Maulana Azad Library, Aligarh Muslim University

Date……………

CERTIFICATE

This is to certify that the thesis entitled “Immune potential of Mycobacterium tuberculosis hypoxic stress induced Acr-1 protein against intracellular Mycobacterium species infection” herewith submitted by Ms. Nida in fulfilment of the requirements for the degree of Doctor of Philosophy in Biotechnology of the Aligarh Muslim University, is an authentic record of the research work carried out by her under my supervision and guidance and that no part, thereof, has been presented before for any other degree.

Prof. Mohammad Owais (Supervisor) Maulana Azad Library, Aligarh Muslim University

INTERDISCIPLINARY BIOTECHNOLOGY UNIT ALIGARH MUSLIM UNIVERSITY ALIGARH- 202002 INDIA

ANNEXURE – I SELF DECLARATION

I, Ms. Nida, Interdisciplinary Biotechnology Unit, certify that the work embodied in this Ph.D. thesis is my own bonafide work carried out by me under the supervision of Prof. Mohammad Owais at Aligarh Muslim University, Aligarh. The matter embodied in this Ph.D. thesis has not been submitted for the award of any other degree.

I declare that I have faithfully acknowledged, given credit to and referred to the research workers whenever their works have been cited in the text and in the body of the thesis. I further certify that I have not plagiarised some other work, paragraph, text, data, results, etc. reported in the journals, books, magazines, reports, dissertations, thesis, etc. or available on web-sites, and included them in this Ph.D. thesis or cited them as my own work.

Date: …………… (Signature of the Candidate) NIDA …..……………………………………………………………………………………… Certificate from the Supervisor This is to certify that the above statement made by the candidate is correct to the best of my/our knowledge.

Research Supervisor Prof. Mohammad Owais Maulana(Professor Azad) Library, Aligarh Muslim University Interdisciplinary Biotechnology Unit Aligarh Muslim University Aligarh-202 002 (Signature of the Chairperson)

INTERDISCIPLINARY BIOTECHNOLOGY UNIT ALIGARH MUSLIM UNIVERSITY ALIGARH- 202002 INDIA

ANNEXURE – II

COURSE/COMPREHENSIVE EXAMINATION/PRE-SUBMISSION SEMINAR COMPLETION CERTIFICATE

This is to certify that Ms. Nida, Interdisciplinary Biotechnology Unit, Aligarh

Muslim University, Aligarh has satisfactorily completed the course work/comprehensive

examination and pre-submission seminar requirement, which is a part of her Ph.D.

programme.

Date: (Signature of the Chairperson)

Maulana Azad Library, Aligarh Muslim University

INTERDISCIPLINARY BIOTECHNOLOGY UNIT ALIGARH MUSLIM UNIVERSITY ALIGARH- 202002 INDIA

ANNEXURE - III

Title of the Thesis: “Immune potential of Mycobacterium tuberculosis hypoxic stress induced Acr-1 protein against intracellular Mycobacterium species infection” Candidate’s Name: Ms. Nida Copyright Transfer

The undersigned hereby assigns to the Aligarh Muslim University, Aligarh copyright that may exist in and for the above thesis submitted for the award of the Ph.D. degree.

Date: (Signature of the Candidate)

Note: However, the author may reproduce or authorize others to reproduce material extracted verbatim from the thesis or derivative of the thesis for author’s personal use provide that the source and the University’s copyright notice are indicated.

Maulana Azad Library, Aligarh Muslim University ACKNOWLEDGMENTS

In the name of Almighty Allah, the most beneficent and merciful who has provided me strength during this effort and blessed me with the presence of many people who have assisted me in this work. Writing this statement of gratitude, I vividly remember the times I experienced to this juncture. Like most of the other researchers, I have had my share of ups and downs, soul touching memories, exaltations and frustrations but at the end I feel it a real life colour.

To begin with immense gratitude, I consider myself fortunate and greatly privileged to have worked under the supervision of Prof. M. Owais. I will ever cherish his unflinching faith in my abilities, with sustained encouragement and wholehearted support during this study. His steadfast guidance and great scientific approach with constant accessibility are greatly appreciated. His positive attitude had been a driving force for the completion of this work. Any words would be inadequate to express my gratitude for him. I would like to thank him from all my heart for whatever he has done for me.

I would like to express my appreciation to Prof. Asadullah khan, Co-ordinator, Interdisciplinary Biotechnology Unit, for his constant support in providing me necessary facilities to complete this study. I am also sincerely thankful to my teachers Prof. Saleemudeen, Dr. Rizwan H. Khan, Dr. Hina yonus, Dr. Waseem Ahmad Siddiqui, Dr.Shahper Nazir Khan for their help and able advices.

I find no word complementary enough to express my deep sense of gratitude to Dr. Javed Agrewala, Sr. Scientist, Institute Of Microbial Technology, Chandigarh for extending necessary helps and much needed facilities. Their cooperation and concern during my Ph.D has been commendable. I’ve got a great opportunity to learn a lot of things from him individually. They provide me the lab facilities for performing some experiments in their labs. I thank them for their significant help.

I am unable to master words of thanks to my friend Dr. Sameena Ahsan Qazi, Dr, Nida Sultana who provided both friendship and assistance during the course of the present study.

I sincerely acknowledge the altruistic help and cooperation received from my seniors and friends Dr. Susanta Pahari, Dr. Qamar Zia, Dr. Fazle Aalm, Dr. Mehboob, Dr. Shadab Kazmi, MaulanaDr. Jyoti AzadGupta, Dr. AhmarLibrary, rauf and many Aligarh others whose nameMuslim are in my soul University and heart in my early days of research.

I would also like to thanks my Ph.D batch mates Faraz Ahmad , Mrs Tajjalli Chandel, Dr. Sharique Qayyum, Dr. Lama Misbah, Dr. Saima, Dr. Mohd Faisal, Dr.Parvez for being there whenever I nedded. I am not having words to thank my lab colleagues and juniors like Haris saeed, Anzar Abdul Mujeeb, Nazoora Khan, Ashima Sharma and Saba Farheen, for their help, continous cooperation and support for me during my Ph.D both professionally and personally. My thesis is our collaborative effort in every way. It had been a memorable and superb time with all of you around. I am really at loss of words in thanking you for making things easier for me.

I extend my cordial thanks to Mohd. Saad Umar for his continuous help, encouragements, critical comments, moral support and concern in academic pursuits during the pursuance of the research work despite his varied and busy schedule. His ever helping attitude and spontaneous aid at any time of need, shall always linger in my mind.

I acknowledge Mr. Faisal Maqbool, Syed Iqtedaar and Dr. Parveen Salahuddin for assisting me in solving all the problems related to DISC. I thank Mr. Lal Mohd. Mr. Ramesh Chandra. Mr. Chanderpal, Mr. Amir, Mr. Nasir, Mr. Ashraf for their rendering their help whenever required.

Iam fortunate to have friends like Rehan Mohd. who has opened there hearts to me, given consistence support, constantly motivated me and stood for me in all ups and down. His efforts to keep me smiling during rough phase of my Ph.D are highly appreciated.

Mere words will never match the quantum of love, affection, blessing and sacrifice rendered my mother, to whom this work is dedicated. Their invaluable support, constant encouragement and never ending patience will never be forgotten. My heartfelt love is due to my sisters Sabiha Mubin and brother Mohd. Azhar without whose support, this would not have ever been possible. I also thank my other family members for being adjusting and accommodative for me in the social engagements.

Last but not least I must thank to all those whom I have not mentioned but who have helped me directly or indirectly during this study.

I pray to God Almighty for clarifying of vision and thank Him for letting me understand how so really we need each other.

I express my gratitude for those selfless animals that gave their sacrifices for completion of this work.

Maulana Azad Library, Aligarh Muslim University

Aligarh Dated (NIDA) Abbreviations

Ab Antibody

Acr-1 alpha crystallin

AcrMΦpost Acr-1 treatment after differentiation of bone marrow derived

macrophages

AcrMΦpre Acr-1 treatment during differentiation of bone marrow derived

macrophages

Ag Antigen

APCs Antigen Presenting Cells

BCA Bicinchoninic acid

BCG Bacillus Calmette Guerin

BMDM Bone Marrow Derived Macrophages

CFP-10 Culture Filtrate Protein-10

CFU Colony Forming Unit

CMI Cell Mediated Immunity

CNP Chitosan Nanoparticle

CNP-A Acr-1 loaded Chitosan Nanoparticle

CNP-L Ligand decorated Chitosan Nanoparticle

DAPI 4′,6-diamidino-2-phenylindole

DCFDA 2`,7` Dichlorofluorescein diacetate

DCs Dendritic Cells

DMEM Dulbecco's Modified Eagle Medium

EDTA Ethylenediaminetetraacetic Acid

MaulanaELISA Azad Library,Enzyme-linked Aligarhimmune sorbent Muslim assay University

FACS Fluorescence Activating Cell Sorting

FBS Fetal Bovine Serum

FCS Fetal Calf Serum FDA Food and Drug Administration

FITC Fluorescein isothiocyanate

HRP Horseradish Peroxidase

HSP Heat Shock Protein

IFN Interferons

IgG Immunoglobulin G

IL Interleukines

IPTG Isopropyl β-D-1-thiogalactopyranoside kDa Kilo Dalton

M Molar

MDR Multi Drug Resistance

MHC Major histocompatibility complex

Ml Milileter mM Mili Molar

Mφ Macrophages

Ni-NTA Nickel-nitrilotriacetic Acid

NO Nitric Oxide

OD Optical Density

OPD Ortho-Phenylenediamine

ORF Open Reading Frame

PAGE Polyacrylamide gel electrophoresis

PAMPs Pathogen-associated molecular patterns

PBS Phosphate buffered saline

PCRMaulana AzadPolymerase Library, Chain Reaction Aligarh Muslim University

PI Propidium iodide

PMSF phenylmethylsulfonyl fluoride

PRR Pattern recognition receptors PVDF Polyvinylidene difluoride

rBCG Recombinant Bacillus Calmette-Guerin

RD Region of difference

ROS Reactive Oxygen Species

RPMI-1640 Roswell Park Memorial Institute medium

SDS Sodium Dodecyl Sulfate

TAE Tris-acetate-EDTA

TB Tuberculosis

TCR T Cell Receptor

TH-1 T helper cells-1

TH-2 T helper cells-2

TLR Toll Like Receptr

TNF Tumour Necrosis Factor

Tris (Hydroxymethyl) aminomethane

TRITC Tetramethylrhodamine

µg Microgram

µl Microliter

4-SO4-GalNAc 4- SO4-N-Acetyl-Galactosamine

Maulana Azad Library, Aligarh Muslim University Content

Page No Abstract List of Abbreviations List of Tables List of Figures

CHAPTER 1

REVIEW OF LITERATURE 1-53 1.1 Introduction 1.2 Brief Introduction of Tuberculosis 1.3 Identification and Morphological features of Mycobacteria 1.4 Cell wall of Mycobacteria 1.5 Mode of Infection, granuloma formation and latency 1.6 Virulence Factor 1.7.1. Culture Filtrate Protein

1.7.1.1. ESAT-6 family proteins/CFP-10 Protein (Rv3875, Rv3874) 1.7.1.2. HspX (Rv2031c, hspX) 1.7.1.3. GlnAl (Rv2220, gInAl)

1.7.2. Mycobacterial cell wall and cell surface components

1.7.2.1. Erp (3810.erp) 1.7.2.2. FadD 26 (Rv2930) and FadD28 (Rv2941) 1.7.2.3. Mas (Rv2940, mas) 1.7.2.4. PcaA (Rv0470c, pcaA)

1.7.2.5. FbpA (Rv3804, FbpA) 1.7.2.6. OmpA (Rv0899,OmpA) 1.7.2.7. HbhA (Rv0475, hhhA) 1.7.2.8. Lipoarabinomannan or LAM 1.7.2.9. Sulpholipid 1.7.2.10. Mycolic acid 1.7.2.11. Trehalose-6, 6’-dimycolate or TDM

1.8 Tuberculosis and the BCG Maulana Azad1.8.1. Recombinant Library, live BCG Aligarh vaccine Muslim University 1.8.2. Different strategies used in rBCG development 1.8.3. Boosting BCG with Subunit Antigens 1.8.4. Subunit vaccine 1.8.5. DNA vaccine 1.8.6. Attenuated Mycobacteria in tuberculosis vaccine development 1.8.7. Replication deficient vector based vaccine 1.9 Host Response to Mycobacterium tuberculosis 1.10 Role of innate immune cells in pathogen clearance 1.11 M.tb uptake and survival inside macrophages: phagocytosis mechanism 1.12 Pattern recognition receptor and innate immune response against M.tb 1.12.1. Toll like receptors 1.12.2. Nod like receptor (NLR) 1.12.3. C- Type lectins receptors (CLRs) 1.12.4. Dectins 1.13 Cytokines as immunomodulator 1.14 Microbial products as immunomodulator against M.tb 1.15 Delivery system 1.15.1.1. Lipid based nanoparticles 1.15.1.2. Carbon based nanoparticles 1.15.1.3. Ceramic nanoparticles 1.15.1.4. Metal nanoparticles 1.15.1.5. Semiconductor nanoparticles 1.15.1.6. Quantum dots 1.15.1.7. Polymeric nanoparticles 1.15.1.8. Dendrimers 1.15.1.9. Chitosan CHAPTER 2

MATERIALS AND METHODS 54-60

2.1 Biochemicals and Antibodies 2.2 Expression vector pET23 (d) 2.3 The cloning/expression vector, pET23 (d) 2.4 Cloning of Acr-1 (Rv2031c) gene from M. tuberculosis H37Rv in E. coli expression vectors 2.4.1. Preparation of genomic DNA of M. tuberculosis H37Rv 2.4.2. Isolation and amplification of the gene 2.4.3. Restriction digestion and ligation of the genes in Maulana Azadex pressionLibrary, vectors Aligarh Muslim University 2.4.4. Confirmation of the clones 2.4.5. Screening for clones expressing Acr-1 2.4.6. Over expression and purification of Acr-1

CHAPTER 3

MYCOBACTERIUM TUBERCULOSIS HOST CELL

INTERACTION: ROLE OF LATENCY ASSOCIATED 61-80 PROTEIN ACR-1 IN DIFFERENTIAL MODULATION OF MACROPHAGES 3.1 Introduction 3.2 Materials and Methods 3.2.1. Mice and ethics statement 3.2.2. Reagents 3.2.3. Murine Bone Marrow Derived Macrophages (BMDM) 3.2.4. Differentiation of THP-1 macrophages 3.2.5. Antigen uptake studies 3.2.6. T cell proliferation study 3.2.7. Flow cytometry analysis 3.2.8. Cytokines estimation 3.2.9. Annexin and Propidium Iodide (PI) assay 3.2.10. Western blot 3.2.11. Statistical analysis 3.3 Result 3.3.1. M.tb Acr-1 modulates the differentiation of host MΦs 3.3.2. Exposure of MΦs to Acr-1 during their maturation results in the tolerogenic phenotype 3.3.3. Acr-1 treatment modulates the cytokine release in macrophages 3.3.4. Acr-1 post treatment augments antigen uptake of macrophages 3.3.5. AcrMΦpost treatment resulted in augmented proliferation of allogenic T cells while AcrMΦpre inhibits T cells proliferation 3.3.6. Acr-1 modulates the phosphorylation of STAT-1 and STAT-4 in host MΦs

3.4 Discussion CHAPTER 4

THE PRIME BOOST VACCINATION STRATEGY: 81-93 PROSPECTIVE APPROACH FOR IMPROVING MEMORY Maulana AzadRESPONSE Library, AGAINST Aligarh M.TB INFECTION Muslim University 4.1 Introduction 4.2 Materials and Methods 4.2.1. Reagents 4.2.2. Antibodies 4.2.3. Mycobacterial strains 4.2.4. Experimental mice and immunization strategy 4.2.5. Challenge with Mycobacterial infection and assessment of residual bacterial burden in vital organs 4.2.6. Ethics statement 4.2.7. Determination of antibody isotype in sera of immunized mice 4.2.8. Isolation of lymphocytes from spleen of immunized animal 4.2.9. Proliferation assays 4.2.10. Immunophenotyping 4.2.11. Statistical analysis 4.3 Results 4.3.1.Concomitant immunization with Acr-1antigen and boosting with BCG or H37Ra induces robust lymphocyte proliferation and Th1 response 4.3.2. CD69 surface expression on activated CD4+ T lymphocytes present in lung of immunised animals 4.3.3. Boosting BCG with Acr-1 induces CD4 specific T Cells with long lasting Memory and Effector Phenotype 4.3.4. Vaccination with Acr-1 with BCG induces better protection against M.tb infection

4.4 Discussion CHAPTER 5

SELECTIVE TARGETING OF 4SO -N-ACETYL- 4 GALACTOSAMINE FUNCTIONALIZED M. TB PROTEIN

LOADED CHITOSAN NANOPARTICLE TO MACROPHAGES: 94-120 CORRELATION WITH ACTIVATION OF IMMUNE SYSTEM

5.1 Introduction 5.2 Materials and Methods 5.2.1. Reagents 5.2.2. Cell line, animals and bacterial culture growth condition Synthesis and characterization of Acr-1 protein loaded chitosan nanoparticles 5.2.4. Surface modification of as-synthesised CNPs with ligand 4-SO4-GalNAc Maulana 5.2.5.Azad Fourier Library, transforms infrared Aligarh spectroscopy Muslim University 5.2.6. High resolution transmission electron microscopy (HR- TEM) 5.2.7. Percent Entrapment Efficiency (%EE) 5.2.8. In vitro killing assay to determine anti-mycobacterial potential of as-synthesised CNPs 5.2.9. Anti-mycobacterial potential of as-synthesised CNPs as determined by agar diffusion assay 5.2.10. Cytotoxicity assay 5.2.11. FITC labelling of nanoparticle and M. smegmatis cell 5.2.12. Cellular uptake study of as formed CNPs by RAW264.7cells employing confocal laser microscopy 5.2.13. Antibacterial potential of as-synthesised CNPs against intracellular M. smegmatis 5.2.14. Potential of as-synthesised CNPs to generate intracellular ROS 5.2.15. Anti-biofilm potential of as-synthesised CNPs 5.2.16. Live/Dead staining of CNPs treated M. smegmatis biofilm 5.2.17. Effect of CNPs on M. smegmatis biofilm as revealed by confocal microscopy 5.2.18. Effect of as-synthesized CNPs on expression of costimulatory molecules in treated macrophages 5.2.19. Statistical Analysis 5.3 Results 5.3.1. Characterization of surface decorated CNPs employing FTIR and TEM 5.3.2. FTIR Spectroscopy 5.3.3. Encapsulation Efficiency of CNP-A nanoparticles 5.3.4. In vitro antigen release 5.3.5. Antibacterial activity of various as-synthesised CNPs 5.3.6. CNPs mediated damage of M. smegmatis cell wall 5.3.7. Intracellular ROS production by as-synthesised CNPs 5.3.8. Assessment of biofilm inhibition by as-synthesised CNPs using SYTO-9 dye 5.3.9. Safety evaluation & Cytotoxicity assay 5.3.10. Cellular uptake of CNPs by RAW264.7cell 5.3.11. Efficacy of CNPs in killing of intracellular M. smegmatis and also up-regulation in expression of costimulatory molecules in infected macrophages after treatment with CNPs.

5.4 Discussion Maulana5.5 Conclusion Azad Library, Aligarh Muslim University BIBLIOGRAPHY 121-155

LIST OF TABLES

Figures Title P. No.

Chapter 1

Figure 1.1 The structure of the Mycobacterium tuberculosis cell wall 11

Figure 1.2 TB pathogenesis 15

Figure 1.3 Schematic presentation of various drug/ antigen delivery 48 systems

Figure 1.4 Schematic representation of proposed mechanism of 53 ligand conjugataed chitosan nanoparticle as vaccine candidate.

Chapter 2

Figure 2.1 (A) Circular and linear map of pET2(d) vector 57 (B) Circular and linear map of pET2 (d) with Acr-1 (16-kDa) insert cloned at NcoI and XhoI restriction site

Figure 2.2 (A) Agarose gel electrophoresis of amplified Acr-1 59 product. (B) 12% SDS page of eluted Acr-1 (C) Western blot of Acr-1 with TGBAb.

Chapter 3

Figure 3.1 Differential role of alpha crystallin protein (Acr-1) in 68 BMDM maturation and in the function of human monocytes.

Figure 3.2 AcrMΦpre treatment lead to tolerogenic phenotype in 69 MΦs.

Figure 3.3 Acr-1 modulates the release of various cytokines 71

Figure 3.4 Acr-1 regulates antigen uptake by macrophages 72

Figure 3.5 Post Acr-1 treatment resulted in augmented proliferation 73 of allogenic T cell while pre Acr-1 treatment hampers T Maulana Azadcell response Library, Aligarh Muslim University Figure 3.6 Acr1 modulates the phosphorylation of STAT molecules 75

Chapter 4

Figure 4.1 Elicitation of immune response after prime boost with Acr- 87 1 BCG

Figure 4.2 Significantly higher expression of CD69 on CD4+T cells 88 in Acr-1-BCG vaccinated mice

Figure 4.3 Induction of CD4 T cell effector and central memory 90 response upon immunized with Acr-1 antigen followed by boosting with BCG or H37Ra

Figure 4.4 Reduced Mycobacterium tuberculosis load in lungs of 91 mice immunized with Acr-1-H37Ra and Acr-1-BCG

Figure 5.1 Physical characterization of as-synthesised CNPs by using 104 (A) TEM (B) Zeta Potential (C) FTIR (D) Acr-1 antigen release from CNP-A/CNP-L nanoparticle at stipulated pH-5.5

Figure 5.2 (A) Bacteriocidal and bacteriostatic effect of CNP 107 against M.smegmatis using 7H9 agar plates (B) Dose dependent killing of M. smegmatis by various as-synthesised CNPs

Figure 5.3 CNPs treatments disintegrate the M. smegmatis cell wall. 108

Figure 5.4 Fluorescence micrograph showing the generation of 109 intracellular reactive oxygen species (ROS) using DCFDA dye in CNPs treated M. smegmatis cells

Figure 5.5 Confocal microscope image showing M. smegmatis 110 biofilm inhibition by CNPs as visualised in 63X oil immersion magnification

Figure 5.6 Assessment of cytotoxic activity of various as-synthesised 112 CNPs against mouse macrophages 264.7 cells

Figure 5.7 Confocal microscope image showing cellular uptake 113 capacity of ligand conjugated chitosan nanoparticles by RAW264.7 mouse macrophages cell line

MaulanaFigure 5.8 Azad Chitosan Library,-based conjugated Aligarh nanoparticles Muslim (CNPs) killUniversity 115 intracellular Mycobacterium smegmatis.

Figure 5.9 Flow Cytometry analysis of Co-stimulatory molecule in M. 116 smegmatis infected macrophages cell line

LIST OF TABLES

Table No. Title Page. No.

Table 1.1 Summary of new generation tuberculosis 26-27 vaccine development Table 2.1 Summary of Strains, plasmids and primers used 55 in cloning of Acr-1

Maulana Azad Library, Aligarh Muslim University Chapter-1 INTRODUCTION & REVIEW OF LITERATURE

Maulana Azad Library, Aligarh Muslim University Chapter -1

1. Introduction

Despite discovery, development and availability of effective and affordable chemotherapy, TB remains a major cause of death worldwide. World Health Organization (WHO) declared TB as devastating global health emergency as the first disease to be so designated. Tuberculosis (TB) is considered to be a major health threat that may kill about nearly 2 million people a year worldwide. On the other hand, more than 2.5 million people worldwide act as a carrier of TB pathogen (Mycobacterium tuberculosis) burden and every fourth person seem to be infested with M.tb (WHO 2015). The pathogen, M.tb behaves more likely as a symbiotic rather than a parasite in most incidents of M.tb infection; a condition that denominate as latent TB (LTB) (Parrish NM et al. 1998). Mycobacterium tuberculosis, a facultative intracellular parasite causes chronic granulomatous disease, is the main causative agent and evolved numerous successful strategies to invade and persist within the host macrophages. The devastating disease can also be caused by other member of M.tuberculosis family such as; M.bovis. M.microti, M.africanum, M.canetti in a range of hosts. Pulmonary M.tb infection is caused by the inhalation of aerosolized particles loaded with M.tb bacilli. The inhaled M.tb aerosolized particles primarily infect the phagocytic alveolar macrophages and the non-phagocytic alveolar endothelial cells. This allows M.tb to replicate within these permissive host cells and its subsequent spread to pulmonary lymph nodes and several other extra pulmonary sites. The outcome of the initial interaction between M.tb and host determines the subsequent establishment of bacteria within macrophages and its ability to damage host cells by counter acting various host defence mechanisms. M.tb evolved several mechanisms to manipulate the host protective immune regulatory networks. It creates conductive conditions for small infection droplets to be delivered directly into the intra alveolar spaces of the lower compartment of lung. This help in anchoraging and interaction with fewer microbicidal macrophages, while interaction with feeble macrophages helps in establishing niche for Mycobacteria (Russell DG et al. 2009). MaulanaBesides numberAzad of otherLibrary, factors also Aligarhassociated with Muslim altered host cellular University immunity like HIV-coinfection, diabetes immunosuppressive therapy, cancer, endstage renal disease, severe malnutrition etc. increases the risk of reactivation of latent TB into active TB (Geldmacher C et al. 2010).

Chapter -1

Studying details of crosstalk between host and the pathogen Mycobacterium tuberculosis (M.tb) is indispensable to understand the pathophysiology of the M.tb. Principally, M.tb’s enormous pathogenic success is based on multiple possibilities exist; i), reprogramming of macrophages after primary infection/phagocytosis in order to prevent its own destruction; ii), originate the genesis of well-organized granulomas, comprising different immune cells to create a confined niche for host– pathogen standoff; iii), the efficiency to close down its own central metabolism, terminate replication and thereby transit dormant state and provide the shield to itself from extremely resistant to host defense and drug treatment; iv), reactivation of bacteria by evasion of dormancy upon favourable condition leading to re-emergence of the infection.

In order to develop better diagnostic methods and treatment options better understanding of the biology of M.tb and LTB is necessary. However, the interplay between M.tb and the human host is incompletely understood. The unique feature characterising tuberculosis is its pathogenesis. The pathogenesis of tuberculosis involves cell-mediated immune responses against M.tb. The cell involved in tuberculosis immunology and pathogenesis includes mainly effector T cells and antigen presenting cell (DCs, MQ and B cells). APCs, impart crucial role because they constitute the element which triggers the subsequent immune events (Boom WH. et al. 2003).

The host response to M.tuberculosis infection is a complex phenomenon. At the cellular level, the core arsenal of host defence to Mycobacterial infection is the formation of granulomas which are comprised primarily of lymphocytes and cells of monocytic lineage. The granuloma represents the formation of an isolated microenvironment, in which activated macrophages and lymphocytes strive to eliminate the bacterial load (Flynn JL et al. 2011). The alveolar macrophages, which are amongst the first cells to encounter the M.tb pathogen and its secreted antigen, Maulanaappear to play only Azad a limited Library, defensive containment Aligarh role against Muslim the bacteria. UniversityIt could be correlated with poor antigen processing ability and lack of proper activation signal.

This highlights the importance of the early event in host pathogen interaction in tuberculosis that may lead to proper activation of co-stimulatory molecule, adhesion molecule expressed on APCs and subsequent secretion of pro and anti-inflammatory

Chapter -1

cytokine response, which together may regulate subsequent activation and development of a protective immunity (Van de Vosse E et al. 2004). The infected cell surface had been remained as a focus of intensive research against several intracellular infections including, tuberculosis, leishmaniasis and malaria and not only for the better understanding of host parasite interactions but also for the identification of new drug targets and vaccine development against active pulmonary tuberculosis and latent TB.

Infected macrophages act as a primary reservoir cells for both active TB and LTB. Infect these are primary target that may help to study the pathophysiology of M.tb. In the latent phase, the stage when M.tb entered into hypoxic condition, a gene is induced under hypoxia and potentially involved in latency that is known as Acr-1 or hspX, Rv2031c (Sherman DR et al. 2001).

Heat shock protein (Hsp) are a ubiquitous group of proteins found in all living organism, expressed in response to different types of stress including environmental changes, nutrient starvation, PH changes and the stages of development. Hsps also function as molecular chaperones aiding the folding or refolding or in some cases elimination at the nascent protein molecule. Hsps play an important role in cytoprotection and cell survival (Jakob U et al. 1993). Small Hsps (sHsp) have a molecular weight ranging between 2-43 kDa. They comprise of a structurally divergent group of proteins characterized by a conserved sequence of 80-100 amino acid residues, which is flanked by two extensions. The N-terminal extension is poorly conserved and is responsible for oligomer construction and chaperone activity, whereas the C-terminal is a highly variable, flexible region accountable for stabilizing the quaternary structure and enhancing protein/substrate complex solubility.

M.tb, Acr-1, also called latency associated antigen which have the potential to exert potent immunoregulatory effects on the cells of the developing granuloma and APCs and required for the growth of M.tb in cultured macrophages. Acr-1 localizes to the Maulanainner surface Azad of the Library, cell membrane Aligarh of M.tb and Muslim its expression isUniversity dramatically increased in hypoxic condition and its release into the extracellular medium was proposed to play an important role in controlling the maintenance of dormancy and recruitment of cells to the site of infection. Acr-1 is not essential for virulence of the host; however some reports suggest that it is required for maintaining Mycobacterial

Chapter -1

growth inside host macrophages (Yuan Y et al. 1998). Therefore, the role of Acr-1 with respect to immunodominating properties and its growth inside host needs to be clearly established.

Inside the phagosomes of activated macrophages different peroxides can be formed, including hydrogen peroxide, peroxynitrite and fatty acid hydro peroxides along with other oxidative species. All of these have been reported to be cytotoxic against various invading microorganisms including bacteria. M.tb has evolved an elaborate mechanism to enzymatically detoxify these reactive oxygen and nitrogen species as a self-survival (Ehrt S et al. 2009). Most studies till date have focused on defence mechanisms of Mycobacteria to survive within macrophages but none have tried to explicate the role of latency associated antigen Acr-1 in host imuunomodulation.

The sole vaccine against tuberulosis developed almost a century ago, licensed for human use is a live, attenuated strain of the closely related Mycobacterium bovis Bacille-Calmette Guerin (BCG), and provides limited protection against pulmonary diseases in adults particularly against latent infection. The poor efficacy conveyed by BCG for preventing TB, attributed to many factors, began with genetic diversity through deletion or insertion of genes and gene families from the strain. For example, absence of RD loci from M.bovis strain, however these loci are present in virulent strain of M.tb. BCG is primarily believed to mediate immunity through the development of antigen specific CD4+ T cells but fail to induce long term memory response against adult pulmonary TB (Andersen P, Doherty TM. 2005).

In principal, current putative vaccination strategy against TB include the development of ; prophylactic vaccines based on BCG with or without antigens secreted by replicating bacteria recognized during the early stage of infection or protective mutants (live attenuated BCG substitutes) and secondly, as yet undefined post- exposure vaccines (boosting BCG) aimed at elimination/containment of latent TB and prevention of reactivation of TB to mount an appropriate T cell response against the MaulanaM.tb pathogen. AzadKeeping in Library, view the failure Aligarh of BCG in different Muslim regions across University the world as well as high degree of genomic similarity of M.tuberculosis, it is imperative to have detailed analysis to enhance prophylactic potential of selected combination of antigens to supplement BCG, in order to improve their prophylactic efficacy and protection against tuberculosis. Ideally, a prime-boost approach comprising of a

Chapter -1

prophylactic vaccine with subunit, based on late-stage antigens induced in the latency stage (or resuscitation/reactivation stage), should have maximum impact on controlling all stages of M.tb infection (Fine PE. 1995).

One such antigen for vaccine design is the Acr-1 small heat shock protein (HspX) and molecular chaperone from M.tb. This protein has been implicated as latency associated antigen due to its late expression during course of infection and ability to re-stimulate T cells from latently infected patients. Whereas the role of secreted cytokines in the host response during latency to M. tuberculosis is being elucidated, what follows the release of these molecules is even less understood.

Although, it is still unclear why BCG fails to prohibit primary infection, reactivation, and eventually establishment of pulmonary TB, it is widely accepted that there is an urgent need for strategies that can bolster BCG induced immunity along with maintenance of long-term memory for optimum protection. An alternative approach to improve BCG efficacy could be to add immunostimulatory antigen in a prime boost vaccination strategy, which can augment the BCG induced immunity as well as quality and longevity of memory T cell response against TB.

