VASCULAR BIOLOGY
Induction of CCL20 production by Kaposi sarcoma–associated herpesvirus: role of viral FLICE inhibitory protein K13-induced NF-B activation
*Vasu Punj,1 *Hittu Matta,1 Sandra Schamus,1 Tianbing Yang,2 Yuan Chang,3 and Preet M. Chaudhary1
1Department of Medicine, Division of Hematology-Oncology, 2Spang Translational Research Core Facility, and 3Department of Pathology, University of Pittsburgh Cancer Institute, PA
Kaposi sarcoma–associated herpesvirus This induction is caused by transcrip- duced in cultured cells either by KSHV Downloaded from https://ashpublications.org/blood/article-pdf/113/22/5660/1089754/zh802209005660.pdf by UNIVERSITY OF PITTSBURGH user on 09 October 2019 (KSHV), also known as human herpesvi- tional activation of CCL20 gene, which is infection or on K13 expression. Finally, rus 8, is the etiologic agent of Kaposi mediated by binding of the p65, p50, and expression of CCL20 and CCR6 is in- sarcoma (KS), an angioproliferative le- c-Rel subunits of the transcription factor creased in clinical samples of KS. These sion characterized by dramatic angiogen- nuclear factor–B (NF-B) to an atypical results suggest that KSHV and K13- esis and inflammatory infiltration. In this NF-B–binding site present in the CCL20 mediated induction of CCL20 and CCR6 study, we report that expression of chemo- gene promoter. The CCL20 gene induc- may contribute to the recruitment of den- kine CCL20, a potent chemoattractant of tion is defective in K13 mutants that lack dritic cells and lymphocytes into the KS dendritic cells and lymphocytes, is NF-B activity, and can be blocked by lesions, and to tumor growth and metasta- strongly induced in cultured cells either specific genetic and pharmacologic inhibi- ses. (Blood. 2009;113:5660-5668) by KSHV infection or on ectopic expres- tors of the NF-B pathway. CCR6, the sion of viral FLICE inhibitory protein K13. specific receptor for CCL20, is also in- Introduction
Kaposi sarcoma (KS) is a highly vascular tumor that frequently interleukin-6 (IL-6), IL-8, IL-1, GRO-1, monocyte chemotactic occurs in the dermis of skin and mucus membranes of immunocom- protein-1 (MCP-1), NAP-2, Rantes, and CXCL16.1,12-21 promised patients.1 It is a multifocal angioproliferative lesion that The KSHV genome contains an open reading frame K13, which is is histologically characterized by the presence of distinctive one of the few genes to be expressed in latently infected KS spindle proliferating spindle cells of endothelial origin, marked neoangio- cells.22 The K13 gene encodes for a protein with homology to the genesis with edema and extravasation of red blood cells, and prodomain of caspase 8/FLICE.23 The K13 protein was originally infiltration of lymphomononuclear inflammatory cells.1-3 The in- thought to protect KSHV-infected cells from apoptosis by preventing flammatory cells are thought to play a central role in the pathogen- the activation of caspase 8/FLICE and, as such, was classified as a viral esis of KS lesions; indeed, it has proposed that early-stage KS is not FLICE inhibitory protein (vFLIP).23 However, it was subsequently a true sarcoma but an angiohyperplastic-inflammatory lesion demonstrated that K13 directly binds to and activates an approximately whose growth is driven, in part, by exuberant production of 700-kDa IB kinase (IKK) signalosome complex to activate the nuclear angiogenic and inflammatory cytokines by lymphocytes and macro- factor-B (NF-B) pathway.24-26 K13 uses the NF-B pathway to phages present in the lesion.1,4 Although infiltration by inflamma- promote cellular survival, proliferation, transformation, cytokine secre- tory cells, including CD8ϩ T cells, monocytes, macrophages, and tion, and KSHV latency.15,16,27-32 Recent work from our laboratory and dendritic cells, precedes the appearance of spindle cells in the KS others has shown that ectopic expression of K13 in human umbilical lesions,4,5 the nature and source of chemokines responsible for their vein endothelial cells (HUVECs) induces them to acquire a spindle cell recruitment remain to be fully characterized. phenotype, which is accompanied by exuberant production of proinflam- Infection with Kaposi sarcoma–associated herpesvirus (KSHV) matory cytokines and chemokines known to be involved in the is thought to play a central role in the histogenesis of KS lesions, pathogenesis of KS lesions.31,32 including its inflammatory component.4 KSHV infection has been CCL20 is a recently identified chemokine that binds to the CC detected in the endothelial cells of early KS lesions and is thought chemokine receptor 6 (CCR6) and serves as a powerful chemoat- to contribute to their phenotypic transformation into spindle tractant of a subset of effector/memory T cells, B cells, and cells.6-8 This hypothesis is supported by in vitro studies showing immature dendritic cells.33 It has been proposed that CCL20 plays a that microvascular and macrovascular endothelial cells latently crucial role in the recruitment of lymphocytes and dendritic cells to infected with KSHV acquire a spindle cell morphology.9-11 More the sites of inflammation and in the regulation of inflammatory importantly, these KSHV-infected endothelial cells were shown to response, particularly at skin and mucosal surfaces.33 Because the up-regulate the expression of genes encoding several proinflamma- KS lesions show intensive infiltration with inflammatory and tory and angiogenic cytokines and chemokines that have been dendritic cells and primarily involve the skin and mucosa,4 we have previously implicated in the pathogenesis of KS lesions, such as examined the effect of KSHV infection on the induction of CCL20.
Submitted October 27, 2008; accepted March 20, 2009. Prepublished online as The publication costs of this article were defrayed in part by page charge Blood First Edition paper, March 26, 2009; DOI 10.1182/blood-2008-10-186403. payment. Therefore, and solely to indicate this fact, this article is hereby marked ‘‘advertisement’’ in accordance with 18 USC section 1734. *V.P. and H.M. contributed equally to this work. © 2009 by The American Society of Hematology
5660 BLOOD, 28 MAY 2009 ⅐ VOLUME 113, NUMBER 22 BLOOD, 28 MAY 2009 ⅐ VOLUME 113, NUMBER 22 KSHV INDUCES CCL20 VIA vFLIP K13 5661
Our results suggest that latent infection with KSHV strongly data presented as fold change in target gene expression plus or minus SEM. induces CCL20 expression, and vFLIP K13 plays a key role in this Primers used for real-time PCR are: CCL20, forward: CCAAGAGTTT- process. We further demonstrate that mRNA of CCR6 is also GCTCCTGGCT; CCL20, reverse: TGCTTGCTGCTTCTGATTCG; CCR6, strongly induced in KSHV-infected or K13-expressing cells. These forward: GGACCGGTACATCTCCATT; CCR6, reverse: TGCTGCGCGG- TAGTGTTCT; GNB2L1, forward: GAGTGTGGCCTTCTCCTCTG; studies suggest that KSHV-mediated induction of CCL20 and GNB2L1, reverse: GCTTGCAGTTAGCCAGGTTC; Actin, forward: TCAC- CCR6 may contribute to the recruitment of dendritic cells and CCACACTGTGCCATCTACGA; Actin, reverse: CAGCGGAACCGCT- lymphocytes into the KS lesions, and vFLIP K13 may play a key CATTGCCAATGG. Primers for K13 and latency-associated nuclear anti- role in this process. gen (LANA) have been described previously.36
