WHERE WILL AI TAKE US? in Westworld, the AI Incorporated Into “Host” Robots Has Advanced to the Point of Passing the Famed Turing Test

Total Page:16

File Type:pdf, Size:1020Kb

Load more

PERSPECTIVE THE WRITER’S VOICE HBO’s Westworld imagines how artificial intelligence could have dire costs. Should health care professionals take note? tion facility, were likely enough to hook many viewers. As a budding physician with a passion for anatomy, I was further enthralled with how the show depicted the engineering of the androids’ human-like PHOTO COURTESY OF HBO / JOHN P. JOHNSON COURTESYPHOTO / JOHN P. OF HBO physiques from artificial primordial ele- ments. The onscreen procedure was equal parts fascinating and disturbing, invoking Vesalius’ grisly dissections, which founded our modern understanding of the human body. However, my strongest personal response to the show has been an unex- pected realization that the ethical issues AI poses in Westworld will likely be the foremost issues the field of radiology faces during my career. WHERE WILL AI TAKE US? In Westworld, the AI incorporated into “host” robots has advanced to the point of passing the famed Turing test. Westworld triggers Visitors to the titular theme park cannot distinguish these artificial beings from reflections about actual humans. Today, in the real world, advancements in deep learning are allow- ing AI to accumulate new information and radiology’s future understanding at a rate that humans can- not match. According to Keith J. Dreyer, BY JOSHUA T. OLSON DO, PhD, and vice chairman of Radiol- hen the Radiological Society of future AI applications, including the use ogy Computer and Information Sciences North America (RSNA) hosted its of machine learning to correlate imaging at Massachusetts General Hospital, the W2016 annual meeting in Chicago, findings with clinical data in electronic “point of singularity”—a time at which among the chief subjects discussed was medical records, as well as with relevant machine intelligence surpasses that of the evolution of machine learning and scientific literature—an innovation that all humans combined—could be just its impact on radiology. Session topics would usher in a new era of precision over a decade away, occurring as soon as touched on key developments in artificial medicine. 2029.2 Given Dreyer’s prediction, perhaps intelligence (AI), including the use of Last fall, as a medical student circling some elements of Westworld are not so computing technology to model the neural the Midwest on the residency interview far-fetched—but instead of playing out in networks of the human brain—a technique trail in pursuit of a position in the ra- an antiquated western theme park, they’ll labelled “deep learning.” Through deep diology field, I found myself splitting be set within the modern American health learning, computers have demonstrated an time between virtually attending the care system. ability to surpass humans in competitions RSNA meeting, preparing for upcoming Putting aside the plausibility of such measuring accuracy of visual recognition. interviews, and (like many of my col- a scenario, I find myself pondering the Not unexpectedly, the infusion of leagues) binge-watching HBO’s new hit implications AI poses for radiology. Given this technology into radiology work has TV series Westworld. In this remake of recent advances in visual recognition already begun. For example, computer- Michael Crichton’s 1973 science fiction software, will deep learning reach a point assisted identification of breast lesions thriller, theme-park robots revolt and where the technology doesn’t merely aug- now plays a major role in mammographic begin killing park visitors. The show’s ment the work of radiologists, but fully screening for breast cancer.1 At the RSNA scenic western vistas, juxtaposed with the replace it? Will other humans’ health care meeting, attendees discussed possible workings of a futuristic android produc- 16 | MINNESOTA MEDICINE | MARCH/APRIL 2017 THE WRITER’S VOICE PERSPECTIVE roles become obsolete, as well? Will tech- Most importantly, to what degree will that carries with it the potential to harm nology we employ while serving patients radiologists incorporate AI into the pro- humans, it will be the responsibility of ever be able to “think” in a manner we cesses of making life-or-death health care radiologists—along with the creators of consider “conscious”? If so, where will the management decisions? AI solutions deployed within the radiol- responsibility lie if machine error leads Undoubtedly, these are questions we’ll ogy field—to avoid such a grave mistake. to faulty or missed diagnoses—say, for grapple with in the coming years. Until We must address possible ramifications example, a missed lung nodule that leads then, I find myself ruminating on a fore- beforehand, so the evolution of machine to metastatic cancer? What will be our boding statement made by Dr. Robert learning will strengthen our work—and threshold of tolerance for such mistakes? Ford, Westworld’s park designer (played not hurt those who depend upon us. MM by Anthony Hopkins), Joshua T. Olson is an MD candidate (class of in this season’s final epi- 2017) at the University of Minnesota Medical sode: “Wasn’t it Oppen- School. heimer who said, ‘Any man whose mistakes REFERENCES: take 10 years to correct 1. Wang J, Yang X, Cai H, Tan W, Jin C, Li L. is quite the man?’ Well, Discrimination of breast cancer with microcalcifica- mine took 35.”3 This tions on mammography by deep learning. Sci Rep. 2016;6:27327. PHOTO COURTESY OF HBO / JOHN P. JOHNSON PHOTO COURTESYHBO / JOHN P. OF character didn’t an- 2. Dreyer K, Baron R. When Machines Think: ticipate that his earlier Radiology’s Next Frontier. Radiological Society of North America 2016 Scientific Assembly and Annual decisions surrounding Meeting, November 27-December 2, 2016, Chicago AI would, decades later, IL. Information at: archive.rsna.org/2016/16004761. html. have dire consequences. 3. “The Bicameral Mind.” Westworld. HBO. Anthony Hopkins As we now prepare to December 4, 2016. as Dr. Robert Ford. implement a profoundly disruptive technology You have worked hard. Protect what Your Link to Mental Health Resources you have worked for. Wealth Protection Strategies for High-Income, High Net-Worth individuals, their families, and their businesses. Thomas F. Miller Attorney at Law 40 YEARS EXPERIENCE • HIGHEST PEER REVIEWS Thomas F. Miller, P.A. 1000 Superior Boulevard, Suite 303, Wayzata, MN 55391 OFFICE: 952-404-3896 MOBILE: 612-991-5992 [email protected] MARCH/APRIL 2017 | MINNESOTA MEDICINE | 17.
Recommended publications
  • Struction of the Feminine/Masculine Dichotomy in Westworld