In order to develop, a successful vaccine against M.tb infection, it is mandatory to acquire precise understanding how immunity develops following an experimental BCG vaccination with Acr-1 in a prime boost vaccination strategy. It is also desirable to know the roadblocks that hamper generation of sustainable protective immunity. In the present study, we explored the host innate and adaptive immune responses against BCG administered alone or in combination of immunodominant antigen Acr-1. We also studied how presence of Acr-1 during BCG vaccination influences the host response to M.tb infection and eventually progression to TB. Finally, we discuss an important and commonly overlooked factor in BCG vaccine design, the influence of the human lung environment, and its consequences in development of infection with M.tb. Maulana Azad Library, Aligarh Muslim University Earlier studies carried out in small animals have revealed a close association between the release of pro-inflammatory cytokines, and the accumulation of inflammatory cells at a given site, through the modulation of co-stimulatory molecule expression on the APC (Ulrichs T, Kaufmann SH. 2006). Scenario of cell infiltration, cytokine and antigen secretion during M.tb granuloma formation in latency period is not clear and

Chapter -1

underlying molecular mechanisms involved in the same remained obscure. For instance, little is known about the factors released from granuloma during hypoxic condition that govern the immunomodulation against M.tb infection. Surprisingly, it remains elusive that what molecular mechanism and pathways are explored by M.tb to accomplish its survival.

In fact in the present study, we have tried to investigate the role of latency associated antigen Acr-1 from Mycobacterium tuberculosis in orchestrating immunoevasion and immunosuppression event within macrophages, which are primary determinants for subsequent establishment or elimination of bacteria from the host cells.

In continuation to these efforts, the objectives of thsis study were as follow:

 Cloning and purification of recombinant Acr-1 from M.tb strain.

 Role of latency associated Mycobacterium tuberculosis protein Acr-1 in differential modulation of macrophage maturation.

 To enhance the immunogenicity of BCG with immunodominant Acr-1 antigen in prime boost vaccination strategy with expected long lasting memory response against Mycobacterium tuberculosis.

 Interactions of 4-SO4-GalNAc ligand decorated M.tb-Acr-1 antigen-loaded chitosan nanoparticles with macrophages and their correlation with the immune response.

Maulana Azad Library, Aligarh Muslim University

Chapter -1

1.2 Aim of the study

Tuberculosis kills about 2 million people a year and has been declared a global health emergency by World Health Organization (WHO), the first disease to be so designated. More than two billion people worldwide are carriers of TB pathogen Mycobacterium tuberculosis and every second someone is infected with M. tuberculosis. M.tb behaves more like a commensal than a parasite in most cases of infection, a condition that is designated as latent TB. M.tb has evolved mechanisms to manipulate the immune regulatory network of the host, creating conditions that secure their survival for an extended period of time. A number of conditions that are associated with altered host cellular immunity like HIV infection, extremes of age, immunosuppressive therapy, cancer, end stage renal disease, diabetes, severe malnutrition etc. increase the risk of latent TB developing into active TB.

Macrophages and dendritic cells (DCs) are important antigen presenting cells (APCs) regulating both innate and adaptive T cell immune responses. Several studies have revealed the various mechanisms employed by Mycobacteria to modulate the protective responses of both macrophages and DCs (Hickman SP et al. 2002). However, the mechanisms by which the bacilli modulate various protective functions of host are not fully understood. Proteins secreted by dormant Mycobacteria play an important role in Mycobacterial virulence and maintenance of dormancy. Various studies indicate an essential role of Acr-1 protein in the latency phase of M.tb. Acr-1 is one of the most crucial secreted proteins of latency phase that plays an essential role in tuberculosis pathogenesis.

Acr-1 secretion in latently infected tuberculosis infection results in dramatic reduction of pathogenicity of M.tb and maintainance of latency in LTB. Various studies have shown that Acr-1, is an immuno-dominant protein, can modulate APCs specially DCs protective functions like cytokine production, inflammation, autophagy, apoptosis as well as Th17 cell differentiation and cytokine production by T cells (Siddiqui KF et Maulanaal. 2011) Azad. Library, Aligarh Muslim University

In the host cell Mycobacteria underwent in latency phase and can be reactivated in pathogenic containment phase. In hypoxic or stress condition dormant pathogenic Mycobacteria secrete Acr-1 in host cell. Therefore, the functions of Acr-1 seem to be due to its interaction with host target thereby modulating host cell responses to favour

Chapter -1

survival of M.tb in macrophages. For all the modulating functions associated with Acr-1, host interacting factors of Acr-1 and the mechanisms underlying its virulence functions are not well studied. Therefore, in the present study we aimed to identify the host interacting partners of Acr-1 and to understand the effect of such interactions on modulation of macrophage effector functions.

Maulana Azad Library, Aligarh Muslim University

Chapter -1

1.3 Brief introduction of tuberculosis

Tuberculosis is a disease of great public concern globally and it is one of the most devastating causes of disease declared by WHO. Approximately, 2-2.5 million deaths occurred every year and millions of people get every year infected latent tubuerculosis (WHO 2016). Inspite of the availability of chemotherapy, the emergence of multi drug–resistance (MDR-TB) is of great challenge. This can be attributed to the human immunodeficiency virus (HIV) epidemics as well as demographic and socio economic factor such as poverty and malnutrition which served to maintain the reservoir of potential infection (Bloom BR, Murray CJ. 1992).This alarming rise led to the WHO to declare TB a global emergency in 1993. It is rely recently that the high level UN meeting has conveyed to tackle with the growing measure of tuberculosis.

1.4 Identification and morphological features of Mycobacteria

At the end of 19th century, Robert Koch discovered that M.tuberculosis was the causative agent of TB. Metabolically, Mycobacterium are acid–fast, gram positive, obligative aerobes with non-motile and nonsporulated rods shaped structure, that require oxygen for aerobic and cellular respiration while surviving extracellulary inside the host (in the lower lobes of the lungs). However, macrophages provide a niche for M.tb where they live as ‘facultative intracellular parasite’. The unique characteristics of the tubercle bacilli include its slow growth, dormancy, and complex cell wall envelope, intracellular persistence for survival and pathogenesis and genetic homogenecity (Wheeler PR, Ratledge C. 1994). M.tuberculosis has a very slow generation time of 15 to 20 h in synthetic medium and in infected animal typically 20-24 h, which significantly contribute to the virulence of the bacterium (Cook GM et al. 2009). The bacteria lying in the dormant state in the infected tissue may affect metabolic shut down resulting from the action of a cell mediated immune response that can contain but not eliminate the infection completely. Maulana Azad Library, Aligarh Muslim University The cell envelope of M.tb having high G+C rich content (61-71%) genome with unique features contain an additional layer beyond the peptidoglycan with notably high unusual lipid, glycolipid and polysaccharides (Cole S et al. 1998). This unique property is termed as “acid –fastness” and is the basis of the Ziehl-Neelsen staining

Chapter -1

method for the identification of Mycobacteria. Novel biosynthetic pathways of Mycobacteria generate a unique cell wall component such as mycolic acid, mycoserosic acid, phenolthiocerol, arabinogalactans and lipoarabinomannan, and may contribute to Mycobacterium longetivity, rigidity, triggers inflammatory host response and pathogenesis. As immunity wanes through immune suppression or ageing, the dormant Mycobacteria reactivate, causing an outbreak of disease often many decades after initial infection. This contributes to the chronic nature of the disease, lengthy treatment regimen and represents the dreadful challenges for researchers. The molecular basis of dormancy and resurrection remain obscure but is supposed to be genetically programmed and to involve intracellular signalling pathway (Stewart GR. 2003).

1.5 Cell wall of Mycobacteria

Mycobacterium pathogen has a thick lipid rich cell envelope consisting of three major constituent: the plasma membrane, the cell wall core with the extractable non– covalently linked glycans and associated proteins. The illustration in (Fig: 1.1) depicts thick cell wall of Mycobacterium surrounding the cytoplasm contained within a cytoplasmic membrane. There is no periplasmic space between the plasma membrane and the cell wall. The cell wall structure of the bacterium has been widely studied because it has very distinctive ability to survive in mammalian host, pathogenicity, immunogenic properties and major determinant virulence for the bacterium (Brennan PJ. 2003). The cell wall represent up to 40% of the total dry weight of the bacterium. It is composed of both peptidoglycan and complex lipids. Lipids accounts for 60% of the cell wall. Broadly, the cell wall can be divided into two major segments which are the lower to mycolic acid layer.

Maulana Azad Library, Aligarh Muslim University

Chapter -1

Figure 1.1: The structure of the Mycobacterium Tuberculosis cell wall. This figure shows a schematic presentation of the major components of the cell wall and their distribution. The outer membrane is composed of mycolic acid, glycolipids like (mannose capped) lipomannan and mannoglycoproteins. The inner layer is composed of peptidoglycan, covalently linked to arabinogalactan layer.

All major Mycobacterium species share a characteristics cell wall, thicker than in many other bacteria. The external cell wall of the membrane is peptidoglycan layer held together by a hydrophobic polysaccharide. External to the membrane peptidoglycans is covalently attached to arabinogalactans, which in turn attached to hydrophobic mycolate layer with their long mero-mycolates and short alkyl- chains. This portion is termed the cell-wall core, the mycolylarabinogalactan-peptidoglycan complex (MAPc). The mycolic acid unique to Mycobacteria along with intercalating long chain fatty acids covalently bound to arabinogalactans –peptidoglycans co- polymer; implicated in the formation of inner layer of an asymmetric outer membrane of mycobacteria, while outer lipid constitute the outer leaflet (Cole S et al. 1998) (Fig: 1.1). The mycolic acids extend perpendicular to the arabinogalactan / peptidoglycan Maulanawhile other Azad cell wall Library,-associated glycolipids Aligarh intercalate Muslim into the mycolic University acid layer to form a ‘pseudo’ lipid bilayer.

The cell wall is chemically composed of highly cross-linked peptidoglycan, arabinogalactan (AG) and mycolic acid. The arabinan of AG provides the anchoring point for the outer mycolyllipid layer and links it to the underlying peptidoglycan

Chapter -1

layer via a galactan chain to from the mycolylarabinogalactan peptidoglycan [MAP] (Khasnobis S et al. 2002). The free lipid comprise the extractable material, which include the phthiocerol-containing lipids, the phosphatidylinositol mannoside, lipomannan, lipoarabinomannan, trehalosedimycolate (cord factor), trehalosemonomycolate and the diacyl-and polyacyltrehalose presumably intercelating with the alkyl brances and mero-mycolates chains of the mycolic acid (Russell DG et al. 2010). When the bacterial cell wall is exposed to treatment with various solvents, the free lipid and protein are solubilised first and MAPs remain intact as an insoluble residue. Hence it is consider that these lipids, proteins and lipoglycan may impart as a signalling effectors molecule in the disease progression, while the insoluble core material may provide infrastructural support to maintain the architecture (Neyrolles O et al. 2011). The hydrophobic nature of mycolic acid layer and the hydrophilic arabinogalactans layer afford impermeability to the mycobacterial membrane that confers on M.tb two of its characteristics, its slow growth and intrinsic drug resistance. Transport of low–molecular weight nutrients and metabolites through this impermeable cell wall is facilitated by hydrophobic channels formed by proteins called porins (Niederweis M. 2003).

Mycobacterial cell wall permeability is only partly responsible for the extremely high level of antibiotic tolerance, an array of synergistic cellular defence mechanisms play a more predominant role in evolution and maintenance of against antibiotics in Mycobacteria. Additionally, Mycobacteria also possess effective β-lactamase enzymes that bind to and degrade the β-lactam drugs (Wang F. 2006).

1.6 Mode of infection, granuloma formation and latency

Nearly 1.5 billion (according to latent mathematical model based estimation) people are estimated to be latently infected with M.tb, in a non-replicating or dormant stage. TB can affect any organ but mostly affects lungs. The mode of TB infection involves sequences of events responsible for M.tb transmission. It begins with the inhalation of Maulanatubercle bacilli Azad as droplet, Library, released into Aligarh the atmosphere Muslim from infected University active pulmonary tuberculosis individuals/animals. When infected person coughs, sneeze, speak or spits, he expels thousands of aerosol droplet to air, each of which contain a maximum of three bacilli. Healthy individual who came in frequent or prolonged contact with infected people are at highest risk to getting infected (the infection rate is

Chapter -1

estimated to be 25%). However, transmission occurs from people with active pulmonary TB but not the latent TB disease. Only 10% of the people infected with M.tuberculosis develop the active TB disease whereas in 90% of the cases, the infection remains asymptomatic (WHO 2013). M.tb is transmitted via inhalation of aerosol droplets containing the bacilli and there subsequent travel to pulmonary alveoli where they get phagocytosed by non-activated lung macrophages and interstitial dendritic cells. Alveolar resident macrophages are the primary cells involved in the initial uptake of M.tb. Dendritic cells and monocyte-derived macrophages also take part in the phagocytosis of bacteria (Danelishvili L et al. 2003). The bacilli are taken up by macrophages using receptor-mediated phagocytosis by expressing variety of receptors including CR3, CR4 and mannose receptors. The inhaled bacilli don’t immediately multiply for at least 3 days (lag period) (Cooper AM, Khader SA. 2008) it may be controlled by alveolar macrophages before any lesion is produced.

The M.tb modulates many cellular mechanisms for its survival within the macrophages viz. halting the fusion between phagososmes and lysosomes (Houben EN et al. 2006). The ability of the bacteria to deceive phagolysosomal degradation allows it to replicate freely. When large numbers of macrophage gets infected, they fuse and form multinucleated giant cell also called Langhans cells. The initial site of infection is pulmonary macrophages that further develops into a lesion in lung is called Ghon’s focus after the name of Anton Ghon (1866-1936), a Czech pathologist. All infected macrophages do not play role in killing of the bacilli. The bacilli replicate without any stipulation inside the macrophage till the host macrophage bursts. Macrophages from peripheral blood migrate to the site of primary infection and phagocytose M.tb. Intersetingly, Mycobacteria use these macrophages as safe shelter niche for their own replication. Dendritic cells also take part in phagocytosis of bacilli, but successfully restrict replication of these bacilli. Although, dendritic cells do not take part in killing mechanism of M.tb, they serve as a transporter of Maulanainfectious Azad bacilli from Library, the Ghon’s Aligarhfoci to lymph nodesMuslim for priming University of T cells. However occasionally bacilli spread to distant tissues and organs such as peripheral lymph nodes, kidneys, brain and bones and can cause extra pulmonary TB [EPTB] (Sharma SK, Mohan A. 2004).

Chapter -1

In lungs, the infected macrophages generate a localized proinflammatory response. While some of the immune cells which are being surround the infected macrophages, to form a barrier to the surrounding tissue. These cells are the building blocks for the tubercle or granuloma, which is the signature of pathological feature of tuberculosis (Pieters J. 2008). Small caceous lesions developed around or within granuloma may progress or heal or stabilize before they are detectable by a radiograph.

The infected macrophages undergo apoptosis leading to genesis of apoptotic vesicles filled with Mycobacterial antigens and components. These apoptotic vesicles are efficiently taken up by professional antigen presenting cell (APCs) which express and deliver the antigens on MHC class I or MHC class II molecules for further recognition by CD8 or CD4 T cells, respectively (Davis MM, Bjorkman PJ. 1988). During this process, unconventional T cells are also activated. The unconventional T cells include T cells expressing y/δ T cell receptor with specificity for small phosphorylated ligands and lipoprotein and T cells with specificity for glycolipids (Kaufmann SH. 2005). Thereafter, infected macrophages and DCs enter lung parenchyma where they form inflammatory foci which recruit mononuclear phagocytic cells from neighbouring blood vessels and gradually develop the granuloma or tubercle.

A typical granuloma consists of a kernel of infected macrophages surrounded by foamy macrophages and other mononuclear phagocytes in association with a fibrous cuff of collagen and other extracellular matrix components. A granuloma represents containment phase of the bacterium in which the bacilli are unable to infect neighbouring tissues and there are no overt signs of the disease. In the progression of the stage, there is marked development in the fibrous cuff of the granuloma which leads to loss of number of blood vessels supplying blood to this structure. However, containment of Mycobacteria remains established till the immune system of the infected person is strong (Ulrichs T, Kaufmann SH. 2006).

MaulanaContainment usually Azad fails Library, when the immune Aligarh system of the Muslim host changes, University which correlates with essentially any condition that ensues in reduction or impairment in the functional CD4 specific T cells as seen in old age, malnutrition or co-infection with HIV etc. Following such a change in the immune status, the granuloma caseates (decays into a structure-less mass of cellular debris), breach and spread within the

Chapter -1

lungs (active pulmonary TB) and even to other tissues via the lymphatic system and the blood (miliary or extrapulmonary TB), which leads to the development of the disease and requires antibiotic therapy (Dannenberg Jr AM, Rook GA. 1994). Larger caceous lesions may grow locally and shed bacilli into the blood and lymph. The outcome of an infection in the new host depends on the balance between the host- pathogen interactions and dominated by the ability of the pathogen to prevent phagolysosome biogenesis (Vergne I et al. 2004) by modulating the phagosomal compartment and preventing its fusion with acidic lysosomal compartments and actively excluding vesicular proton ATP-ases, resulting in an elevated pH of 6.3–6.5 (compared to the normal lysosomal pH of 4.5). The granulomas uphold a balance between pathogen virulence factors and the host immune response. The failure ofimmune system at any stage later state could result in resurrection of bacterial multiplication and continuation of M.tb infectious cycle (Fig: 1.2).

Figure 1.2: TB pathogenesis: Tubercle bacilli are inhaled in aerosol droplets, enter into the lungs and when the host innate immune defence fails to eliminate the bacteria, M.tb starts multiplying inside the alveolar macrophages and then spread to other tissues and organs through the bloodstream and lymphatics. Once the cell mediated immune response kicks in, bacterial replication is usually controlled and in Maulana90-95% ofAzad cases non Library,-overt sign or symptoms Aligarh of disease Muslim ensues (Latent University TB). During latent infection a dynamic equilibrium between the bacilli and host immune responses is established and may event that weakens cell mediated immunity may lead to active bacterial replication, tissue damage and disease occur (active TB).

Bacteria inside the granulomas could survive for longer period and hence requires longer antibiotic treatment. In fact, most of the antibiotics could never reach to the

Chapter -1

deep interior of granuloma. In general, available antibiotics are directed towards different parts of replication machinery which are not targeted as effectively in dormant bacteria. Within granulomas the microenvironment could be characterized by nutrient starvation, hypoxia and exposure to reactive nitrogen intermediates (RNI) and reactive oxygen intermediates (ROI) (MacMicking JD et al.1997). These compounds are used by phagocytic cells to eliminate internalized bacteria, yet some pathogenic bacteria like S. Typhimurium and M.tb were found to avoid elimination, leading to long term durability and the establishment of persistent infection (Chan JO et al. 1995). The peptidoglycan layer was found to play an important role in the maintenance of bacterial dormancy and variation in specific cross-link during stationary phase adaptation of M.tb. There is strong evidence that M.tb metabolizes lipids as their major energy source for unremitting in the host. M.tb uses the host triacylglycerol [TAG] to accumulate lipid droplets intracellularly and with their help promote dormancy phenotype inside macrophage (Daniel J et al. 2011). Recently it was reported that, dormant bacteria may be exterminate with antibiotics generated with hydroxyl radicals, suggesting that stimulation of reactive oxygen species provide potential strategy to manage persistent infections (Grant S.S. et al. 2012).

The uncontrolled growth of M. Tuberculosis due to impaired immunity leads to the development of active infection. Human tuberculosis can either be pulmonary or extra pulmonary with majority of the cases being pulmonary (≥90) based on the site of infection. Pulmonary tuberculosis is caused by infection of lungs and may also spread to other organs. The symptoms include cough, breathlessness, fatigue, fever and unintentional weight loss. Extra pulmonary tuberculosis is a disseminated infection occurs after the primary infection due to the compromised immune status and nutritional deficiency of the individual. The granuloma caceates, ruptures and bacilli infects different parts of the body like lymphatic system through blood stream causing military tuberculosis and to the brain causing tubercular meningitis.

Maulana1.7 Virulence f actorAzad Library, Aligarh Muslim University M. tuberculosis lacks typical bacterial virulence factors such as pili, capsule, endotoxins and exotoxins etc. Various virulence factors of M.tb pertain to its ability to survive in macrophages by inhibiting phagolysosome fusion as well as the acidification of phagosome and make it more able to remain dormant in

Chapter -1

granulomatous lesions under anaerobic condition. The knowledge about various virulence factors responsible in establishment and dissemination of a pathogen are generally determined by exposure of different cell lines such as lung macrophage cell and animal models to a given M.tb strain. Various potent virulence factors involved in infectivity are described below.

1.7.1 Culture filtrate protein

1.7.1.1 ESAT -6 family proteins /CFP-10 Protein (Rv3875, Rv3874).The ESAT-6 and CF-10 proteins are members of the ESAT-6 family of related small secreted proteins secreted in the culture medium in which M.tb grown in vitro or in vivo. Both, ESAT-6 and CFP-10 protein are immunodominant antigens with strong target for human B-and T-cell responses, induced both high levels of IFN-g and recognized by the sera in a majority of TB patients CFP are extensively studied and it has been speculated that M.tb vaccine prepared from CFP-10 is far better than those made from heat killed wild type M.tb strain. Rv3874 and Rv3875 are located in the RD1 deletion region .this region is found in all virulent M.tb strain but is the only deletion found in all M.bovis BCG strain (Berthet FX et al. 1998).

1.7.1.2 HspX (Rv2031c, hspX). α-crystallin protein (Acr or Hsp16.3 encoded by the acr gene), is a major M.tb antigen which is undetectable during logarithmic growth of the tubercle bacilli, is strongly induced under hypoxic condition. It is hypothesised that the chaperone-like HspX is a substantial element, play important role in management of controlling M. tuberculosis latency or persistence, since overexpression of the protein inhibits M.tb growth (Yuan Y et al. 1998). Acr-1 is known to be expressed during human infection with virulent strains of M.tb and is highly recognised from the sera of pulmonary tuberculosis patient.

1.7.1.3 GlnAl (Rv2220, gInAl): The gene (gInA) encodes for glutamine synthetase or GlnAl, and its presence in culture filtrate is most probably result from cell leakage Maulanaand lysis. Azad M.tuberclosis Library, Glutamine synthaseAligarh plays aMuslim fundamental roleUniversity in nitrogen metabolism and involved in the synthesis of poly-L-glutame-glutamine that is a cell wall components found in pathogenic Mycobacteria. GlnA1 inhibitor i.e L- methionine-SR-sulfoximine (MSO) was found to inhibit the growth of M. tuberculosis in vitro as well as in guinea pig model (Tullius MV et al. 2003).

Chapter -1

1.7.2 Mycobacterial cell wall and cell surface components

1.7.2.1 Erp (3810.erp). Erp is a surface located exported protein with repetitive six tandem repeats of amino acid residues with the sequence (PA/G) LTS. This protein is similar to an exported 28-kDa antigen (the PLGTS antigen) in M.leprae and is not found in nonpathogenic Mycobacteria. The function of the Erp protein is unknown and the M.tb containing Erp mutant shows normal growth in vitro but mutant bacteria recovered from infected mice grow very slowly that the wild-type and complemented mutant strains (Delogu G et al. 2008).

1.7.2.2 FadD 26(Rv2930) and FadD28 (Rv2941). FadD26 was originally identified as an acyl coenzyme-A (acyl-CoA) synthetase that is involved in fatty acid degradation. FadD26 mutant grow approximately 2 log unit lesser in mouse lung than the wild type strain of M.tb. FadD28 is also annotated as acyl-co-A-synthetase. FadD26 disruption also affected the expression of the downstream ppsA to ppsE operon (Rv 2931 to 2935) encoding a polyketide synthase involved in phthioceroldimycocerates biosynthesis which is a virulence factor present in the outer layer of Mycobacterial cell wall (Onwueme KC et al. 2005).

1.7.2.3 Mas (Rv2940, mas). Mas is mycocerosoic acid synthase an enzyme that catlyzes the synthesis of long chain fatty multiply methylated branched fatty acid, called mycocerosoic acids that are found only in pathogenic Mycobacteria (Lee W et al. 2013). Virulence phenotypes of the mas mutant were not established but citation of unpublished experiments mentioned that it was attenuated for growth in macrophages and mice.

1.7.2.4 PcaA (Rv0470c, pcaA). PcaA is a methyltransferase that form cycloprane residue present in mycolic acids. It is a family of protein that introduces cyclopropane ring of the a-mycolate chain of mycolic acids (Smith CV et al 2004).

1.7.2.5 FbpA (Rv3804, FbpA). Mycobacteria have three mycolyltransferase Maulanaenzymes, encoded Azad by three Library, genes, fbpA, fbpB Aligarh, and fbpC, are Muslim encoded by Rv3804cUniversity (fbpA), Rv1886c (fbpB) and Rv0129c (fbpC), respectively. These are also known as Antigen 85 complex or the fibronectin-binding proteins that transfer long-chain mycolic acids to trehalose derivatives. These are immunodominant proteins and have been employed for constructing vaccines against tuberculosis. The live vaccine M.

Chapter -1

Bovis BCG secreting FbpB (Ag85B) conferred better protection than the parental BCG itself (Wiker HG, Harboe M. 1992 and Huygen K. 2014).

1.7.2.6 OmpA (Rv0899, OmpA). Omp is a porin like protein and can form pores in lipososmes. It is present in outer cell membrane of M.tb. ompA expression is induced at low pH and also during the growth in macrophages. It showed delayed growth in acidic condition and it is extremely interesting to know that environment faced by M.tb during infection is acidic and that OmpA plays a role in the bacterial response to this condition. OmpA mutants of M.tb H37Rv are attenuated for growth in both human and murine macrophages (Song H et al. 2008).

1.7.2.7 HbhA (Rv0475, hhhA). HbhA is an iron regulated heparin binding heamagglutinin protein, localised on the surface of M.tb. HbhA contains a possible N- terminal signal sequence and is absent in non-virulent Mycobacteria. The exact function of hbhA is still unknown, hbhA mutant displayed wild type ability for interaction with phagocytic cells to grow in murine or human macrophages and exhibited role in extrapulmonary dissemination (Parida SK et al. 2010).

1.7.2.8 Lipoarabinomannan or LAM. LAM is a major component of cell wall envelope and accounts for upto 5mg/g of dry weight of bacterial weight. LAM, is a complex glycolipid, consisting with repeating unit of arabinose mannose disaccharide subunits. There are three types of LAM; ManLAM which make complex with mannose capping at arabinan termini, LAM with phospho-myo-inositol capped (PILAM), and AraLAM that are deficient in mannosylation at its arabinanan termini. M.tuberculosis bind to the mannose receptors expressed at the surface of macrophages by recognising ManLAM, with the help of its mannose cap, followed by get inserted into membranes and induces all events of cell signalling in the host cell that are required for defense against M.tb infection. M.smegmatis that contains LAM with no mannose capping i.e. AraLAM fails to bind to the receptor. It is important as an immunomodulator and suppressing IFN-y production and inhibits host protein Maulanakinase C Azadand scavanges Library, oxygen radicals). Aligarh LAM protecting Muslim the M.tb by Universityescaping lethal mechanism of the respiratory burst and allow to down modulate host responses (Strohmeier GR, Fenton MJ. 1999).

1.7.2.9 Sulpholipid: The sulfolipids belong to acylatedtrehalose family of M.tb. There are five structurally related sulpholipids are identified. The acyl function of

Chapter -1

sulfatides may be either palmitate, stearate, phthioceranate or hydroxyphthioceranate. Among them, the sulphated glycolipid termed sulpholipid and evidence suggested that they inhibited phagosome activation by mediating host pathogen interaction during M.tb infection (Seeliger JC et al. 2012).

1.7.2.10 Mycolic acid: Mycolic acid is essentially owes to their role as key architectural element of the outer membrane of M.tb, with major and specific lipid components of the cell envelope. Mycolic acid covalently linked with arabinogalactan chain represents about half of the weight of the cell wall core. They play key roles in the permeability of the cell envelope, the ability of M.tb to form biofilm, and the pathogenicity of the bacterium during the course of persistence and replication stages of the infection. Mycolic acid, make complex hydrobhopic barrier in the cell wall of M.tb, which shields the mycobacteria and confer resistance to certain antibiotics. In association with multi drug resistance, mycolic acids also maintain resistance to the bacillus from oxygen radicals, cationic proteins and lysozyme in phagocytic vesicles inside the host cells and from complement deposition while present in blood (Liu J et al. 1996 and Brennan PJ. 2003).

1.7.2.11 Trehalose-6, 6’-dimycolate or TDM: Trehalose-6, 6’-dimycolate is a major glycolipd of Mycobacterial cell wall that exhibited an unusual toxicity and has been reported as a virulence factor for M.tb pathogenicity. TDM when dissolved in paraffin oil and injected in small doses (e.g. 10 µg) is highly toxic to animals but is rarely lethal in larger doses (e.g.50-100 µg). In particular formats, TDM acts as a potent adjuvant for stimulation of cell mediated immunity when administered with protein antigens. It also induces non-specific resistance to infectious agents and possesses antitumour and proangiogenic activities (Indrigo J et al.2003 andKarakousis et al. 2004).

1.8 Tuberculosis and the BCG

MaulanaBacillus Calmette Azad Guerin (BCG)Library, is the only Aligarh reliable, oldest Muslim and most commonly University administered vaccine available for the prevention of the disease. At the end of the 19th century Robert Koch discovered that M.tuberculosis was the causative agent of TB and attempted to develop a therapy, using sterile filtrates from in vitro cultures of M.tuberculosis but with failure. Later on, two French scientists Albert Calmette and Camille Guerin made an attenuated strain from M.bovis who passaged a strain of

Chapter -1

M.bovis 230 times in vitro from 1908 to 1921. The resulting vaccine was speculated with a balance between reduced virulence and conserved immunogenicity. Thereafter the vaccine was distributed to different laboratories worldwide where further repeated subculture of BCG led to the emergence of phenotypically different vaccine strains. When newborns and toddlers were immunised with this BCG vaccine, its appears to be effective at preventing disease but failed at pulmonary tuberculosis in adults (Andersen et al. 2005). To date, it is estimated that more than 3.5 billion people have been vaccinated with BCG vaccine worldwide. Recent data display that a large number of mutations have taken place in the course of long in vitro procreation of this strain. It is known that these mutations have resulted in the deletion of many open reading frames (ORFs; 16 deletions encoding 129 ORFs reported so far), encoding several important T-cell antigens such as the immunodominant molecules ESAT-6 (early secretory antigenic target of 6 kDa) and CFP-10 (Arend SM et al. 2000). BCG vaccine strains used in today, differ even further from the original BCG strain and from each other, with “stronger” strains (Pasteur 1173 P2, Danish 1331) being more reactive and, presumably, more immunogenic, than “weaker” strains (Glaxo 1077, Tokyo 172).

In addition, BCG vaccination may only provide protection against primary infection and its protective efficacy wanes in already infected individuals or in case of recurrent Tb or in case of latent TB (Colditz GA et al.1994 and Smith RM. 2004). Nevertheless, BCG has failed to control the increase of new TB cases worldwide. Deletion of ORFs causes, loss of prominent antigens, eventually resulted in loss of immunogenicity, and hence the prophylactic activity of BCG is also diminished. There is, therefore an urgent need to discover new TB vaccine candidates as an alternative or complement to BCG against tuberculosis (McShane H et al. 2012). Several controlled clinical trials of the BCG vaccine have yielded diverse and often contradictory results and lead to the conclusion that BCG protects against severe form of childhood TB, especially meningeal TB, its protective efficacy stands variable Maulanafrom (0 -80%)Azad against Library, pulmonary TB Aligarhin adults. Thus Muslimamongst the aspe Universitycts considered responsible for hampering efficacy of BCG vaccine against TB are nontuberculosis mycobacteria (NTM), co-infection with HIV and helminthes, emergence of drug resistant strains, massive migration etc. (WHO report 2008).

Chapter -1

BCG is a good candidate vaccine, but a number of host as well as environmental factors adversely affect its protective efficacy and compromises the ability of certain vaccinated individuals to mount an effective immune response against TB. The variability in BCG’s protective efficacy has been attributed to the methodological differences among the clinical trial, genetic variations within and amongst host population and virulence differences amongst M.tb strains. BCG efficacy varying depends on primary infection in children and endogenous resurrection of persistent infection versus exogenous reinfection, and effect of environmental non-tuberculous Mycobacteria on the host immune response to BCG. However, no single factor alone could hold responsible for the observed variability in protective efficacy of BCG.