NF-B DNA-binding assay Downloaded from https://ashpublications.org/blood/article-pdf/113/22/5660/1089754/zh802209005660.pdf by UNIVERSITY OF PITTSBURGH user on 09 October 2019 Methods The DNA-binding activity of the p65, p50, p52, RelB, and cRel subunits was measured in triplicate in the nuclear extracts using an enzyme-linked Cell lines and reagents immunosorbent assay (ELISA)–based NF-B DNA binding assay, as HUVECs were purchased from Cambrex (East Rutherford, NJ) and were described previously.36 grown in endothelial cell basal medium-2 (EMB; Lonza, Walkersville, MD) medium containing 10% fetal bovine serum and supplemented with the ELISA bullet kit. Cells were used for experiments at passages 2 to 6. HUVECs Human CCL20 was measured in the cell-culture supernatant using a CCL20 stably expressing 4-hydroxytamoxifen (4-OHT)–inducible K13-ERTAM ELISA kit from R&D Systems and following the recommendations of the have been described previously.31 293T, BC-1, BCBL-1, BJAB, Namalwa, manufacturer. and K562 cells were obtained from ATCC (Manassas, VA). JSC-1 cells were obtained form Dr Richard Ambinder (Johns Hopkins University, Baltimore, MD). Telomerase immortalized HUVECs (iHUVECs) were Immunohistochemistry obtained from Dr Deborah Freedman (Harvard Medical School, Boston, Biopsy specimens were fixed in 10% buffered formalin and embedded in MA). MSCVneo-based retroviral vectors expressing Flag-tagged K13 and paraffin. Sections (5 m) were deparaffinized by sequential immersion in TAM 28,31 K13-ER have been described previously and were used to generate xylene and ethanol and then used for high-temperature antigen retrieval in polyclonal populations of infected cells after selection with G418. Rabbit citrate buffer (pH 6.0) for 20 minutes. All sections were subsequently polyclonal antibodies against p65, p50, p52, RelB, and cRel were obtained incubated with 3% hydrogen peroxide to block the endogenous peroxidase from Santa Cruz Biotechnology (Santa Cruz, CA). Antibodies against Flag activity and incubated with an antibody against LANA (raised in mouse) or and tubulin were from Sigma-Aldrich (St Louis, MO), and an antibody an antibody against CCL20 (raised in goat). The reactions were developed against CCL20 was from R&D Systems (Minneapolis, MN). NF- B using the MACH2 detection system (Biocare Medical, Concord, CA) as inhibitors Bay-11-7082, PS-1145, IKK-inhibitor VI (5-phenyl-2-ureido)thio- recommended by the manufacturer using 3,3-diaminobenzidine (for LANA) phene-3-carboxamide, and IKK-inhibitor VIII (ACHP, 2-amino-6-(2- and Vulcan fast red (for CCL20) as chromogens. The sections were (cyclopropylmethoxy)-6-hydroxyphenyl)-4-(4-piperidinyl)-3-pyridinecar- counterstained lightly with hematoxylin. KS and tonsil samples were used bonitrile) were purchased from Calbiochem (San Diego, CA). Arsenic as positive controls for LANA and CCL20 staining, respectively. To trioxide (As2O3) was from Sigma-Aldrich. examine nonspecific reactivity, samples were analyzed by either omitting the primary antibody or by replacing the primary antibody with an Plasmids isotype-matched control antibody. Plasmids encoding various vFLIPs, phosphorylation-resistant mutants of IB␣ and lentiviral vectors encoding control and K13 shRNAs have been Statistical analysis 16,26,28 ␣ described previously. The pGL2-CCL20/MIP- (CCL20 WT-Luc) Differences in the expression level of CCL20, CCR6, K13, and LANA ␣ ⌬ and pGL2-CCL20/MIP-3 / BM (CCL20 NF- B-Luc) luciferase reporter among control and KSHV-infected samples were studied using nonparamet- constructs were kind gifts from Dr Tomoko Kohno (Nagasaki University, ric Mann-Whitney U test using Analyse-it statistical software (Analyse-it, 34 Nagasaki, Japan). Recombinant lentiviruses were generated and used to Leeds, United Kingdom). All tests were 2-tailed, and P values less than 26 infect BCBL-1 cells essentially as described previously. .05 were considered significant.
Luciferase reporter assay Image acquisition The 293T cells were transfected in a 24-well plate with various test plasmids Images in Figure 7 were viewed with an Olympus CKX41 along with the wild-type (WT) or mutant CCL20 luciferase reporter constructs ϫ (75 ng/well) and a pRSV/LacZ (-galactosidase) reporter construct (75 ng/well) microscope with 40 /0.60 numeric aperature objective Luc Plan using calcium phosphate as described previously.24 Cells were lysed 24 to PLN lenses and the following stains: hematoxylin and eosin (panel 36 hours later, and extracts were used for the measurement of firefly luciferase B), DAB-3 (3-diaminobenzidine; panel C), and DAB and Vulcan and -galactosidase activities, respectively. Luciferase activity was normalized fast Red (panel D). Images were acquired using a SPOT Insight 4 relative to the -galactosidase activity to control for the difference in the Firewire camera and Spot Advanced version 4.6 acquisition transfection efficiency. Luciferase reporter assay in MEF cells was conducted software (Diagnostic Instruments, Sterling Heights, MI), and essentially as described previously.35 processed with Adobe Photoshop CS2 software (Adobe Systems, San Jose, CA). Real-time reverse-transcribed–polymerase chain reaction
RNA was isolated using the RNeasy Mini kit (QIAGEN, Valencia, CA) and quantitative reverse-transcribed–polymerase chain reaction (RT-PCR) per- Results formed as described previously.36 Real-time PCRs were performed in triplicate using an ABI Prism 7000 system and SYBR green-Taq polymer- Induction of CCL20 expression by KSHV ase mix to determine the relative change in the expression of CCL20 or CCR6 genes. GNB2L1 (guanine nucleotide binding protein, beta polypep- Infection of HUVECs with KSHV is known to induce the tide 2-like 1) or -actin was used as a housekeeping control. Quantitative expression of a large number of chemokines and cytokines, such as RT-PCR data (Ct values) were analyzed using the 2Ϫ⌬⌬C method,37 and the IL-6, IL-8, and CCL5/RANTES, and CXCL16.1,12-21 To determine 5662 PUNJ et al BLOOD, 28 MAY 2009 ⅐ VOLUME 113, NUMBER 22 Downloaded from https://ashpublications.org/blood/article-pdf/113/22/5660/1089754/zh802209005660.pdf by UNIVERSITY OF PITTSBURGH user on 09 October 2019
Figure 1. KSHV up-regulates CCL20 expression in HUVEC and PEL cell lines. (A) HUVECs were infected with KSHV for 48 hours, and expression of CCL20 was measured by quantitative RT-PCR analysis and normalized to GNB2L1 (housekeeping control). PCRs were performed in triplicate and the data presented as fold change in target gene expression (mean Ϯ SE). The results of the quantitative RT-PCR analysis were confirmed by separating the products (5.0 L) on a 1.5% agarose gel followed by staining with ethidium bromide (bottom panel). (B,C) Cellular supernatants from KSHV-infected HUVECs were collected 3 days (B) and 6 days (C) after infection and used to measure the secretion of CCL20 by ELISA. The values shown are averages (mean Ϯ SE) of 1 representative experiment of 3 in which the level of CCL20 secretion was measured in duplicate. (D) Kinetics of CCL20 up-regulation in KSHV-infected iHUVEC as measured by ELISA. (E) Level of CCL20 mRNA expression, as measured by quantitative RT-PCR, in PEL cell lines naturally infected with KSHV (BC-1, BCBL-1, and JSC-1). The KSHV-negative BJAB cell line was used as negative control. whether KSHV infection can also induce CCL20 gene expression, in-frame to the ligand-binding domain of a mutated estrogen we infected HUVECs with KSHV and, approximately 48 hours receptor.31 The mutated estrogen receptor does not bind to the after infection examined the induction of CCL20 mRNA by physiologic ligand estrogen but binds with very high affinity to the quantitative RT-PCR analysis. Significant induction of CCL20 synthetic ligand 4-OHT and regulates the activity of its fusion mRNA expression was observed in KSHV-infected HUVECs partner K13 in a 4-OHT–dependent fashion.31 Induction of K13 compared with the mock-infected cells (Figure 1A). CCL20 protein activity in these cells on treatment with 4-OHT results in the level, as measured by ELISA, was also significantly higher in the acquisition of spindle cell morphology and secretion of pro- supernatant of KSHV-infected HUVECs 3 and 6 days after inflammatory cytokines and chemokines, thus mimicking the effect infection (Figure 1B,C). A sustained increase in CCL20 secretion, of KSHV infection.31 We used this cell line model to examine which was maintained for up to 6 days after infection, was also whether induction of K13 activity in HUVEC-K13-ERTAM can also seen in telomerase-iHUVECs on KSHV infection (Figure 1D). mimic the effect of KSHV infection on CCL20 gene induction. To examine whether CCL20 gene expression in KSHV-infected Treatment of HUVEC-K13-ERTAM cells with 4-OHT led to a cells was limited to vascular endothelial cells, we examined its dramatic induction of CCL20 gene expression as determined by expression in 3 primary effusion lymphoma (PEL) cell lines (BC-1, quantitative RT-PCR analysis (Figure 2A). This was accompanied BCBL-1, and JSC-1), which are naturally infected with KSHV. As by a parallel increase in CCL20 secretion in the supernatant, as shown in Figure 1E, strong CCL20 gene expression was observed determined by ELISA (Figure 2B). 