    Struction of the Feminine/Masculine Dichotomy in Westworld

    WiN: The EAAS Women’s Network Journal Issue 2 (2020) Skin-Deep Gender: Posthumanity and the De(con)struction of the Feminine/Masculine Dichotomy in Westworld Amaya Fernández Menicucci ABSTRACT: This article addresses the ways in which gender configurations are used as representations of the process of self-construction of both human and non-human characters in Jonathan Nolan and Lisa Joy’s series Westworld, produced by HBO and first launched in 2016. In particular, I explore the extent to which the process of genderization is deconstructed when human and non-human identities merge into a posthuman reality that is both material and virtual. In Westworld, both cyborg and human characters understand gender as embodiment, enactment, repetition, and codified communication. Yet, both sets of characters eventually face a process of disembodiment when their bodies are digitalized, which challenges the very nature of identity in general and gender identity in particular. Placing this digitalization of human identity against Donna Haraway’s cyborg theory and Judith Butler’s citational approach to gender identification, a question emerges, which neither Posthumanity Studies nor Gender Studies can ignore: can gender identities survive a process of disembodiment? Such, indeed, is the scenario portrayed in Westworld: a world in which bodies do not matter and gender is only skin-deep. KEYWORDS: Westworld; gender; posthumanity; embodiment; cyborg The cyborg is a creature in a post-gender world. The cyborg is also the awful apocalyptic telos of the ‘West’s’ escalating dominations . (Haraway, A Cyborg Manifesto 8) Revolution in a Post-Gender, Post-Race, Post-Class, Post-Western, Posthuman World The diegetic reality of the HBO series Westworld (2016-2018) opens up the possibility of a posthuman existence via the synthesis of individual human identities and personalities into algorithms and a post-corporeal digital life.
  • Casual and Hardcore Players in HBO's Westworld (2016): the Immoral and Violent Player

