5, Russ Byrum 5, Kurt Cooper 5, Janie Liang 5, Jens H. Kuhn 5 , Xiankun Zeng 6, Kathleen A. Kuehl 6, Kayla M. Coffin 6, Jun Liu 6, Hong Sang Oh 7, Woong Seog 7, 3 1,8, , 1, , Byung-Sub Choi , Mariano Sanchez-Lockhart * z , Gustavo Palacios * z 2, , and Seong Tae Jeong * z 1 Center for Genome Sciences, United States Army Medical Research Institute of Infectious Diseases (USAMRIID), Fort Detrick, Frederick, MD 21702, USA; [email protected] (U.P.-S.); [email protected] (K.C.); [email protected] (N.D.P.); [email protected] (J.A.C.); [email protected] (E.N.); [email protected] (B.B.); [email protected] (D.S.R.) 2 The 4th Research & Development Institute, Agency for Defense Development (ADD), Daejeon 34186, Korea; [email protected] (S.H.G.); [email protected] (D.H.S.); [email protected] (D.L.) 3 Army Headquarters, Gyeryong-si 32800, Korea; [email protected] (Y.-J.K.); [email protected] (B.-S.C.) 4 Force Health Protection and Preventive Medicine, Medical Department Activity-Korea/65th Medical Brigade, Unit 15281, APO AP 96271, USA; [email protected] (T.A.K.); [email protected]
    [Show full text]
  • Molecular Identification of Blood Meal Sources of Ticks (Acari, Ixodidae) Using Cytochrome B Gene As a Genetic Marker
    A peer-reviewed open-access journal ZooKeys 478: 27–43Molecular (2015) identification of blood meal sources of ticks( Acari, Ixodidae)... 27 doi: 10.3897/zookeys.478.8037 RESEARCH ARTICLE http://zookeys.pensoft.net Launched to accelerate biodiversity research Molecular identification of blood meal sources of ticks (Acari, Ixodidae) using cytochrome b gene as a genetic marker Ernieenor Faraliana Che Lah1,2, Salmah Yaakop2, Mariana Ahamad1, Shukor Md Nor2 1 Acarology Unit, Infectious Diseases Research Centre, Institute for Medical Research, Jalan Pahang, 50588, Kuala Lumpur, Malaysia 2 School of Environmental and Natural Resource Sciences, Faculty of Sciences and Technology, University Kebangsaan Malaysia, 43600 Bangi, Selangor, Malaysia Corresponding author: Ernieenor Faraliana Che Lah ([email protected]) Academic editor: D. Apanaskevich | Received 5 June 2014 | Accepted 30 December 2014 | Published 28 January 2015 http://zoobank.org/A6589F9C-293D-4EBF-B419-6FF2E3677922 Citation: Che Lah EF, Yaakop S, Ahamad M, Md Nor S (2015) Molecular identification of blood meal sources of ticks (Acari, Ixodidae) using cytochrome b gene as a genetic marker. ZooKeys 478: 27–43. doi: 10.3897/zookeys.478.8037 Abstract Blood meal analysis (BMA) from ticks allows for the identification of natural hosts of ticks (Acari: Ixodi- dae). The aim of this study is to identify the blood meal sources of field collected on-host ticks using PCR analysis. DNA of four genera of ticks was isolated and their cytochrome b (Cyt b) gene was amplified to identify host blood meals. A phylogenetic tree was constructed based on data of Cyt b sequences using Neighbor Joining (NJ) and Maximum Parsimony (MP) analysis using MEGA 5.05 for the clustering of hosts of tick species.
    [Show full text]
  • Vol 25 No 2 Supplement TEXTS.Pmd
    FOREWORD It is an honour for me to have the opportunity and Nad has become knowledgable at the to write a few words in appreciation of professional level in a wide range of areas, Scientist Nadchatram’s life and work. I hope which he demonstrates in this report. He sets he will agree to my using the appellation forth in clear fashion the fundamentals of “Nad” for him. It is a term of friendship and Acari-related conditions, including rickettsiae respectful address used by his numerous (notably scrub typhus), viral diseases, and friends overseas. Our association began in conditions caused directly by acarines (such 1963 with my joining the staff of the George as tick bite and scabies in its zoonotic form). W. Hooper Foundation (HF) at the University He was a participant in most of the research of California Medical Centre in San Francisco. carried out in his own country, so that he is Director J. Ralph Audy, who hired me, had able to write of it with familiarity and previously been at the Institute of Medical authority. It should be obvious that this report Research (IMR) as Head of the Division of will be of unusual value to anyone concerned Virus Research and Medical Zoology and, as with research in medical zoology in Malaysia. Nad relates in his historical summation of However, I would emphasise that medical scrub typhus research, that led to a zoologists anywhere in the world can benefit collaborative program between HF and IMR. from it. Many of my associates spent one to several I was pleased to read of two topics that years at IMR (or the University of Singapore), Dr.