4-OHT treatment had no effect in the BC-1 cell line, whereas weak expression was seen in the on CCL20 mRNA or CCL20 protein expression in the control BCBL-1 and JSC-1 cell lines. The level of expression of CCL20 in vector-expressing HUVECs, thus demonstrating that the observed the 3 PEL cell lines correlated well with their previously reported effect was specific to the induction of K13 activity (Figure 2A,B). level of vFLIP K13 expression and NF-B activity.25,36 In contrast, Because induction of K13 activity in HUVEC K13-ERTAM cells very little CCL20 expression was seen in the human B-cell is accompanied by acquisition of spindle cell morphology,31,32 it lymphoma cell line BJAB (Figure 1E), which is not infected with was conceivable that K13 does not up-regulate CCL20 expression KSHV and demonstrates weak NF-B activity.38 directly but rather does so indirectly by inducing spindle cell Induction of CCL20 expression by KSHV-encoded vFLIP K13 differentiation of HUVECs. In addition, because KSHV infection has been also linked to the pathogenesis of PEL, it was important to We have previously generated HUVECs stably expressing a examine whether K13 could up-regulate CCL20 expression in PEL K13-ERTAM fusion construct, in which the K13 cDNA is fused cells. To address these questions, we examined the effect of
Figure 2. K13 induces CCL20 expression in HUVEC and PEL cell lines. (A) HUVECs stably expressing a control vector or K13-ERTAM were mock-treated or treated with 4-OHT (50 nM) for 48 hours after which RNA was extracted and used for quantitative RT-PCR. The results of the quantitative RT-PCR analysis were confirmed by agarose gel electrophoresis (bottom panel). (B) Supernatants from cells treated in panel A were used for the measurement of CCL20 protein by ELISA. (C) Quantitative RT-PCR analysis showing increased expression of CCL20 mRNA in BCBL-1 and K562 cells stably transduced with a Flag-K13–expressing retroviral vector (top panel). The expression of Flag-tagged K13 in cell lysates was confirmed by immunoblotting (bottom panel). (D) Quantitative RT-PCR analyses showing down-regulation of K13 and CCL20 mRNAs in BCBL-1 cells infected with a K13 shRNA-expressing lentiviral vector compared with cells infected with a control shRNA vector. BLOOD, 28 MAY 2009 ⅐ VOLUME 113, NUMBER 22 KSHV INDUCES CCL20 VIA vFLIP K13 5663
exogenous K13 expression in the PEL-derived BCBL-1 cell line, which expresses very low levels of K13 endogenously36 and shows weak endogenous CCL20 expression (Figure 1C). BCBL-1 cells that had been stably transduced with a Flag-K13–expressing retroviral vector demonstrated approximately 4-fold increase in CCL20 mRNA compared with the vector-expressing cells (Figure 2C). Essentially similar results were obtained on ectopic K13 expression in the human chronic myeloid leukemia cell line K562 (Figure 2C). Collectively, these results demonstrate that K13 stimulates CCL20 gene expression in cells of different lineage, and Downloaded from https://ashpublications.org/blood/article-pdf/113/22/5660/1089754/zh802209005660.pdf by UNIVERSITY OF PITTSBURGH user on 09 October 2019
this effect is not related to the acquisition of spindle cell phenotype Figure 3. K13-induced NF-B activity is critical for the activation of CCL20 by vascular endothelial cells. promoter. (A) The 293T cells were transfected with an empty vector or the indicated vFLIPs (250 ng/well) along with a WT CCL20 promoter luciferase construct (75 ng/ shRNA-mediated silencing of K13 down-regulates CCL20 gene well) and a pRSV/LacZ (-galactosidase) reporter construct (75 ng/well), and the expression reporter assay performed as described in “Luciferase reporter assay.” The values shown are averages (mean Ϯ SE) of 1 representative experiment of 3 in which each We have previously reported successful silencing of K13 expression in transfection was performed in duplicate. (B) Ectopic expression of WT K13 but not its NF-B–defective mutants (K13 58AAA and K13 67AAA) induces CCL20 promoter 26 PEL cells using lentiviral-mediated shRNA delivery. To confirm the activity. The experiment was performed essentially as described in panel A. (C) The involvement of K13 in the constitutive CCL20 expression in PEL cells, NF-B site in the CCL20 promoter is critical for activation by K13. The 293T cells we infected BCBL-1 cells with lentiviral vectors encoding a control were transfected with a control vector or a vector encoding K13 along with either CCL20-WT-Luc or CCL20-⌬NF-B-Luc reporter constructs, and the luciferase shRNA or an shRNA against K13. The lentiviral constructs also reporter assay performed as described in panel A. The values shown are averages expressed a green fluorescent protein–blasticidin fusion protein to help (mean Ϯ SE) of 1 representative experiment of 3 in which each transfection was with monitoring the infection efficiency. Approximately 80% to 90% of performed in duplicate. the cells expressed green fluorescent protein after a single round of infection with the lentiviral constructs, as measured by fluorescence transcription, we transfected 293T cells with either a luciferase reporter microscopy (not shown). A quantitative RT-PCR analysis performed construct containing the WT CCL20 promoter (CCL20-WT-Luc) or a 72 hours after infection revealed an approximately 90% reduction in reporter construct (CCL20-⌬-NF-B-Luc) bearing mutations (GG- K13 expression in the cells infected with the lentiviral vector encoding GAAAAAAAC) in this site. As shown in Figure 3C, K13-induced shRNA targeting this protein compared with the cells infected with the CCL20 promoter activity was nearly abolished in the CCL20-⌬ control shRNA vector (Figure 2D). More importantly, this reduction in NF-B-Luc construct, confirming the importance of the Ϫ82 B site in the K13 mRNA was accompanied by an approximately 70% reduction K13-mediated CCL20 gene expression. in the expression of CCL20 mRNA (Figure 2D), thereby confirming a major role of K13 in the constitutive CCL20 expression in the PEL cells. K13-induced binding of NF- B subunits to the CCL20 promoter
K13 stimulates CCL20 promoter activity via NF-B activation Because the mutation analysis of the CCL20 promoter suggested that K13 probably activated transcription through the Ϫ82 B site, To examine whether the CCL20 promoter responds to K13, we we next examined the nuclear proteins that bind to this site. For this transfected human embryonic kidney 293T cells with a luciferase-based purpose, we took advantage of an ELISA-based NF-B DNA- reporter construct containing 874 bp of the CCL20 gene promoter. binding assay and examined the recruitment of different NF-B Coexpression of K13 led to approximately 10 000-fold increase in subunits to a synthetic oligonucleotide duplex containing the CCL20 promoter-driven reporter activity, suggesting that K13 activates Ϫ82 B site. Nuclear extracts from K13-expressing K562 cells the CCL20 gene at the transcriptional level (Figure 3A). In contrast, demonstrated significant recruitment of p65 and p50 subunits and vFLIPs MC159 and MC160 from the molluscum contagiosum virus modest recruitment of c-Rel subunit to the Ϫ82 B site compared and the vFLIP E8 from the equine herpesvirus 2, which resemble K13 in with the nuclear extracts from the control vector cells (Figure 4A). structure but lack the ability to activate the NF-B pathway,24,39 were unable to activate the CCL20 promoter (Figure 3A). The involvement of the NF-B pathway in K13-induced CCL20 of promoter activation was further examined using 2 previously described point mutants of K13, K13-58AAA and K13-67AAA, which demonstrate total and partial loss of NF-B activity, respectively.28 Consistent with their loss of NF-B activating ability, the mutant 58AAA demonstrated a complete loss of CCL20 reporter activation, whereas the mutant 67AAA demonstrated partial activity (Figure 3B). Collectively, these results suggest that the ability of K13 to transactivate the CCL20 promoter is probably linked to its ability to activate the NF-B pathway.