    Casual and Hardcore Players in HBO's Westworld (2016): the Immoral and Violent Player

    Casual and Hardcore Players in HBO’s Westworld (2016): The Immoral and Violent Player MA Thesis Ellen Menger – 5689295 [email protected] Supervisor: Dr. René Glas Second reader: Dr. Jasper van Vught Utrecht University MA New Media & Digital Culture MCMV10009 - THE-Masterthesis/ MA NMDC May 8, 2017 Abstract This thesis approaches the HBO series Westworld (2016) through the lens of game studies and interprets the series as a commentary on the stereotype of casual and hardcore players and immoral violence in video games. By performing a textual analysis, this thesis explores how Westworld as a series makes use of the casual and hardcore player stereotype, looking at the way the series explores the construction of player categories and how it ties these to the dialogue about violence and immoral behaviour in video games. Keywords: Westworld, games, player types, Western, casual gamer, hardcore gamer, violence, ethics, morals SPOILER WARNING This thesis reveals certain plot twists that may spoil part of the storyline of the first season of HBO’s Westworld. If you have not watched the series, read at your own risk. Table of Contents 1. Introduction ........................................................................................................................ 1 2. Theoretical framework ....................................................................................................... 7 2.1. (Im)moral Behaviour in Game Worlds ....................................................................... 7 2.2. The Player as a Moral
  • Beyond Westworld

    Beyond Westworld

    “We Don’t Know Exactly How They Work”: Making Sense of Technophobia in 1973 Westworld, Futureworld, and Beyond Westworld Stefano Bigliardi Al Akhawayn University in Ifrane - Morocco Abstract This article scrutinizes Michael Crichton’s movie Westworld (1973), its sequel Futureworld (1976), and the spin-off series Beyond Westworld (1980), as well as the critical literature that deals with them. I examine whether Crichton’s movie, its sequel, and the 1980s series contain and convey a consistent technophobic message according to the definition of “technophobia” advanced in Daniel Dinello’s 2005 monograph. I advance a proposal to develop further the concept of technophobia in order to offer a more satisfactory and unified interpretation of the narratives at stake. I connect technophobia and what I call de-theologized, epistemic hubris: the conclusion is that fearing technology is philosophically meaningful if one realizes that the limitations of technology are the consequence of its creation and usage on behalf of epistemically limited humanity (or artificial minds). Keywords: Westworld, Futureworld, Beyond Westworld, Michael Crichton, androids, technology, technophobia, Daniel Dinello, hubris. 1. Introduction The 2016 and 2018 HBO series Westworld by Jonathan Nolan and Lisa Joy has spawned renewed interest in the 1973 movie with the same title by Michael Crichton (1942-2008), its 1976 sequel Futureworld by Richard T. Heffron (1930-2007), and the short-lived 1980 MGM TV series Beyond Westworld. The movies and the series deal with androids used for recreational purposes and raise questions about technology and its risks. I aim at an as-yet unattempted comparative analysis taking the narratives at stake as technophobic tales: each one conveys a feeling of threat and fear related to technological beings and environments.
  • Michael Crichton