Besides its interference with tuberculin skin test screening (TST), BCG's applicability is restricted due to its potential lack of safety in immuno-compromised individuals. Numerous cases of BCG vaccination induced tubercular infection have been reported in HIV+ and other immuno-compromised individuals (Mangtani P et al. 2013). This, along with the emergence of multi drug resistant (MDR) clinical isolates of M.tb, enforced the nation that current tuberculosis control practises like BCG vaccination and DOTS –directly observed therapy are not sufficient enough to control the worldwide maintenance of the disease (Young D, Dye C. 2006). This alarming situation clearly progress for the urgent need to step-up the development of more effective vaccination strategies aimed to protect against primary infection and reinfection progress attention of BCG induced long term immune memory (Gomes MG. et al.2004).

The plethora of promising new approaches and technical advancement have made during the last two decades. For instance the rapid screening technique enabling gene and antigen identification from annotated genome sequence of M.tb H37Rv and other clinical strains, expanded understanding of cellular immune mechanisms involve in either control of Mycobacterial diseases, development of novel class of adjuvants Maulanaand delivery systems Azad targeting Library, both innate and Aligarh T-cell immunity. Muslim However to Universityreach a point where these improved tools can provide good protection in the different animal models is a challenging task.

To realize these important task a number of significant international research effortsare under way for decades to develop new TB vaccine and as a result, over the

Chapter -1

last 10 years dozen of new TB vaccine candidates have been tested in mouse, guinea pig and non-human primate models, representing variety of concept including subunit protein/peptide vaccines with adjuvants (2005-15)

1.8.1 Recombinant live BCG vaccine

Although BCG vaccine is relatively stable, cheap and immunogenic, it has limited efficacy in generating long lasting protection against pulmonary tuberculosis. The efficacy of BCG vaccine can be enhanced by inserting or deleting a gene of interest by employing various biotechnological tools. Many such attempts have been made in recent past in this direction. Furthermore, being a live vaccine, BCG confers an ability to express inserted foreign antigen in its functional form. These advantages of the BCG have driven the development of various recombinant BCG (rBCG) vaccines. Most of the recombinants strains made are based upon BCG as the “vector”, and more than 25 such construct have been tested till date.

Among non BCG vectored constructs, one example is attenuated recombinant Salmonella thyphimurium strain secreting ESAT-6-HIy, a fusion protein containing haemolysin secretory system of E.coli (Mollenkopf et al. 2001). However, the vaccine this could only provide minor protection in mice models.

To further the advancement of recombinant BCG vaccines, immunological correlates of protection should be defined, but ideal immune phenotype that can fulfil the requirement of protection is still far from understanding. In mouse model, the most accepted memory phenotypes are TEM, CD44hi CD62Llo CCR7lo (effector memory T cells) and TCM CD44hi CD62Lhi CCR7hi (Central memory T cells). While, IFN-γ- secreting CD4+ T cells are one of the major targets of most TB vaccine studies. IFN- γ-secreting CD8+ T cells also have crucial role in protection against TB (Lalvani A. et al. 1998). The CD8+ cells have also suggested playing a significant role in controlling latent tuberculosis infection (LTBI) (Van Pinxteren LA et al.2000). Thus Maulanaan effective Azad BCG should Library, induce a balanced Aligarh M.tb antigen Muslim specific CD4+ University and CD8+ T cells response. It has further speculated that protection against TB infection vaccines with boosted memory T cells should have polyfunctional characteristics to secrete IFN-γ, tumour necrosis factor (TNF)-α and interleukin (IL)-2 cytokines (Giacomini E et al. 2001). Eventually, the aim of an experimental vaccine is to provide protection in human against the disease. To characterize vaccine induced human memory T cells

Chapter -1

combinations of biomarkers with defined effector (CD45RAhi, CD45ROneg, and CCR7neg,) and central memory includes (CD45RAhi/low, CD45ROneg, and CCR7pos) phenotypes have established. Similarly, a long lasting memory T cell population expressing CD127 (IL-7 receptor) have been suggested to be an important mediator of protection against M.tb infection (Kaech SM et al. 2004). The TB vaccine development programme is further hampered by a lack of an optimal animal model that truly resembles human TB disease and induced matching profile immune responses.

1.8.2 Different strategies used in rBCG development

Different strategies have been employed in order to achieve optimum vaccination strategy against M.tb and one of such attempts was to construct recombinant BCG-30. rBCG-30 is the first amongst recombinant BCG vaccines and conferred better protection in guinea pigs compared with the parental BCG vaccine. The recombinant BCG construct over expressing the secreted antigen Ag85B is also known as r-BCG- 30 (Horwitz, M.A et al. 2006). The phase 1 clinical trial of r-BCG30 has already been completed and it is concluded that although this recombinant vaccine showed enhanced immunogenicity compared to the BCG strain, it could not justify all the criteria of an ideal vaccine to develop further in its convert form.

Another such strategy is based on recombinant BCG producing autologous immunodominant protective antigens HSPs along with culture filtrate protein. Other strategies to create r-BCG focused on either the reintroduction of antigens that are immunodominant antigen of Mycobacteria crucial in vaccine development and may have been deleted during attenuation procedure of BCG. Ag85A (Rv3804c), Ag85B (Rv1886c) and Ag85C (Rv0129c) are important antigens from Ag85 complex that have been used to construct the recombinant BCG vaccines. These proteins have mycolyl-transferase activity that is necessary for the synthesis of Mycobacterial cell wall. rBCG-30 was engineered to overexpresses Ag85B which is most abundant Maulanasecretory protein Azad of M.tb isLibrary, capable to induced Aligarh potent Th1 Muslim immune response University had developed (Kaufmann SH et al. 2010).

In another strategy, the parental BCG has engineered to generate a potential CD8+ T cell response. This recombinant BCG construct namely rBCGΔureC:hlyC;, harbouring the secreted listerion which is a sulphahydryl- activated cytolysin from

Chapter -1

listeria monocytogenes , and is capable to generate pores in phagosomal membrane in an acidic environment and allow the entry of rBCG to the cytoplasm of the infected host cell (Hess J et al. 1998). The access of BCG to the host cytoplasm, allow the host cell to increase MHC class I presentation which subsequently results in enhanced CD8 T cell response. Moreover, as a result of entry of rBCG in the cytoplasm, which further generate Mycobacterial antigen loaded in vesicles called blebs, lead to the apoptotic of cells, which then internalised and processed by subsequent DCs that activate both CD4+T and CD8+ T cells by a mechanism referred as ‘cross priming’ (Farinacci M et al. 2012). In this recombinant BCG construct, the BCG urease gene, ureC was deleted. This would otherwise block acidification process of early phagosomes. The recombinant rBCGΔureC:hlyC was also found to be more capable to induce better protective efficacy than the parentral BCG starin and was safer in immunocompromised SCID mice.

Another recombinant BCG vaccine (rBCG-Aeras 403) that escape endosome using perfringolysin (pfo) gene of C. perfringens pH-independent manner with overexpression of few immunodominant antigens such as Ag85A, Ag85B and TB10.4 have been constructed and tested. This vaccine showed greater protection than BCG with enhanced protection and safety of the endosome-escape construct (Sun R et al. 2009). This vaccine have entered clinical trials for further evaluation

Recently one more strategy has been used for r-BCG construction that’s a construction of pro-apoptotic vaccine by deletion of some specific genes such as nlaA (Rv3238c) that inhibit apoptosis of infected host cells. This construct of rBCG vaccine promote caspase-dependent apoptosis of host cells leads to the cross priming resulting in impaired CD8+ T cell response. Caspase-mediated apoptosis is very well characterized for the induction of powerful cellular immunity and this construct might have been benefitted from the caspase dependent pro-apototic entity (Skeiky YA, Sadoff JC. 2006).

Maulana Azad Library, Aligarh Muslim University

Chapter -1

Table 1.1: Summary of new generation tuberculosis vaccine development:

Vaccine Description Reference

Subunit Vaccines

Hybrid-1 Recombinant fusion protein of Ag85B and Van Dissel JT et (Ag85B–ESAT6) ESAT-6 in IC31 adjuvant al. 2011

M.tb72F Fusion protein of M.tb39 and M.tb32 in Tsenova L et al. AS02A and AS01B adjuvants 2006

HyVac-4 Recombinant fusion protein Ag85B– Dietrich J et al. 2013 (Ag85B-TB10.4) TB10.4 in IC31 adjuvant

ID93+GLA-SE Four-antigen M.tb protein Rv2608, Orr MT et al. Rv3619, Rv3620 and Rv1813 in a 2014 glucopyranosyl lipid adjuvant-stable emulsion GLA-SE (TLR4 agonist)

DNA vaccines and viral vectored vaccines

Hsp65(GroEL) Antigen from Mycobacterium leprae for dos Santos SA et DNA immunotherapy al. 2010

MVA85A Attenuated strain of vaccinia virus Goonetilleke NP expressing Ag85A et al. 2003

AdAg85A Replication deficient adenovirus vectored de Val BP et al. expressing Ag85A 2012

Crucell d35/Aeras Non-replicating adenovirus vectored Ad35 Radošević K et 402 (Ad35.TB-S) expressing multiple TB proteins including al. 2007 Ag85A, Ag85B and TB10.4

Mycobacterial whole cell/extract vaccines

RUTI Fragmented detoxified M.tb encapsulated Vilaplana C et al. in liposomes 2010

DAR 901 Heat-inactivated Mycobacterium obuense ClinicalTrials.gov Maulana Azad Library,strain of AligarhM.tb Muslimidentifier: University NCT0206355

M. Vaccae Whole Heat-killed Mycobacterium vaccae Rodríguez-Güell E et al. 2008

Chapter -1

Recombinant BCG

rBCG30 Overexpression of Ag85B Hoft DF et al. 2008

rBCG-Ag85A Overexpression of Ag85A Sugawara I et al. 2009

rBCG-85C Overexpression of Ag85C Jain R et al. 2008

rBCG:X Expresses HspX protein Jain R et al. 2010

rBCG:PhspX-85B Expresses Ag85B under control of Kong CU et al. promoter HspX 2011

rBCG-AE Expresses fusion protein Ag85A-ESAT-6 Deng YH et al. 2014

rBCG-Aeras 403 Endosome escape activity with Rahman S et al. overexpression of Ag85A, Ag85B, TB10.4 2012

rBCGΔureC:hlyC Endosome escape activity Desel C et al. (VPM 1002) 2011

BCG:RDI Reintroduction of RD1 gene regions Pym AS et al. 2003

rBCG-E6 Reintroduction of ESAT-6 Dey B et al. 2009

rBCG:Ag8 Co-expresses Ag85B, ESAT-6 and Rv2608 Lu Y et al. 2012 ESAT-6-Rv2608

rBCG-AMM Expresses Ag85B-MPT64-M.tb 8.4 Qie YQ et al. 2009

Pro-apoptotic Deletion nlaA gene that inhibit apoptosis Chattergoon MA BCG et al. 2000

1.8.3 Boosting BCG with subunit antigens MaulanaReintroduction Azad of theLibrary, genes that were Aligarh deleted during Muslim the attenuation University procedure of BCG is also one of the important strategies of rBCG development. Virulence region RD1 is absent in all sub-strains of BCG, but present in virulent M.tb. This strategy used the collection of T cell antigen epitopes whose gene locus was lost during the attenuation or evaluation of BCG. These gene regions include RD1 locus which

Chapter -1

encodes imunodominant proteins M.tb72F CFP-10 (Rv3874), ESAT-6, INV (Rv1474) and MPT64 (Pym AS et al. 2003).The fusion protein construct Mtb72F was identified as protective in mice, and prolonged survival of guinea pigs to an extent similar to that of BCG [about 1 year].When used in a prime/boost strategy BCG and M.tb72F gave outstanding results, with survival rate doubled to over 2 years [Brandt et al. 2004]. In the surviving animals the bacterial load was log 2 dilution, and histological examination showed lesser lesions to be few, small, and dominated by mononuclear cells with no necrosis, as compared to control (Reed SG et al. 2009).

1.8.4 Subunit vaccine

Subunit vaccine are the most widely used version of tuberculosis vaccine in development and are being prepared as recombinant protein purified from bacterial expression vector or as a DNA vaccine consisting of recombinant plasmid harbouring M.tuberculosis antigen under the eukaryotic promoters control. Many research groups have reported that key protective antigen is secreted in the early stages of M.tb infection. This comes from the agreement that live bacteria could induce some factor or antigen that could induce a significant immune response whereas killed mycobacteria failed to do so. Once Mycobacteria are phagocytosed by the macrophages, inside the phagosomes, Mycobacteria secrete a number of proteins to high over host cell response and these proteins are the first antigens to be presented to the immune system in the initial phase of infection. Since, these are the first antigens, perceived by the host; immune response towards these proteins might be associated with protection strategy. Therefore, the early secretory protein or short term culture filtrate protein of M.tb make up the major source of protective antigen that can be selected to design non–viable sub-unit vaccine against tuberculosis. The culture supernatant filtrate of M.tb contains as many as 200 proteins (Schubert OT et al.2013). Also the protein that are present in M.tb and absent in M.bovis BCG (129 ORFs are absent in BCG, (Behr et al. 1999) and protein generate in M.tuberculosis Maulanaduring infection Azadare potential Library, target of sub-uni Aligarht vaccine. Till Muslimdate, more than University40 subunit vaccines have been tested against tuberculosis (Andersen P. 2007). Few among these most promising protein antigen are either recombinant proteins made by fusion of two or more Mycobacterial antigen, for example; [hybrid-1(from Statens Serum Institute, Copenhagen, Denmark] containing Ag-85B and ESAT-6 and M.tb-72f (GlaxosmithKline, Brussels, Belgium) i.e. consist of fusion of [Rv1196 and Rv0125

Chapter -1

protein domain] are some protein identified by their potential to activate and proliferate human T cells (Barker LF et al. 2009). Some other protein such as Ag85A (Rv3804c, fibronectin binding protein), Ag85B (Rv1886c, mycolyltransferase), CFP- 10(Rv3874), TB10.4Rv0288, functionunknown), MPT51(Rv3803c-alpha/ betahydr olase),hspX (Rv2031c, Chaperonin), Mtb32A (Rv2376, serine protease), CFP6 (Rv 3004, function unknown) and several others as identified (Andersen P, Doherty TM. 2005;Ganguly N et al. 2008; Skjot et al. 2002; Agrewala JN et al. 1998; Skeiky et al. 1999; Miki et al. 2004 and Bhaskar et al. 2000).

Since Hsp-X (16-kDa) is antimmunodominant protein secreted at the latent stage of M. tuberculosis infection, the protein are widely studied as a component of sub-unit vaccine or as individual proteins or as fusion protein with different adjuvants. Purified Hsp-16 kDa has been recognized in recall of immune response to mice (Dubaniewicz A et al. 2013). Also in humans Hsp-16 kDa, is recognized by IFN-y secreting and cytotoxic T cells in association with frequently expressed HLA class II molecules. Hsp-16-kDa also play instrumental role in maintaining dormant stage of M.tb. Immunization of mice with Hsp-16-kDa enapsulated in liposomised microspheres, gave a strong Acr-1specific T cell response and it was observed that the recall response conferred by acr-1 protein was comparable to purified protein derivative (PPD) and CFP-10. A successful candidate TB vaccine was made using single protein subunit. The administration of acr-1 in liposomised adjuvant form conferred protection similar to BCG against pulmonary tuberculosis. However, protection conferred by Acr-1 can be enhanced by addition of any other protective antigen or any adjuvant such as cationic lipid CAF 01. Moreover, Acr-1, when administered as liposomised antigen, significantly induces long term memory response and reduces the bacterial load in animal models (Siddiqui KF et al. 2015)

The lacuna for recombinant protein subunit vaccine development against M.tb is the requirement of adjuvants approved for use in general human population, which Maulanashould beAzad capable Library, to generate sufficient Aligarh T-cell response. Muslim Consequently University adjuvant discovery is just as important as antigen selection with respect to recombinant protein subunit vaccine development. In this regard, DNA based vaccines provide the benefits of endogenous antigen production within antigen presenting cells after vaccination, thus causing the efficient processing of M.tb antigen for stimulation of both CD4+ and CD8+ T cells. Recombinant DNA vaccine of the early secreted

Chapter -1

antigen ESAT -6 by M.tuberculosis and Flt3 ligand enhanced the cell-mediated immunity in mice by presenting a strong T helper-1 (Thl)-biased response, accompanied by higher levels of lymphocytes proliferation, elevated production of Th-l cytokines (IFN-y and IL-2) by spleen cells, as well as increased specific antibody in sera, together with lower levels of Th-2 cytokines (IL- 4 and IL-l0) (Pym AS et al. 2003). Thereafter, despite their sufficiently immunogenic behaviour of DNA vaccines in animal models by DNA vaccines, they have failed to translate impressive results in clinical evaluation. Overall, the protein subunit vaccines can boost immense T cell response against key antigens and have the advantage of increased safety even in immunosuppresed individuals (Hoft DF et al. 2008).

1.8.5 DNA vaccines

The journey with DNA based vaccination commenced in 1992, when Tang et al. propelled DNA coated gold microprojectiles into the skin of mice and showed that the animal could induce an immune response. This was the first report of genetic immunization that came into light. Two years later, in 1994, Lowrie et al proposed the DNA vaccine in mice with plasmid DNA containing the gene hsp65 from M.leprae strain. The immunised mice exhibited significant protection against M.tuberculosis infection via activation of cell mediated immune response. This DNA based strategy of vaccination opens a new window for vaccine development against tuberculosis infection employing DNA. The DNA vaccine against tuberculosis could enhance potential Th1 response which was required for protection against tuberculosis infection (Gurunathan S et al. 2000). The vaccine possesses an adjuvant effect, because they contain non-methylated CpG sequences which are TLR-9 agonist an, inducer of the interlukin IL-12 production. The immunization protocol enhanced in antigen presentation and promotes acquisition of Th-1 cells (Krug A et al. 2001). Mostly the secretory antigen or culture filtrates protein of M.tb has been tested to design DNA vaccines. Later on DNA vaccine with unique feature to confer protective Maulanaefficacy against AzadM.tb was found Library, to have a s ignificantAligarh therapeutic Muslim effects (Lowrie University DB et al.1999). Upon infection with M.tb, a predominant Th-2 response is developed in mice, which is not required for protection. However DNA vaccination, even in heavily M.tb burdened mice can switch the immune response in cell proliferating and provide protection against M.tb. Hsp-65-DNA vaccine have cleared the resident bacterial burden from mice when given after chemotherapy. Plasmid DNA containing

Chapter -1

the gene hsp70 from M.leprae was also successful in decreasing the bacterial load in mice infected with M.tb. However, in some of the cases, DNA vaccines containing Ag85 antigen or Hsp65gene of M.tb promote a severe pulmonary necrosis in susceptible mouse strain i.e those having a latent infection or previously exposed to M.tb infection (Taylor JL et al. 2003). As a result of immunization with DNA vaccine expressing ESAT-6 in guinea pigs induced high IL-10 and IFN-γ production, which is indicative of a mixed Th-1/Th-2 response (Khera et al. 2005). DNA vaccine expressing CFP-10 produced a similar immune response in mice (Ha SJ.et al.2005).It can be inferred that, DNA vaccine expressing CFP-10 or ESAT-6 is not suitable for prophylactic or therapeutic purposes against TB. The prophylactic efficiency of these DNA vaccines was found to be more successful in combination with other antigen coding sequences such as Ag85B. Taken together, these observations confer that DNA based vaccines could not provide better protective efficacy than BCG (Li Z et al. 2006), and the major disadvantage with them is their poor efficacy.

1.8.6 Attenuated Mycobacteria in tuberculosis vaccine development

Table 1.1 summarize development of new tuberculosis vaccines. Many of these vaccine candidates are based on on-going attenuated strain of Mycobacteria. Recombinant BCG strains overexpressing key M.tb antigens, immunodominant protein or immunoenhancer, may offer prophylactic effect better than standard BCG through various mechanisms. For instance: by allowing escape of the recombinant BCG from the phagolysosome compartment, an improved capacity to stimulate CD8+ CTL through cross presentation can be achieved (Skinner MA et al.1997). Similarly, auxotrophic M.tb mutant that expresses entire antigenic repertoire of virulent M.tb including many antigens that are deleted from the BCG can impart impressive protection. Unfortunately, such M.tb mutants fail to persist in vivo due to the deletion of vital metabolic enzymes, that might serve as potential vaccine against TB (Jackson et al.1999)

MaulanaThe use Azadof auxotrophic Library, M.tb mutant asAligarh vaccine candidates Muslim could induce University much better immunity than BCG because of their potential to induce diverse response against a more complete set of antigens expressed by such virulent but attenuated mycobacterial strain. However, if these mutant strains, somehow evoked under attenuation could result in vaccine associated tuberculosis, and if, over attenuated,

Chapter -1

they might not show strong immunogenic response as BCG. Recombinant M.vaccae MPT64 induced high level of both cellular and humoral mediated response in mice and could be used as a new vaccine candidature against TB (Andersen P et al. 2000).

Use of killed atypical mycobacteria (e.g. M.vaccae) to enhance immune response that are cross reactive with M.tb antigen represents better strategy for whole cell based protective vaccine. Killed atypical Mycobacteria perhaps may provide better safety features as compared to attenuated mycobacterial vaccines, and are being designed for use in HIV-infected individuals at high risk of TB and BCG associated infectious complications (Waddell et al. 2000). However, it remain elusive that whether these atypical mycobacterial vaccines might offer least immunopotential capacity of attenuated mycobacterial vaccines, probably due to their incapability to induce immune response against a complete set of unique M.tb antigens, and may remain deficient in inducing an important and desirable asset of immune system (e.g.CD8+Tcell responses) which, typically generate only when antigens are synthesised within the cytoplasm of the antigen presenting cells, which normally is least possible in case of such atypical killed vaccines (Hoft et al. 2008).

1.8.7 Replication deficient vector based vaccine

Mycobacterial antigen employed for protein and DNA subunit vaccine target utilised a number of recombinant replication deficient vector vaccine. Modified adenovirus, vaccinia Ankara and other virus and bacterial vectors based vaccines are at various stages of development for expression of the secreted M.tuberculosis antigen Ag-85A and Ag85B. Recombinant modified vaccine Ankara expressing Ag85A (MVA85A) had been tested in phase 1 clinical trial and implicated in the induction of potent CD4+T cell responses, especially in individuals already immunised with BCG (McShane et al. 2004). The major advantage of live recombinant vector vaccine is to enhance the immune response of its key antigens. Additionally live vector also possesses potent adjuvant effects; can deliver vaccine antigens through mucosal tissue Maulanaas well, to location Azad distant fromLibrary, the vaccination Aligarh site, can effect Muslim endogenous synthesis University of vaccine antigens in the cytoplasm of antigen presenting cells and thereby, process through classical MHC-I pathway of antigen presentation to generate appropriate CD4+ and CD8+ T-cell stimulation. However, live recombinant vector sometime pose problem due to potential reactogenecity and the fact that pre-existing immunity

Chapter -1

induced by natural exposure to organism expressing cross reactive antigen with vector components could block or suppress effective immunization.

Since existing vaccination strategies are largely failed in achieving the goal of effective control of this debilitating disease, concerted attempts for improving control measures and intense research endeavour into basic virulence mechanisms and host – pathogen interactions are solely needed. In this regard, many attempts particularly into the identification of mycobacterial molecules involved in host immune response modulation such as surface proteins and actively secreted proteins in active pulmonary disease and in latency phase of M.tb have been made. Several other studies suggest that these molecules play crucial role in immune system activation target during the initial onset of infection, and thus represent valuable candidates for being included in the development of new therapeutic treatment regimens against TB.

The sensitive proteomic analysis of cell wall of M.tb has provided valuable information about cell envelope components and firm evidence supporting the existing hypothetical protein prediction by the genome sequences, showing no similarity with known protein in other organisms. These proteins could represent useful targets in development of highly specific immune-diagnostic tool and new vaccine preparations. This information provides necessary impetus to search for novel targets or characterize the existing protein with unknown function situated in the cell envelope of Mycobacteria to their functional applicability and immunological potential in the physiology and pathogenesis of Mycobacteria.

1.9 Host Response to Mycobacterium tuberculosis

The entry route of the tubercle bacilli into the body is via the respiratory tract through the inhalation of respiratory droplet aerosol generated from active pulmonary TB cough sneeze, spit or expelling infectious aerosol droplet, small enough in size (1- 2µm) or less, to allow passage into the lower respiratory tract (Fiegel J et al.2006). MaulanaLarger size Azad droplets Library,are efficiently excluded Aligarh from to reachMuslim the lower respiratoryUniversity tract by the physical barriers of the nasopharynx and upper respiratory tract. The respiratory bronchial epithelium is remarkably resistant to infection by M. tuberculosis (Li Y et al. 2012). It also produces antimicrobial peptides with a wide spectrum of activity Bacilli may infect alveolar epithelial cells or can be taken up by alveolar macrophages (Schnappinger D et al.2003).

Chapter -1

The bacilli infecting alveolar cells, it may as well represents an end of its infectious cycle, as the epithelial cells have no mechanism for transcytosis and the glycoprotein that seals the spaces between stratified epithelial cells obstruct the bacterial cells. However, virulent M.tuberculosis strains which are cytotoxic to the infected cells may destroy the epithelial cells and gain access to the submucosa, lymphatic and circulatory system (Russell DG et al. 2010).Whether this mode of entry occurs frequently enough to be of importance is unknown. Infection of A549 epithelial cells with M.tb strain H37Rv has been shown to induce the release of IL-8 and MCP-1 along with other chemokines (Olszewska-Pazdrak B et al.1998)and these cytokines (mainly MCP-1) play a role in efficient translocation of M.tb across the alveolar wall by creating a gradient between the alveolar side and the endothelial side, resulting in progression of monocyte migration. IL-8 secreted by the epithelial cells might play role in the influx of neutrophils commonly observed during initiation phase of lung infection (Gerritsma JS et al.1996). Alveolar macrophages have been shown to play a cardinal role in the destruction of particles that enter the organism through the airways; and are generally considered the first cell population to counteract with the tubercle bacillus. More number of macrophages is recruited from the bloodstream to the site of infection and is required for containing the infection in the host (Schnappinger D et al. 2003). Infection of mononuclear phagocytes with M.tuberculosis stimulates the release of TNF-α, which boost expression of membrane receptors that promote monocyte migration on the surface of alveolar epithelial and endothelial cells (Van Crevel R et al. 2002).

The host response to M.tuberculosis infection is a complex phenomenon. The principal host defense to Mycobacterial infection is the formation of granulomas, where M.tb successfully hides itself employing its unique ability to modulate host immune response. After successfully withstanding the immune cells onslaught. M.tb takes shelter in macrophages and survives efficiently for the long period (Russell DG et al. 2009). Once established the M.tb either causes active tuberculosis or may opt Maulanafor dormancy, dependingAzad onLibrary, the extent of Aligarh immune assent Muslim and surveillance University. The immune system protects most of latently infected individuals from recurrence of the disease, whilst the 5-10% of individuals is incapable to diminish the M.tb replication and growth and develop active TB. The granuloma represents the formation of an

Chapter -1

isolated microenvironment, in which activated macrophages and lymphocytes strive to eliminate the bacterial egress (Co DO et al.2004).

The innate immune system constitute essential first line weapon against infections and set stage for subsequent adaptive immune response (Hoebe K et al. 2005). During the early phase of the Mycobacterium infection innate immunity come into play before adaptive immunity gets activated and considered to be an important arm of immune system. Though, adaptive immunity possesses very high antigenic specificity through T and B cells involvement. In contrast, innate immunity uphold specific interaction through pattern recognition receptors (PRRs) by engaging with conserved molecular signatures that are expressed amongst large variety of pathogenic microbes and known as “pathogen-associated molecular patterns” (PAMPs) (Kawai T, Akira S. 2011). PRRs, such as toll-like receptors (TLRs), NOD-like receptors (NLRs), C-type lectin receptors (CLRs), mannose receptor and dendritic cell (DC)-specific intercellular adhesion molecule-3-grabbing non-integrin (DC-SIGN) are constitutively expressed on APCs that guide proper activation of innate immunity (Kleinnijenhuis J et al. 2011). Incidentally, these gateway molecules are important for activation of adaptive immunity as well. Recently, strategies employed to model innate immunity and inflammatory mediators using TLRs, NLRs, CLRs, Dectins and DC-SIGN have gained more ample attention. The surface molecules play a cardinal role not only in activation of innate immune cells to counter microorganisms or related microbial products; they also play active role in activation of signal transduction pathway that culminates into potent transcriptional responses necessary for stimulating immunity and elimination of pathogen. Activated innate immunity subsequently lead to provoke better adaptive immunity. Accumulating evidences indicate that many PRRs agonist are commercially available and can be exploited to study PRR–mediated activation of the immune system against microbial infection (Medzhitov R. 2007). In this regard it may be utmost important to exploit the PRRs agonist to target PRRs as immuno-adjuvant and translate into successful strategy to Maulanacontrol M.tbAzad and to minimizeLibrary, chances Aligarhof developing drug Muslim resistance. University

1.10 Role of innate immune cells in pathogen clearance

The immune system is considered as a meshwork comprising of both innate and adaptive cells. The innate immune system is made of many cells, such as those white

Chapter -1

blood cells that are not B lymphocytes or T lymphocytes of the adaptive immune system. The immune cells such as, dendritic cells (DCs), macrophages, neutrophils, eosinophil, mast cells, and the so-called NK cells harbour germ line encoded recognition receptor surface molecule. Such cell population gets activated during an inflammatory response, which is basically a sign of infection with a pathogenic microbe (Sternberg EM. 2006). Macrophages and neutrophils are specialised phagocytes, which play imperative role in offering first line of defence against pathogen including intracellular bacteria such as M.tb. At the same time these phagocytes are also primary targets to be abused during infection with M.tb. The efficacy of these cells population to contain eradicates intracellular M.tb, altogether depend on degree of establishment of pathogen in the host. Phagocytes may act as important effector cells during latent or chronic infection, for example, macrophages have evolved a myriad of defence mechanism to combat M.tb infection. The cells play a pivotal role in various events that involved in phagocytosis and killing of mycobacteria as well as establishment of adaptive T cell (Russell DG et al. 2010). Both monocyte and macrophages significantly contribute in the elimination of M.tb by employing a variety of PRRs to recognize Mycobacterium specific PAMPs, such as scavenger receptors, mannose receptor etc. Phagocytosis, a hallmark of the host defence directly engaged with the activation of many PRRs (Areschoug T et al 2008).

1.11 M.tb uptake and survival inside macrophages: phagocytosis mechanism

M.tb has a potential to reach more than one organ of the host, however lungs remain to be the primary site of infection. The bacteria enter through the nasal cavity and reaches to the alveoli of lung via respiratory tract. Macrophage cells are efficient for restricting in growth of the bacillus through phagocytosis, and participating in a broader context of cellular immunity through the process of antigen presentation and recruitment of T lymphocytes (Cooper AM. 2009). Macrophages cells are equipped with different mechanism of internalization. Phagocytosis is a defined form of Maulanaendocytosis in whichAzad relatively Library, large particulate Aligarh material, including Muslim microorganisms, University are internalized into large (1-5µm) vesicles. Processes involved in phagocytosis include, ingestion by cells of large (≥0.5 μm) particles and involves the recognition and binding of the bacterium by receptor on the host cell surface and finally growth inhibition or killing (Flannagan et al 2009). As a general phenomenon, phagocytosis usually begins with the phagocytic cell engulfing the invading microbes in a

Chapter -1

membrane-bound tight vacuole, which is created when pseudopods surrounds the bacterium and fuse distally (Asrat S et al. 2014).