The NF-B site at ؊82 in the CCL20 promoter is essential for
K13-mediated activation Figure 4. K13 triggers the recruitment of p65, p50, and c-Rel to the CCL20 promoter. (A) An ELISA-based NF- B binding assay showing increased binding of The CCL20 promoter region contains an atypical NF- B binding- p65, p50, and c-Rel subunits in nuclear extracts derived from K13-expressing cells to element (GGGAAAACCC) beginning at position Ϫ82 bp from the the NF-B site present in the CCL20 promoter. (B) K13 fails to activate CCL20 Ϫ Ϫ Ϫ Ϫ putative transcription start site, designated Ϫ82 B, which has been promoter in p65 and p50 knockout cells. WT and p65 / and p50 / MEFs were transfected with an empty vector or K13 along with a CCL20-WT-Luc (75 ng/well) and ␣ 40,41 shown to play a key role in response to TNF- stimulation. To a Renilla reporter construct using Lipofectamine. The luciferase assay was per- examine the involvement of the Ϫ82 B site in K13-induced CCL20 formed 48 hours after transfection as described previously.35 5664 PUNJ et al BLOOD, 28 MAY 2009 ⅐ VOLUME 113, NUMBER 22
Figure 5. Role of NF-B pathway in K13-induced CCL20 promoter activation. (A) Dominant-negative mutants of IB␣ (IB␣⌬N and IB␣SS32/36AA) block K13-induced CCL20 promoter activity. The 293T cells were transfected either with an empty vector or K13, along with a CCL20 luciferase reporter construct and a -galactosidase reporter construct, as described in Fig- ure 3A. The amount of IB␣ mutant plasmids (500 ng/ well) was 5 times the amount of vector or K13 (100 ng/ well) plasmid, and the total amount of transfected DNA was kept constant by adding empty vector. The values shown are averages (mean Ϯ SE) of 1 representative experiment of 3 in which each transfection was per- Downloaded from https://ashpublications.org/blood/article-pdf/113/22/5660/1089754/zh802209005660.pdf by UNIVERSITY OF PITTSBURGH user on 09 October 2019 formed in duplicate. (B,C) Pharmacologic inhibitors of NF-B block K13-induced CCL20 promoter activation. The 293T cells were transfected with an empty vector or a vector encoding K13, and 30 minutes after transfection treated with dimethyl sulfoxide (vehicle) or the indicated compounds for 16 hours before cell lysis. Reporter assay was performed as described for Figure 3A. (D) HUVECs
were pretreated with Bay-11-7082 (5 M) or As2O3 (2.5 M) for 2 hours and subsequently infected with KSHV as described previously.31 Four hours after infec- tion, the medium was changed with fresh medium contain-
ing Bay-11-7082 or As2O3. After overnight incubation, supernatant was collected and CCL20 secretion was measured as described in Figure 1B.
In contrast, no significant recruitment of p52 and RelB subunits to blocked K13-transactivated CCL20 promoter activity. Arsenic the Ϫ82 B site was observed (Figure 4A). To confirm the trioxide, a known inhibitor of K13-induced NF-B activation, also functional significance of the p65 and p50 subunits in K13-induced blocked K13-induced CCL20 promoter activity in a dose- CCL20 gene expression, we use mouse embryonic fibroblast dependent fashion (Figure 5C). We also examined the effect of (MEF) cells lacking the expression of these subunits. As shown in NF-B inhibitors on KSHV-induced CCL20 up-regulation in Figure 4B, K13 failed to activate the CCL20 luciferase reporter HUVECs. As shown in Figure 5D, treatment with Bay-11-7082 and construct in p65Ϫ/Ϫ and p50Ϫ/Ϫ MEFs, compared with the WT arsenic trioxide led to near-complete inhibition of CCL20 protein MEFs. Taken collectively, these results support the hypothesis that secretion in the supernatant of KSHV-infected HUVECs, as K13-induced NF-B activity is directly involved in CCL20 pro- determined by ELISA. Taken collectively, these results confirm the moter activation and this process is not dependent on the presence importance of the IKK complex and the NF-B pathway in KSHV- of an intermediate protein. and K13-induced CCL20 expression.
Abrogation of K13-induced CCL20 promoter activation by KSHV- and K13-mediated induction of CCR6 genetic and pharmacologic inhibitors of the NF-B pathway CCL20 is known to modulate its cellular effects through its K13 is known to activate the NF-B pathway by inducing receptor CCR6.45 Therefore, we studied the effect of KSHV phosphorylation of IB␣ at residues Ser32 and Ser36, which leads infection on CCR6 gene expression. CCR6 mRNA expression, as to its ubiquitination and subsequent proteasome-mediated degrada- assayed by quantitative RT-PCR, was highly induced in HUVECs tion.24,25 Consistent with this mechanism, K13-induced NF-B that were infected with KSHV (Figure 6A). CCR6 mRNA expres- activity can be blocked by phosphorylation-resistant mutants of sion was also induced by treatment with 4-OHT in the HUVEC-K13- IB␣.24 Therefore, we examined whether phosphorylation- ERTAM cells, whereas 4-OHT had no effect in the control vector- resistant mutants of IB␣ can also block K13-induced CCL20 expressing HUVECs (Figure 6B). promoter activity. As shown in Figure 5A, K13-induced CCL20 promoter activity was completely blocked by either a phosphoryla- tion-resistant mutant of IB␣ in which the 2 critical serine residues have been mutated to alanine (IB␣ SS32/36AA), or a deletion mutant of IB␣, lacking the N-terminal 36 amino acids (IB␣⌬N). We also examined whether K13-induced CCL20 promoter activity could be antagonized by pharmacologic inhibitors of the NF-B pathway. We have previously reported that Bay-11-7082, a specific inhibitor of the NF-B, can block K13-induced NF-B activity and spindle cell transformation of HUVECs.31 Consistent with these results, treatment with Bay-11-7082 also blocked K13-induced CCL20 promoter activity in 293T cells (Figure 5B). Because K13 activates the NF-B pathway by activating the IKK complex,24,25 we examined the ability of 3 recently described Figure 6. KSHV infection and K13 expression induce the expression of CCL20 specific inhibitors of this complex, PS1145,42 IKK inhibitor VI,43 receptor CCR6 in HUVECs. Quantitative RT-PCR analysis showing induction of CCR6 mRNA in HUVECs after infection with KSHV (A) and in HUVEC-K13-ERTAM 44 and IKK inhibitor VIII, to block K13-induced CCL20 promoter cells on treatment with 4-OHT (B). The experiments were performed essentially as activity. As shown in Figure 5B, all these inhibitors effectively described in Figures 1A and 2A, respectively. BLOOD, 28 MAY 2009 ⅐ VOLUME 113, NUMBER 22 KSHV INDUCES CCL20 VIA vFLIP K13 5665
Figure 7. Up-regulation of CCL20 and its receptor CCR6 in KS samples. (A) Box-whisker plots with 95% confidence intervals for the RNA expression of CCL20, K13, LANA, and CCR6 in KSHV- infected patients’ lymph nodes (KS lymph nodes, n ϭ 5) and skin samples (KS skin samples, n ϭ 10) along with corresponding benign lymph nodes (n ϭ 6) and normal skin (n ϭ 10) samples. Box-whisker plot indicates the median expression of respective genes relative to -actin (line in the box) and their interquartile range (box). The whiskers present an entire range of expression level of indicated genes in a group, the upper value being the largest observation Ն 75th percentile ϩ 1.5 ϫ (interquartile range), with the lowest value being the smallest observation Յ 25th percentile Ϫ 1.5 ϫ (interquartile range). The RNA was isolated Downloaded from https://ashpublications.org/blood/article-pdf/113/22/5660/1089754/zh802209005660.pdf by UNIVERSITY OF PITTSBURGH user on 09 October 2019 from flash frozen tissues, and the expression levels of the indicated genes were determined by quantitative RT-PCR. The expression levels of CCL20 and its receptor CCR6 were signifi- cantly higher in the KS samples compared with corresponding uninfected controls (*P Ͻ .05, Mann-Whitney U test). Similarly, the expression level of LANA and K13, 2 key genes of KSHV infectivity, were significantly higher in KS samples than the corresponding healthy skin or lymph node samples (*P Ͻ .05, Mann-Whitney U test). (B) Hematoxylin and eosin staining shows the presence of characteristic spindle cells in a KS biopsy specimen. (C) Immunohistochemistry shows the presence of LANA-positive cells with typical brown punctate nuclear staining (black arrows) in the KS lesion. (D) Double immunostaining with LANA and CCL20 antibodies shows that a majority of CCL20- positive cells (red; white arrows) are positive for LANA (brown). (B-D) original magnification ϫ400.