    Michael Crichton

    Michael Crichton Genre: Science fiction/Thrillers/Adventure Remember that huge movie years ago called Jurassic Park? Did you know that was based off of Michael Crichton’s book of the same name? Michael Crichton’s books can extremely detailed and involve science, adventure, political and thriller elements. While most famous for Jurassic Park and it’s sequel, The Lost World, he has written many other books tackling a wide range of subjects. The Great Train Robbery is his foray into historical fiction, and Rising Sun is a suspense story with political elements. Read-a-likes Greg Bear If you the science fiction aspect of Crichton, try Greg Bear. The Forge of God is disaster science fiction where two sets of aliens visit Earth and set in motion humanity’s demise. Darwin’s Radio tackles human evolution, where as Blood Music deals with nanotechnology. Philip Kerr Like Crichton, Kerr’s books are in a wide variety of genres. His Bernie Gunther novels, starting with March Violets, start a detective during the World War II period. The Second Angel and The Grid are science fiction thrillers, much like Crichton’s. Dark Matter: The Private Life of Sir Isaac Newton: A Novel is Kerr’s stab at historical mystery. John Darnton A scientific thriller writer, Darnton’s novels explore human cloning, evolution, and the soul. His book Mind Catcher deals with whether souls can be transferred to a computer chip. Two scientists get caught up in a conspiracy when they discover ancient ancestors of human in Neanderthal. Steven Alten If you have a taste for science fiction thrillers that are on the weird side, try Alten’s books.
  • Michael Crichton and the Distancing of Scientific Discourse

    Michael Crichton and the Distancing of Scientific Discourse

    ASp la revue du GERAS 55 | 2009 Varia Apparent truth and false reality: Michael Crichton and the distancing of scientific discourse Stéphanie Genty Electronic version URL: http://journals.openedition.org/asp/290 DOI: 10.4000/asp.290 ISBN: 978-2-8218-0408-1 ISSN: 2108-6354 Publisher Groupe d'étude et de recherche en anglais de spécialité Printed version Date of publication: 1 March 2009 Number of pages: 95-106 ISSN: 1246-8185 Electronic reference Stéphanie Genty, « Apparent truth and false reality: Michael Crichton and the distancing of scientific discourse », ASp [Online], 55 | 2009, Online since 01 March 2012, connection on 02 November 2020. URL : http://journals.openedition.org/asp/290 ; DOI : https://doi.org/10.4000/asp.290 This text was automatically generated on 2 November 2020. Tous droits réservés Apparent truth and false reality: Michael Crichton and the distancing of scie... 1 Apparent truth and false reality: Michael Crichton and the distancing of scientific discourse Stéphanie Genty Introduction 1 This article began as an inquiry into the relation of FASP, or professional-based fiction, to professional reality. I was interested in elucidating the ways in which this reality, which formed the basis for such fiction, was transformed by the writer in his/her work and the reasons behind the transformation. Since my own professional activity has been related to the sciences, I chose to study the novels of Michael Crichton, a commercially-successful writer whose credentials and practice qualify him as an author of professional-based fiction as defined by Michel Petit in his 1999 article “La fiction à substrat professionnel: une autre voie d'accès à l'anglais de spécialité”.
  • Complicated Views: Mainstream Cinema's Representation of Non

    Complicated Views: Mainstream Cinema's Representation of Non

    University of Southampton Research Repository Copyright © and Moral Rights for this thesis and, where applicable, any accompanying data are retained by the author and/or other copyright owners. A copy can be downloaded for personal non-commercial research or study, without prior permission or charge. This thesis and the accompanying data cannot be reproduced or quoted extensively from without first obtaining permission in writing from the copyright holder/s. The content of the thesis and accompanying research data (where applicable) must not be changed in any way or sold commercially in any format or medium without the formal permission of the copyright holder/s. When referring to this thesis and any accompanying data, full bibliographic details must be given, e.g. Thesis: Author (Year of Submission) "Full thesis title", University of Southampton, name of the University Faculty or School or Department, PhD Thesis, pagination. Data: Author (Year) Title. URI [dataset] University of Southampton Faculty of Arts and Humanities Film Studies Complicated Views: Mainstream Cinema’s Representation of Non-Cinematic Audio/Visual Technologies after Television. DOI: by Eliot W. Blades Thesis for the degree of Doctor of Philosophy May 2020 University of Southampton Abstract Faculty of Arts and Humanities Department of Film Studies Thesis for the degree of Doctor of Philosophy Complicated Views: Mainstream Cinema’s Representation of Non-Cinematic Audio/Visual Technologies after Television. by Eliot W. Blades This thesis examines a number of mainstream fiction feature films which incorporate imagery from non-cinematic moving image technologies. The period examined ranges from the era of the widespread success of television (i.e.
  • For Immediate Release Second Night of 2017 Creative Arts