In vitro studies have implicated that initial interaction of the bacilli with the macrophages takes place through complement receptor (CR3) as a major receptor expressed on macrophages during phagocytic intake of M.tb. Nonetheless, several other macrophage surface receptors, such as CR1, CR4, Mannose receptor, CD14, and scavenger receptors also play role in recognition and binding of the M.tb to macrophages, in vitro. Pulmonary surfactant protein (Sp-A) too plays an important role in enhancement of M.tb uptake by human macrophages. A role for CD14 has been demonstrated for attachment of Mycobacteria to microglia, which are the resident phagocytic cells in the brain, and this ligand may be important for binding of M.tb to alveolar macrophages as well Mycobacteria can be taken up by host macrophages after opsonisation with complement factor C3, which is followed by binding and uptake through complement receptors CR1, CR3, and CR4 (Bowdish DM et al.2009). For opsonisation with C3, the split product C3b needs to be generated by activation of the complement system. M. tuberculosis also utilizes part of the classical pathway. Virulent and relatively avirulent strains of Mycobacteria have different binding mechanism to complement components (Hirsch CS et al.1994). It has been demonstrated that blocking complement receptors with monoclonal antibodies inhibit phagocytosis of M.tuberculosis strain H37Ra (an avirulent strain) and the Erdman and H37Rv strains (virulent strains), but down-regulation of mannose receptors (MR) is associated with decreased binding of only the virulent strains. The interaction between mannose receptors on phagocytic cells and mycobacteria seems to be mediated through the mycobacterial surface glycoprotein lipoarabinomannan (LAM), which is present on the cell wall of Mycobacteria, including virulent strains of M. tuberculosis, and is capped by a mannose residue β-glucan and Fc receptor do not impart major importance in mediating binding of M.tuberculosis to mononuclear phagocytes or to alveolar phagocytic macrophages (Hoving JC et al.2014). Maulana Azad Library, Aligarh Muslim University Inside the human respiratory tract, neutrophils are the first cells to encounter M.tb during establishment of the infection. In general, neutrophils present in the mucosal lining ingest M.tb via neutrophil extracellular trap [NET](Warren E et al. 2017).The interaction of invading bacteria various immune cells induces secretion of pro- inflammatory cytokine, chemokine, free radicals small lipid mediators (SLM) as well

Chapter -1

as antimicrobial peptides etc. As a result, other components of respiratory mucosa, such as resident epithelial cells, connective tissues, and monocyte derived macrophages and DCs get activated and eventually migrate toward the site of infection. Epithelial cells of the mucosal lining through involvement of PRRs may interact with PAMPs of M.tb. This eventually leads to general inflammation along with generation of a myriad of pro-inflammatory cytokine such as tumour necrosis-α (TNF- α), granzymes, IL-6, IL-12, IL-18 or IL-23 etc until the elimination of the pathogen or anti -inflammatory regulatory mechanism kicks in (Etna MP et al. 2014).

In spite of providing shelter to the M.tb, macrophages use multiple strategies to combat this pathogen. NK cells are the direct killers of the M.tb infected macrophages, produce major anti-inflammatory cytokines such as IFN-γ which are necessary for the activation of macrophages and DCs. Furthermore, γδ T cells may act as antigen-presenting cells (APCs) to activate CD4+T cells, cross-present antigen to CD8+ T cells. They also produce IL-17 and IFN-γ in the lungs (Torrado E, Cooper AM 2010). Primary route of M.tb infection involves lungs via oral and nasal cavity. Post access to host lung alveoli, M.tb successfully evades destruction of innate immune response barriers of the upper respiratory tract employing defensive microbicidal machinery. The nasal immunity offers a primary checkpoint in controlling M.tb. In addition, other allied immune cells like NK cells, neutrophils get activated and communicate with each other in order to combat the bacteria. Correspondingly, APCs, such as DCs and macrophages, link the innate and adaptive immunity.

Growing body of evidences suggest that M.tb expresses a large repertoire of PAMPs and their agonist such as, tri-acylatedlipopeptidezymosan, CpG ODNs DNA, LPS, MDP (muramyl dipeptide), trehalose-6,6 dimycolate (TDM), lipoarabinomannan, TDB, curdlan, and N-glycolyl MDP etc. Successful engagement of PAMPs by PRRs can promote and augment expression of co-stimulatory expression, MHC and Maulanaadhesion molecules. Azad The specific Library, PAMP-PRRs Aligarh interaction canMuslim also stimulate University many mediator, chemokine, cytokine, and free radical in the host. In addition, PRRs may promote production of reactive nitrogen as well as reactive oxygen intermediates and enhance apoptosis, autophagy and inflammasome formation in the host (Thi EP et al. 2012). It is tempting to speculate that activation of various immunomodulator

Chapter -1

mediated stimulation of host bactericidal machinery can be an excellent approach in treatment of TB.

1.12 Pattern recognition receptors and innate immune response against M.tb

1.12.1 Toll like receptors

The innate immune system involves variety of pattern recognition receptors, expressed on the cell surface, in intracellular compartments, or secreted into the tissue fluids and bloodstream. The pattern recognition receptors play important role in opsonisation, phagocytosis, activation of complement and coagulation cascades, activation of proinflammatory signalling pathways, and induction of apoptosis, thereby offering diverse targets for therapeutics (Kabelitz D et al.2007).They are one of the components of the immune system to first encounter pathogens. There are 10- 12 TLR family members identified in human and mice, each with distinct ligand and functional relevance. TLR were first being described in the fruit fly, are the best characterised group of innate immune receptor in terms of their known ligand or PRRs, downstream signalling pathways and functional relevance. Recognition of microorganisms exploiting PRRs is linked to a cascade mechanism that promotes inflammation, lead to activation of innate immune responses and priming of adaptive immunity (Medzhitov R. 2007).

PAMPs recognized by different TLRs protein result in expression of variety of chemically diversified bacterial products; that include lipoprotein, lipid, protein and nucleic acid derived from a wide range of microbes such as bacteria, fungi, and parasite. The TLRs involved in the identification of nucleic acids (TLR3, TLR7, TLR8 and TLR9) are confined within endolysosomal compartments, whereas other TLR family members (TLR1, TLR2, TLR4, TLR5 and TLR6) are localised at the cell surface. LPS is predominantly recognised by TLR-4, whereas LAM peptidoglycan and bacterial lipoprotein are recognised by TLR-1, TLR-2 and TLR-6, TLR-3 double- Maulanastranded Azad (ds) RNA Library, ; TLR-4- LPS ;Aligarh TLR- 5 flagellin Muslim, TLR-7 and UniversityTLR-8 single- stranded (ss) RNA; TLR-9 senses CpG ODNs DNA.

The TLRs are classified as type I integral membrane glycoprotein, structurally same to that of interleukin-1 receptors (IL-1Rs).The two set of TLR receptor have a considerable homology: the extracellular domain contains leucine-rich repeat (LRR)

Chapter -1

motifs, whereas the extracellular region of IL-1Rs contains three immunoglobulin- like domains. Toll also has an essential role in the recognition of wide array of extracellular or intracellular PAMPs. There are two major signalling pathways involved in TLRs regulation; one is TIR-domain-containing adapter-inducing interferon-beta (TRIF)-dependent and the other is myeloid differentiation primary response gene 88 (MyD88)-dependent. The casual role of different TLRs in conjugation with immunodominant M.tb proteins has been successfully elucidated against pulmonary tuberculosis infection (Kawai T, Akira S.2011).

1.12.2 Nod like receptor (NLR)

Recently, another family of PRRs known as Nucleotide-binding and oligomerization domain (NOD)-like receptors (NLRs) are pattern-recognition receptors similar to toll- like receptors (TLRs) has gained considerable attention. There are 23 NLR family members reported in human and at least 34 NLR genes in mice. NLRs are expressed in many cell types including epithelial cells and immune cells, although some members of NLR expressed primarily in phagocytes including neutrophils and macrophages (Fritz JH et al.2006). Their basic structure includes a central NACHT domain and a C-terminal leucine-rich repeat region. While TLRs are trans membrane receptors, NLRs are a specialised group of intracellular proteins, have a cytoplasmic receptor that play a crucial role in the regulation of the host innate immune response by recognising pathogen-associated molecular patterns (PAMPs) and damage- associated molecular patterns (DAMPs). NLRs subfamily composed of the nucleotide-binding oligomerization domain (NOD) proteins NOD1 and NOD2, the founding members of the intracellular NOD-like receptor family have a variable caspase activation and recruitment domain (CARD), a centrally located NOD that is critical for activation that assemble signalling platforms that trigger nuclear factor-κB and mitogen-activated protein kinase signalling pathways and control the activation of inflammatory caspases in response to distinct peptidoglycan (Shaw MH et al. Maulana2008).The activated Azad NLRs showLibrary, various functions Aligarh that can be Muslim divided into four University broad categories: inflammasome formation, transcription activation, signalling transduction and autophagy. The signalling activation in response to NLR, promotes the production of pro-inflammatory cytokines (IL-6, TNF, IL-8, and IL-1β) chemokine’s, nitric oxide and antimicrobial peptides (β-defensin-2).This cascade mechanism lead to the increased expression of co-stimulatory and adhesion molecule on phagocytic

Chapter -1

cells, by activating NF-κB and MAPKs signalling pathways. In order to recognize PAMPs and DAMPs, NLRs act as a key regulator of early development and apoptosis. Interestingly, adjuvant therapy using the ligand of NOD-2/ TLR-4 as anti TB regimen against M.tb have been established in M.tb infected mice model (Yamamoto M etal.2003).

1.12.3 C- Type lectins receptors (CLRs)

Distinct pathogens display different PAMPs, and the combination of these PAMPs functions as a fingerprint that promote a unique set of PRRs, leading to the inauguration of signalling pathways to tailor the immune response to that specific pathogen. Recent studies have identified CLRs as an important family of PRRs that are intricate in the induction either by modulating TLR signalling or by directly inducing gene expression. C-type lectins (CLRs) comprise a large superfamily of proteins, which recognise a diverse range of ligands, and are defined by the presence of at least one C-type lectin-like domain (CTLD). In ver-tebrates, CLR family is classified into 17 subclasses. CLRs are a family of PRRs involved in the identification of polysaccharide structures of pathogens. CLRs are expressed on various myeloid cells like monocytes, Macrophages, DCs and NK cells that are directly engaged in the recognition of various pathogens including M.tb (Cummings RD et al. 2009). These CLRs can be divided into two groups according to their structural similarities and functional differences. These lectins are of major importance in mediating cell adhesion and migration, and the mannose receptor subfamily is specialised in the binding and uptake of pathogens. Group I CLRs belong to the soluble form such as mannose–binding lectin (MBL), while the group II CLRs belong to the transmembrane proteins such as DC-associated C-type lectins (DC-SIGN), can function both as an adhesion receptor and as a phagocytic pathogen- recognition receptor. Mycobacterial stimulation through MR leads to production of the anti-inflammatory cytokines IL-4 and IL-13, inhibition of IL-12 production, and Maulanafailure toAzad activate oxidativeLibrary, responses. Aligarh Some report Muslim proposed tha tUniversity certain CLRs recognised, early complement components, viz; targeted apoptotic cells, oxidised lipid and protein and support safe clearance of cellular debris, by opsonisation with the help of MBL targets apoptotic cell to DCs. This process facilitates phagocytosis and possibly by immunomodulatory mechanism, thus preventing autoimmunity (Figdor CG et al. 2002). CLRs share at least one carbohydrate recognition domain

Chapter -1

(CRD), contain conserved residue motifs and determines the carbohydrate specificity of the CLR but do not always bind carbohydrate structure. CLRs were introduced to distinguish between Ca2+‑ dependent and Ca2+‑ independent carbohydrate‑ binding lectins. It has been reported that CLRs expressing the unique amino acid motif EPN (Glu-Pro-Asn) in the CRD, specific for the mannose based ligand ,whereas CLRs express QPD (Gln-Pro-Asp) have unique specificity for recognising galactose moiety (Lee YC et al.1995).

1.12.4 Dectins

Dectins (Dectin-1 and Dectin-2) represent the paradigm of non TLR family, glycosylated type II transmembrane receptor. Dectins encompasses single extracellular C-type lectin-like domain (CTLD) and a cytoplasmic immunoreceptor tyrosine-based activation (ITAM)-like motif. In both humans and mice, Dectin is a pathogen recognition CLRs is predominantly expressed on myeloid cells (monocytes/macrophage, dendritic cells and neutrophils) and certain subset of T cells (Brown GD et al. 2006). Dectin-1 is a predominant PRR involved in antifungal immunity and is recognises β-1-3-linked glucans, carbohydrates found in the cell walls of plants and fungi and in some bacteria, and is the major receptor on myeloid cells for these molecules (Brown GD et al. 2003). Dectin-1 also recognises ligand(s) on Mycobacteria, and possibly some endogenous molecules. Therefore, signalling through dectins has been suggested to play an important role in host immunity against various infectious diseases. Dectin-1 and TLR4 were reported to be involved in the M.tb induced IL-17A production and IL-17A response strongly relies on the endogenous IL-1 pathway and IL-1R signalling (Van de Veerdonk FL et al. 2010). Although the physiological role of selective dectin-1 binding by the receptor agonist Alpha–glucan of M.tb was sufficient to enable DCs to generate Th1/Th17 response, and further support the uptake of M.tb. Dectin-1 impart important role in the innate response to mycobacteria. M.tb infected dectin -/- mice showed the decreased level of MaulanaIL-12p40 production Azad in splenicLibrary, dendritic Aligarh cells (SpDC) Muslim following exposure University to live M.tb bacilli (Rothfuchs AG et al. 2007).

MINCLE ligand identified a component of small ribonucleoprotein SAP130, mainly released from dead cells. By contrast, the carbohydrate recognition domain of DC- SIGN recognizes virulent factor of Mycobacterial cell wall envelope components,

Chapter -1

such as mannosides (PIMs) lipomannans TDM and Mannose capped Lipoarbimannan (Man-LAM) for recognition of CLR and infected host cells (Yamasaki S et al. 2008).

1.13 Cytokines as immunomodulator

Cytokines are a large group of low molecular weight glycoprotein produced by various cells of the immune system and communicate with one another by releasing and communicating to chemical messenger. Cytokines impart a cardinal role in modulation of immune response. Various cells types, in addition to immune cells, produces different cytokines and expresses receptor for cytokines: maintain a fine balance of homeostasis and communication network between the cells of the immune system. In efforts to compensate for defective host response, immunity can be inflected by an array of cytokines secretion IL-1β, IL-2, IL-4, IL-6, IL-10, IL-12, IL- 17, IFN-β, IFN-γ, TNF-α, and TGF-β, etc (Trinchieri G et al. 1998).

Recently, modulation of immune responses by the use of recombinant cytokines or cytokine antagonist is opens the new window for evolving sussecfull strategy against anti-bacterial immunity. Currently one report showed that synthetic form of IFN-α2b antagonist ‘infergen’ showed a potent immunomodulatory activity against M.tb, by inducing the activation of macrophages activation, induction of autophagy and controlling the growth of M.tb (Pahari S et al. 2017). Recently it has been established, that co-administration of cytokines IL-7 and IL-15 substantially augmented the efficacy of BCG to protect against TB infection by eliciting enduring desired memory T cells and polyfunctional characteristics to secrete IFN-γ, tumour necrosis factor (TNF)-α and interleukin (IL)-2 cytokines concomitantly (Singh V et al. 2010). Similarly, cytokines IL-1, IL-6 and TNF–α reinforce BCG potency by enduring protective long lasting T cell response (O'Donnell MA et al. 1994). Thus, administration of recombinant cytokines along with recombinant BCG was quite interesting to generate a recombinant BCG specific memory response as IL-7 and IL- 15 are known to support maintenance of long term immune memory. This Maulanaexperimental Azad recombinant Library, BCG vaccine Aligarh improves theMuslim BCG efficacy University in protection against not only childhood but also the adult manifestation of TB.

Chapter -1

1.14 Microbial products as immunomodulator against M.tb

In 1885, Louis Pasteur proposed that microbes have immunogenic property. A large body of data has since been accumulated that microbial product include several molecule can be sensed by PRRs of the host to attentive the cells of the immune cells (Bérdy J et al. 2005). Activation of macrophages and DCs in response to bacterial PAMPs releases numerous chemokine and cytokines. By that way, these factors are involved to shield the host by preventing and clearing of microbial infections. Glycolipid trehalosedimycolate (TDM) components of outer cell wall of M.tb empower with adjuvant property and can bind to NOD-2 of host cells and boost their function. Dolicholmonophosphomannose (DPM) is an ever-present donor of mannose (Man) in various eukaryotic glycosylation processes. Intriguingly, the related polyprenolmonophosphomannose (PPM) is involved in the biosynthesis of lipomannan and lipoarabinomanan, key bacterial factors found in Mycobacteria (Ishikawa E et al. 2017). The identification of the PPM synthase as a key enzyme in lipoarabinomannan biosynthesis now provides an attractive candidate also exploited as a target for specific inhibitors of M. tuberculosis. Furthermore, monophosphoryl lipid-A, (MPLA) immunostimulatant, derived from liposaccharides of Gram- negative bacteria cell wall is an agonist of TLR-4, is being considered to possess adjuvant property and heightened immune response to co-administered heterologous antigen, making it an integral part of some vaccine and immunotherapeutics (Mata- Haro V et al. 2007). The unmethylated CpG-ODN of M.tb recognized by TLR-9 and administration switch on Th1 cells immunity with a number of different antigens (Weeratna RD et al. 2005). Other mycobacterial component like lipoprotein also possesses virulence. M.tb binds to lipoglycans, such as lipoarabinomannan (LAM), that mediate M.tb immune evasion. The Mycobacterial lipoprotein act as a potent adjuvant by remitting danger signal via TLR1/2, resulted in the secretion of IL-1, IL- 6, TNF-α and NO secretion by monocytes and macrophages, which ultimately enhances the immunity M.tb (Vergne I et al. 2015). Maulana Azad Library, Aligarh Muslim University 1.15 Delivery system

Tuberculosis one of the courses of death worldwide with multidrug resistance is expected to increase the death rate and renders TB treatment more complex. The central problem in the tuberculosis treatment is the long term exposure to

Chapter -1

antitubercular drugs resulting in development of drug resistance and non-reversible lung tissue damage. Invariably, the side effects impose long term dose therapy, treatment delay or discontinuance of therapy. A striking development in TB treatment leads to design new drug delivery system over conventional drug regimen, and an increasing number of targeted drugs and subunit vaccines by using antibacterial agent have entered the clinical arena to treat tuberculosis (Gagneux S et al. 2006).

Thus there is an urgent need of an attractive strategy to enhance the therapeutic index of drugs or microbial product, specifically to deliver these agents to the defined target cells without disturbing healthy cells, which are sensitive to the toxic effects of the drug. Currently, there are different kinds of drug delivery system that either ha sevolved from the basic knowledge of key pathways involved in M.tb pathogenesis or alternatively they target specific pathogenic hallmark of M.tb.

Owing to the intracellular lifestyle of M.tb, the need for control release of drugs necessitates construction of efficient delivery system for targeted delivery of therapeutic agents. The strategy may also overcome the problem of drug resistance. To overcome these issues, nanotechnology, could of immense help owing to new, beneficial properties of nanomaterials to medicine. The field of nanomedicines deals with the development of nanoparticle as therapeutic carriers with the understanding of materials having at least one of its dimensions in nanosize range (1-100nm). These nanoparticles exhibited properties significantly different from those of compositional atoms and molecule as well as corresponding raw bulk materials. Thus nanotechnology, have not only been widely used as a valuable tool for delivering functional drugs or therapeutics agent, but they also have demonstrated great potential to cater the need of therapeutics delivery of drug /or biological agent to diseases caused by pathogenic bacteria (Moghimi SM et al. 2005). One of the most important issues to overcome before full clinical application is the development of effective administration methods for nanoparticle to the target tissue or cells in vivo, which is Maulanahighly dependent Azad on Library, the delivery system. Aligarh In addition toMuslim achieve these Universitygoals, delivery system must be safe, it should target particular cells of the immune system with specificity and should be stable and affordable. Nevertheless, the progress in development of formulations that fulfil all of these criteria is a time consuming and expensive task.

Chapter -1

Over the last several decades, vaccine development has shifted away from conventional method using attenuated or inactivated whole pathogens in favour of recombinant subunit antigens. This shift is partly due to safety concern over potentially harmful pathogen and partly due to an robust immunity toward non – pathogenic self or self like antigen such as microbial product or antigen or overexpressed protein implicated in diseases. Subunit antigens are rapidly degraded by proteases and not able to requisite secondary immune stimulus, i.e. co-stimulation and/or danger signals, required for the generation of antigen-specific immunity (McGhee JR et al. 1992). As a result, a great deal of nano drug or antigen carriers are passively targeted to host cells through the enhanced permeability and retention effect, so they are ideally suited for the delivery of anti-tubercular drug vaccine in M.tb treatment. Indeed, advances in nanomedicine have rapidly translated into clinical practice. To date, there are five clinically approved nanoparticle chemotherapeutics for tuberculosis treatment and many more under clinical investigation. A number of novel implant-, nanoparticle, micro particulate-, and various other carrier systems, combinations of liposomes and cationic polymer complexes, have exhibited improved in vivo stability, target specificity, and cell/tissue uptake and internalization of the encapsulated principal anti-tubercular drug or antibacterial agent have been fabricated, which result in more effective with less cellular toxicity and immune stimulation. Here, we will discuss the latest advancements in nanoparticle-mediated delivery systems, including nano-materials, preparation, and characteristics. (Fig: 1.3) illustrate different delivery systems currently used to deliver various drugs and antigens against M.tb in various studies.

1.15.1 Nanomedicine: From concept to clinic

1.15.1.1 Lipid based nanoparticles

Lipid nanoparticles are generally spherical in shape with a diameter ranging from 10 to 100nm. It consists of a solid core made of lipid and a matrix containing soluble Maulanalipophilic molecules. Azad The Library, external core ofAligarh these nanoparticles Muslim is stabilized University by surfactants and emulsifiers. These nanoparticles have application in the biomedical field as a drug carrier and delivery and RNA release in cancer therapy.

Liposomes, sphere-shaped vesicles consisting of one or more phospholipid bilayers, were first described in the mid-60s, suggested as attractive drug delivery system,

Chapter -1

especially used for pulmonary target. Since then, liposomes have moved from a model in biophysical research to one of the first NP platforms to be applied for gene and drug delivery. These are bilamellar or unilamellarin structure, ranges in size from a nanomemeter to micrometer. They are prepared using lung surfactants, phospholipids, cholesterol, etc. forming a phospholipids bilayer and are biocompatible, biodegradable and non-immunogenic. Liposomes have generated a great deal of interest because of their unique versatility and possess sustained release properties, which enable the maximum drug effect over a prolonged time period. To enhance their circulation half-life and stability in vivo, liposomes have been conjugated with biocompatible polymers such as polyethylene glycol (PEG). Liposomes can also be functionalized with targeting ligands to increase the accumulation of diagnostic and therapeutic agents within desired cells (Lian T, Ho RJ. 2001).

Enhanced safety and efficacy have been achieved for a wide range of drug classes, including antiviral, antimicrobials, vaccines, antitumor agents and gene therapeutics etc. In the 1990s, the first liposomal product was introduced, which was purified bovine surfactant (Alveofact®) for acute respiratory distress syndrome (ARDS) in infants by pulmonary instillation. Later, amphotericin B-loaded liposomes were introduced (Ambisome®), yet not for pulmonary, but for parenteral application. Inhaled liposomes are still a challenge. Today, there are twelve clinically approved liposome-based therapeutic drugs. Liposomes offer ample opportunities for maintaining the critical physical properties of therapeutic agent or drug. Currently, two liposomal products in the last stage of clinical development are dry powder liposomes, Arikace® (amikacin,Insmed, Monmouth Junction, NJ, USA) and Pulmaquin™ (ciprofloxacin, Aradigm Corp., Hayward, CA,USA), for the treatment of lung infections (Clancy JP et al. 2013 and Cipolla D. 2013). Another major application of liposomes is their use as therapeutic carriers since their design can allow for entrapment of hydrophilic compounds within the core and hydrophobic Maulanadrugs in theAzad lipid bilayer Library, itself. Aligarh Muslim University

Chapter -1

Figure 1.3: Schematic presentation of various drug/ antigen delivery systems (A) Polymeric nanoparticles (B) polymeric micelles (C) Dendrimers (D) Liposomes (E) Viral based Nanoparticles (F) carbon nanotubes

1.15.1.2 Carbon-based nanoparticles

Carbon-based nanoparticles include two main materials: carbon nanotubes (CNTs) and fullerenes. CNTs are nothing but graphene sheets rolled into a tube. These materials are mainly used for the structural reinforcement as they are 100 times stronger than steel.

CNTs can be classified into single-walled carbon nanotubes (SWCNTs) and multi- walled carbon nanotubes (MWCNTs). CNTs are unique in a way as they are thermally conductive along the length and non-conductive across the tube (Compton OC, Nguyen ST. 2010).

Fullerenes are the allotropes of carbon having a structure of hollow cage of sixty or more carbon atoms. The structure of C-60 is called Buckminsterfullerene, and looks like a hollow football. The carbon units in these structures have a pentagonal and Maulanahexagonal arra ngement.Azad These Library, have commercial Aligarh applications Muslim due to their electricalUniversity conductivity, structure, high strength, and electron affinity (Rao CN. 1995).

Chapter -1

1.15.1.3 Ceramic nanoparticles

Ceramic nanoparticles are inorganic solids made up of oxides, carbides, carbonates and phosphates. These nanoparticles are stable and show high heat resistance as well as chemical inertness. They may find application in photocatalysis, photodegradation of dyes, drug delivery, and imaging etc. By controlling some of their characteristic features like size, surface area, porosity, surface to volume ratio, etc, ceramic nanoparticle perform as a good drug delivery agent. The ceramic nanoparticles have been used effectively as a drug delivery system for a number of diseases including bacterial infections, glaucoma, cancer, etc. (Roy I et al. 2003).

1.15.1.4 Metal nanoparticles

Metal nanoparticles are prepared from metal precursors. These nanoparticles can be synthesized by chemical, electrochemical, or photochemical methods. In chemical methods, the metal nanoparticles are obtained by reducing the metal-ion precursors in solution by chemical reducing agents. These have the ability to adsorb small molecules and have high surface energy. These nanoparticles have applications in biological research areas, such as detection and imaging of biomolecules and in environmental and bioanalytical applications. For example gold nanoparticles are used to coat the sample before analyzing in SEM. This is usually done to enhance the electronic stream, which helps us to get high quality SEM images (Sun X, Li Y. 2004).

1.15.1.5 Semiconductor nanoparticles

Semiconductor nanoparticles have properties like those of metals and non-metals. They are found in the periodic table in groups II-VI, III-V or IV-VI. These particles have wide bandgaps, which on tuning shows different properties. They are used in photocatalysis, electronics devices, photo-optics and water splitting applications.Some examples of semiconductor nanoparticles are GaN, GaP, InP, MaulanaInAs from Azad group III Library,-V, ZnO, ZnS, CdS, Aligarh CdSe, CdTe Muslim are II-VI semiconductors University and silicon and germanium are from group IV (Schmid G.2005).

Chapter -1

1.15.1.6 Quantum dots, nanometric multifunctional inorganic fluorophores used in imaging, detection and targeting, are luminescent semiconductor crystals. They are made of elements from groups II–VI or III–V, being their structure generally based on cadmium sulfide (CdS) and cadmium selenide (CdSe) that can be highly toxic. As advantages, comparing to traditional fluorophores (organic dyes and fluorescent proteins), quantum dots present a broad absorption range and narrow emission spectra. In fact, they have tunable size emission with different wavelengths over a broad range of the light spectrum. Additionally, quantum dots present high photostability, being remarkably resistant to photobleaching. The use of quantum dots is based on their unique chemical and physical properties, achieved due to their size and highly compact structure.

1.15.1.7 Polymeric nanoparticles

Polymeric nanoparticles are organic based nanoparticles. Depending upon the method of preparation, these have structures shaped like nanocapsular or nanospheres. A nanosphere particle has a matrix-like structure whereas the nanocapsular particle has core-shell morphology. In the former, the active compounds and the polymer are uniformly dispersed whereas in the latter the active compounds are confined and surrounded by a polymer shell (Soppimath KS et al. 2001). Some of the merits of polymeric nanoparticles are controlled release, protection of drug molecules, ability to combine therapy and imaging, specific targeting and many more. They have applications in drug delivery and diagnostics. The drug deliveries with polymeric nanoparticles are highly biodegradable and biocompatible.

1.15.1.8 Dendrimers

They are nanosized polymers built from branched units. The surface of a dendrimer has numerous chain ends, which can be tailored to perform specific chemical functions. This property could also be useful for catalysis. Also, because three- Maulanadimensional dendrimers Azad contain Library, interior cavities Aligarh into which otherMuslim molecules couldUniversity be placed, they may be useful for drug delivery (Liu M, Fréchet JM. 1999).

1.15.1.9 Chitosan is an interesting polymer that is basically either partially or fully deacetylated chitin. As chitin occurs naturally and is a fully biodegradable and biocompatible natural polymer, and can be used as an adhesive and as an antibacterial

Chapter -1

and antifungal agent.Chitosan nanoparticle have the advantage of nano size range, which is highly tunable (1–100 nm), enabling them to evade the immune system. The chemical properties of chitosan, such as chemical inertness, low toxicity to human cells and high selectivity and the biodegradability interact easily with the biological system make it worthy for its use in drug delivery systems. Chitosan has been investigated extensively as a potential drug carrier, due to it's biocompatible properties. The degree of deacetylation and the molecular weight of chitosan can be modified in order to obtain different physico-mechanical properties. The elemental composition of the chitosan polymer is carbon (44.11%), hydrogen (6.84%) and nitrogen (7.97%). The viscosity average molecular weight of chitosan is ~5.3x105 Daltons.The biocompatibility and non-toxicity of the material makes it attractive as a neutral agent for delivery of active agents.Chitosan acts a penetration enhancer by opening the tight junctions of the epithelium. Chitosan facilitates both paracellular and transcellular transport of drugs. Chitosan interacts with mucus (negatively charged) to form a complex by ionic or hydrogen bonding as well as though hydrophobic interactions. Because of the cationic properties of chitosan, ion complexes can be formed by electrostatic interaction between chitosan and anionic drugs or therapeutics agent. There are several mechanisms which govern therapeutic agent release from chitosan nanoparticles such as: swelling of the polymer, diffusion of the adsorbed protein or therapeutic material, drug diffusion through the polymeric matrix, polymer erosion or degradation and a combination of both erosion and degradation. The initial burst release from the chitosan nanoparticles is either because of swelling of the polymer, creating pores, or diffusion of the drug or protein from the surface of the polymer. This type of release leads to a clear sustained-release effect. Because of varied degradation rate and time of chitosan of different molecular weight and degree of deacetylation degree, different types of nanoparticles can be used to regulate drug-release rate. Meanwhile, chitosan can also be modified to achieve the sustained/controlled release. Chitosan nanoparticles also exhibit a pH-dependent drug Maulanarelease becauseAzad of the Library, solubility of ch Aligarhitosan. Chitosan Muslim derivatives alter University the release of drug from the NP, affording tunable drug release and impacting the pharmacokinetic profile of the loaded drug (Agnihotri SA et al. 2004).

Chitosan nanoparticles can be functionalized with the any coating material with suitable surface moieties, any specific ligand or any antibacterial agent in order to

Chapter -1

reduce cytotoxicity and increased their bioavailability and targeted drug or antigen delivery system to phagocytic cells or APCs. CNP can be stabilized in the presence of biologically important compounds such as protein, DNA, DNA bases, RNA and drug conjugate (Dash M et al. 2011). Thus, interaction of chitosan nanoparticles with Mycobacterial protein, nucleic acids, or antibacterial agent is important in the clinical field because of its imminent effects on the synthesis, replication, and structural integrity of therapeutic delivery system. The unique binding properties of CNPs with other molecule make them particularly attractive tools for targeted detection of pathogenic bacteria and therapy. These properties make them use for targeted delivery of therapeutic agent to the host immune cells. Polymeric nanoparticles like chitosan coated nanoparticles have been of recent great interest in the context of its diverse applications. Besides, the currently acceptable delivery system includes liposomes, dendrosomes, metallic nanoparticles, exosomes etc. chitosan and its conjugated nanoparticles has been by far the most common delivery system used in clinical trials. Chitosan conjugated nanoparticles containing M.tb Ag 85A, has also been reported to be well tolerated among mice and guinea pig model and has shown to enhance antibody production to antigens and immune response against M.tb and influenza virus (Amidi M et al. 2007).

The work incorporated in the thesis is based on the synthesis, characterization of

chitosan and its conjugated nanoparticle with M.tb protein Acr-1 and 4-SO4-GalNAc ligand targeted delivery system against M.smegmatis infected host macrophages and its correlation with application of these nanoparticles as antibacterial, anti-biofilm and anti-inflammatory role in activation of host immune response.(Fig: 1.4 illustrate chitosan based ligand conjugated delivery system with Acr-1 antigens against M.smegmatis in our study).

Maulana Azad Library, Aligarh Muslim University

Chapter -1

Figure 1.4: Schematic representation of proposed mechanism of ligand conjugated chitosan nanoparticle as vaccine candidate.