Increased CCL20 and CCR6 expression in KS clinical samples change in the KS lesions that precedes the appearance of spindle cells,4,5 the factors responsible for the accumulation of inflamma- To determine the clinical significance of our results, we examined tory cells in KS lesions have not been completely delineated. It has the expression of CCL20 and CCR6 in KS lymph nodes (n ϭ 5) been proposed that the inflammatory cytokines produced in the KS and KS skin samples (n ϭ 10) by quantitative RT-PCR analysis. lesions induce the expression of chemokines, such as MCP-1, We included benign lymph nodes (n ϭ 6) and normal skin MIP-1␣, MIP-1, IL-8, and Rantes, which promote recruitment of (n ϭ 10) samples as controls. As shown in Figure 7A, the inflammatory cells into the lesions.47 An additional mechanism for expression levels of CCL20 and CCR6 were significantly higher chemokine production in the KS lesions is infection with KSHV. in the KS lymph nodes and KS skin samples compared with the Whereas lytic replication of KSHV is associated with the expres- corresponding healthy skin or lymph node samples (P Ͻ .05, sion of viral proteins with known proinflammatory and chemotactic Mann-Whitney U test). The expression levels of LANA and K13, 2 KSHV latent genes, were also significantly higher in the KS activities, such as viral G protein–coupled receptor, viral 48 samples compared with the corresponding controls (P Ͻ .05, interleukin-6 (vIL-6), and several chemokine homologs, latent Mann-Whitney U test), thereby confirming the presence of infection with KSHV up-regulates the expression of several KSHV in the KS lesions (Figure 7A). cellular chemokines, such as IL-8, IL-1, GRO-1, MCP-1, NAP-2, 12-19,32,49 To confirm the results of quantitative RT-PCR analysis and to Rantes, and CXCL16. Here we demonstrate that infection investigate the cells of origin of CCL20, we performed immunohis- with KSHV also induces the expression of CCL20, a chemokine tochemistry on KS biopsy specimens. The diagnosis of KS in the that is not only a chemoattractant for lymphocytes but is also the biopsy specimens was confirmed by the presence of characteristic most potent chemoattractant for immature dendritic cells. spindle-shaped cells, as determined by hematoxylin and eosin The CCL20 gene was discovered through bioinformatics-based staining (Figure 7B) and by characteristic punctate nuclear staining searches of DNA databases.50-52 Under physiologic conditions, for LANA, as determined by immunohistochemistry (Figure 7C). CCL20 is expressed by a variety of epithelial cells, including Importantly, double immunohistochemical staining for LANA and keratinocytes, pulmonary epithelial cells, and intestinal epithelial CCL20 revealed that a majority of cells that were positive for cells, where it promotes the assembly and maintenance of orga- CCL20 were also positive for LANA (Figure 7D). Taken collec- nized lymphoid structures located beneath epithelial surfaces.33 tively, these results suggest that KSHV-mediated stimulation of Although CCL20 is usually expressed at a low basal level, its CCL20 and CCR6 expression that we demonstrated in vitro also expression is highly induced by proinflammatory cytokines (eg, occurs in vivo. TNF-␣, IL-1, and interferon-␥), and Toll-like receptor agonists (eg, lipopolysaccharide).33 The increased level of CCL20 observed during inflammatory stimuli is thought to help recruit CCR6- Discussion expressing cells and serve an antimicrobial function.33 The mechanism of CCL20 induction after inflammatory stimuli In addition to the presence of distinctive spindle cells, KS lesions has been clarified by the analysis of its promoter region. Although are characterized by infiltration with inflammatory cells, including the CCL20 promoter contains putative binding sites for several dendritic cells, macrophages, plasma cells, and lymphocytes.4,46 transcription factors, the NF-B transcription factors are thought to Although the inflammatory cell infiltrate is the first histologic be primarily responsible for its gene induction after inflammatory 5666 PUNJ et al BLOOD, 28 MAY 2009 ⅐ VOLUME 113, NUMBER 22 insults.40,41 Consistent with these prior studies, we demonstrate that such as mechanism is provided by a recent study in which the NF-B pathway is also primarily responsible for KSHV- increased expression of chemokine CXCL16 was observed in induced CCL20 induction. This claim is supported by the following HUVECs after latent infection with KSHV or ectopic expression of lines of evidence. First, in vitro infection of vascular endothelial K13.15 However, interestingly, this effect was limited to primary cells with KSHV results in NF-B activation,31,32,53 which supports endothelial cells, such as HUVECs and primary microvascular the involvement of this pathway in CCL20 gene induction after endothelial cells of blood or lymphatic lineage, which are known to acute KSHV infection of HUVECs observed in the current study. undergo spindle cell differentiation on KSHV infection or K13 Second, the NF-B pathway is also constitutively active in PEL expression, and neither KSHV infection nor ectopic K13 expres- cell lines that are latently infected with KSHV, although the level of sion was able to induce CXCL16 expression in cells that are NF-B activity varies between the different cell lines.25,54 Interest- generally resistant to this effect.15 As most cells expressing K13 Downloaded from https://ashpublications.org/blood/article-pdf/113/22/5660/1089754/zh802209005660.pdf by UNIVERSITY OF PITTSBURGH user on 09 October 2019 ingly, the level of CCL20 mRNA in the PEL cell lines observed in display NF-B induction, these results led the authors of this study the current study correlates closely with their previously reported to the hypothesis that the ability to up-regulate CXCL16 mRNA is level of NF-B activity,25,36,54 suggesting a causal association. probably controlled by post–NF-B regulatory steps/factors that Thus, the BC-1 cell line, which possesses high constitutive NF-B are present in HUVECs but are absent in the nonresponsive cells.15 activity, showed high CCL20 mRNA expression, whereas BCBL-1 To rule out the possibility that K13-induced CCL20 gene induction and JSC-1 cell lines, which have low NF-B activity, showed weak is similarly mediated by another protein controlled by NF-B, we CCL20 expression. Finally, KSHV-induced CCL20 induction in assayed binding of the different NF-B subunits to the Ϫ82 B site HUVECs could be effectively blocked by Bay-11-7082, a specific present in the CCL20 promoter region and found that p65, p50, and inhibitor of the NF-B (Figure 5D). c-Rel bind to this site. Furthermore, in contrast to the results with It was recently reported that overexpression of KSHV-encoded CXCL16, we found