    For Immediate Release Second Night of 2017 Creative Arts

    FOR IMMEDIATE RELEASE SECOND NIGHT OF 2017 CREATIVE ARTS EMMY® WINNERS ANNOUNCED (Los Angeles, Calif. – September 10, 2017) The Television Academy tonight presented the second of its two 2017 Creative Arts Emmy® Awards Ceremonies honoring outstanding artistic and technical achievement in television at the Microsoft Theater in Los Angeles. The ceremony honored performers, artists and craftspeople for excellence in scripted programming including comedy, drama and limited series. Executive produced by Bob Bain, the Creative Arts Emmy Awards featured presenters from the season’s most popular show including Hank Azaria (Brockmire and Ray Donovan), Angela Bassett (911 and Black Panther), Alexis Bledel (The Handmaid’s Tale), Laverne Cox (Orange Is the New Black), Joseph Gordon-Levitt (Are You There Democracy? It's Me, The Internet) and Tom Hanks (Saturday Night Live). Press Contacts: Stephanie Goodell breakwhitelight (for the Television Academy) [email protected], (818) 462-1150 Laura Puig breakwhitelight (for the Television Academy) [email protected], (956) 235-8723 For more information please visit emmys.com. TELEVISION ACADEMY 2017 CREATIVE ARTS EMMY AWARDS – SUNDAY The awards for both ceremonies, as tabulated by the independent accounting firm of Ernst & Young LLP, were distributed as follows: Program Individual Total HBO 3 16 19 Netflix 1 15 16 NBC - 9 9 ABC 2 5 7 FOX 1 4 5 Hulu - 5 5 Adult Swim - 4 4 CBS 2 2 4 FX Networks - 4 4 A&E 1 2 3 VH1 - 3 3 Amazon - 2 2 BBC America 1 1 2 ESPN - 2 2 National Geographic 1 1 2 AMC 1 - 1 Cartoon Network 1 - 1 CNN 1 - 1 Comedy Central 1 - 1 Disney XD - 1 1 Samsung / Oculus 1 - 1 Showtime - 1 1 TBS - 1 1 Viceland 1 - 1 Vimeo - 1 1 A complete list of all awards presented tonight is attached.
  • Global Warming, the Politicization of Science, and Michael Crichton's State of Fear

    Global Warming, the Politicization of Science, and Michael Crichton's State of Fear

    Journal of Scientific Exploration, Vol. 19, No. 2, pp. 247-256, 2005 0892-33 1OlO5 Global Warming, the Politicization of Science, and Michael Crichton's State of Fear College of Geoscience University of Oklahoma Norman, Oklahoma 7301 9 e-mail: ddeming @ou.edu Abstract-Michael Crichton's book State of Fear addresses the politicization of science, in particular the topics of climate change and global warming, through the vehicle of a novel. In the author's opinion, Crichton is correct: the field of climate research has become highly politicized. An example is provided by the revisionist efforts of some researchers to extinguish the existence of a Medieval Warm Period. The politicization of science is a threat to the process of free inquiry necessary for human progress. Keywords: global warming-temperature-Crichton-climate- Medieval Warm Period On December 26, 2004, a magnitude 9.0 earthquake occurred off the coast of Northern Sumatra. The massive temblor, the largest in 40 years, spawned tsunamis that killed more than 280,000 people. The next day, a colleague at a think tank emailed me to ask whether I had any opinions about the new Michael Crichton book, State of Fear (Crichton, 2004). Although State of Fear is a fictional thriller about eco-terrorism, its real thesis is the politicization of science, in particular climate change and global warming. Because global warming is a highly-charged political subject, Crichton's book has received a lot of attention in the press, including a review by Washington Post columnist George Will (Will, 2004). My colleague closed his email with a little joke: P.S.-I'm also anxious to see if anyone blames this weekend's tsunami in Indonesia on global warming.
  • 1) Michael Crichton's Fantasy About Cloning Dinosaurs, Jurassic Park Contains a Putative Dinosaur DNA Sequence