53 Maulana Azad Library, Aligarh Muslim University

Chapter-2 MATERIALS AND METHODS

Maulana Azad Library, Aligarh Muslim University Chapter -2

2. Material and Method 2.1 Biochemical and Antibodies

The expression vector pET23 d and pET16 used for cloning of alpha crystallin Acr-1 (HSP 16.3) gene obtained from Novagen (Darmstadt, Germany). The pQE was purchased from Qiagen (Germany). Oligonucleotides (primers) were designed using Gene Runner software and were purchased used in gene isolation method were from Sigma-Genosys (Bangalore, Karanataka, India). Gene amplification from M.tuberculosis H37Rv genomic DNA was performed using high fidelity PCR enzymes (Restriction enzymes, T4 DNA ligase, Calf Intestinal Phosphatase (CIP), Pfu DNA polymerase and other modifying enzymes), their buffers, dNTPs were purchased from New England Biolabs Inc, (Beverly, MA, USA and Fermentas (Genetix, New Delhi, India), Plasmid Miniprep kit, Maxiprep kit, and the Gel extraction kit used for plasmid preparations and DNA purification processes, respectively, were obtained from Qiagen (Genetix, New Delhi, India). The cloning kit was from Promega (Madison, USA). DNA sequencing kit ABI PRISM 3130 XL with dye termination cycle sequencing ready reaction kit was obtained from Perkin Elmer, (Norwalk, CT, USA).

7H9 broth, 7H-11 Media and Agar powder used for preparation and cultivation of bacteria were procured from Hi-Media, India. The protease inhibitors phenylmethylsulfonyl fluoride (PMSF), 4-(2-aminoethyl)-benzenesulfonyl fluoride (AEBSF) and protease inhibitor cocktail (containing AEBSF, pepstatin A, E-64, bestatin, and phosphoramidon) and IPTG were from Sigma (New Delhi, India). Nickel-nitrilotriacetic Acid (Ni-NTA) Superflow metal-affinity chromatography matrix was obtained from Qiagen (Genetix, New Delhi, India). Amicon concentrator (MWCO 10kDa) ultrafiltration membrane used for concentrating purified proteins was from Millipore Pvt. Ltd. (Bangalore, India). DMEM, RPMI-1640 and FBS were obtained from Gibco BRL (USA). Endotoxin removal kit was purchased from MaulanaThermo -FisherAzad scientific Library,. Rests of theAligarh chemical rea Muslimgents unless listed University here were obtained from Sigma and SRL (Mumbai, Maharashtra, India).

Chapter -2

Table 2.1: Summary of Strains, plasmids and primer used in cloning of Acr-1

Strains Source

DH5-α New England BioLabs Inc.

BL-21 DE3 Novagen Inc.

Rv2031c (acr,hspX) F: GTCCGGCATGATCAACCTCC R: GGTGGCCATTTGATGCCTCC

2.2 Expression vector pET23 (d): The pET vectors were originally constructed by Studier and colleagues (Studier and Moffatt. 1986; Rosenberg et al.1987 and Studier et al.1990). The newer pET derivatives were developed at Novagen Inc., U.S.A. with enhanced features to permit easier subcloning, detection and purification of the target proteins.

2.3 The cloning/expression vector, pET23 (d), falls in the translation vectors category of the pET vectors. The translation vectors contain the highly efficient ribosome binding site from the phage T7 major capsid protein. All these vectors have a reading frame relative to the BamHI cloning site. The letter (d) in the vector’s name indicates that this vector/s express from the ATC triplet of the GGATCC BamHI recognition sequence and have NcoI cloning site for insertion of target genes directly into the ATG start codon. Its selection marker is ampicillin, and the transcriptional promoter is that of phage T7 RNA polymerase. The map of the vector pET23 (d) is provided in (Fig: 2.1).

2.4 Cloning of Acr-1 (Rv2031c) gene from M. tuberculosis H37Rv in E. coli expression vectors

2.4.1 Preparation of genomic DNA of M. tuberculosis H37Rv

Genomic DNA of M.tuberculosis H37Rv was prepared by the method described by

Maulanasomewhere (Wilson Azad K. 2001 Library,). Briefly, a volume Aligarh of 500 µlMuslim of M.tb H37Rv University (pre- cultured harvested cell) was taken in 1.5 ml micro centrifuge tube, washed twice with at 8000xg for 15 min. The resulting cell pellet was suspended in 250 µl of T.E buffer, followed by addition of 25µl of 500µl of T.E buffer and suspended in 200µl of T.E buffer. The bacilli were heat killed at 80oC for 1 h on a dry bath with 1mg/ml of

Chapter -2

lysozyme and 2µl (1mg/ml) of RNase to the suspension and were centrifuged. The mixture was incubated for 2h at 37oC. After incubation, 60 µl of 10% SDS and 1µl of 20mg/ml proteinase K were added to the mixture suspension and it was further incubated for 1h. After incubation, the cell debris was removed by pelleted down by centrifugation at 1000X g for 30 min at room temperature. The clear supernatant was taken carefully and transferred in a fresh eppendorf tube and was extracted first with equal volume of phenol (50% v/v) /chloroform (49% v/v)/ iso-amyl alcohol (1% v/v) and then with equal volume of chloroform (98% v/v)/ iso-amyl alcohol (2% v/v). Finally, the DNA comes in the aqueous phase was precipitated with 0.7 volume of isopropanol, followed by washing with 70% ethanol and suspended in 100 µl of TE buffer-2 (10 mM Tris.Cl, 1mM EDTA, pH 8.0). The concentration of DNA was estimated on nanodrop instrument.

2.4.2 Isolation and amplification of the gene

Genes encoding Acr-1 (16-kDa or HSPX) were amplified by PCR using gene specific primers having NcoI and XhoI as restriction sites. Genomic DNA of M.tb H37Rv was used as template. The primer used for amplification of the desired Acr-1 gene by polymerase chain reaction (PCR) from the genomic DNA of M.tuberculosis H37Rv is given in the Table-2.1. In a typical 50 µl PCR reaction, 10 ng of M.tuberculosis H37Rv genomic DNA; 5 µl (25pmols) of each Forward and Reverse primer: 200 µl of dNTPs were used for proper reaction mixture. The reactions were carried out in Ix- PCR buffer and Ix-Q-buffer (Qiagen, Hilden, Germany) along with distilled water. The PCR reactions were carried out with Mini Cycler (Global Medical Instrumentation, Inc) (Marchesi JR et al. 1998). Each PCR reaction was set for an initial denaturation step of 3 min at 95°C which facilitated melting of the genomic DNA, followed by 25 cycles of denaturation at 94°C for 1 min, primer annealing at 65°C for 1 min, and primer extension at 72°C for 1 min. Each PCR reaction was terminated with a final extension step of 72°C for 20 min followed by cooling down Maulanato 4°C. TheAzad amplified Library, product was checked Aligarh for the size Muslim of the fragment University was verified by running the PCR amplified product on a 1.5% agarose gel in 1x TAE (40 mM Tris- acetate, 1 mM EDTA) buffer and comparing their sizes with DNA marker. The amplified PCR products were extracted from the agarose gel by using Qiagen Gel extraction kit.

Chapter -2

2.4.3 Restriction digestion and ligation of the genes in expression vectors

2µg of desired amplified PCR product of Acr-1 (Rv2031c) was digested with Nco I and XhoI in 1x-NE Buffer-2 for 2 h at 37°C in a water bath (according to user’s manual). Similarly 2-µg of pET23(d) vector was digested and deposphosphorylated in Ix NE Buffer-2 for 2 h at 37°C in a water bath. The reaction was continued for 10 h after addition. The restriction endonucleases (Nco I and Xho I) digested products were run on 1.5% agarose gel and purified using the Gel extraction kit. 200 ng of digested Acr-1 and pET23 (d) were used to set a 15µl ligation reaction in Ix T4 DNA ligase buffer and 200U of T4 DNA ligase from NEB on ice. The reaction was mixed properly and incubated at 16°C for 12-16 h. Plasmid pET23 (d) with insert Acr-1 (16 kDa) is shown in Fig 2.1. This cloning strategy added an additional 6x-His-tag at N terminal (Mamiatis T et al. 1982). This hybrid vector possessing the insert was then transformed into chemically competent E. coli DH5α.

Maulana Azad Library, Aligarh Muslim University

Figure 2.1: (A) Circular and linear map of pET2(d). Ampicillin resistant (AmpR), Origin of replication (Ori), T7 promotor (T7 pro), multiple cloning site (MCS) and T7 terminator (T7 ter). (B) Circular and linear map of pET2 (d) with Acr-1 (16 kDa) insert cloned at NcoI and XhoI restriction site.

Chapter -2

The amplified PCR products of Acr-1 were initially cloned into pET23 (d) by following user's manual. The clones containing the genes in right orientation were selected by digesting pET23(d) hybrid vector containing clones with restriction sites Nco I and Xho I .The correct clones were subsequently digested with Nco I and Xho I and run on 1.5% agarose gel to separate Nco I and Xho I digested Acr-1 and were purified using the Gel extraction kit. The purified digested products were ligated with Nco I and Xho I digested pET 23(d) vector.

2.4.4 Confirmation of the clones

The recombinant products were transformed into E. coli Dh5a cells, and screened on LB plates supplemented with ampicillin (100µg/mL). Transformed E. coli Dh5a colonies resistant to ampicillin were observed in the form of white colonies on LB X- gal IPTG plates (IPTG 0.25 mM, X-gal 20 mg/ml) after overnight incubation. The positive clones were selected for plasmid minipreps and subsequent double digestion by restriction enzyme Nco I and Xho I and analysing the digested product on 1% agarose gel. Following digestion many clones showed DNA insert of correct size (16) in 1% agarose gel electrophoresis. These clones were subsequently verified by sequencing. The desired clone containing the insert plasmid pET-23d-16-kDa, was further transformed into BL21 (DE3) expression host for T7 expression system.

2.4.5 Screening for clones expressing Acr-1

Clones showing correct size insert upon double digestion were checked for the expression of Acr-1 upon IPTG (1mM) induction. Among the various clones expressing variable amount of recombinant protein, clones expressing highest level of correct size (16.3 kDa) protein were selected for confirmation of the presence of the polyhistidine tag Acr-1 by western blotting using TGB monoclonal antibody. 1ml of cells pellet from each of induced and uninduced cultures were boiled with 50 µl of 2X gel loading buffer, followed by centrifugation at 10,000g for 10 minutes. The Maulanasupernatant Azad were fractioned Library, on SDS PAGEAligarh and subsequently Muslim blotted toUniversity nitrocellulose membrane. Membrane was blocked overnight with blocking buffer and washed 3 times with wash buffer. Next morning, the membrane was incubated with 1:2500 dilution of TGB monoclonal antibody for two hour at room temperature, washed twice with wash buffer and incubated again for 1 hour with 1:1000 dilution of horseradish peroxidase-conjugated secondary antibody. The membrane was washed

Chapter -2

twice with wash buffer followed by protein detection with hydrogen peroxide as the substrate and 4-Chloro-l-naphthol (4-CN) as the chromogen in the visualization solution.

2.4.6 Overexpression and purification of Acr-1

BL21 (DE3) cells containing the plasmid pET23-Acr-1 were grown in LB medium to standardize optimum cultivation temperature, induction OD6oo, IPTG concentration and induction time for highest expression of soluble C-terminal 6-X histidine tagged Acr-1. During the standardization procedure, Acr-1 was expressed in a temperature range from 20°C to 37°C, OD6oo was varied from 0.4 to 1.2, IPTG was varied from 0.2 mM to 2 mM, and the induction time was varied from 2 h to 12 h. The optimim level of expression of soluble Acr-1 was obtained by inducing the protein expression

at OD6oo =0.8 with a final IPTG concentration of 1mM and induction time of 4 h. The culture cells were immidiately harvested, washed and the pellet was suspended in euillibiration buffer (pH-8.8) with 1mM PMSF and protease inhibitor cocktail. The cells with buffer cocktail were subjected to lysis by sonication by using constant cell Distrubtion system (Labmate (Asia) Pvt. Ltd.) at room temperature.

MaulanaFigure 2.2: (A) Azad Agarose gelLibrary, electrophoresis Aligarh of amplified AcrMuslim-1 product. (UniversityB) 12% SDS page showed, whole cell lysate of M.tb protein (lane 1 and 3), protein marker (lane 2) and eluted Acr-1 (16 kDa) protein (lane 6 and 8) (C) Western blot of Acr-1 with TGBAb.

Chapter -2

Rest of the steps were performed at 4°C. The lysate were centrifuged at 20,000xg for 1 h and the supernatant was passed through 0.2µm syringe filter. Subsequently, the resulatant clear supernatant was loaded onto NI-NTA column pre –equillibirated with buffer A. Unbound protein were removed by washing the coloum with 25 times coloum volume (CVs) of buffer B containing 250 mM imidazole. The bound Acr-1 was finally eluted with 4 CVs of elution buffer contains 50 mM Tris, 250 mM NaCl and 250mM imidazole. The eluted fractions were checked for purity on a 15% SDS PAGE and the fractions containing more than 90 pure protein were pooled together

(Fig 2.2). The purified protein was dialysed against 20 mM NaH2P04, 50 mM NaCl, 0.1 % NaN3, pH 6.5, and concentrated by ultrafiltration using the Amicon (MWCO 10 kDa) ultrafiltration membrane. The concentration of purified Acr-1 (16 kDa) protein was determined by Bradford assay. Yield of the purified protein was 6 mg/ml of culture.

Maulana Azad Library, Aligarh Muslim University

Chapter-3 MYCOBACTERIUM TUBERCULOSIS HOST CELL INTERACTION: ROLE OF LATENCY ASSOCIATED PROTEIN ACR- 1 IN DIFFERENTIAL MODULATION OF MACROPHAGES

Maulana Azad Library, Aligarh Muslim University

Chapter-3

3.1 Introduction

Mycobacterium sps. adapt intracellular niche as a stratagem to evade antibody onslaught. Incidentally, it chose macrophages, the first line defender of the host, as a sheltered resort (Fels AO, Cohn ZA.1986). To withstand hostile ambiance inside the macrophages, the pathogen downplays its own metabolic activities and switches to a non-replicating dormant state (Wayne LG, Hayes LG.1996). As suppression of invading M.tb is generally conferred by cell-mediated components of the host, residual latent bacilli residing inside macrophage remain viable in the healthy host for many years and can reactivate into contagious TB disease in subsequent years (Lin PL, Flynn JL. 2010). During latency, M.tb uses a range of effector modalities to modulate various host-related metabolic processes and factors viz. pattern recognition, antigen presentation, and phagolysosome formation etc. The incurred modulations help in the intracellular survival of M.tb inside host MΦs (Salgame P. 2005). It is of paramount importance to comprehend the intricate host–pathogen interaction and the evasion approaches thrived by M.tb to circumvent immune onslaught of the host (Pahari S et al. 2018). The pathogen systematically deteriorates the immune function of the host by down-modulating overall activities and functioning of both macrophage and DC cell population (Tailleux L et al. 2008). While residing in a granuloma, M.tb expresses small molecular weight proteins i.e. heat shock protein X (sHSPX) also known as HSP-16.3 or Acr-1. While the functions of various expressed protein including CFP-10, ESAT-6 i.e early secretory antigenic target of M.tb, 38-kDa, and 85B (Ag85B) had been evaluated for their possible role in modulating DCs (Bekmurzayeva A et al. 2013), however to the best of our knowledge the effect of Acr-1 on host MΦs has remained elusive.

The protein Acr-1 is mainly expressed in the latent phase of M.tb infection and augmented in the stress condition (Sherman DR et al. 2001). The fact that M.tb devoid of Acr-1 fails to continue its latency (Yuan Y et al. 1998), suggesting an Maulanaimperious Azad aspect of Library,the protein in the Aligarh prevailing of M.tbMuslim in the dormant University state. With the present state of the knowledge, it is unclear that how M.tb exploits its latency associated antigen in modulating macrophage in terms of their maturation, differentiation, cytokine release and capacity to activate T cells. Although cellular immune responses help in the containment of M.tb infection, however, its persistence

61 Chapter-3

in MΦs ensues in down-regulation of costimulatory molecule on one hand and upregulation of coinhibitory molecule on the other (Khan N et al. 2012).

The infected MΦs may also incur tolerance and promotes M.tb survival (Hmama Z et al. 2015). Accumulating shreds of evidence have indicated that bone marrow derived, antigen-presenting cells (APCs) play a decisive role in the induction of T cell tolerance. The phenotype of tolerance depends on antigen presenting efficiency of the specific class of APCs (Langlois RA, Legge KL. 2007). An increase in regulatory T cells (Tregs) population has also been noticed in latent TB which eventually restrains type 17 T-helper (Th17) cells function. The overall, development in Treg populations along with the decline in Th17 cells generally leads to suppression of the immune response against M.tb (Marin ND et al. 2015).

In general, antigen presenting cells including MΦs participate in a pivotal role in suppressing immunity against M.tb and facilitate differentiation of naïve T cells to effector cells (Pozzi LA et al. 2005). The invading pathogen in turn modulates host immune machinery that leads to induction of tolerance that otherwise eventually help its safe survival inside the host. For example, latent M.tb residing in macrophages exploits host cell machinery to inhibit the function of various immune cells. It also manipulates the differentiation of monocytes and macrophages (Cosma CL et al. 2003 and Mazurek J et al. 2012).

Several sets of studies had suggested the immunoprophylactic role of Acr-1 in the immunized host (Siddiqui KF et al. 2011). Macrophages harnessing to various tuberculosis antigen may provide a pivotal regulatory factor in endowing defensive immunity. Currently available studies have suggested that several M.tb proteins can modulate MΦs in various ways. For example, Mycobacterial proteins such as ESX, ESAT-6, and CFP-10 had been stated to facilitate maturation of MΦs (Stanley SA et al. 2003, Abdallah AM et al. 2008 and Tan T et al. 2006). The expressed Mycobacterial proteins also prime T cell response by triggering NF-κB and MAPK Maulanasignaling pathways Azad and urge Library, Th-1 immune response Aligarh in the host, Muslim most presumably University by augmenting IL-12 and IFN-γ production (Ganguly N et al. 2008 and Qiao D et al. 2011).

Chapter-3

The present study explores a comprehensive approach to study the immunological role of Acr-1 in the modulation of the host MΦs. The data suggest that Acr-1 hamper the maturation and differentiation of bone marrow derived macrophages (BMDM). The BMDM exhibited tolerogenic phenotype with the hampered immune response when exposed to Acr-1 during their maturation by modulating STAT-1 and STAT-4 pathways.

3.2 Material and Method

3.2.1 Mice and ethics statement

BALB/c and C57BL/6 mice aged 6-8 wk old were obtained from the Department animal house facility Interdisciplinary Biotechnology Unit, AMU Aligarh and JALMA Institute for Leprosy and other Mycobacterial Diseases, Agra, India. Animals were offered standard pellet diet and water ad libitum. The animals were maintained in pathogen-free conditions at the Department Animal House Facility. The animal experiments were approved by the Institutional Animal Ethics Committee of the Interdisciplinary Biotechnology Unit, Aligarh Muslim University, Aligarh, India. All animal experiments were performed according to the National Regulatory Guidelines issued by the CPCSEA (Committee for the Purpose of Control and Supervision of Experiments on Animals). Our approval ID was 332/ CPCSEA, Ministry of Environment and Forests, Paryavaran Bhavan, Government of India.

3.2.2 Reagents

Both free and fluorochrome conjugated antibodies (Abs): CD4 Pacific Blue, CD-80- FITC, CD-40-PEcy5, CD86-PE, MHC-II-Per-CPcy5-5, TIM-3-APC. All reagents used in cytokine ELISA experiment were procured from eBiosciences (San Diego, CA) and BD Pharamigen (San Diego, CA). Fetal Bovine Serum (FBS) was purchased from GIBCO (Grand Island, NY) and Biological Industries (Kibbutz Beit Haemek 25115, Israel). Penicillin, Streptomycin, L-glutamine, L-pyruvate and tissue culture Maulanagrade plastic Azad wares Library, used in experiments Aligarh were purchased Muslim from Serva University (Heidelbergh, Germany) and BD Biosciences (Bedford, MA). Abs against pSTAT-1 and pSTAT-4 were procured from BD Biosciences (San Diego, CA). All other reagents and chemicals were purchased from Sigma Aldrich (St.Louis, MO) or otherwise mentioned

63 Chapter-3

3.2.3 Murine Bone Marrow Derived Macrophages (BMDM)

Bone marrow cells were collected from femurs and tibiae of C57BL/6 mice. Briefly, a single suspension of bone marrow cells (BMCs) collected from the femurs and tibia of C57BL/6 mice was obtained by passing the bone marrow spicules through cell strainers (Weischenfeldt J et al. 2008). Cells were counted (2x106/well) and cultured with RPMI medium supplemented with 20% L929 media contains M-CSF with 10% FBS in tissue culture plates in presence of Acr-1 [9µg/ml] (AcrMΦpre). On day 3, the cells were replenished with fresh media containing Acr-1 in the first set of experiment (AcrMΦpre). In another set, BMDM cells were cultured in similar condition in media without Acr-1. On sixth day, the cells of second set were exposed to Acr-1 [9µg/ml] (AcrMΦpost). On day 7, AcrMΦpre and AcrMΦpost cells were harvested and the supernatant was collected to determine expressed cytokines.

3.2.4 Differentiation of THP-1 macrophages

Human THP-1 monocytes (3×105/well) were incubated with PMA (20 ng/ml) in the presence or absence of Acr-1 (9µg/ml) for 16h in 48 well plates. The MΦs were washed with RPMI and then rested for another 24h. For the post-exposure to Acr-1 (AcrMΦpost) after differentiation, human macrophages were treated with Acr-1 (9 µg/ml) for 24h.

3.2.5 Antigen uptake studies

For antigen uptake study, both AcrMΦpre and AcrMΦpost cells were incubated with fluorescein-isothiocyanate-dextran (100µg/ml) at 37°C for 30 mins. The cells incubated at 4°C were used as a negative control. Antigen uptake was detained by adding ice-cold phosphate buffered saline (PBS) at 4°C. Further, cells were washed subsequently 3 times with chilled PBS with 1% fetal bovine serum. Later, cells were acquired for the fluorescence-thiocyanate dextran (Dextran–FITC) using FACS MaulanaCalibur and analyzed Azad by BD Library, DIVA (BD Biosciences, Aligarh San Jose, Muslim CA) software. University

3.2.6 T cell proliferation study

Chapter-3

CD4 specific T cells purified from splenocytes of BALB/c mice by MACS were labelled with CFSE-dye. The experimental AcrMΦpre and AcrMΦpost cells (cultured from C57BL/6 mice bone marrow) were irradiated at 3000 rad followed by co-culture with allogenic CD4 T cells in a 1:10 ratio (MΦs:T cells) for 72 hours. Then, cells were harvested, washed with 1X PBS and fixed in 1% paraformaldehyde. Flowcytometry data were acquired using FACS Aria II and analyzed by FACS DIVA software (BD Biosciences, San Jose, CA). Flowcytometry data is represented as percentage population normalized with suitable isotype-matched controls. Later, supernatant was collected to screen for the presence of various cytokine.

3.2.7 Flow cytometry analysis

The cultured cells were stained with fluorochrome labelled anti-mouse surface Abs along with relevant isotype controls, as mentioned earlier study (Nicoletti I et al. 1991). Briefly, cells were stained with fluorochrome-labelled anti-mouse F4/80/CD80/CD86/CD40/MHC-II/TIM-3 Abs and their isotype-matched controls. Finally, cells were washed and fixed in 1% paraformaldehyde. Flowcytometry data were obtained using FACS Aria II and analyzed by FACS DIVA software (BD Biosciences, San Jose, CA). Flowcytometry data is presented as percentage cells population positive for respective fluorochrome-labelled anti-mouse Abs normalized with suitable isotype-matched controls.

3.2.8 Cytokines estimation

The culture supernatants from the various experimental set were assayed for the presence of cytokines such as IL-6, IL-12, TNF-α, IL-10, IFN-γ, and IL-17 as described previously (Mosmann TR, Fong TA. 1989). In brief, 96 well ELISA plates were coated with purified rat anti-mouse IL-6, IL-12, TNF-α, IL-10, IFN-γ, and IL-17 Abs at 4°C overnight. Then, the plates were washed 3 times with FACS buffer (1X PBS+0.05% Tween-20) and blocking was performed with blocking buffer (1X MaulanaPBS+1% Azad BSA) for Library, 2h at RT and washed Aligarh again 3 timesMuslim with 1X PBSUniversity. Later, the culture supernatants and serially diluted standards (recombinant anti-mouse IL-6, IL- 12, TNF-α, IL-10, IFN-γ, and IL-17 in log2 dilutions) were added in those plates and incubated for 2h. Then, the plates were again washed and bound IL-6, IL-12, TNF-α, IL-10, IFN-γ, and IL-17 antibody were detected by biotinylated anti-mouse secondary

Abs, followed by their detection with avidin-HRP/OPD-H2O2 for colorimetric

65 Chapter-3

cytokines estimation. Later on, the concentrations of released cytokines were estimated using optical densities (ODs) of respective standard values as reference curves and data were presented as pg/ml.

3.2.9 Annexin and Propidium Iodide (PI) assay

The Annexin V and PI assay were set according to the standard protocol, as stated previously (Riccardi C, Nicoletti I. 2006). In brief, both pre and post Acr-1 treated BMDM cells were harvested. After extensive washing step cells were resuspended in

binding buffer solution [0.01 M HEPES (pH 7.4), 0.14 M NaCl, and 2.5 mM CaCl2]. The FITC conjugated Annexin V antibody was given to the cells. Further, the cells were incubated in dark for 15 mins at RT. Later, the cells were incubated with PI for 5 mins at RT and then the binding buffer (300 µl) was added. The stained samples were acquired immediately using FACS Aria II and data was analyzed by FACS DIVA software (BD Biosciences, San Jose, CA).

3.2.10 Western blot

The immune cells belonging to both AcrMΦpre and AcrMΦpost groups were harvested and treated with lysis buffer (Cytosolic protein extraction buffer along with protease as well as phosphatase inhibitor cocktail). Equal amount of lysate was subjected to SDS-PAGE analysis. The gel was transblotted to PVDF membrane followed by subsequent blocking. The membrane was immunoblotted with specific Abs against phosphorylated STAT-1, and STAT-4. The blot was developed by a chemiluminescence kit (Amersham Pharmacia Biotech, Buckinghamshire, UK). The scanning of the blots was completed with the help of ImageQuant LAS 4000 (GE Healthcare, Pittsburgh, PA, USA). Densitometric analysis was done using ImageJ software.

3.2.11 Statistical analysis

The data analysis was completed by Student’s ‘t’ test, non-parametric Mann-Whitney Maulanatwo-tailed and repeatedAzad measure Library, ANOVA with Aligarh post-Student -NewmanMuslim-Keuls multipleUniversity comparison test using Graph Pad Prism 6 software. The statistical differences were considered significant at a level of p <0.05.

Chapter-3

3.3 Result

3.3.1 M.tb Acr-1 modulates the differentiation of host MΦs

Latent stages of M.tb infection is considered to be the foremost burdens in developing countries. While residing inside MΦs, M.tb thwarts hostile host immune response by its transition to latent phase (Gengenbacher M, Kaufmann SH. 2012). The infected MΦs undergo subtle changes upon establishment of infection. Macrophages express several surface molecules that actively participate in various cell-cell interaction events. Among various surface molecule, optimum expression of MHC as well as costimulatory molecules on APCs is imperative for deciding its future interaction with effector T cells in term of their activation or anergy (Gimmi CD et al. 1993).

In our study, we envisage effect of M.tb latent phase expressed protein Acr-1 on modulation of MΦ functions. We noticed that presence of Acr-1 during differentiation and maturation phase of MΦs (AcrMΦpre) down-regulate the expression of CD80 molecules in the exposed MΦs. In contrast, exposures of mature MΦs to Acr-1 (AcrMΦpost) result in up-regulated expression of CD80 (Fig: 3.1 A). The AcrMΦpre modulated expression of co-stimulatory molecules resulted in downregulation of CD86, CD40, and MHCII molecules (Fig: 3.1 B-D). To authenticate that the downregulation of costimulatory molecules in AcrMΦpre is not due to cell death, we stained AcrMΦpre and AcrMΦpost (dose dependent, with varying dose of Acr-1) with PI and found no change in the viability of both AcrMΦpost and AcrMΦpre. The presence of Acr-1 did not affect the viability of host MΦ cells (Fig: 3.1 E).

In addition, Acr-1 also modulates the expression of costimulatory molecules in human monocyte differentiated macrophages. Interestingly, we observed upregulation of CD40 molecules in the exposure of mature human macrophages to Acr-1 (AcrMΦpost). On the contrary, exposure with Acr-1 (AcrMΦpre) during the Maulanadifferentiation Azad of humanLibrary, macrophages Aligarh resulted in Muslimthe down regulation University in the expression of CD40 (Fig: 3.1 F). In order to validate the specificity of our findings, we have demonstrated by employing another M.tb antigen (CFP-10) and observed no considerable effect in both AcrMΦpre and AcrMΦpost MΦs (Fig: 3.1G).

67 Chapter-3

Figure 3.1: Differential role of alpha crystallin protein (Acr-1) in BMDM maturation and in the function of human monocytes. The BMDM were exposed to MaulanaAcr-1 (9µg/ml) Azad either duringLibrary, maturation Aligarh (AcrMΦpre) Muslim or after maturation University (AcrMΦpost) and the expression of various molecules on F4/80 gated population was accessed by flow cytometry. [A] The expression of CD80, [B] CD86, [C] CD40, [D] MHC-II, [E] the cell viability was detected by PI staining and [F] Human monocyte cell line (THP-1) were treated with Acr-1 (9μg/ml) during (AcrMΦpre) and after

Chapter-3

differentiation (AcrMΦpost) of monocytes to macrophages for 24h. Untreated and Acr-1 treated monocyte was taken as cell control. [G] Later, the macrophages were incubated in presence or absence of Acr-1 and the expression of CD40 was monitored by flow cytometry. CFP-10 was used to establish the specificity of Acr-1. Data presented are representative of 2 independent experiments. AcrMΦpre: Acr-1 treatment during differentiation of THP-1 macrophages; AcrMΦpost: Acr-1 treatment after differentiation of THP-1 macrophages. CFP-10pre: CFP-10 treatment during differentiation of THP-1 macrophages; CFP-10post: CFP-10 treatment after differentiation of THP-1 macrophages.

3.3.2 Exposure of MΦs to Acr-1 during their maturation results in the tolerogenic phenotype

Macrophages are the first line of host defense and actively participate in T cell activation. The invading M.tb finds the safe and protected niche inside the MΦs (Mosser DM, Edwards JP. 2008). M.tb down modulates an immune function of host MΦs. Among various anergy inducing factor the higher expression of TIM-3 does hamper cytokine expression and leads to immune tolerance (Ocaña-Guzman R et al. 2016). Keeping this fact into contemplation, we assessed the effect of Acr-1 on the expression of TIM-3 molecule. Acr-1 exposure induced a significantly higher the expression of TIM-3 in MΦs belonging to AcrMΦpre (Fig: 3.2). In contrast, we observed lower expression of TIM-3 in AcrMΦpost macrophages (Fig: 3.2).

Maulana Azad Library, Aligarh Muslim University Figure 3.2: AcrMΦpre treatment lead to tolerogenic phenotype in MΦs. Acr-1 treatment augment the tolerogenic immune response in AcrMΦpre by increasing coinhibitory TIM-3 molecule, while AcrMΦpost did not. TIM-3 expressions were monitored by flow cytometer. The value in the flow cytometry histogram depicts percentage of cells. Data are representative of 2-3 independent experiments.

69 Chapter-3

3.3.3 Acr-1 treatment modulates the cytokine release in macrophages

The cytokines expressed by MΦs have been reported to play a significant role in differentiation of T cells (Hickman SP et al. 2002). IL-12 is a key cytokine that promotes differentiation of naïve T cells to Th1 phenotype to produce IFN-γ by T cells. The pro-inflammatory cytokine such as TNF-α, IL-6 etc. exerts primordial role in restricting the growth of M.tb (Denis M et al. 1999). On the other hand, IL-10 promotes pathogen persistence by inducing to M.tb phagosome maturation arrest in macrophages (Fiorentino DF et al. 1991). Considering this fact, we examined the potential of Acr-1 to induce IL-6, IL-12, TNF-α, and IL-10 cytokines secretion in both pre and post treatment groups (Fig: 3.3 A-D). We observed significant increase in the production of IL-6 (p<0.001), IL-12 (p<0.01), and TNF-α (p<0.01) in AcrMΦpost treatment (Fig: 3.3 A-C). Co-incubation of BMDM with Acr-1 during its maturation (AcrMΦpre) resulted in down-regulation of TNF-α. On the contrary, post exposure with Acr-1 resulted in significantly enhanced expression of TNF-α by BMDM (Fig: 3.3 C). Further, there was significantly (p<0.05) higher expansion of IL-10 in AcrMΦpre group when compared to AcrMΦpost group (Fig: 3.3 D). The overall data signify that Acr-1 incapacitate the maturation and expression of the key surface molecules that are potential for the optimum activation of MΦs.