that KSHV- or K13-induced CCL20 expression K15 protein, a known activator of the NF-B pathway, induces is not limited to HUVECs but is observed in a variety of established CCL20 gene expression in HeLa cells.55 However, K15 is primarily cell lines of different lineage, such as K562, BCBL-1, and 293T, expressed during the lytic phase of the KSHV life cycle.55-57 none of which undergoes spindle cell differentiation on K13 Therefore, we focused our attention on vFLIP K13 because it is not expression. Taken collectively, these results demonstrate that only a powerful activator of the NF-B pathway but has been also K13-induced NF-B activity itself is the direct mediator of CCL20 shown to be primarily responsible for NF-B activity in latently gene induction, and no intermediate protein or mechanism, such as infected cells.25,54 We and others have previously reported that spindle cell differentiation, is involved in this process. ectopic expression of K13 in vascular endothelial cells is sufficient An unexpected result of our study was that infection with to mimic the effect of KSHV on the acquisition of spindle cell KSHV or induction of K13 activity in HUVECs not only induced phenotype.31,32 In this report, we demonstrate that ectopic expres- the expression of CCL20 but also up-regulated the expression of sion of K13 in HUVECs is also sufficient to induce CCL20 gene CCR6, a G protein–coupled receptor that acts as the specific and protein expression, thereby suggesting that K13 plays a key receptor for CCL20. Unlike CCL20, the transcriptional regulation role in KSHV-induced CCL20 gene induction. Furthermore, we of CCR6 gene has not been clarified yet. However, because K13 confirm the involvement of K13 in constitutive CCL20 gene primarily activates the NF-B pathway,38 it is possible that this expression in KSHV-infected PEL cells by its shRNA-mediated pathway is also involved in CCR6 gene induction, either directly or gene-silencing. indirectly. Studies are currently in progress to address this question The CCL20 promoter region contains binding sites for different by analysis of the CCR6 promoter region. transcription factors, such as activator protein 1 and activator We observed increased expression of CCL20 and CCR6 mRNAs protein 2, CAAT/enhancer-binding protein, stimulating protein 1, in clinical samples of KS. Concomitant induction of CCR6 and and the epithelium-specific Ets nuclear factor ESE-1.40,41 However, CCL20 on the same cell types has been previously documented in a nonstandard NF-B binding site (5Ј-GGGAAAACCC-3Ј), desig- pancreatic cancer and human T-cell leukemia-1–infected cells.34,58 nated Ϫ82 B site, is thought to be primarily responsible for Importantly, exogenous CCL20 was shown to stimulate the growth induction of its gene expression by proinflammatory cytokines.40,41 of one pancreatic cell line and enhance the migration of another cell The involvement of the NF-B pathway and the Ϫ82 B site in line showing CCR6 expression.58 Therefore, it is conceivable that K13-induced CCL20 gene induction is supported by the following KSHV-infected endothelial cells (and possibly lymphocytes), with lines of evidence. First, we observed a strong correlation between up-regulated expression of CCL20 and CCR6, could similarly the ability of vFLIPs to activate NF-B and their ability to activate proliferate or migrate in an autocrine/paracrine-dependent manner, CCL20 promoter. Thus, although WT K13 strongly activated thereby contributing to the pathogenesis of KSHV-associated CCL20 promoter, its NF-B–defective mutants failed to do so. malignancies. It is important to note in this context that circulating Similarly, no CCL20 promoter activation was observed on expres- endothelial cells in patients with KS have evidence of KSHV sion of vFLIPs MC159, MC160, and E8, which lack NF-B infection.59 Recent studies further suggest that new blood vessels in activity. Second, mutations in the Ϫ82 B site nearly abolished tumors develop not only from existing vessels but also from K13-induced CCL20 promoter activity. Third, K13 failed to induce circulating endothelial progenitor cells originating from the bone CCL20 promoter activity in cells lacking the p65 and p50 subunits marrow,60 which has led to the suggestion that KSHV-infected of NF-B. Finally, K13-induced CCL20 promoter activity was circulating endothelial precursor cells may home to the permissive blocked by genetic (ie, IB␣ SS32/36AA and ⌬NIB␣) and sites and propagate to produce KS lesions.61 Therefore, increased pharmacologic (ie, Bay-11-7082, PS1145, IKK inhibitors VI and expression of CCR6 on KSHV-infected endothelial progenitor and VIII, and arsenic trioxide) inhibitors of the NF-B pathway. immune cells may promote their migration to sites of injury and Because KSHV infection and ectopic K13 expression in inflammation, locations that are rich in CCL20.33 The preferential primary endothelial cells are accompanied by their spindle cell migration of KSHV-infected cells to sites of inflammation and differentiation, it was conceivable that the induction of CCL20 is a injury might, in part, provide a mechanistic explanation for the secondary consequence of spindle cell differentiation. Support for clinical observation that KS lesions sometimes arise precisely at BLOOD, 28 MAY 2009 ⅐ VOLUME 113, NUMBER 22 KSHV INDUCES CCL20 VIA vFLIP K13 5667 the site of antecedent inflammation or injury, a property known as University of California, San Francisco, CA, and George Washing- the Koebner phenomenon.62 Thus, in addition to promoting the ton University, Washington, DC, for providing patient samples; recruitment of inflammatory and dendritic cells into KS lesions, Marie Acquafondata (Tissue and Research Pathology Services) for KSHV- and K13-induced CCL20 and CCR6 up-regulation may help with immunohistochemistry; and Dr Siddhartha Kar and directly contribute to tumor initiation, proliferation, and metastases. Aletheia Tamewitz for critical reading of the manuscript. Furthermore, because CCL20 is known to inhibit the proliferation of This work was supported by the National Institutes of Health hematopoietic progenitor cells in response to multiple growth factors,52 (Bethesda, MD; grants CA85177, CA124621, and HL085189), the it may also contribute to the pathogenesis of bone marrow failure Leukemia & Lymphoma Society (White Plains, NY), and the syndromes associated with KSHV infection.63,64 It needs to be pointed Mario Lemieux Foundation (Pittsburgh, PA). out, however, that because KSHV infection increases the expression of Downloaded from https://ashpublications.org/blood/article-pdf/113/22/5660/1089754/zh802209005660.pdf by UNIVERSITY OF PITTSBURGH user on 09 October 2019 several chemokines and their receptors,14-16,31,32,49 CCL20/CCR6 signal- ing