    1) Michael Crichton's Fantasy About Cloning Dinosaurs, Jurassic Park Contains a Putative Dinosaur DNA Sequence

    1) Michael Crichton's fantasy about cloning dinosaurs, Jurassic Park contains a putative dinosaur DNA sequence. Use nucleotide-nucleotide BLAST against the default nucleotide database to identify the real source of the following sequence: >DinoDNA "Dinosaur DNA" from Crichton's JURASSIC PARK p. 103 nt 1-1200 GCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGC GGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCG TGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGC TGCTCACGCTGTACCTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTG CCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAA AGTAGGACAGGTGCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAG ATCGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACT CCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCTGGGCT GGCGTTCGCGACGCGAGGCTGGATGGCCTTCCCCATTATGATTCTTCTCGCTTCCGGCGG CCCGCGTTGCAGGCCATGCTGTCCAGGCAGGTAGATGACGACCATCAGGGACAGCTTCAA CGGCTCTTACCAGCCTAACTTCGATCACTGGACCGCTGATCGTCACGGCGATTTATGCCG CACATGGACGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAA CAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAA GCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGG CTTTCTCAATGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTG ACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCA ACACGACTTAACGGGTTGGCATGGATTGTAGGCGCCGCCCTATACCTTGTCTGCCTCCCC GCGGTGCATGGAGCCGGGCCACCTCGACCTGAATGGAAGCCGGCGGCACCTCGCTAACGG CCAAGAATTGGAGCCAATCAATTCTTGCGGAGAACTGTGAATGCGCAAACCAACCCTTGG CCATCGCGTCCGCCATCTCCAGCAGCCGCACGCGGCGCATCTCGGGCAGCGTTGGGTCCT 2) Mark Boguski of the NBCI noticed
  • The Emancipatory Politics of Westworld (2016-)

    The Emancipatory Politics of Westworld (2016-)

    UNIVERSITY OF OKLAHOMA GRADUATE COLLEGE QUESTIONING THE NATURE OF REALITY: THE EMANCIPATORY POLITICS OF WESTWORLD (2016-) A THESIS SUBMITTED TO THE GRADUATE FACULTY In partial fulfillment of the requirements for the Degree of MASTER OF ARTS By MORGAN JONES Norman, Oklahoma 2021 QUESTIONING THE NATURE OF REALITY: THE EMANCIPATORY POLITICS OF WESTWORLD (2016-) A THESIS APPROVED FOR THE DEPARTMENT OF GEOGRAPHY AND ENVIRONMENTAL SUSTAINABILITY BY THE COMMITTEE CONSISTING OF Dr. Laurel Smith, Chair Dr. Alison Fields Dr. Darren Purcell © Copyright by MORGAN JONES 2021 All Rights Reserved iv Acknowledgements I’d like to extend thanks to my thesis advisor, Dr. Laurel Smith, for letting me take this short final paper from Gender & Environment and turn it into a fully-fledged Master’s thesis. She has always taken this project seriously, even when I doubted its value (as I often did). Her extensive notes have been invaluable in crafting this document into what it is today. I would also like to thank Dr. Darren Purcell and Dr. Alison Fields who both serve on my advisory committee. The classes I have taken with them helped my conceptualization of what this thesis could be. I hope that their influence is visible in this paper. Another extension of gratitude goes to Dr. Harriet Hawkins for introducing me to geographical aesthetics, and for getting coffee with me in London when her work was the grounding force in my undergraduate capstone. I think it is absolutely necessary to thank my roommate, Holden Dempsey, and my dog, Olive, for being a stellar support system when I was at my most fragile.
  • Remixing Generalized Symbolic Media in the New Scientific Novel Søren Brier