Maulana Azad Library, Aligarh Muslim University

Chapter-3

Figure 3.3: Acr-1 modulates the release of various cytokines. BMDM were generated in the presence of Acr-1 (9µg/ml) during pre-and post-maturation (AcrMΦpre and AcrMΦpost) and supernatant was collected and analyzed for the presence of [A] IL-6; [B] IL-12; [C] TNF-α; [D] IL-10 cytokines by ELISA. Data represents as pg/ml (mean±SEM) and are representative of 3 independent experiments. Data were analyzed by one-way ANOVA repeated measure *p<0.05, **p<0.01, ***p<0.001. UT: untreated BMDM; AcrMΦpre: Acr-1 treatment during differentiation of BMDM; AcrMΦpost: Acr-1 treatment after differentiation of BMDM.

3.3.4 Acr-1 post treatment augments antigen uptake of macrophages

MaulanaAcrMΦp Azadost treatment Library, resulted in the Aligarhup-regulation of Muslimcostimulatory on University one hand and down-regulation of coinhibitory molecule (CD80hi/CD86hi/CD40hi/MHC-IIhi/TIM- 3low) in MΦs (Fig: 3.1 A-D and Fig: 2). We next assessed antigen uptake potential of MΦs in both AcrMΦpre and AcrMΦpost groups. The flowcytometry data exhibited a significant increase (p<0.01) in the dextran uptake of AcrMΦpost as compared to

71 Chapter-3

unstimulated control (Fig: 3.4 A, B). AcrMΦpre treatment significantly (p<0.001) reduced dextran uptake capacity as compared to AcrMΦpost macrophages (Fig: 3.4 A,B).

Figure 3.4: Acr-1 regulates antigen uptake by macrophages. AcrMΦpre and AcrMΦpost were cultured in the existence of indicated dose of Acr-1. Antigen uptake was observed as [A] histogram; [B] bar graph depicts dextran uptake capacity of AcrMΦpre and AcrMΦpost macrophages by flow cytometry. Data represents mean±SEM and are representative of 2 independent experiments. Data were analyzed by one-way ANOVA repeated measure *p<0.05, **p<0.01, ***p<0.001.

3.3.5 AcrMΦpost treatment resulted in augmented proliferation of allogenic T cells while AcrMΦpre inhibits T cells proliferation

MaulanaMacrophages play Azad a pivotal Library, role in the activation Aligarh as well as Muslimdifferentiation ofUniversity naïve CD4 T cell (Pahari S et al. 2017). Next, we explored to check the ability of AcrMΦpre and AcrMΦpost treated macrophages to activate T cells. Both AcrMΦpre and AcrMΦpost treated sets of macrophages were cultured with allogenic purified

Chapter-3

CD4 T cells. Interestingly, we observed that AcrMΦpost treated macrophages acquired the capacity to augment the T cells proliferation significantly (p<0.001) as compared to AcrMΦpre treated macrophages (Fig.: 3.5 A, B).

Figure 3.5: Post Acr-1 treatment resulted in augmented proliferation of allogenic T cell while pre Acr-1 treatment hampers T cell response. CD4 T cells purified by MACS were labelled with CFSE-dye. Later, BMDM primed with 9μg/ml Acr-1 (AcrMΦpre and AcrMΦpost) were co-cultured with allogenic CD4 T cells for 72h. Maulana[A, B] The Azad CD4 T cell Library, proliferation was Aligarh examined by Muslimflowcytometry; [B]University supernatant was collected for the estimation of IFN-γ; [C] IL-17 by ELISA. AcrMΦpre suppress, in contrast AcrMΦpost promotes the release of IFN-γ and IL-17 when co-cultured with allogenic (Balb/c) naïve T cell. The data signify as pg/ml (mean±SEM) and are representative of 3 independent experiments. Data were analyzed by one-way ANOVA repeated measure *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

73 Chapter-3

We noticed the diverse role of AcrMΦpre and AcrMΦpost in modulating the release of IL-6 and IL-12 that play a pivotal role in the differentiation of T lymphocytes with Th1 and Th17 phenotype (Fig. 3.3 A,B). Further, we assessed the influence of AcrMΦpre and AcrMΦpost treated macrophages in the production of Th1 and Th17 cells. Intriguingly, AcrMΦpost potentiated but AcrMΦpre inhibited the differentiation of Th1 cells, as evidenced by elevated expression of IFN-γ by AcrMΦpost. The observed change was observed for both IFN-γ and Th-17 cytokines in allogeneic CD4 T cells (Fig: 3.5 C,D).

3.3.6 Acr-1 modulates the phosphorylation of STAT-1 and STAT-4 in host MΦs

Besides playing a central role in evoking innate immune responses, macrophages are considered to be equally important in the induction of adaptive responses in the host (Pahari S et al. 2018). Various cytokine induces in response to antigen initiates signaling cascade through there receptor, leading to the activation of the transcription factor and target gene expression may in turn activate the STATs, the cytoplasmic transcription factors. Binding with cytokines ensues in auto phosphorylation of receptor-associated JAK kinases that in turn phosphorylate and activate STATs. Activated STATs translocate into the nucleus and bind to specific target elements in the promoters of cytokine-inducible genes. Upon interaction with antigen macrophages secreted various cytokines. Both STAT-1 and STAT4 can be activated by M.tb infected macrophages. IL-12 signaling activates STAT-4 that ensues in differentiation of naïve T cells into Th1 cells. On the other hand, IFN-γ executes multiple biological functions through the activation of STAT-1, a decisive transcription factor accountable for the activation as well as maturation of MΦs (Okamura H et al.1998).

Keeping this fact into consideration, we have tried to elucidate operative mechanism conscientious for the distinct behavior of Acr-1 in both AcrMΦpre and AcrMΦpost groups. There was substantial enhancement in the expression of both STAT-1 (1.9 Maulanafold) and STAT Azad-4 (2.3-fold) Library, phosphorylation Aligarh in AcrMΦpost Muslim group. On the University other hand, expression of both STAT-1 and STAT-4 was observed in AcrMΦpre treated group (Fig: 3.6 A, B).

Chapter-3

The extent of both STAT-1 and STAT-4 phosphorylation in AcrMΦpre treated group was considerably less as compared to unstimulated BMDM cells and AcrMΦpost treated groups. The observed decrement in STAT-1 and STAT-4 was specific and got hampered by Acr-1 protein lead to defective antimicrobial immunity. The exposure of AcrMΦpre with Acr-1 led to down regulated expression of both pSTAT-1 as well as pSTAT-4. On the contrary Acr-1 treatment of mature MΦs resulted in several folds increased expression of pSTAT-1 as compared to LPS. The Acr-1 treatment was also successful in upregulation of pSTAT-4 protein (2.3< fold change) in treated AcrMΦpost.

Overall, our data suggest the indispensable role of pre and post treated Acr-1 in influencing the activation, maturation and differentiation of bone marrow derived macrophages (BMDM). The BMDM exhibited tolerogenic phenotype with the hampered immune response if exposed to Acr-1 during their maturation by modulating STAT-1 and STAT-4 pathways.

Figure 3.6: Acr1 modulates the phosphorylation of STAT molecules. Macrophages were cultured with Acr-1 (9μg/ml) during (AcrMΦpre) and after differentiation (AcrMΦpost). The cells were treated by Acr-1 (9µg/mL) for 7day Maulanaexposure Azad of culture Library, medium supplemented Aligarh in a pre Muslim-and post-strategy. University Later, the cytosolic cell lysate was made and Western blotting was completed to demonstrate the expression of [A] pSTAT-1; [B] pSTAT-4. β-Actin was taken as a loading control. The densitometry data represent fold change. The density of untreated cells was considered as 1. LPS is used as positive control. The data are representative of the 2 independent experiments.

75 Chapter-3

3.4 Discussion

During the course of its establishment, M.tb coevolved various evading strategies to cope up hostile immune onslaught that may be waged by the host. For example, it halts fusion of phago-lysosome as a strategy to evade endo-lysosomal degradation (De Chastellier C. 2009). Subsequent to infection, M.tb generally switched to the dormant state and survives for years before resuscitation (Peyron P et al. 2008). M.tb circumvents the immune system and endows its persistence in the host by releasing several factors that modulate expression of various genes (Mukamolova GV et al. 2010 and Abebe M et al. 2011).

The latently infected human subjects can always be a possible threat for dispersion of the disease. The invading bacterium modulates the activity of the host MΦs to withstand hostile ambiance. During hypoxic condition, many secreted Mycobacterial proteins modulate the host’s MΦs immune response. Many latency-associated proteins are augmented when M.tb encounters nutrient starvation, hypoxia condition, low nitric oxide or low pH that essentially mimics the granuloma environment in the lung during latent infection (Park HD et al. 2003).

It has found that Mycobacterium heat shock protein Acr-1 based vaccine can activate the host immune responses that protect host from subsequent Mycobacterium onslaught (Siddiqui KF et al. 2015). The prophylactic role of Acr-1 has been attributed to its potential to modulate MΦs and also to its capacity to trigger M.tb specific T cells in the host. Acr-1 is principally expressed during the dormant stage of M.tb. Conversely, this seems to be quite unlikely that organism which is opting dormancy as a strategy to avoid host immune system would be expressing a protein product that will act against its own survival. The present study is an attempt to solve this puzzle and can be considered as an effort to understand the possible role of Acr-1 in the modulation of host immune response.

MaulanaWe authenticated Azad the role ofLibrary, Acr-1 in influencing Aligarh the maturation Muslim and differentiation University of host macrophages. Next, we explored the effect of exposure of Acr-1 on fully differentiated and matured host MΦs. The data suggest that Acr-1 can affect host immune response especially MΦs in above-specified condition in two different ways. Although it is well recognized that pathogen-specific immunity is predisposed by the 76

Chapter-3

pathogen as well as secreted various protein at the infection site, we attempted to provide unequivocal evidence in the context of the action of Acr-1 protein in host MΦs. Novel aspects of the present study suggest; (i) that the importance of T cell response in both AcrMΦpre and AcrMΦpost groups differ significantly; (ii) that there is a momentous functional diversity in generated T cell response which is demonstrated in context of antigen uptake capacity of Acr-1 treated MΦs group; (iii) that AcrMΦpre treatment augments an enhanced latency antigen (Acr-1) specific regulatory IL10, TIM-3, while interaction of mature MΦs with Acr-1 [AcrMΦpost] induces a specific Th17 and IFN-γ response that skewed to an inflammatory phenotype (Fig. 3.4); (iv) functional composition of Acr-1 induced cytokines in both AcrMΦpre and AcrMΦpost treated group are remarkably different. The optimal activation of naive T cells involved the interaction of the TCR by the peptide-MHC complex co-presented on the surface of macrophages. The interaction is substantially supported by costimulatory signals and also by immunoregulatory cytokines such as IL-12 (Giacomini E et al. 2001).

Next, we explored the effect of Acr-1 on MΦs viz. Acr-1 modulates the activity of developing macrophages as evidenced by the exposure of MΦs with Acr-1during their maturation (AcrMΦpre) was found to result in:

(i) Diminish in the percentage of F4/80/CD86+cells upon treatment with AcrMΦpre.

(ii) Downregulation of costimulatory molecules namely CD80, CD86, CD40, and MHC-II on MΦs in AcrMΦpre group.

(iii) Decrease expression of IL-12, IL-6, and TNF-α while upregulated expression of IL-10 in AcrMΦpre group.

(iv) Low antigen uptake ability of MΦs that offers reduced help to T cells in AcrMΦpre group. Maulana(v) Induction Azad of theLibrary, tolerogenic phenotype Aligarh (TIM-3 hiMuslim) in AcrMΦpre group.University (vi) Down regulation of STAT-1 and STAT-4 in AcrMΦpre group.

(vii) Augmented expression of IFN-γ and IL-17 cytokine with potent allogenic T cell response in AcrMΦpost group.

77 Chapter-3

We evaluated the expression of cell surface markers on Acr-1 exposed MΦs cells. Interestingly, a significant down regulation of MHC-II, CD80, CD86, and CD40 was observed in AcrMΦpre group, while there were upregulated expression costimulatory molecules in MΦs phenotype in AcrMΦpost treated group was observed in both mouse and human macrophages. Macrophages in AcrMΦpre group had phenotypically comparable cell surface expression (CD80lo/CD86lo/CD40lo/MHC- IIlo/TIM-3hi) to the one present in chronic stages of tuberculosis granulomas (Attanasio J, Wherry EJ et al. 2016). Macrophages with such signature phenotype generally induce immune tolerance and thereby protect invading Mycobacteria from host immune cells onslaught. AcrMΦpre mediated augmentation of TIM-3 can also be correlated with the generation of tolerance (Monney L et al. 2002).

In contrast, the up-regulation of the co-stimulatory surface markers in AcrMΦpost highlights the ability of MΦs to mature phenotype. Next, we explored the effect of Acr-1 on the expression of various cytokines in MΦs. AcrMΦpost treatment resulted in augmentation of pro-inflammatory cytokines (IL-12 and IL-6) to a significant level. TNF-α, a critical pro-inflammatory cytokine is an imperative early incident that leads to granuloma formation and help in providing protective host immune responses. We observed that Acr-1 derived AcrMΦpost enhance the production of TNF-α while there was a down regulating trend in TNF-α expression in AcrMΦpre cells. In addition, the suppression of IFN-γ production weakly correlated with an increased level of IL-10. Acr-1 exposure of MΦs (AcrMΦpre) coincided with the significant rise in IL-10 production in agreement with the possibility of cross- regulation of IL-10 and IFN-γ. Furthermore, increased IL-10 production down regulates the expression profile of the IL-12 secretion in AcrMΦpre. Altogether, the data propose that the Acr-1 protein hamper macrophages functions in AcrMΦpre and eventually suppress Th1 type immune response in the host during M.tb infection. Acr- 1 mediated debilitated functioning of macrophages ensues in less proliferation of T cells. Lower T cell function might also be linked by the CD86lo/TIM-3hi phenotype of MaulanaAcrMΦpre, which Azad had been Library, widely described Aligarh in chronic stage Muslim diseases (Mogues University T et al. 2001). Acr-1 mediated activation of transcription factor STATs in bone marrow derived macrophages has the direct impact on the subsequent expression of type I cytokine in the host. This work elucidates factors involved in cytokine signalling and

Chapter-3

regulation of immune response by latency associated protein Acr-1 of M.tb with host MΦs. Although the role of STAT-1 in M.tb infection in mice is well established (Sugawara I et al. 2004). STAT-1 is considered to be an important prerequisite for the maturation and activation of dendritic cell and macrophages. Subsequent activation of macrophages leads to the initiation of T cells and later on IL-12 secretion induces STAT-4 activation. Acr-1 mediated activation of STATs has direct impact on activation of T lymphocytes in the host. It is interesting to note that Acr-1 mediated activation of macrophages (Acr-MΦpost) may induce high expression of IFN-γ that in turn causes further activation of MΦs. Employing an IFN-γ/IL-12 cytokine milieu response in pre-and post-treated Acr-MΦ cells; we observed an increase in the phosphorylation of STAT-1 and STAT-4 in AcrMΦpost group. The observed expression of STAT-1 in the both treated group (AcrMΦpre and AcrMΦpost) clearly suggest that AcrMΦpost successfully prompt MΦs for their active involvement in subsequent immune response. On the other hand, the AcrMΦpre conditions caused down regulation of both STAT-1 and STAT-4 in the treated cells.

The observation can have a strong implication with high expression of IL-17 and IFN-γ in allogenic T cell response. Various operative pathways are likely to be modulated upon exposure to Acr-1. Furthermore, the establishment of factors determined by M.tb that control the JAK/STAT pathway has created up new windows to generate new anti-tubercular drug and wisely attenuated new generation vaccine, predominantly for pulmonary TB.

The present study also suggests that Acr-1 impairs the functioning of macrophages. It seems latency associated antigen Acr-1 play a role in the immune-evasion and immunosuppression by differential modulation of MΦs maturation and enforces them not to activate T cells for protective immunity against Mycobacterial onslaught.

Although, the present study does not provide direct evidence about the effect of Acr-1 in AcrMΦpost suggest that, Acr-1 could be an important antigen target for the stable Maulanadesign inAzad M.tb vaccine. Library, The vaccine Aligarh approach meets Muslim the following University measures: (1) availability (cell wall accompanying) to APCs by triggering MΦs; (2) initial recognition by the immune system in host MΦs; (3) finally initiation of Th1 response preferred proper functioning of the immune response against M.tb. Acr-1 based

79 Chapter-3

prophylactic scheme may need its further assessment as a defensive antigen for designing new TB vaccine against active and latent TB.

3.5 Conclusion

The current study examined M.tb dormancy associated Acr-1 protein mediated modulation of macrophage differentiation incurred through the pre and post maturational stages. The data suggest that Acr-1 affects with the activation, maturation, and differentiation of mouse bone marrow derived macrophages (BMDM) as well as human THP-1 monocyte derived macrophages. Exposure with Acr1 during the maturation stage of macrophages results in downregulation of costimulatory molecules namely CD80, CD86, CD40, and MHC-II on MΦs in AcrMΦpre group. Further, the interaction of Acr1 with AcrMΦpre group ensues in decreased expression of IL-12, IL-6, and TNF-α on one hand and upregulated expression of IL-10 on the other. The flow cytometry and cytokine stimulation data reveal the overall increase in expression of costimulatory molecules and Th1 response in AcrMΦpost treatment groups. The BMDM exhibited tolerogenic phenotype with hampered immune response if exposed to Acr-1 during their maturation by modulating STAT-1 and STAT-4 pathways. Future studies to understand allogenic response in host macrophages may help improve functionality and specificity for increased efficacy of Acr-1 against vaccine preparation.

Maulana Azad Library, Aligarh Muslim University

Chapter-4 THE PRIME BOOST VACCINATION STRATEGY: PROSPECTIVE APPROACH FOR IMPROVING MEMORY RESPONSE AGAINST M.TB INFECTION

Maulana Azad Library, Aligarh Muslim University

Chapter -4

4.1 Introduction

Mycobacterium tuberculosis (M.tb) infects billions of people; across the world (World Health Organization. 2009). Some of them succumb to fall blown infection, while a greater population latently infected and have fair chances of having infection in the later part of the life. Latent tuberculosis infection (LTBI) remains a challenge to prevent, diagnose and treat adequately; with upwards of 2 billion people exhibit with LTBI (Arend SM, van Dissel JT. 2002). Most infected people initially control the infection by achieving cell-mediated immunity; however, residual latent bacilli persist in viable form in healthy hosts for many years and revoke into TB disease, and may act reservoir and play active role in contagious tuberculosis (Aagaard C et al. 2011 and Fine PE. 1995).

The attenuated Mycobacterium bovis based bacillus calmette Guerin (BCG), is the only available vaccine against tuberculosis. The BCG vaccine is effective in prophylaxis of childhood tuberculosis; however its protective effects wane in adult (Comstock GW. 1994 and Andersen P, Doherty TM. 2005). Incidentally, the environment of TB-endemic zones has rich heritage of nontuberculosis Mycobacteria (NTM), helminth infestation. Thus latent M.tb prevalence interferes with presence of NTM and helminth, results in BCG failure (Brandt L et al. 2002). In short-term studies, BCG has been shown to generate a T helper-1 (Th1) response and induce protection against Mycobacterium tuberculosis. However it does not evoke memory T cells, thus fail to maintain long-term protection (Orme IM. 1999 and Henao-Tamayo M et al. 2014).

M.tuberculosis has unique ability to establish a dormant non replicating state and survive in an intracellular habitat for many years. The denial to access oxygen and other food material ensues in development of latent stage of infection with minimal bacterial replication and a characteristic set of differentially expressed gene (Dannenberg Jr AM. 1994 and Chan J, Flynn J. 2004). Many new antigens of the Maulanalatency- associatedAzad MLibrary,.tb compromised Aligarh of DosR-regulon Muslim as well asUniversity resuscitation promoting factor proteins, associated with resuscitating TB, have been reported (Voskuil MI et al. 2003). Recent DNA microarray analysis revealed upregulation of the DosR regulon, which comprises 48 genes including the heat shock protein (hsp) X/α-crystallin with molecular weight of 16 kDa, encoded by acr gene in M.tb

Chapter -4

produced during its dormancy state or persistent metabolic condition (Sherman DR et al. 2001). Which also contains B-cell epitope specific for the M.TB complex (Senol G et al. 2007 ).

6 genomic region of differentiation (RD1-16, nRD18) were deleted from ongoing evolution of M. Bovis BCG genome, subsequently found to be present in M.tb (Mahairas GG et al. 1996 and Behr MA et al. 1999). Since its original deviation leads to loss of important T cell antigens and considered to one of the possible reasons for non effectiveness of BCG against Mycobacterial infection in adults (Srivastava S, Ernst JD. 2013). The prophylactic TB subunit vaccines currently under development are almost exclusively based on immunodominant antigens secreted by the replicating bacteria and recognized in the first stage of infection (Govender L et al. 2010). The main purpose for developing is to design a vaccine capable of inducing long-lasting functional memory with protection similar or superior to that of BCG.

In the present study, we have established empirical approach, that prophylactic vaccines can be combined with late-stage antigens induced in the dormant or resuscitation stage (i.e. the transition from low to high bacterial metabolic activity as infection progresses) with boosting dose of BCG, into a multi-stage vaccine with maximum impact on all stages of M.tb infection, to combine humoral and cell mediated immunity coupled with long lived memory response is required for the comprehensive protection of BCG, (Aldovini A, Young RA. 1991) with Acr-1, immunodominant antigen expressed in latency phase of M.tb.

This study was conducted to check whether vaccination with latency associated antigen Acr-1 boosted with BCG or H37Ra, could generate Th-1 cytokine expression profile with enduring M.tb specific T cell memory response. We vaccinated mice, in a prime boost (P/B) vaccination strategy, with combination of Acr-1–H37Ra, and Acr- 1–BCG vaccine to study the generation and sustenance of long-term protective immunity against M.tb (Dalmia N, Ramsay AJ. 2012). Interestingly, prime boost Maulanavaccination with Azad Acr-1–BCG Library, demonstrated Aligarh considerable augmentation Muslim in CD4University cell memory pool, as evident by significant improvement in immune response and protection against M.tb.

Chapter -4

4.2 Materials and Method

4.2.1 Reagents:

All the reagents used were of the highest purity available. Mycobacterial culture media viz. Middlebrook 7H9 broth; Middlebrook 7H-11medium albumin, dextrose, oleic acid and OADC were procured from Difco laboraties. Nickel Ni-NTA beads nitrilo acetic acid metal-affinity chromatography matrix Taq polymerase, Plasmid Miniprep kit, Gel extraction kit, DNA purification kit other reagents for PCR, were procured from Qiagen. Tissue culture media (RPMI 1640), Bovine serum albumin (BSA), Antimycotic solution and MTT reagent used in this study were procured from BD-Biosciences and Sigma (USA) respectively.

4.2.2 Antibodies: Fluorescein isothiocyanate (FITC)–conjugated CD62-L, phycoerytrin conjugate (PE) conjugated CD69, PerCP (Cy5.5) conjugated CD44 (IM- 7); were procured from e-Biosciences. IgG2a (R35-95) isotype control; IgG1, IgG2a isotype kit (550487) were procured from BD Biosciences.

4.2.3 Mycobacterial strains:

Various Mycobacterial strains viz. Mycobacterium tuberculosis H37Rv, M. tuberculosis H37Ra and BCG (Danish strain) were kind gift by V.M Katoch (National JALMA Institute for Leprosy and Other Mycobacterial Diseases). M.tuberculosis was incubated in Middlebrook 7H9 broth containing 0.2% glycerol and 0.05% Tween-80 supplemented with 10% OADC (Zhang M et al. 1998). The viability of the bacteria was determined by plating on Middlebrook 7H-11 medium supplemented with OADC.

4.2.4 Experimental mice and immunization strategy

Female BALB/c mice aged 6-8 weeks were procured from JALMA institute for Leprosy and other Mycobacterial Diseases, Agra, India and maintained in pathogen Maulanafree condition Azad at animal Library, house facility Aligarh of JALMA and Muslimoffered pellet feed University and water ad libitum, and were used for experiments beginning between 8-10 week of age. Mice were transferred and maintained in a BSL level 3 physical containment facilities before aerosol challenge with M. tuberculosis H37Ra, in accordance with guidelines from the CPCSEA (Committee for the purpose of control and supervision of

Chapter -4

experiments on animals, Govt. of India). Mice were immunized subcutaneously with 100µg of Acr-1 in incomplete freund adjuvant (IFA). After 7 days mice were boosted with 50µg of Acr-1 in IFA with same route of administration, PBS was taken as control. 21 day later of second dose of Acr-1 mice were challenged with low dose aerosol infection of BCG and H37Ra infection, with the use of an inhalation exposure system (Glas-Col) to deposit ∼100 bacteria in the lungs.

4.2.5 Challenge with Mycobacterial infection and assessment of residual bacterial burden in vital organs

For long-term studies, animals were rested for 120 days. After stipulated quarantine, 5 BALB/c mice from each group were challenged with M.tb H37Rv through aerosol route. Suspension having a bacterial count of 5x107/ml in a volume of 10 ml was added to the venture nebulizer unit of the middle brook Aerosol Generator device (Glas-col, USA) to deposit, 100 bacilli in each mouse. To evaluate the prophylactic potential of prime boost Acr-1–BCG/H37Ra vaccine candidates, bacterial load in lungs and spleens of experimental animals was determined at various time points. After 30 days, three animals from each group were sacrificed. The lungs of representative animal from each group was taken out aseptically and homogenized in 7H9 media. Different dilutions of prepared homogenate were plated onto 7H11 agar plates supplemented with oleic acid, albumin, dextrose and catalase. In BCG (Danish) immunized group, thiophene carboxylic hydrazide (TCH) at concentration of 2 mg/ml, was added to inhibit the growth of BCG and incubated for 3 weeks at 37OC. After stipulated incubation period, colonies were counted to calculate the bacterial load.

4.2.6 Ethics statement:

All animal experiments were approved by the Institutional Animal Ethics Committees of IBU-AMU and NJIL & OMD, India. All animal experiments were performed Maulanaaccording to the Azad National Regulatory Library, Guidelines Aligarh issued by CPCSEA Muslim (Committee University for the Purpose of Control and Supervision of Experiments on Animals). Our approval ID was 332/CPCSEA, Ministry of Environment and Forest, Govt. of India.

Chapter -4

4.2.7 Determination of antibody isotype in sera of immunized mice:

Serum was collected from the immunized animals on 30thday of the aerosol challenge as described earlier (Harlow E, Lane D.). The Ag-specific indirect ELISA was performed to characterize anti-M.tb Acr-1 protein specific antibody and their isotype following protocol (Singh SV et al. 2014). Briefly, ninety-six well microtitre plates were incubated overnight with 200 ng antigen/well in carbonate/bicarbonate buffer (0.05 M, pH 9.6) at 4oC After washing and blocking steps, the plates was incubated with serially diluted sera at 37oC for 2 h. After excessive washing of the plates, 100 µl of (1:5000 dilution of stock) goat anti-mouse anti- IgG2a antibodies were added in each well and incubated for 1 h at 37oC. After washing steps, 100µl of (1:5000 dilution of stock) HRP conjugated rabbit anti goat antibody was added to each well and each plate was incubated at 37oC for 1 h. The plates were washed again followed by adding 100µl of substrate solution (6 mg OPD in 12 ml of substrate buffer with 5 o ml of 30% H2O2) and were finally incubated at 37 C for 40 min. The reaction was

stopped by the addition of 50 µl of 1 M H2SO4.The absorbance was read at 490 nm with a microtitre ELISA plate reader (Bio-Rad, USA).

4.2.8 Isolation of lymphocytes from spleen of immunized animal

Mice were sacrified on 30th day after the aerosol challenge, Spleen and lymph node (axillary, brachial, and inguinal), were collected aseptically from euthanized, ex- sanguinated experimental mice and homogenized to recover the single cell suspension were prepared as described elsewhere (Cooper AM et al. 2002). Splenic cells were passed through a cell strainer using a syringe plunger, and treated with ACK lysis buffer to lyse red blood cells. The cell suspension was centrifuged at 1200Xg for 3 min and cell pellet was washed with HBSS solution 3 times and resuspended in RPMI 1640 medium containing 10% fetal bovine serum and 0.1% antimycotic cocktail.

4.2.9 Proliferation assays

MaulanaLymphocyte Azad proliferation Library, assay was Aligarhperformed as described Muslim elsewhere University (Sharma N, Agrewala JN. 2004). Briefly, lymphocytes isolated from the spleen and lymph node of mice belonging to various immunized groups were incubated in round bottomed 96-well plates (2x105 cells per well) in 200µL of RPMI 1640 medium with 10% fetal bovine serum. Briefly, lymphocytes (2x105) from spleen and lymph nodes were

Chapter -4

cultured in triplicates in 200 µl of complete RPMI-1640 supplemented with 10% FCS with optimal concentration of Acr-1 in 96 well U bottom plate. Cells incubated with the medium alone (without Acr-1) were used as control. After 48 hours, the cultured cells were pulsed with [methyl-3H]-thymidine (0.5 μCi/well) and 16h later, plates were harvested using Tomtec-Harvester-96 (Tomtec, Hamden, CT). The incorporated radioactivity was measured employing liquid β-scintillation counter (Wallac1450 Microbeta Trilux ; Perkin Elmer, Waltham, MA).

4.2.10 Immunophenotyping :

Cells were surface stained with fluorochrome labeled anti-mouse Abs and their respective isotype-matched controls, following method as described elsewhere (Singh V et al. 2010). Cells were stimulated with antigen in a setup as described above for the proliferation assays. After 48 h of incubation, cells were harvested and washed 2 times with staining buffer in ice. Cells were incubated with Fc block (2.4G2) and stained with anti-mouse fluorochrome-labeled monoclonal antibodies (CD4, CD44, CD62L CD-69 and isotype controls) for 30 min at 4oC. For staining with biotinylated antibodies, cells were incubated with. After washing cells were fixed in 1% paraformaldehyde and acquired using FACSAria II cell sorter (BD Biosciences). Data were analyzed with Diva software (version 6.1.2; BD Biosciences).

4.2.11 Statistical analysis:

All the experiment were repeated thrice with similar condition and Data were analyzed with the Student t test and repeated- measure analysis of variance with the Student-Newman-Keuls multiple-comparisons posttest by use of InStat software (version 3; GraphPad).

4.3 Results:

4.3.1 Concomitant immunization with Acr-1 antigen and boosting with BCG or MaulanaH37Ra induces Azadrobust lymphocyte Library, proliferation Aligarh and Th1 responseMuslim University The mice vaccinated in a prime boost strategy in combination of Acr-1 with BCG and H37Ra. The animals were rested for 120 days to generate bonafide memory response. Later, the animals were sacrificed and M.tb specific T cell response was monitored. As compared to BCG or Acr-1 alone, combination such as Acr-1-BCG and Acr-1-

Chapter -4

H37Ra, exhibited significantly higher T cell proliferation on in vitro priming cells with Acr-1. Control group immunised with placebo, failed to improve T cell recall response. Significantly increased T cell proliferation was observed in Acr-1-BCG and Acr-1-H37Ra immunised mice (p≤0.01) as, compared from the groups of mice immunized with BCG, Acr-1 and PBS (sham alone) (Fig: 4.1A) Serum samples obtained from mice vaccinated with Acr-1-BCG, Acr-1-H37Ra showed significantly greater IgG2a-type antibody levels, compared with those of BCG and Acr-1 alone vaccinated mice. Control groups of mice immunized with only PBS completely failed to generate reactive IgG2a isotypes (Fig: 4.1B).

Figure 4.1: Elicitation of immune response after prime boost with Acr-1 BCG. Mice were primed s.c with Acr-1 and 21 days later were administered booster dose of BCG / H37Ra (1x106 CFU/animal). Similarly the animals from control group were primed with Acr-1 and boosted with BCG. Animal were rested for 120 d before aerosol challenge with M.tb. Post 30 day challenge; mice were sacrificed and an invitro cell culture were set. T cell proliferation was studied after in vitro stimulation of cultures with Acr-1. The proliferation was measured by following [methyl 3H]- thymidine incorporation in the DNA of proliferative cells. (A) Lymphocytes were obtained from vaccinated mice and lympho proliferation was observed in presence of Acr-1 antigen. Bars represent the T cell proliferation and results are expressed as a stimulation Index (B) Acr-1 specific IgG1 and IgG2a isotype were detected in the serum samples and expressed as ratio of IgG2a/IgG1. Data shown were analyzed by Student t test and were shown as means of standard error of mean of ten animals in one group. Maulana Azad Library, Aligarh Muslim University 4.3.2 CD69 surface expression on activated CD4+ T lymphocytes present in lung of immunised animals.