probably acts in conjunction with signaling through other chemo- Authorship kine receptors in the pathogenesis of KSHV-associated malignancies. Contribution: V.P., H.M., S.S., and T.Y. performed research; V.P. and H.M. prepared figures; Y.C. provided the LANA antibody and Acknowledgments KS specimens and helped with immunohistochemistry; and V.P., H.M., and P.M.C. designed research, analyzed the data, and wrote The authors thank Dr Hiroyasu Nakano and Dr Gutian Xiao for and edited the manuscript. providing MEFs lacking the NF-B p65 and p50 subunits, Conflict-of-interest disclosure: The authors declare no compet- respectively; Dr Tomoko Kohno for pGL2-CCL20/MIP-␣ (CCL20 ing financial interests. WT-Luc) and pGL2-CCL20/MIP-3␣/BM (CCL20 ⌬NF-B-Luc) Correspondence: Preet M. Chaudhary, Hillman Cancer Center, for luciferase reporter constructs; the National Cancer Research 5117 Centre Ave, Suite 1.19A, Pittsburgh, PA 15213-1863; e-mail: Institute–sponsored AIDS and Cancer Specimen Resources at [email protected]. References
1. Ensoli B, Sturzl M. Kaposi’s sarcoma: a result of 13. Poole LJ, Yu Y, Kim PS, Zheng QZ, Pevsner J, 23. Thome M, Schneider P, Hofmann K, et al. Viral the interplay among inflammatory cytokines, an- Hayward GS. Altered patterns of cellular gene FLICE-inhibitory proteins (FLIPs) prevent apopto- giogenic factors and viral agents. Cytokine expression in dermal microvascular endothelial sis induced by death receptors. Nature. 1997; Growth Factor Rev. 1998;9:63-83. cells infected with Kaposi’s sarcoma-associated 386:517-521. 2. Ensoli B, Gallo RC. AIDS-associated Kaposi’s herpesvirus. J Virol. 2002;76:3395-3420. 24. Chaudhary PM, Jasmin A, Eby MT, Hood L. sarcoma: a new perspective of its pathogenesis 14. Naranatt PP, Krishnan HH, Svojanovsky SR, Modulation of the NF-kappa B pathway by virally and treatment. Proc Assoc Am Physicians. 1995; Bloomer C, Mathur S, Chandran B. Host gene encoded death effector domains-containing pro- 107:8-18. induction and transcriptional reprogramming in teins. Oncogene. 1999;18:5738-5746. 3. Masood R, Cai J, Law R, Gill P. AIDS-associated Kaposi’s sarcoma-associated herpesvirus 25. Liu L, Eby MT, Rathore N, Sinha SK, Kumar A, Kaposi’s sarcoma pathogenesis, clinical features, (KSHV/HHV-8)-infected endothelial, fibroblast, Chaudhary PM. The human herpes virus and treatment. Curr Opin Oncol. 1993;5:831-834. and B cells: insights into modulation events early 8-encoded viral FLICE inhibitory protein physi- during infection. Cancer Res. 2004;64:72-84. 4. Ensoli B, Sgadari C, Barillari G, Sirianni MC, cally associates with and persistently activates Sturzl M, Monini P. Biology of Kaposi’s sarcoma. 15. Xu Y, Ganem D. Induction of chemokine produc- the Ikappa B kinase complex. J Biol Chem. 2002; Eur J Cancer. 2001;37:1251-1269. tion by latent Kaposi’s sarcoma-associated her- 277:13745-13751. pesvirus infection of endothelial cells. J Gen Virol. 26. Matta H, Chaudhary PM. Activation of alternative 5. Dorfman RF. The histogenesis of Kaposi’s sar- 2007;88:46-50. NF-kappa B pathway by human herpes virus coma. Lymphology. 1984;17:76-77. 16. Sun Q, Matta H, Lu G, Chaudhary PM. Induction 8-encoded Fas-associated death domain-like IL-1 6. Corbeil J, Evans LA, Vasak E, Cooper DA, Penny of IL-8 expression by human herpesvirus 8 en- beta-converting enzyme inhibitory protein R. Culture and properties of cells derived from coded vFLIP K13 via NF-kappaB activation. On- (vFLIP). Proc Natl Acad Sci U S A. 2004;101: Kaposi sarcoma. J Immunol. 1991;146:2972- cogene. 2006;25:2717-2726. 9399-9404. 2976. 17. Carroll PA, Brazeau E, Lagunoff M. Kaposi’s 27. Sun Q, Matta H, Chaudhary PM. The human her- 7. Beckstead JH, Wood GS, Fletcher V. Evidence sarcoma-associated herpesvirus infection of pes virus 8-encoded viral FLICE inhibitory protein for the origin of Kaposi’s sarcoma from lymphatic blood endothelial cells induces lymphatic dif- protects against growth factor withdrawal-induced endothelium. Am J Pathol. 1985;119:294-300. ferentiation. Virology. 2004;328:7-18. apoptosis via NF-kappa B activation. Blood. 8. Kennedy MM, Cooper K, Howells DD, et al. Iden- 18. Wang HW, Trotter MW, Lagos D, et al. Kaposi 2003;101:1956-1961. tification of HHV8 in early Kaposi’s sarcoma: im- sarcoma herpesvirus-induced cellular reprogram- 28. Sun Q, Zachariah S, Chaudhary PM. The human plications for Kaposi’s sarcoma pathogenesis. ming contributes to the lymphatic endothelial herpes virus 8-encoded viral FLICE-inhibitory Mol Pathol. 1998;51:14-20. gene expression in Kaposi sarcoma. Nat Genet. protein induces cellular transformation via NF- 9. Flore O, Rafii S, Ely S, O’Leary JJ, Hyjek EM, 2004;36:687-693. kappaB activation. J Biol Chem. 2003;278:52437- Cesarman E. Transformation of primary human 19. Hong YK, Foreman K, Shin JW, et al. Lymphatic 52445. endothelial cells by Kaposi’s sarcoma-associated reprogramming of blood vascular endothelium by 29. Chugh P, Matta H, Schamus S, et al. Constitutive herpesvirus. Nature. 1998;394:588-592. Kaposi sarcoma-associated herpesvirus. Nat NF-kappaB activation, normal Fas-induced apo- 10. Moses AV, Fish KN, Ruhl R, et al. Long-term in- Genet. 2004;36:683-685. ptosis, and increased incidence of lymphoma in fection and transformation of dermal microvascu- 20. Fiorelli V, Gendelman R, Sirianni MC, et al. human herpes virus 8 K13 transgenic mice. Proc lar endothelial cells by human herpesvirus 8. J Vi- ␥-Interferon produced by CD8ϩ T cells infiltrat- Natl Acad Sci U S A. 2005;102:12885-12890. rol. 1999;73:6892-6902. ing Kaposi’s sarcoma induces spindle cells with 30. Guasparri I, Keller SA, Cesarman E. KSHV vFLIP 11. Ciufo DM, Cannon JS, Poole LJ, et al. Spindle angiogenic phenotype and synergy with human is essential for the survival of infected lymphoma cell conversion by Kaposi’s sarcoma-associated immunodeficiency virus-1 Tat protein: an im- cells. J Exp Med. 2004;199:993-1003. herpesvirus: formation of colonies and plaques mune response to human herpesvirus-8 infec- 31. Matta H, Surabhi RM, Zhao J, et al. Induction of with mixed lytic and latent gene expression in in- tion? Blood. 1998;91:956-967. spindle cell morphology in human vascular endo- fected primary dermal microvascular endothelial 21. Lane BR, Liu J, Bock PJ, et al. Interleukin-8 and thelial cells by human herpesvirus 8-encoded vi- cell cultures. J Virol. 2001;75:5614-5626. growth-regulated oncogene alpha mediate angio- ral FLICE inhibitory protein K13. Oncogene. 12. Moses AV, Jarvis MA, Raggo C, et al. Kaposi’s genesis in Kaposi’s sarcoma. J Virol. 2002;76: 2007;26:1656-1660. sarcoma-associated herpesvirus-induced up- 11570-11583. 32. Grossmann C, Podgrabinska S, Skobe M, regulation of the c-kit proto-oncogene, as identi- 22. Sturzl M, Hohenadl C, Zietz C, et al. Expression Ganem D. Activation of NF-kappaB by the latent fied by gene expression profiling, is essential for of K13/v-FLIP gene of human herpesvirus 8 and vFLIP gene of Kaposi’s sarcoma-associated her- the transformation of endothelial cells. J Virol. apoptosis in Kaposi’s sarcoma spindle cells. pesvirus is required for the spindle shape of virus- 2002;76:8383-8399. J Natl Cancer Inst. 1999;91:1725-1733. infected endothelial cells and contributes to their 5668 PUNJ et al BLOOD, 28 MAY 2009 ⅐ VOLUME 113, NUMBER 22