    [Show full text]
  • Zootaxa 0000: 0–0000 (2010) ISSN 1175-5326 (Print Edition) Article ZOOTAXA Copyright © 2010 · Magnolia Press ISSN 1175-5334 (Online Edition)
    Zootaxa 0000: 0–0000 (2010) ISSN 1175-5326 (print edition) www.mapress.com/zootaxa/ Article ZOOTAXA Copyright © 2010 · Magnolia Press ISSN 1175-5334 (online edition) The Argasidae, Ixodidae and Nuttalliellidae (Acari: Ixodida) of the world: a list of valid species names ALBERTO A. GUGLIELMONE1,8, RICHARD G. ROBBINS2, DMITRY A. APANASKEVICH3, TREVOR N. PETNEY4, AGUSTÍN ESTRADA-PEÑA5, IVAN G. HORAK6, RENFU SHAO7, & STEPHEN C. BARKER7 1Instituto Nacional de Tecnología Agropecuaria, Estación Experimental Agropecuaria Rafaela, Argentina 2ISD/AFPMB, Walter Reed Army Medical Center, Washington, DC 20307-5001, USA. E-mail: [email protected] 3U. S. National Tick Collection, the James H. Oliver, Jr. Institute of Arthropodology and Parasitology, Georgia Southern University, Statesboro, Georgia 30460-8056, U.S.A. E-mail: [email protected] 4Zoologisches Institut I, Abteilung für Ökologie und Parasitologie, Kornblumenstrasse 13, 76131 Karlsruhe, Germany. E-mail: [email protected] 5Universidad de Zaragoza, Facultad de Veterinaria, Miguel Servet 177, CP 50013, Zaragoza, Spain. E-mail: [email protected] 6Department of Veterinary Tropical Diseases, Faculty of Veterinary Science, University of Pretoria, Onderstepoort, 0110 South Africa. E-mail: [email protected] 7Parasitology Section, School of Molecular and Microbiological Sciences, University of Queensland, Brisbane, Queensland 4072, Australia. E-mail: [email protected] 8Corresponding author. E-mail: [email protected] Abstract This work is intended as a consensus list of valid tick names, following recent revisionary studies, wherein we recognize 896 species of ticks in 3 families. The Nuttalliellidae is monotypic, containing the single entity Nuttalliella namaqua. The Argasidae consists of 193 species, but there is widespread disagreement concerning the genera in this family, and fully 133 argasids will have to be further studied before any consensus can be reached on the issue of genus-level classification.
    [Show full text]
  • Human Infestation by Amblyomma Testudinarium (Acari: Ixodidae) in Malay Peninsula, Malaysia
    J. Acarol. Soc. Jpn., 21(2): 143-148. November 25, 2012 © The Acarological Society of Japan http://acari.ac.affrc.go.jp/ 143 [SHORT COMMUNICATION] Human Infestation by Amblyomma testudinarium (Acari: Ixodidae) in Malay Peninsula, Malaysia 1 2 3 2 Takeo YAMAUCHI *, Ai TAKANO , Munetoshi MARUYAMA and Hiroki KAWABATA 1Toyama Institute of Health, Imizu 939–0363, Japan 2Department of Bacteriology-I, National Institute of Infectious Diseases, Toyama, Shinjuku-ku, Tokyo 162–8640, Japan 3The Kyushu University Museum, Hakozaki, Higashi-ku, Fukuoka 812–8581, Japan (Received 9 July 2012; Accepted 30 July 2012) ABSTRACT A Japanese male repeatedly infested with Amblyomma testudinarium in Malaysia was reported. He visited to Ulu Gombak, Malay Peninsula, Malaysia on April and May 2007, and he recalled three times of tick bite during traveling. The fi rst tick bite was by one nymph infested on the inner side of the brachium of the patient. After a few days, erythema with a diameter of 2 cm was found at the site of tick attachment. Pain of the site remained for 20 days. The second tick bite was by larvae infested on the skin surface of the abdomen, basal portion of the thigh, and scrotum of the patient. He felt a pain at the moment of tick infestation. The pain remained for 15 days. The third tick bite was by a larva, and the tick was found in the phyma of his back immediately after his return Japan. Key words: hard tick, Amblyomma testudinarium, tick bite, molecular identification, imported case, Malaysia Ticks transmit a greater variety of pathogenic microorganisms than any other arthropod vector groups, and are one of the most important vectors carrying diseases to humans, livestock, and companion animals (Parola and Raoult, 2001; Jongejan and Uilenberg, 2004).
    [Show full text]
  • Amblyomma Testudinarium
    ISSN (Print) 0023-4001 ISSN (Online) 1738-0006 Korean J Parasitol Vol. 52, No. 6: 685-690, December 2014 ▣ CASE REPORT http://dx.doi.org/10.3347/kjp.2014.52.6.685 Perianal Tick-Bite Lesion Caused by a Fully Engorged Female Amblyomma testudinarium 1, 2 3 1 4 Jin Kim *, Haeng An Kang , Sung Sun Kim , Hyun Soo Joo , Won Seog Chong 1Department of Parasitology, College of Medicine, Seonam University, Namwon 590-711, Korea; 2Department of Colorectal Surgery, Kangmoon Surgical Clinic, Gwangju 502-835, Korea; 3Department of Pathology, Chonnam National University Medical School, Gwangju 501-746, Korea; 4Department of Pharmacology, College of medicine, Seonam University, Namwon 590-711, Korea Abstract: A perianal tick and the surrounding skin were surgically excised from a 73-year-old man residing in a south- western costal area of the Korean Peninsula. Microscopically a deep penetrating lesion was formed beneath the attach- ment site. Dense and mixed inflammatory cell infiltrations occurred in the dermis and subcutaneous tissues around the feeding lesion. Amorphous eosinophilic cement was abundant in the center of the lesion. The tick had Y-shaped anal groove, long mouthparts, ornate scutum, comma-shaped spiracular plate, distinct eyes, and fastoons. It was morphologi- cally identified as a fully engorged female Amblyomma testudinarium. This is the third human case of Amblyomma tick in- fection in Korea. Key words: Amblyomma testudinarium, tick, human, histopathology INTRODUCTION CASE RECORD The ticks that belong to the genus Amblyomma are large, or- A 73-year-old Korean man with a round nodule in the left nate, longirostrate blood-feeding ectoparasites of a wide variety perianal area presented to our clinic in September 2010.
    [Show full text]