The activation and proliferation of T cell response following M.tb infection is mandatory for controlling systemic infection. Both CD4 and CD8 T cell population play pivotal role in

Chapter -4

offering protection against M.tb infection. In order to evaluate the lymphocyte effector function, we determined the expression of surface antigen CD69 on CD4+ T cells. Importantly, CD4 specific CD69 cells were predominantly Th-1 cells. The CD69 antigen expression has been identified as the earliest activation marker on the surface of antigen specific lymphocytes in lung. Once CD69 is expressed it acts as a costimulatory molecule for T cell activation and proliferation (Lindestam Arlehamn CS, Sette A. 2014). In order to examine whether employed vaccine candidate (Acr-1- BCG and Acr-1-H37Ra) up regulate surface expression of CD69 (as direct assessment criteria of M.tb specific Th-1 response), we checked CD4 specific CD69 expression in lung T cells. A significantly higher expression level of CD69 was found in Acr-1-BCG and Acr-1-H37Ra as compared to the both BCG, Acr-1 and sham control (Fig: 4.2). The phenotypic and functional analysis of lung CD4+ CD69 could be a useful marker for the identification as well as enrichment of Th-1 cell specific vaccine against M.tb infection.

Figure 4.2: Significantly higher expression of CD69 on CD4+T cells in Acr-1- BCG vaccinated mice : Representative expression of CD 69 on CD +T cells was determined by FACS in Lung T cells in all vaccinated mice.Acr-1-BCG vaccinated mice showed higher expression of CD 69 surface expression on lung T cells.

4.3.3 Boosting BCG with Acr-1 induces CD4 specific T Cells with long lasting Memory and Effector Phenotype:

Induction of long-lasting immunity is a pivotal feature of a successful vaccine. Keeping this fact into consideration, we investigated how enduring T cell memory Maulanacan be elicited byAzad prepared Library, vaccine against AligarhM.tb. It is reported Muslim that combination University of immunodominant antigen with BCG can induce long-term T cell memory (Brandt L et al. 2000). CD4+T cells play an important role in the clearance of M.tb infection and also in induction of memory response in the immunized animals (Chen K, Kolls JK. 2013). It has been demonstrated that Acr-1 has a great immune potential to be used as

Chapter -4

future vaccine candidate (Siddiqui KF et al.2011). In the present study, we have tried to comply question that whether priming with Acr-1 antigen and boosting with BCG (vaccine) or H37Ra (environmental Mycobacteria) has the ability to induce memory response in the immunized subjects. We primed the animal with Acr-1 followed by boosting with BCG vaccine. We studied the effectiveness of immunization protocol along with its ability to boost sustenance of long-lasting memory T cells. After vaccination, the mice were rested for long duration (120 days) before challenge with M.tb, to establish bona fide T cell memory response (Gowthaman U et al. 2011). For this, we checked the expression of CD62L and CD44 on CD4 T cells. Interestingly, we observed, that significant increase in the number of effector memory CD4 T cells expressing CD44hiCD62Llow in mice immunized with Acr-1-BCG or H37Ra as compared to BCG, Acr-1 and sham control group. Although statistically insignificant, there was increase in number of effector memory CD4T cells in group immunized with Acr-1-H37Ra (Fig: 4.3A)

Maulana Azad Library, Aligarh Muslim University

Chapter -4

Figure 4.3: Induction of CD4 T cell effector and central memory response upon immunized with Acr-1 antigen followed by boosting with BCG or H37Ra. Lymphocytes isolated from spleen and lymph nodes were incubated with Acr-1 and assessed or the expression of CD4, CD44 and CD62L by flow cytometry. (A) Best representative dot plot of each group indicating CD4 T cells expressing CD44 and CD62L among various groups placebo BCG, Acr-1, Acr-1/H37Ra, Acr-1/BCG. Numbers in the inset indicate percentage of cells Bars indicate the mean percentage of CD4 expressing (B) CD44hiCD62Llow (C) CD44hiCD62Lhi. Data were analyzed by student t test and were shown as the means of (Standard error of the mean) of five animals in one group.

4.3.4 Vaccination with Acr-1 with BCG induces better protection against M.tb infection:

MaulanaWe next explored Azad protective Library, efficacy of various Aligarh vaccine preparations Muslim on the Universitybasis of their potential to suppress bacterial load in lungs and spleens of the immunized mice. On 120 days post last booster vaccination, mice were challenged with live M.tb H37Rv. Vaccinated mice showed significant (P ≤.001) reduction in the growth of M.tb, tubercles and necrotic lesion were very less as compared with that in the

Chapter -4

unvaccinated control group. We determined residual bacterial burden in homogenate prepared from the spleens and lungs from Acr-1–H37Ra, Acr-1-BCG vaccinated mice. After 4 weeks, plate was counted and observed that, Vaccine candidate of Acr- 1-BCG and Acr-1-H37Ra showed significant reduction in bacterial burden in immunized animals when compared to sham group. Acr-1 in a prime boost vaccination with BCG and H37Ra, significantly stand protective for decrease in the Mycobacterial load in lung of mice immunized as, compared to placebo. Mice

vaccinated with Acr-1-BCG exhibited a corresponding to 1.5log10 significant decrease

in CFU while 1log10 decrease in mice vaccinated with Acr-1-H37Ra (as shown in Fig : 4.4). However, there was no significant difference in CFU between two vaccinated groups. The control groups of mice immunized with only PBS failed to show any significant growth of bacteria.

Figure 4.4: Reduced Mycobacterium tuberculosis load in lungs of mice immunized with Acr-1-H37Ra and Acr-1-BCG. The representative bar graph shows bacterial colonies from lung of infected mice in each group. The lung tissues Maulanawere analyzed Azad for processingLibrary, of the MAligarhycobacterial loMuslimad by enumerating University plate. Bars indicate the log CFU/g of lung. Statiscal analysis was performed by Student t test.

4.4 Discussion:

The failure of BCG vaccine against latent M.tb is one of the most important factors that jeopardise serious global TB epidemic related healthcare in recent decades

Chapter -4

(Kaufmann SH. 2013). Latent Mycobacteria persist in a dormant, non-replicating state with a potential to renaissance, whenever the favourable conditionpromote their establishment as virulent pathogen (Gupta A et al. 2012). BCG is currently the only available and most widely used vaccine against tuberculosis. The effectiveness of BCG varies greatly from 0–80%.

In this study we choose a dormancy associated Acr-1 i.e; Heat shock protein as a vaccine to boost BCG mediated protection against tuberculosis. The DosR regulated α-crystalline protein, induces cellular and humoral immune response (Van Eden W et al. 2005).The immunization with Acr-1 administered either as a protein or DNA or recombinant BCG boost desirable immune response in the host (Yuan Y et al. 1998). It has been reported that rBCG (over expressing HSP-X) increases the efficacy of BCG (Shi C et al. 2010). Subsequently, a better vaccine strategy can still be generated, either by over expressing multiple DosR regulated gene or expressing antigens of both dormant and replicating bacilli.

The present study was conducted to examine the influence of prime boost vaccination of Acr-1 with BCG to impart long-term sustenance of memory T cell response against M.tb infection. The following major findings have emerged from the study: prime boost vaccination of Acr-1 with BCG and H37Ra successfully generated robust immune response along with enduring memory T cells in the host. As evidenced by (1) augmented proliferation of T cells; (2) predominant production IgG2a; (3) upregulated expression of CD4 expressing CD44hiCD62Llow(central) and CD44hiCD62Lhi(effector) (4) an enhanced pool of multifunctional CD4 specific CD69 expression (5) when combined together Acr-1 and BCG caused reduction in the Mycobacterial burden.

Compared with control (immunization schedule involving BCG or H37Ra), Acr-1 priming combined with boosting BCG/H37Ra substantially evoked long lasting CD4 specific T cell memory response. The combination elicited protective immunity Maulanaagainst M.tb. TheAzad combination Library, evoked enhanced Aligarh proliferation Muslim of CD4+ University CD 69 expression was noticed in lung T cells, which indicates the predominance of a Th1- like response. This eventually led to elevated production of Th-1 like response. To further validate our results on the generation of the Th1 response, we next monitored levels of IgG1 and IgG2a isotypes upon exposure to combination of Acr-1 and BCG.

Chapter -4

There was predominant up regulation of secretion of M.tb–specific IgG2a-type antibodies in the animal immunised with Acr-1-BCG combination. B cells priming executed by Th1 cells, mainly produce IgG2a; whereas when they interact with Th2 cells, secretion of IgG1 isotype occurs (Swain SL et al. 2006). It is a widely accepted that protection against M.tb depends mainly on up regulation of IFN-γ producing Th1 cells (Scanga CA et al. 2000). It is well established that successful activation of host immune system is accompanied with expression of CD69 on CD4+T cells in tuberculous pleurisy (Li L et al. 2011). Encouraged with immune boosting response against Acr-1-BCG as well as Acr-1-H37Ra combination, we performed CD4 +CD- 69 intracellular staining on lung T Cells population. We observed that the majority of CD69 cells were higher in Acr-1-BCG. Prime boost Vaccination with Acr-1-BCG /H37Ra resulted in upregulation of memory CD4 specific T cells, indicating that the crucial blend of CD4 T cells is elicited by Acr-1-BCG and Acr-1-H37Ra combination.

In general, the adaptive immune response is initiated in the local lymph nodes afterward; effector cells migrate to the site of infection to counter the invading pathogen (Wolf AJ et al. 2008 and Reiley W et al. 2008). Splenocytes and lymph node from vaccinated mice, immunised with prime boost vaccination strategy regimen, exhibited significantly higher T cell proliferation at low antigen concentration. This explicity suggests immunogenic nature of Acr-1 protein. Increased T cell proliferation (stimulation index) observed in both Acr-1-BCG and Acr-1-H37Ra. Immunity of the lungs plays a seminal role in imparting protection against M. tuberculosis. Consequently, we substantiated our study by demonstrating that Acr1-BCG/H37Ra combination significantly reduced Mycobacterial load and alleviated the pathology in the lungs. Inhibition of the Mycobacterial burden correlates with the enduring protective efficacy of memory T cells against tuberculosis on vaccination.

MaulanaOn the basisAzad of immune Library,-prophylactic Aligarh data generated, Muslim we propose that University failure of the BCG vaccine to confer long-term protection against tuberculosis, particularly in areas where it is endemic, may be circumvented by supplementing BCG immunization protocol with DosR regulated protein. Our results also indicate that prime boost vaccine regimen Acr-1-BCG/H37Ra, can be considered as potential vaccine strategy

against M.tb infection. 93

Chapter-5 SELECTIVE TARGETING OF 4SO4-N- ACETYL-GALACTOSAMINE FUNCTIONALIZED M. TB PROTEIN LOADED CHITOSAN NANOPARTICLE TO MACROPHAGES: CORRELATION WITH ACTIVATION OF IMMUNE SYSTEM

Maulana Azad Library, Aligarh Muslim University Chapter -5

5.1 INTRODUCTION

Tuberculosis, an important infectious disease, is a leading cause of death across the world. Approximately one third of the world is infected with M. tb, resulting in more than eight million new cases and two million deaths annually worldwide (Van Soolingen D. 2001). Overwhelming numbers of both tuberculosis and non-tuberculous Mycobacteria (NTM) have emerged as prevalent clinical entities (Espy MJ et al. 2006). The situation is further complicated by the development of multiple antibiotic resistances among Mycobacteria associated infections. Beside emergence of untreatable clinical isolates, failure in the prevention and eradication of Mycobacterial biofilm poses a number of serious health issues (Yang SC et al. 2001). Biofilm formation has been elucidated as an important factor having significant presumption in pathogen virulence. Biofilm shields the pathogen from inhibitory effect of both antibiotics as well as immune cells (Hall-Stoodley L, Stoodley P. 2005). In order to develop effective strategies to curb this important disease, it is desirable to have better understanding of Mycobacterial pathogenesis, involved virulence factors and its interaction with host cell macrophages.

Mycobacterium smegmatis, with its short generation time and requirement of low biosafety level, serves as an appropriate model to study pathogenesis of genus Mycobacterium in general. Further, M. smegmatis shares important virulence gene homology with M. tuberculosis therefore might be helpful to understand different host-microbe aspects of virulent Mycobacteria (Altaf M et al. 2010). Being relatively long-lived, macrophages are used as a persistent reservoir of invading Mycobacterium spp. (De Chastellier C. 2009). Besides offering a safe heaven against antibody onslaught infected macrophages contribute to maintain sub therapeutic concentrations of antibacterial medications through continuous efflux of the antibiotics (Adams KN et al. 2011). Recently nanotechnology has emerged as a platform for designing nanoparticles not only as a therapeutic delivery system for controlling Mycobacterial Maulanainfection, Azad however, canLibrary, be used as adjuvant Aligarh in development Muslim of vaccine University or therapeutics carrier for boosting immune response against M.tb infection.

The potential advantage of using nano-formulations over conventional therapies include their capacity to encapsulate or conjugate a variety of drugs/antigens thus offering tunable and site-specific targeted release of the entrapped solute (Weissleder

Chapter -5

R et al. 2005). In addition, nano-system based delivery system overcome biological barriers improve stability, solubility, bioavailability and eventually facilitate sustained release of therapeutic substances. A wide range of nanomaterials have been used to deliver M.tb specific therapeutic agent (Dube A et al. 2013). Among various nanoparticle based delivery systems, chitosan co-polymers have been widely used as effective delivery vehicles (Meerak J et al. 2013).

Chitosan based nanoparticles (CNPs) have been reported to kill target bacterial cells by disturbing their cell wall. The interaction of CNPs with target bacteria ensues in leakage of cytoplasmic contents, inactivation of respiratory enzymes and protein responsible for RNA and DNA replication. CNPs act like a “molecular knife” and contrive damage to bacterial cell wall even at low concentration (Rabea EI et al. 2003). The hollow, porous chitosan shell also permits high loading of therapeutics molecule. Additionally, CNPs safeguard degradation of entrapped therapeutics agent by apposing polyvalent layers on the surface of core entrapped material (Amidi M et al. 2010). The targeted delivery of the in-house developed CNPs was achieved by

conjugation of 4-SO4-GalNAc on the surface. The ligand 4-SO4-GalNAc is recognized by the C-type lectins (pattern-recognition receptor), a highly expressed receptor on the surface of phagocytic macrophages (Drickamer K.1992).

In the present study, we investigated uptake of as-synthesised CNPs by macrophages that eventually evoked host immune response against M. smegmatis. We evaluated functionalized CNPs for multipurpose applications. The focus of the study was to establish,

(1) Role of CNPs for its possible antibacterial and antibiofilm activity against M. smegmatis.

(2) Immunological potential of Acr-1 protein loaded chitosan nanoparticles (CNP- A) upon interaction with the host macrophages.

Maulana(3) Potential ofAzad 4-SO4-GalNAc Library, ligand bearing Aligarh CNPs for their Muslim ability to enhance University the immunological response against M. smegmatis.

Chapter -5

5.2 Material and Method

5.2.1 Reagent

Chitosan (70 deacetylation) and 4-SO4-N-acetyl galactosamine (4-SO4-GalNAc), Tween 80, Tripolyphosphate (TPP) 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) Sodium tripolyphosphate (TPP) dialysis bag (cut off mol. wt. = 12 kD), antibiotic solution (penicillin/streptomycin, 0.1%v/v) were purchased from Sigma–Aldrich (St. Louis, USA). Tissue culture media DMEM and Fetal Calf Serum (FCS) were purchased from Gibco and plastic-wares were purchased from BD Biosciences (USA).Other reagents and chemicals used were of analytical grade and obtained commercially unless stated otherwise. The triple distilled water was used in all experiments by a three-stage Millipore Milli-Q plus 185 purification system (Bedford, MA, US).

5.2.2 Cell line, animals and bacterial culture growth condition

M. smegmatis was cultured in 7H9 broth medium (supplemented with glycerol and tween-80) by shaking for 3 days at 37°C. Murine macrophage cell line, RAW264.7, was cultured in Dulbecco’s modified Eagle’s medium (DMEM; HIMEDIA, Mumbai, India) supplemented with 10% fetal bovine serum, 1% penicillin-streptomycin solution, 1% L-glutamine and HEPES [4-(2-hydroxyethyl)-1-piperazineethanesulfonic

acid], at 37°C in humidified air supplemented with 5% CO2.

5.2.3 Synthesis and characterization of Acr-1 protein loaded chitosan nanoparticles

High-molecular-weight chitosan was used in synthesis of CNPs. The nanoparticles were prepared following published method as standardized in our lab (Ko JA et al. 2002). Briefly, chitosan solution (1 mg/ml) was prepared in 1% acetic acid and the mixture was stirred at 37oC to obtain a homogeneous solution. Dissolved chitosan solution containing 1% (w/w) Tween 80 was mixed with M. tb Acr-1 protein. MaulanaThereafter, Azad 2 ml of Library, an aqueous TPP Aligarh solution (1mg/ mlMuslim) was added dropUniversity wise to the chitosan–Acr-1 solution with stirring. The resulting Acr-1 loaded chitosan nanoparticles (CNP-A) were separated from suspensions by centrifugation for 30 min at 10,000×g with successive washes with deionised plain water. The pellet was dried and re-suspended in 0.1% acetic acid solution in normal saline. Plain chitosan

Chapter -5

nanoparticles (CNP) were prepared following same method as described above omitting inclusion of Acr-1 protein.

5.2.4 Surface modification of as-synthesised CNPs with ligand 4-SO4-GalNAc

The Acr-1 loaded chitosan NPs was chemically modified with 4-SO4-GalNAc employing method as reported earlier with slight modifications (Alex SM et al. 2011).

In brief, 4-SO4-GalNAc was dissolved in 0.1 M acetate buffer (pH 3.0) and added to as-synthesised Acr-1 loaded chitosan suspension (CNP-A). The mixture was agitated at ambient temperature (30 ± 2oC) for 48 h to accomplish the reaction. The as-formed particles (CNP-L) were dialyzed against triple distilled water in dialysis bag (cut off mol. wt.=12 kD) for 18 h. Finally, an aliquot of nanoparticle (CNP-L) suspension was centrifuged for 30 min at 10,000×g and 4oC. The pellet was resuspended in 100µl of normal saline. The average particle size, polydispersity index (PDI) and zeta potential of the CNPs, CNP-A, and CNP-L nanoparticles was determined employing a Zeta- sizer 3000 (Malvern Instruments Ltd., Malvern, UK) in 5 mM HEPES (pH-7.4). The

formulation was dispersed in low concentration phosphate buffer (5mM PO4, pH-7.4) for determination of zeta potential. The particle size distribution of the NPs was reported as a polydispersity index.

5.2.5 Fourier transforms infrared spectroscopy

FTIR was used to characterize as-synthesized CNPs, employing method published

elsewhere (Kong J, Yu S. 2007). The chemical conjugation of 4-SO4-GalNAc with chitosan was confirmed by FTIR spectrum, recorded on FTIR multi-scope spectrophotometer equipped with spectrum v3.02 software.

5.2.6 High resolution transmission electron microscopy (HR-TEM)

The as-synthesised CNPs were subjected to morphological characterization; employing HR-TEM (Hashimoto A et al. 2004). A drop of various formulations of CNPs was placed onto a carbon-coated copper grid, forming a thin liquid film. For MaulanaTEM analysis, aAzad drop of aqueous Library, suspension Aligarhcontaining the CNP,Muslim CNP-A and University CNP-L based NPs was put on carbon-coated copper grids to get a thin liquid film. The samples were dried and desiccated before loading onto a specimen holder.

Chapter -5

5.2.7 Percent Entrapment Efficiency (%EE)

For determination of actual amount of Acr-1 protein in formed chitosan nanoparticles, an aliquot of CNP-A (1ml) was suspended in mixture of DMSO and 0.1% acetic acid (1:20) and vortexed for half an hour followed by overnight magnetic agitation in the dark at 37oC; centrifuged at 10000×g for 15 min. Complete solubilisation of NPs caused release of entrapped Acr-1 in the surrounding solution. At various time intervals, the supernatant was decanted and released Acr-1 was determined employing micro BCA protein assay method (Agnihotri SA et al. 2004). A sample consisting of plain CNPs re-suspended in PBS was used as blank. The experimental set up was performed at least in triplicate. The amount of protein entrapped in the formed NP was determined following. Loading efficiency (LE) for Acr-1 was determined calculated as follows:

5.2.8 In vitro killing assay to determine anti-Mycobacterial potential of as- synthesised CNPs

To determine the anti-Mycobacterial activity of various as-formed NPs viz; CNP, CNP-A and CNP-L, the NPs were co-incubated with M. smegmatis (4×105 bacteria per well) in 7H9 broth medium in a 96 well plate. The optical density of the bacteria was adjusted to 1.0 at 600 nm. The total volume of the incubation mixture was kept 200µl per well. Bacteria were harvested at the indicated time points and the number of colony-forming units (CFUs) present in aliquoted sample was determined. The experiment was performed in triplicate and values were averaged from three independent trials.

5.2.9 Anti-Mycobacterial potential of as-synthesised CNPs as determined by agar diffusion assay

MaulanaM. smegmatis Azad culture Library, was grown for 48Aligarh h in 7H9 medium Muslim and pelleted University at 5000×g for 5 min. The final pellet was washed with 1×PBS and re-suspended in 7H9 medium. The suspended culture (100µL) was spread uniformly on 7H9 agar plates and incubated at 37oC for 30 min. Increasing amount of CNP, CNP-A and CNP-L were loaded onto various wells along with control drug. The zone of inhibition was determined by

Chapter -5

measuring clear zone in bacterial lawn around corresponding well after 24-48 h of incubation (Bonev B et al. 2008).

5.2.10 Cytotoxicity assay

RAW264.7 cells (1×105cells/ml) were grown in DMEM in a 96-well plate at 37oC in

an atmosphere of 5% carbon dioxide (CO2) for 24 h. The cells were exposed to increasing concentration of various NP for 24 h. To determine the cell viability after 24 h exposure to various formulation viz. CNP, CNP-A and CNP-L, 20 µL of MTT stock solution (5.0 mg/ml in PBS, pH 7.4) was dispensed in each well. The plate was o incubated for 4 h at 37 C in an atmosphere of 5% CO2 in the dark. The supernatant was aspirated carefully, and blue formazan crystals formed by the reduction of MTT were dissolved in buffer (sodium dodecyl sulphate [SDS] [11 g] in 0.02 M hydrochloric acid [HCl] [50 ml] and isopropanol [50 ml]). The absorbance was measured at 570 nm on a micro plate reader (Bio-Rad Model 550; USA). The experiment was performed in triplicate and mean value was used as the final representative result. Since absorbance is proportional to the number of living cells, cell viability was represented by the absorbance ratio of exposed cells to untreated control cells, which was expressed as a percentage. Chitosan-untreated cells in media were used as control (Fisichella M et al. 2009).

5.2.11 FITC labelling of nanoparticle and M. smegmatis cell

Various as-synthesised chitosan NPs were labelled with fluorescein isothiocyanate (FITC) following procedure as published elsewhere (Lu CW et al. 2007). Briefly, CNP-based formulation (500 mg) was incubated with FITC (5 mg, dissolved at 2.5 mg/ml in dimethyl sulfoxide [DMSO] in 50 ml sodium carbonate buffer (0.1 M, pH 9.2) overnight at 37°C in the dark. Unreacted FITC was quenched by treatment with Tris buffer (10 ml, 1.0 M, pH 8.3) for 30 min. The labelled nanoparticles were extensively washed with sterile water until no colour; residue remained followed by Maulanadehydration with Azad absolute ethanolLibrary, and acetone, Aligarh and finally dried Muslim under vacuum University in the dark at room temperature.

M.smegmatis was labelled with TRITC following published protocol (Chassaing B et al. 2011). Briefly, bacterial cells were suspended in 1×PBS. TRITC (2.5 mg/ml in DMSO) was added to the bacterial cell suspension and stirred at room temperature in

Chapter -5

the dark for 3-4 h. Subsequently, Tris buffer (2.0 ml, 1.0 M, pH 8.3) was added, and reaction mixture was stirred for additional 15 min at room temperature to quench the free form of fluorescent labelling reagent. The labelled bacteria were centrifuged at 7000×g and dialysed against water followed by lyophilisation in dark.

5.2.12 Cellular uptake study of as formed CNPs by RAW264.7 cells employing confocal laser microscopy

The interaction of as-synthesised CNPs with RAW264.7 cells was followed by cellular uptake study employing confocal laser microscopy. Briefly RAW cells, seeded at a density of 5×105 cells/cover slip using DMEM along with 10% FBS, were cultured at o 37 C in a humidified atmosphere with 5% CO2. Various FITC-labelled CNPs, denoted as FITC-CNP, FITC-CNP-A and FITC-CNP-L were incubated with macrophage cells at 37oC. Uptake kinetics of as-synthesised nanoparticle by RAW264.7 cells was assessed in time dependent manner (Wang T et al. 2012). The cells were rinsed three times with 1×PBS and fixed with 4% paraformaldehyde. For the nucleus staining, fixed cells were incubated with 1.0 mg/ml DAPI solution at 37oC for 30 min, prior to analysing confocal microscopy. All the samples were examined under Confocal Laser Scanning Microscopy (LSM510 DUO, Zeiss).

5.2.13 Antibacterial potential of as-synthesised CNPs against intracellular M. smegmatis

To examine antibacterial potential of as-synthesised CNPs against intracellular M. smegmatis, infected macrophages (5×105 RAW cells) were treated with as-synthesised CNPs for 24 h. The RAW cells were exposed to M. smegmatis infection for 3 h prior to treatment. Control setups consisting of uninfected RAW264.7 were also exposed to as-synthesised CNPs. Extracellular bacteria were killed by the addition of gentamicin (20µg/ml). After stipulated incubation, cells were washed and lysed with 0.5% Triton X-100; intracellular survival was estimated by plating serially diluted cultures on 7H9 Maulanaagar plates Azad and the colonies Library, were enumerated Aligarh after 72 hMuslim. University 5.2.14 Potential of as-synthesised CNPs to generate intracellular ROS

CNPs mediated generation of intracellular ROS in treated bacterial cells was estimated using 2`,7` Dichlorofluorescein diacetate (DCFDA) dye (Eruslanov E, Kusmartsev S. 2010). M. smegmatis cells (1×105 cells /well) were seeded on coverslips. After 24 h,

100

Chapter -5

the bacterial cells were exposed to CNPs for 6h. The un-interacted CNPs were washed off using 1×PBS. Thereafter, the cultured cells were exposed to DCFDA dye (30µM/ml) for 30 min at 37oC. The excess of DCFDA was removed following subsequent washing. The CNP treated experimental and control cells were visualised for qualitative analysis of ROS generation, employing fluorescence microscope (Zeiss model, United States).

5.2.15 Anti-biofilm potential of as-synthesised CNPs

M. smegmatis biofilm was cultured in polystyrene 96 well microtiter plates (Corning Inc., USA) following published procedure (Stepanović S et al. 2000) Briefly,

overnight cultured M. smegmatis cells were suspended at the 1.0 absorbance (O.D.600) in RPMI-1640 medium. After 3 days preformed biofilm was treated with 100 μg of the nanoparticle suspension/50μL/well using 96 well microtiter plates. The plates were covered with lids and incubated at 37°C. After 36 h of treatment with CNPs, the plate was washed with PBS, and the biofilm activity was assessed by XTT (2,3-Bis-(2- Methoxy-4-Nitro-5-Sulfophenyl)-2H-Tetrazolium-5-Carboxanilide) reduction assays. Biofilms were also observed by SEM and confocal microscopy. The biofilm- harbouring wells were washed with PBS buffer, fixed with glutaraldehyde, dehydrated with ethanol, and dried in vacuum desiccators. The samples were coated with gold and observed by a scanning electron microscope. The M. smegmatis biofilms for confocal microscopic studies were prepared employing similar methods, except that medium 7H9 also was used for culture.

5.2.16 Live/Dead staining of CNPs treated M. smegmatis biofilm

To study the effect of CNPs on biofilm inhibition, M. smegmatis was grown to an 7 OD600 of 1.0 and diluted 1:100 in 7H9 broth medium. Aliquots of 600 µl (10 CFU/ml) of diluted culture were transferred to a sterile 13 mm coverslip. The cells were exposed to MIC and sub-MIC concentration of CNPs. Control samples were prepared Maulanaon a sterile glass Azad coverslip Library, with M. smegmatis Aligarh cells only (positive) Muslim and 7H9 University media only (negative) without any CNPs. The wells were washed twice with 3 min of sterile 0.9% saline. The cells were stained with a 1.5 ml mixture of 0.8 μM SYTO-9 green fluorescent dye and 10 μM propidium iodide (PI) red fluorescent dye of Live/Dead staining kit (LIVE/DEAD® BacLight™ Bacterial Viability Kit, Thermo Fisher Scientific, Waltham, MA, USA) (Boulos L et al. 1999).

101

Chapter -5

5.2.17 Effect of CNPs on M. smegmatis biofilm as revealed by confocal microscopy

Confocal microscopy was employed to assess effect of as-synthesised CNPs on M. smegmatis biofilm. The biofilm was grown on a cover slip. After 72h, the preformed biofilms were treated with a sub inhibitory concentration of various CNPs. The treated biofilm was visualized by confocal microscopy using Layer-scanning model. The treated M. smegmatis biofilm was washed with PBS, fixed with 4% formaldehyde, and stained for SYTO-9/PI staining for 1 hour followed by washing step to remove unbound biofilm and dye, observed with a confocal microscope (LSM710, Zeiss, Germany).

5.2.18 Effect of as-synthesized CNPs on expression of co-stimulatory molecules in treated macrophages

To study the role of various as-synthesised CNPs on expression of co-stimulatory molecule, 5×105 macrophages cells in DMEM (supplemented with 10% fetal calf serum, and 2% HEPES) were seeded in each well of a 24 well plates. Bacteria were

grown to an OD600 ranging from 0.6 - 0.8, passed through a 26 Gauge needle 3 times and allowed to settle for 10 min. The infection was carried out at a multiplicity of infection (MOI) of 10:1 for 3 h in duplicate wells. The extracellular bacteria were removed by 3 washes using PBS. The cells were incubated in DMEM medium supplemented with 100 μg/ml gentamycin for 1 h and treated with various CNPs

formulation. After 24 h of nanoparticle treatment at 37°C and 5% CO2, cells were recovered and stained with phycoerythrin-labelled fluorescent antibodies obtained from BD Pharmingen. Cell surface expression of CD80, CD86, CD40, and major histocompatibility complex (MHC) class II was assessed by flow cytometer (EPICS XL; Beckman Coulter) (Dong H et al. 1999).

5.2.19 Statistical Analysis

MaulanaStatistically Azad significan Library,ce of data among Aligarh groups was determinedMuslim using Universitythe Student’s t- test (two-tailed, equal variances.

102

Chapter -5

5.3 Results 5.3.1 Characterization of surface decorated CNPs employing FTIR and TEM

We employed chitosan and tripolyphosphate TPP as the “fixing materials” to fabricate chitosan shells through anionic and cationic electrostatic interactions. Tween 80 was used to prevent particle aggregation. TPP was used as the cross-linkers to form the CNPs particles. The resultant CNP-A did not allow leakage of entrapped Acr-1 protein. The TEM analysis suggests that the mean particle size of the CNPs in 5mM saline was 17 and 29 nm for CNP-A and CNP-L nanoparticles as compared with 14 nm for unloaded chitosan nanoparticles (Fig: 5.1 A). The polydispersity index was 105 for plain CNP, 186 for CNP-A and 226 for CNP-L respectively. The PDI data indicated a narrow size distribution and a good colloidal stability of the as-synthesised NPs. The as-synthesised CNPs acquired positive surface charge. A significant increase in zeta potential was observed, when CNPs were conjugated with Acr-1 and ligand. CNP-A and CNP-L had a zeta potential of ± 11.2 and 12.2mV in 5mM saline compared with ±9.01 for plain CNP. Next we assessed the zeta potential of macrophage co-cultured with CNPs. We observed highest zeta potential in CNP-L group (±30.2) as compared to both CNP-A (±26.3) and CNP (±24.5) group. The control macrophages (untreated) had a negative zeta potential value (-13.3mv)(Fig: 5.1-B).