proinflammatory phenotype. J Virol. 2006;80: 43. Baxter A, Brough S, Cooper A, et al. Hit-to-lead vascular endothelial cells that is essential for viral 7179-7185. studies: the discovery of potent, orally active, gene expression. J Virol. 2007;81:3949-3968. 33. Schutyser E, Struyf S, Van Damme J. The CC thiophenecarboxamide IKK-2 inhibitors. Bioorg 54. Keller SA, Schattner EJ, Cesarman E. Inhibition chemokine CCL20 and its receptor CCR6. Cyto- Med Chem Lett. 2004;14:2817-2822. of NF-kappaB induces apoptosis of KSHV- kine Growth Factor Rev. 2003;14:409-426. 44. Murata T, Shimada M, Sakakibara S, et al. Syn- infected primary effusion lymphoma cells. Blood. 34. Imaizumi Y, Sugita S, Yamamoto K, et al. Human thesis and structure-activity relationships of novel 2000;96:2537-2542. T cell leukemia virus type-I Tax activates human IKK-beta inhibitors: 3. Orally active anti-inflamma- 55. Brinkmann MM, Pietrek M, Dittrich-Breiholz O, macrophage inflammatory protein-3 alpha/CCL20 tory agents. Bioorg Med Chem Lett. 2004;14: Kracht M, Schulz TF. Modulation of host gene gene transcription via the NF-kappa B pathway. 4019-4022. expression by the K15 protein of Kaposi’s Int Immunol. 2002;14:147-155. 45. Baba M, Imai T, Nishimura M, et al. Identification sarcoma-associated herpesvirus. J Virol. 2007; 35. Matta H, Sun Q, Moses G, Chaudhary PM. Mo- of CCR6, the specific receptor for a novel 81:42-58. lecular genetic analysis of human herpes virus lymphocyte-directed CC chemokine LARC. J Biol 56. Jenner RG, Alba MM, Boshoff C, Kellam P. Kapo- 8-encoded viral FLICE inhibitory protein-induced Chem. 1997;272:14893-14898. si’s sarcoma-associated herpesvirus latent and Downloaded from https://ashpublications.org/blood/article-pdf/113/22/5660/1089754/zh802209005660.pdf by UNIVERSITY OF PITTSBURGH user on 09 October 2019 NF-kappaB activation. J Biol Chem. 2003;278: 46. Douglas JL, Gustin JK, Dezube B, Pantanowitz lytic gene expression as revealed by DNA arrays. 52406-52411. JL, Moses AV. Kaposi’s sarcoma: a model of both J Virol. 2001;75:891-902. 36. Zhao J, Punj V, Matta H, et al. K13 blocks KSHV malignancy and chronic inflammation. Panmin- 57. Paulose-Murphy M, Ha NK, Xiang C, et al. Tran- lytic replication and deregulates vIL6 and hIL6 erva Med. 2007;49:119-138. scription program of human herpesvirus 8 (Kapo- expression: a model of lytic replication induced 47. Ensoli B, Sturzl M, Monini P. Cytokine-mediated si’s sarcoma-associated herpesvirus). J Virol. clonal selection in viral oncogenesis. PLoS ONE. growth promotion of Kaposi’s sarcoma and pri- 2001;75:4843-4853. 2007;2:e1067. mary effusion lymphoma. Semin Cancer Biol. 58. Kleeff J, Kusama T, Rossi DL, et al. Detection and 37. Livak KJ, Schmittgen TD. Analysis of relative 2000;10:367-381. localization of Mip-3alpha/LARC/Exodus, a mac- gene expression data using real-time quantitative 48. Nicholas J. Human gammaherpesvirus cytokines rophage proinflammatory chemokine, and its PCR and the 2(Ϫdelta delta C(T)) method. Meth- and chemokine receptors. J Interferon Cytokine CCR6 receptor in human pancreatic cancer. Int J ods. 2001;25:402-408. Res. 2005;25:373-383. Cancer. 1999;81:650-657. 38. Matta H, Mazzacurati L, Schamus S, Yang T, Sun 49. Caselli E, Fiorentini S, Amici C, Di Luca D, 59. Pellet C, Kerob D, Dupuy A, et al. Kaposi’s Q, Chaudhary PM. Kaposi’s sarcoma-associated Caruso A, Santoro MG. Human herpesvirus 8 sarcoma-associated herpesvirus viremia is asso- herpesvirus (KSHV) oncoprotein K13 bypasses acute infection of endothelial cells induces mono- ciated with the progression of classic and en- TRAFs and directly interacts with the IB kinase cyte chemoattractant protein 1-dependent capil- demic Kaposi’s sarcoma. J Invest Dermatol. complex to selectively activate NF-B without lary-like structure formation: role of the IKK/NF- 2006;126:621-627. JNK activation. J Biol Chem. 2007;282:24858- kappaB pathway. Blood. 2007;109:2718-2726. 60. Ahn GO, Brown JM. Role of endothelial progeni- 24865. 50. Hieshima K, Imai T, Opdenakker G, et al. Molecu- tors and other bone marrow-derived cells in the 39. Matta H, Punj V, Schamus S, et al. A nuclear role lar cloning of a novel human CC chemokine liver development of the tumor vasculature. Angiogen- for Kaposi’s sarcoma-associated herpesvirus- and activation-regulated chemokine (LARC) ex- esis. Prepublished on February 17, 2009, as DOI encoded K13 protein in gene regulation. Onco- pressed in liver: chemotactic activity for lympho- 10.1007/s10456-009-9135-7. gene. 2008;27:5243-5253. cytes and gene localization on chromosome 2. 61. Gill PS. The origin of Kaposi sarcoma [editorial]. 40. Sugita S, Kohno T, Yamamoto K, et al. Induction J Biol Chem. 1997;272:5846-5853. J Natl Cancer Inst. 2007;99:1063. of macrophage-inflammatory protein-3alpha gene 51. Rossi DL, Vicari AP, Franz-Bacon K, McClanahan 62. Maral T. The Koebner phenomenon in expression by TNF-dependent NF-kappaB acti- TK, Zlotnik A. Identification through bioinformatics immunosuppression-related Kaposi’s sarcoma. vation. J Immunol. 2002;168:5621-5628. of two new macrophage proinflammatory human Ann Plast Surg. 2000;44:646-648. 41. Harant H, Eldershaw SA, Lindley IJ. Human mac- chemokines: MIP-3alpha and MIP-3beta. J Im- 63. Luppi M, Barozzi P, Schulz TF, et al. Bone mar- rophage inflammatory protein-3alpha/CCL20/ munol. 1997;158:1033-1036. row failure associated with human herpesvirus 8 LARC/Exodus/SCYA20 is transcriptionally up- 52. Hromas R, Gray PW, Chantry D, et al. Cloning infection after transplantation. N Engl J Med. regulated by tumor necrosis factor-alpha via a and characterization of exodus, a novel beta- 2000;343:1378-1385. non-standard NF-kappaB site. FEBS Lett. 2001; chemokine. Blood. 1997;89:3315-3322. 64. Cuzzola M, Irrera G, Iacopino O, et al. Bone mar- 509:439-445. 53. Sadagopan S, Sharma-Walia N, Veettil MV, et al. row failure associated with herpesvirus 8 infection 42. Hideshima T, Chauhan D, Richardson P, et al. Kaposi’s sarcoma-associated herpesvirus in- in a patient undergoing autologous peripheral NF-kappa B as a therapeutic target in multiple duces sustained NF-kappaB activation during de blood stem cell transplantation. Clin Infect Dis. myeloma. J Biol Chem. 2002;277:16639-16647. novo infection of primary human dermal micro- 2003;37:e102-e106.