    Remixing Generalized Symbolic Media in the New Scientific Novel Søren Brier

    Ficta: remixing generalized symbolic media in the new scientific novel Søren Brier To cite this version: Søren Brier. Ficta: remixing generalized symbolic media in the new scientific novel. Public Un- derstanding of Science, SAGE Publications, 2006, 15 (2), pp.153-174. 10.1177/0963662506059441. hal-00571086 HAL Id: hal-00571086 https://hal.archives-ouvertes.fr/hal-00571086 Submitted on 1 Mar 2011 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. SAGE PUBLICATIONS (www.sagepublications.com) PUBLIC UNDERSTANDING OF SCIENCE Public Understand. Sci. 15 (2006) 153–174 Ficta: remixing generalized symbolic media in the new scientific novel1 Søren Brier This article analyzes the use of fictionalization in popular science commu- nication as an answer to changing demands for science communication in the mass media. It concludes that a new genre—Ficta—arose especially with the work of Michael Crichton. The Ficta novel is a fiction novel based on a real scientific problem, often one that can have or already does have serious consequences for our culture or civilization. The Ficta novel is a new way for the entertainment society to reflect on scientific theories, their consequences and meaning.
  • Ennio Morricone

    Ennio Morricone

    ENNIO MORRICONE AWARDS & NOMINATIONS *selected ACADEMY AWARD NOMINATION (2015) THE HATEFUL EIGHT Best Original Score GOLDEN GLOBE AWARD (2016) THE HATEFUL EIGHT Best Original Score BAFTA AWARD (2016) THE HATEFUL EIGHT Original Music CRITICS’ CHOICE AWARD (2016) THE HATEFUL EIGHT Best Score ACADEMY AWARD (2007) For magnificent and multifaceted contributions to the HONORARY AWARD art of film music ACADEMY AWARD NOMINATION (2000) MALENA Best Original Score GOLDEN GLOBE NOMINATION (2000) MALENA Best O riginal Score GOLDEN GLOBE AWARD (1999) THE LEGEND OF 1900 Best Original Score GRAMMY AWARD NOMINATION (1998) BULWORTH Best Instrumental Composition Written for a Motion Picture or Television GRAMMY AWARD NOMINATION (1996) THE STAR MAKER Best Instrumental Composition Written for a Motion Picture or Television GRAMMY AWARD NOMINATION (1994) WOLF Best Instrumental Composition Written for a Motion Picture or Television ACADEMY AWARD NOMINATION (1991) BUGSY Best Original Score GOLDEN GLOBE NOMINATION (1991) BUGSY Best Original Score BAFTA AWARD (1991) CINEMA PARADISO Best Original Score GOLDEN GLOBE NOMINATION (1990) CASUALTIES OF WAR Best Original Score 1 The Gorfaine/Schwartz Agency, Inc. (818) 260-8500 ENNIO MORRICONE ACADEMY AWARD NOMINATION (1987) THE UNTOUCHABLES Best Original Score BAFTA AWARD (1988) THE UNTOUCHABLES Best Original Score GOLDEN GLOBE NOMINATION (1988) THE UNTOUCHABLES Best Original Score BAFTA AWARD (1987) THE MISSION Best Original Score ACADEMY AWARD NOMINATION (1986) THE MISSION Best Original Score GOLDEN GLOBE AWARD (1986) THE MISSION Best Original Score BAFTA AWARD (1985) ONCE UPON A TIME IN AMERICA Best Original Score GOLDEN GLOBE NOMINATION (1985) ONCE UPON A TIME IN AMERICA Best Original Score BAFTA AWARD (1980) DAYS OF HEAVEN Anthony Asquith Award fo r Film Music ACADEMY AWARD NOMINATION (1979) DAYS OF HEAVEN Best Original Score MOTION PICTURES THE HATEFUL EIGHT Richard N.