Maulana Azad Library, Aligarh Muslim University

103

Chapter -5

Figure 5.1: (A) Physical characterization of as-synthesised CNPs. Transmission MaulanaElectron AzadMicroscopic Library, images of CNP, Aligarh CNP-A and CNP Muslim-L (CNPs) nanoparticles University (scale bar; 100 nm); (B) Zeta potential of as synthesised CNPs were checked after synthesis and after co-culturing of CNPs with macrophages. Macrophage co-cultured with CNPs show highest binding propensity in all synthesised CNPs (C) Fourier Transformation Infrared Microscopy of CNPs (Poly Dispersion Index and Zeta Potential of CNPs as determined by Malvern Zeta Sizer); (D) Acr-1 antigen release from CNP-A/CNP-L nanoparticle at stipulated pH-5.5.

104

Chapter -5

5.3.2 FTIR Spectroscopy

The FTIR spectroscopic studies of various as-synthesised CNPs have been shown in Figure 5.1C. The FTIR spectra of prepared chitosan and its conjugated form consist of various important absorption bands characteristics of various functional groups. The spectrum was recorded in the middle infrared wave number in 4000 to 500-1 cm-1 range. The amine NH- stretching vibrations were observed at 3500-3300 cm-1 and that for C-H were observed at 2900 in various CNPs groups. The absorption peaks at 1600- 1000 cm-1 can be correlated to the presence of the C=O stretching of the amide I band. Bending vibrations of the N–H (N-acetylated residues, amide II band), C-H bending, OH−1 bending respectively were also observed in all three CNPs group. An upshifted new peak appeared at high wave number in both CNP-A and CNP-L between 1690 to 1630 and can be attributed to the amide C==0 stretch of Acr protein. The strong sharp peak in 3400-2900cm-1 was also observed in upshifted manner re-presenting Amine NH stretch in both CNP-A and CNP-L. The observed broadening of peak at 3400cm-1 in CNP-A and CNP-L can be correlated to hydrogen bonding. The spectrum showed the characteristic peaks of the substituted secondary amide in the 3300–3400 cm-1 region. The peaks observed at 1100 to 600 cm-1 can be attributed to the C-S stretching vibrations of sulfides and disulfides bonds in CNP-L (Fig: 5.1-C).

5.3.3 Encapsulation Efficiency of CNP-A nanoparticles

Earlier reports suggested that the encapsulation efficiency of antigen with nanoparticle was due to the electrostatic and hydrophobic interaction between the Acr-1 protein and chitosan nanoparticle and this could be a reason for the increase in size of the particle (Gan Q, Wang T. 2007). Fig: 5.1A represent the TEM images of the CNP-A nanoparticle that showed some structural changes when loaded with Acr-1. The entrapment efficiency of the Acr-1 in chitosan nanoparticle was calculated and it was found that 79% of Acr-1 antigen was loaded in CNP. On the other hand when Acr-1 loaded chitosan (CNP-A) was conjugated with ligand, increase in size was observed in MaulanaCNP-L (Fig: 5. 1AzadA) Library, Aligarh Muslim University

5.3.4 In vitro antigen release

The profile of Acr-1 antigen release, under simulated acidic (pH-5.5) environment, from CNP-A loaded and CNP-L nanoparticles are shown in Fig: 5.1D. The amounts of

105

Chapter -5

the antigen released from the CNPs after 6 h of incubation at pH 5.5 exceed 35% of the loaded protein. The particle showed good physical stability in acidic condition and their size did not noticeably change. The present result showed that under simulated phagosomal condition (pH-5.5) 70 % of the loaded antigen was released after 12-14 h from CNP-A and CNP-L nanoparticle.

5.3.5 Antibacterial activity of various as-synthesised CNPs

The anti-bacterial activity of various as-synthesised CNPs against M. smegmatis was assessed following published protocol (No HK et al. 2002). Exponentially grown bacteria were incubated with increasing concentrations of various CNPs. The MIC of various CNPs was determined using serial two-fold dilution against bacterial inoculum of 1×108 CFU/ml. The positive control consisted of 7H9 broth medium with tested bacterial inoculum and negative control contained only broth. The MIC is the minimal concentration of anti-microbial agent that visually inhibits 99% growth of bacteria. The MIC was assessed on the basis of visual turbidity of the tubes both before and after incubation of as-synthesised CNPs. The residual bacterial load was assessed by harvesting bacteria at various time points and plating serial dilutions of suspension on 7H9 agar plates. The residual live bacteria were enumerated after 72 h incubation. The MBC was observed to ensure presence or absence of bacterial growth in 7H9 agar plates. The MBC endpoint is defined as the lowest concentration of antimicrobial agent that kills 99.9% of the initial bacterial population (Fig: 5.2A). CNP-A formulation showed less antibacterial activity as compared to plain CNP and CNP-L in significant manner (Fig: 5.2B). The observation suggests, Acr-1 inhibits antibacterial activity. Both CNP and CNP-L nanoparticles treatment showed significant inhibitory activity against M. smegmatis in dose-dependent manner (Fig: 5.2B). The anti- mycobactericidal activity of various as-synthesised CNPs was also assessed by Agar diffusion method. All synthesised CNPs were evaluated for their anti-bacterial activity against 106 CFU/ml of the M. smegmatis on agar plate. After 72 h, all three NPs viz. MaulanaCNP, CNP Azad-A and CNP Library,-L showed a clearAligarh zone of inhibition. Muslim The plate University loaded CNP-A group demonstrated less zone of inhibition as compared to CNP and CNP-L formulation. Acr-1 protein alone failed to impart any antibacterial activity, as suggested by a dense population of bacteria in agar plate. Interestingly, CNP-A contribute important role in immuno-stimulation of the host by evoking immune response against M. smegmatis.

106

Chapter -5

Figure 5.2: (A) Bacteriocidal and bacteriostatic effect of CNP against M.smegmatis using 7H9 agar plates showing (a) untreated cells ; (b) CNP treatment showing inhibition of bacterial growth at MIC dose of 145µg/ml (c) CNP treatment at higher dose of MIC (400 µg/ml) showed bacterididal activity against M.smegmatis and (B) Show dose dependent killing of M. smegmatis by various as-synthesised CNPs (a) Antibacterial activity of various CNPs based formulation was assessed by agar diffusion method: Various CNPs (CNP, CNP-A and CNP-L) were loaded at 100μg/ 20μL dose into wells of the plate exposed to M. smegmatis. Growth, inhibition was determined by measuring the zone of inhibition formed in bacterial lawn after 48 h; erythromycin was used as a control. (b) M. smegmatis culture was incubated with increasing concentrations of both CNP and CNP-L group to study dose dependent killing efficiency of as-synthesised CNPs.

5.3.6 CNPs mediated damage of M. smegmatis cell wall

Scanning electron microscopy was used to study interactions between CNPs and M. smegmatis (Fig: 5.3A) shows that M. smegmatis cells lost it cellular integrity after exposure to CNP and CNP-L treatment at a concentration of 100µg/ml whereas Maulanauntreated cells Azad(control group) Library, remained intactAligarh (Je JY, KimMuslim SK. 2006) .University Longer treatment with CNPs resulted in the formation of large sized bacterial aggregates. Next we assessed the potential of pre-formed CNP and CNP-L nanoparticles to inhibit pre formed M. smegmatis biofilm under in vitro conditions by monitoring SEM analysis. We observed that both CNP groups were efficient to inhibit biofilm mass after 36 h

107

Chapter -5

treatment. CNP-L treatment was more effective as compared to CNP at the same dose in terms of biofilm inhibition (Fig: 5.3B).

Figure 5.3: CNPs treatments disintegrate the M. smegmatis cell wall. (A) Scanning Electron Microscopic images showing disruption in cell wall morphology of single M. smegmatis (control) and after exposure to as-synthesised CNP-L (100µg/ml) for 36 h. Maulana(B) (i) ControlAzad M. Library, smegmatis biofilm Aligarh (untreated) (ii)Muslim CNP treatment University inhibits the biofilm formation and (iii) CNP-L treatment at same dose showed more biofilm inhibition after 36 h. (C) Biofilms were grown and treated with CNP and CNP-L followed by incubation with XTT for 1 h, absorbance at 495 nm was measured for biofilm inhibition. Increased killing of M. smegmatis was observed at 200 µg/ml dose of CNP-L.

108

Chapter -5

5.3.7 Intracellular ROS production by as-synthesised CNPs

In order to determine intracellular ROS production by CNPs, we followed fluorescence probe 2`,7`-Dichlorofluorescein diacetate (DCFH-DA) employing fluorescence microscope. DCFDA is cell permeant indicator and employed to probe ROS. The acetate groups of the DCFH-DA are removed by intracellular esterases to form a non-fluorescent product 2`,7` Dichlorofluorescein (DCFH). The DCFH dye reacts with generated reactive oxygen species (ROS) to produce the fluorescent product 2,7 Dichlorofluorescein (DCF) which gets trapped within the cells making it fluorescent. A significant quantitative concentration dependent increase in % ROS was observed increase in the form of fluorescence on treatment with as-synthesised CNPs at 100µg/ml (Fig: 5.4).

Figure 5.4: Fluorescence micrograph showing the generation of intracellular reactive oxygen species (ROS) using DCFDA dye in CNPs treated M. smegmatis cells (a) Control cell (b-c) cells exposed to CNP and CNP-L at pre fix MIC dose for 6 hours showing increases in fluorescence intensity demonstrating excess generation of ROS production.

5.3.7 Assessment of Biofilm inhibition by as-synthesised CNPs using SYTO-9 dye

Biofilms limit diffusion of drug molecules and proffer to the pathogenesis of underlying infection. The biofilm inhibition is crucial to halt bacterial colonization and also to increase the susceptibility of bacteria against given therapeutic agent. M. smegmatis is known for its ability to form biofilms (Zambrano MM, Kolter R. 2005). We determined potential of CNPs to inhibits biofilm formation (and/or disrupted the preformed biofilms) under in vitro conditions by monitoring the binding of the SYTO- Maulana9 dye to live bacterial Azad cells (SYTOLibrary,-9 Stained Aligarhcell- green colour Muslim) (Fig: 5.5) University

109

Chapter -5

Figure 5.5: Confocal microscope image showing M. smegmatis biofilm inhibition Maulanaby CNPs Azad as visualised Library, in 63X oil immersion Aligarh magnification: Muslim Antibiofilm University activity of CNPs was assessed by incubating M. smegmatis with increasing concentrations of CNPs for 36 h in a 6-well plate. The treated biofilm was stained with SYTO-9/PI. The addition of increasing concentration (100 to 200 µg/ml) of CNPs inhibited M. smegmatis biofilm formation. Red-dye showing PI-stain corresponds to killing activity, Green dye showing viable bacteria in pre formed biofilm. Yellow colour corresponds to co-localization of merged green and red dye at same place.

110

Chapter -5

As Acr-1 protein did not impart any antimicrobial activity, we avoid including CNP-A group in biofilm treatment studies. To assess the effect of CNP treatment on disruption of preformed biofilms, M. smegmatis biofilm were grown for 48 h in a 6-well microtiter plate. The biofilm was exposed to increasing concentration of CNPs. Significant, disruption of preformed biofilms was observed in CNP and CNP-L nanoparticle treated group (killed bacteria were stained with PI-Red stain. In contrast, early exposure of M. smegmatis to CNP and CNP-L NPs resulted in significant inhibition of biofilm formation. Our confocal data showed that both CNP and CNP-L at dose of 100 µg/ml treatment for 36 h decreased more than 50% and 60% of the biofilms inhibition respectively. Whereas exposure with both CNP and CNP-L at the dose 200µg/ml, dose resulted in more than 60% and 65% killing of bacteria respectively (Fig: 5.3 C).

5.3.8 Safety evaluation & Cytotoxicity assay

Despite potent anti-bacterial activity of chitosan, the use of CNP as therapeutic agents

is limited. It can be speculated that chitosan conjugation with ligand (4-SO4-GalNAc) coating resulted in modulation of host immune cell component. As M. smegmatis is an intracellular pathogen, we used the MTT assay to test the cytotoxicity of various CNPs in a dose dependent manner on RAW264.7 cell line (Kuo JH et al. 2005). In MTT assay, metabolically active cells reduce MTT to purple formazan; the intensity of dye read at 570 nm is directly proportional to the number of viable cells. The cytotoxicity assay showed a dose dependent drop in cell viability (Fig: 5.6). The cell viability was not significantly affected at 24 h of incubation in the presence of 100-200µg/ml a dose that was found to be lethal for the bacteria tested in this study. Cell viability dropped drastically at the dose of 500µg/ml. We also examined the macrophages cell morphology in a monolayer culture after the treatment with varying concentrations of CNP, CNP-A and CNP-L NPs. Microscopic observations showed no distinct morphological changes in the cells treated with a bactericidal dose (200 µg/ml) of MaulanaCNPs group. Azad Library, Aligarh Muslim University

111

Chapter -5

Figure 5.6: Assessment of cytotoxic activity of various as-synthesised CNPs against mouse macrophages 264.7 cells. Macrophages were treated with increasing concentration of CNPs for 24 h: cell viability was determined by MTT assay. Experiments were performed in triplicate; results are shown as mean ± standard deviation.

5.3.9 Cellular uptake of CNPs by RAW264.7 cell

We followed interaction of CNPs with macrophages in context of surface charge (zeta potential) of the target cells. Our goal was to determine cellular binding of nanoparticle with macrophage membrane. All cells generate an electrical potential across their plasma membrane driven by concentration gradient of charged ions. NPs used in diagnostic and therapeutic applications are treated as inert probes or delivery vehicles for infectious diseases. While NP-delivered therapeutic agent expected to alter a cell, it is assumed that the NP itself will not change the biological system as such. Previous reports had shown that the cellular binding of NPs is affected by membrane potential (He C et al. 2010). We first examined the membrane potential of RAW264.7 cells in order to study the effect of binding propensity of CNPs to the Maulanaplasma membraneAzad Library, independent of Aligarh internalization. Muslim Membrane potential University of intact macrophages cell was checked followed by CNPs internalization. Cellular binding of CNPs with macrophages cell showed increased positive potential (Fig: 5.1 B).

112

Chapter -5

Figure 5.7: Confocal microscope image showing cellular uptake capacity of ligand conjugated chitosan nanoparticles by RAW264.7 mouse macrophages cell line: Macrophage cells were treated with equal concentration of CNP, CNP-A and CNP-L NPs for 4 h and checked for co-localization of NP in cells. (A) Low uptake of various as-synthesised various CNPs was observed in uninfected RAW macrophages (B) MaulanaWhile M. smegmatis Azad infected Library, RAW cells were Aligarh more susceptible Muslim to engulf CNP University-L as compared to both CNP and CNP-A nanoparticle. Staining is as follows: Blue–DAPI– stained nuclei, Green–FITC labelled CNPs and Red–TRITC labelled M. smegmatis cells. Post 4 h incubation, more no of CNP-L was seen inside the cytoplasm as compared to CNP-A and CNP. Scale bar shows 10 μm. Pearson’s coefficients were calculated and expressed as mean value ± SD for at least 3 images obtained in three independent experiments.

113

Chapter -5

Next, we employed confocal microscopy study to investigate the interaction of NPs with RAW cells. RAW264.7 cells were treated with varying concentration of FITC labelled CNP, CNP-A and CNP-L for 4 h (Fig: 5.7 A) (Anes E et al. 2006). Confocal microscopy images demonstrated that FITC-CNP-A and FITC-CNP-L NPs are efficiently taken up by infected macrophages as compared to plain CNP group. The uptake of CNP-A and CNP-L by RAW264.7 cells was at least five times more to that of plain CNPs. The data highlighted representative images of live cells incubated with FITC-CNP, CNP-A and CNP-L for 4 h in RAW264.7 control cells and TRITC-tagged M. smegmatis infected macrophages cell. While in untreated control cultures (Fig: 5.7 B), low fluorescence was detected. Infected cells treated with FITC-CNP-L NPs, fluorescence intensity increased with the NPs uptake (Fig: 5.7 B). The lowest fluorescence intensity was observed in control CNP group tested, high level of cellular uptake was observed in CNP-L group, at same dose. The results support the data and demonstrate that the FITC-CNP-L conjugated NPs were efficiently and rapidly taken up by the infected cells demonstrating the role of galactose residue ligand for specific recognition by C-type lectins, mannose receptor highly expressed on infected macrophages. In addition, the confocal analysis allowed us to visualize the intracellular distribution of the fluorescent Acr-1 (either encapsulated in chitosan alone and along with surface modified galactosylated chitosan nanoparticle) into the macrophage cells. Fig: 5.7 B, shows that the fluorescence is distributed inside the cells, confirming the internalization of the NP in infected cell. By comparing the cellular uptake of CNP, CNP-A and CNP-L, the uptake of CNP-L (Fig: 5.7 A-B) in both uninfected control cells and infected cells, we again observed a higher rate of delivery of FITC–CNP-L NPs confirming the targeted delivery of therapeutic molecule through ligand targeted mannose receptor in infected macrophage cells.

5.3.10 Efficacy of CNPs in killing of intracellular M. smegmatis and also upregulation in expression of co-stimulatory molecules in infected macrophages Maulanaafter treatment Azad with Library, CNPs Aligarh Muslim University Macrophages are professional phagocytic cells that can internalize particles up to 10 µm in size. Keeping this fact into consideration, we hypothesized that exogenous addition of CNPs groups may lead to endocytosis of all modified nanoparticles by macrophages, resulting in intracellular killing of bacteria. Fluorescence microscopy

114

Chapter -5

was used to follow internalization of FITC labelled CNPs by TRITC-M. smegmatis infected macrophages. CNP internalization was followed in both infected as well as uninfected macrophages under identical conditions. The control macrophages (uninfected) showed minimal FITC-CNPs internalization, however, the TRITC-M. smegmatis infected macrophages showed active endocytosis of fluorescently labelled CNP-L NPs as compared to CNP and CNP-A NPs group (Fig: 5.7 B).

The infection conditions and intracellular survival kinetics of M. smegmatis had already been well characterized in macrophages. For this reason, we chose this model to evaluate the killing activity of M. smegmatis–infected macrophages after 24 h treatment with various CNPs. Macrophages were infected with M. smegmatis infection, before 3 h prior to interaction with various CNPs at prefixed dose. The concentration of nanoparticles used in the study was found to be nontoxic to the macrophages (Fig: 5.6). A significant reduction in intracellular bacterial survival was observed after 24 h treatment with CNP-L and CNP-A in terms of CFU count after plating on 7H9 agar as compared with untreated macrophages (Fig: 5.8). Treatment with CNPs had no effect on the phagocytosis of M. smegmatis by RAW cells.

MaulanaFigure 5.8: Chitosan Azad-based Library, conjugated nanoparticlesAligarh (CNPs) Muslim kill intracellular University Mycobacterium smegmatis. RAW264.7 macrophage cells were incubated with various CNPs formulation for 24 h after M. smegmatis infection. Macrophages infected with bacteria alone were used as a control. The cells were lysed after 24 h post infected macrophages and intracellular bacterial survival was determined by determining colony-forming unit (CFU) assay. Experiments were performed in triplicate; results are shown as ± standard deviation; *P ≤0.0

115

Chapter -5

Next, we checked how Acr-1 based nanoparticles can enhance immune response against M. smegmatis infection (Fig: 5.9).

Figure 5.9: Flow Cytometry analysis of Co-stimulatory molecule in M. smegmatis Maulanainfected Azadmacrophages Library, cell line: Post Aligarh 24 h treatment withMuslim all CNP, CNP University-A and CNP- L groups, infected macrophages cell were acquired and checked for costimulatory molecule expression by FACS analysis. (i-iv) showed that CNP-L group are more efficient to enhance upregulated expression of co-stimulatory molecule CD- 40/80/86/MHC-II, expressed on M. smegmatis infected macrophage cell as compared to CNP and CNP-A group.

116

Chapter -5

The infected macrophages undergo subtle changes upon establishment of M. smegmatis infection. The optimum expression of both MHC as well as co-stimulatory molecules on APCs is imperative in deciding its future interaction with effector T cells in term of their activation ((Demotz S et al. 1990). Many reports suggest adjuvant potential of CNPs against infectious diseases (Prego C et al. 2007). The confocal data demonstrated that uninfected macrophages are less efficient in CNP intake while infected macrophages are more efficient in uptake of CNP-L. Further, the flow cytometer data showed that both CNP-A and CNP-L nanoparticles successfully up regulate expression of CD-80/86/40/MHC-II molecule on RAW264.7 cells (Fig: 5.9).

5.4 DISCUSSION

Mycobacterium pathogens adapt intracellular mode of parasitism as a strategy to counteract antibody onslaught. Incidentally intracellular abode also help them to withstand antibiotics used as a modality in tuberculosis treatment, as they fail to access bacteria residing inside the cells (Wakamoto Y et al. 2013). The situation needs development of drug delivery system that can deliver effective antibiotic directly inside the infected cells (Wu W et al. 2005). In recent times, nanomedicines have received a great deal of attention as a therapeutic agent because of their unique mode of action (Moghimi SM et al. 2005). The data of the present study suggest that a specific dose of CNPs can inhibit or kill the Mycobacterium without harming the host cells. We prepared chitosan based NPs and assess their anti-Mycobacterial activity. It was found that plain CNPs possess strong antibacterial activity, which depends on a multiple factors viz. chitosan molecular weight; the viscosity, ionic strength, pH, and presence of metallic ions in the medium; the temperature; and the concentration of chitosan in composite preparations (Rinaudo M et al.1993).

Next, we supplemented CNPs with Acr-1 protein and evaluated the anti-bacterial as well as immunomodulatory role of the combination. We also surface decorated CNP-

A with a ligand (4-SO4-GalNAc) that recognised C-type lectins, surface molecule of Maulanamacrophages or Azadother APC Library, (McGreal EP et Aligarh al. 2005). Various Muslim as-synthesised University CNPs used in this study were found to be stable at both physiological as well as at 4°C up to at least for 1month time period even when present in solution.

Under specific conditions chitosan provided a hollow cage like structure that protects Acr-1 and also coerce a strong interaction with ligand on the periphery of

117

Chapter -5

nanocomposites (Li X et al. 2008). Chitosan binds to metal ions of ligand because of the presence of amine and hydroxyl groups. The as-synthesised CNPs, as determined by FTIR-spectra and TEM studies, were found to be spherical and remained stable for a longer duration. (Fig: 5.1 A,B).

The present study showed distinct differences in the susceptibility of M. smegmatis strain to various as-synthesised CNPs. CNP and CNP-L were found to be more effective in killing of M. smegmatis. In contrast, CNP-A was not significantly effective in killing of M. smegmatis due to unequal proportion of chitosan vs Acr-1 protein ratio as compared to other groups hence proving Acr-1 antigen has not manifested toxicity issue. The interaction of as-synthesised CNPs and M. smegmatis could be correlated to cationic chitosan and the negatively charged molecules present on bacterial cell wall (Raafat D et al. 2008). In contrast, the Mycobacteria cell wall is rich in lipids such as mycolic acids and thus limits the binding and permeability of drug molecules (Nikaido H. 2003). To study the mechanism by which CNPs inactivate bacterial cells components, the effect on cell integrity and disturbance was evaluated by scanning electron microscopy (Fig: 5.3 A,B). The data indicated that irreversible damage could be induced on Mycobacterial cells after direct contact with CNPs and CNP-L treatment. The damage to the cell may be caused by interactions of CNP and CNP-L with free amino group- and sulphur- containing compounds (Sahariah P, Masson M. 2017). Both core chitosan and surface ligand moiety tend to have a high affinity for such molecules. The inhibitory effect could also be due to diffusion of CNPs through the channels present in the biofilms (Wilking JN et al. 2013). Taken together, the data indicate that chitosan-based CNPs not only exhibit potent anti-mycobactericidal activity but also impede the biofilm formation.

Mycobacterium has been reported to synthesize exopolysaccharides that protect it from the host cell offensives. The anti-biofilm activity could be correlated to inhibition of exopolysaccharide synthesis it has been shown that CNPs impair exopolysaccharide Maulanasynthesis Azad in M. smegmatis Library, cells limiting Aligarh the formation Muslim of biofilm (Hall University-Stoodley L, Stoodley P. 2005). The inhibition of biofilm can also be linked to inhibition in iron uptake responsible for biofilm formation in Mycobacteria. This distinction could be because of the presence of abundant LPS, which leads to strong interaction with CNP, produced by M. smegmatis.

118

Chapter -5

The present study further demonstrated that CNPs treatment lead to generation of ROS production in M. smegmatis. The direct correlation between ROS generation and oxidative stress may lead to DNA damage, further suggest as an important route by which CNPs treatment causes DNA damage leading to inhibition or killing of M. smegmatis cells.

An important aspect for any molecule to be used as a therapeutic agent is that it should eliminate the target cells without affecting the viability of neighbouring host cells. Many medically relevant polymeric nanoparticles such as chitosan biomaterial have been investigated for their cytotoxicity, but different researchers have reported varying effects for these nanoparticles on mammalian cells. The observed differences have been largely attributed to individual CNPs preparation methodologies and target cells.

The interaction of CNPs with mouse macrophages cell line RAW264.7 resulted in cell lysis at higher dose of chitosan treatment, while, there was no harm to host macrophage cells upto dose of 100-300µg/ml. Interestingly, same dose was found to have cytotoxic effect to M. smegmatis after 72 h of treatment. The formulation CNP-L that harboured a modifier at the particle surface has been shown to have a significant inhibitory effect against M. smegmatis strain. In contrast, CNP-A was found to have very less antimicrobial effect against M. smegmatis strain.

Macrophages can readily internalize foreign material ranging up to 10 µm in size owing to their phagocytic function. Macrophages have been shown to be an ideal candidate for transporting antibacterial therapeutic molecule to various parts of the body. Since Mycobacteria are an intracellular pathogen that halt the endo-lysosomal fusion and reside in the phagosomal compartments of macrophages, it is important to deliver the therapeutic molecules to the target sites that would otherwise be inaccessible due to the presence of physical barriers (Levitte S et al. 2016).

We also observed active uptake of FITC-labelled CNPs by macrophages. CNPs uptake Maulanaby the RAW2 64.7Azad cells wasLibrary, executed through Aligarh C-type lectin Muslim receptors mediatedUniversity endocytosis. The elevated intracellular killing of M. smegmatis could be because of the delivery of endocytosed CNP-L and CNP-A to macrophages phagosome, where M. smegmatis resides. Alternatively, it could be because of the prolonged exposure (24h) of CNPs treatment and release of Acr-1 from the CNP-A (Koppolu B, Zaharoff DA. 2013). Treatment with CNPs up regulates the expression of co stimulatory molecule

119

Chapter -5

such as CD80/86/40/MHC-II. The up-regulation of co-stimulatory molecule is necessary for optimal activation of immune response that eventually results in elimination of pathogen.

5.5 Conclusion

Present study suggests that CNPs and CNP-L exhibit potent anti-Mycobacterial activity against intracellularly residing M. smegmatis. CNP mediated Mycobacterial cell inhibition may be attributed to both cell wall disruption as well as inactivation of thiol-containing proteins. Both, CNPs and CNP-L exhibit potent anti-biofilm activity against M. smegmatis. The MTT assay and cell morphology analysis results showed that various CNPs groups exhibit no discernible cytotoxic effect on macrophages at the bactericidal concentration. In contrast, treatment with higher doses caused significant decrease in cell viability.

The cellular uptake study indicated that FITC-labelled CNP-L are more efficiently and actively endocytosed by macrophages, which leads to intracellular killing of M. smegmatis. The present study concludes that CNP-A and CNP-L group elicit protective immune response against Mycobacterial infection in host macrophages. Various, CNPs nanoparticles developed in the present study provide a new insight that may help in designing both subunit vaccine as well as anti-tubercular drug delivery system to overcome the problem of drug resistance in Mycobacterial infections.

Maulana Azad Library, Aligarh Muslim University

120

BIBLIOGRAPHY

Maulana Azad Library, Aligarh Muslim University Bibliography

BIBLIOGRAPHY

Aagaard C, Hoang T, Dietrich J, Cardona PJ, Izzo A, Dolganov G, Schoolnik GK, Cassidy JP, Billeskov R, Andersen P. A multistage tuberculosis vaccine that confers efficient protection before and after exposure. Nature medicine. 2011 Feb;17(2):189.

Abdallah AM, Savage ND, van Zon M, Wilson L, Vandenbroucke-Grauls CM, van der Wel NN, Ottenhoff TH, Bitter W. The ESX-5 secretion system of Mycobacterium marinum modulates the macrophage response. The Journal of Immunology. 2008 Nov 15;181(10):7166-75.

Abebe M, Kim L, Rook G, Aseffa A, Wassie L, Zewdie M, Zumla A, Engers H, Andersen P, Doherty TM. Modulation of cell death by M. tuberculosis as a strategy for pathogen survival. Clinical and Developmental Immunology. 2011 Jan 4;2011.

Adams KN, Takaki K, Connolly LE, Wiedenhoft H, Winglee K, Humbert O, Edelstein PH, Cosma CL, Ramakrishnan L. Drug tolerance in replicating mycobacteria mediated by a macrophage-induced efflux mechanism. Cell. 2011 Apr 1;145(1):39-53.

Agnihotri SA, Mallikarjuna NN, Aminabhavi TM. Recent advances on chitosan-based micro-and nanoparticles in drug delivery. Journal of controlled release. 2004 Nov 5;100(1):5-28.

Agrewala JN, Wilkinson RJ. Differential regulation of Th1 and Th2 cells by p91–110 and p21–40 peptides of the 16-kD α-crystallin antigen of Mycobacterium tuberculosis. Clinical and experimental immunology. 1998 Dec;114(3):392.

Aldovini A, Young RA. Humoral and cell-mediated immune responses to live recombinant BCG–HIV vaccines. Nature. 1991 Jun;351(6326):479.

MaulanaAlex SM, Azad Rekha MR,Library, Sharma CP. Aligarh Spermine grafted Muslim galactosylated University chitosan for improved nanoparticle mediated gene delivery. International journal of pharmaceutics. 2011 May 30;410(1-2):125-37.

121

Bibliography

Altaf M, Miller CH, Bellows DS, O’Toole R. Evaluation of the Mycobacterium smegmatis and BCG models for the discovery of Mycobacterium tuberculosis inhibitors. Tuberculosis. 2010 Nov 1;90(6):333-7.

Amidi M, Mastrobattista E, Jiskoot W, Hennink WE. Chitosan-based delivery systems for protein therapeutics and antigens. Advanced drug delivery reviews. 2010 Jan 31;62(1):59-82.

Amidi M, Romeijn SG, Verhoef JC, Junginger HE, Bungener L, Huckriede A, Crommelin DJ, Jiskoot W. N-trimethyl chitosan (TMC) nanoparticles loaded with influenza subunit antigen for intranasal vaccination: biological properties and immunogenicity in a mouse model. Vaccine. 2007 Jan 2;25(1):144-53.

Andersen P, Doherty TM. TB subunit vaccines—putting the pieces together. Microbes and infection. 2005 May 1;7(5-6):911-21.

Andersen P, Doherty TM. The success and failure of BCG—implications for a novel tuberculosis vaccine. Nature Reviews Microbiology. 2005 Aug;3(8):656.

Andersen P, Munk ME, Pollock JM, Doherty TM. Specific immune-based diagnosis of tuberculosis. The Lancet. 2000 Sep 23;356(9235):1099-104.

Andersen P. Vaccine strategies against latent tuberculosis infection. TRENDS in Microbiology. 2007 Jan 1;15(1):7-13.

Anes E, Peyron P, Staali L, Jordao L, Gutierrez MG, Kress H, Hagedorn M, Maridonneau‐Parini I, Skinner MA, Wildeman AG, Kalamidas SA. Dynamic life and death interactions between Mycobacterium smegmatis and J774 macrophages. Cellular microbiology. 2006 Jun;8(6):939-60.

Arend SM, Andersen P, van Meijgaarden KE, Skjøt RL, Subronto YW, van Dissel JT, Ottenhoff TH. Detection of active tuberculosis infection by T cell responses to Maulanaearly-secreted Azad antigenic Library, target 6-kDa Aligarh protein and culture Muslim filtrate protein University 10. The Journal of infectious diseases. 2000 May 1;181(5):1850-4.

Arend SM, van Dissel JT. Evidence of endogenous reactivation of tuberculosis after a long period of latency. The Journal of infectious diseases. 2002 Sep 15;186 (6):876-7.

122

Bibliography

Areschoug T, Gordon S. Pattern recognition receptors and their role in innate immunity: focus on microbial protein ligands. InTrends in Innate Immunity 2008 (Vol. 15, pp. 45-60). Karger Publishers.

Asrat S, de Jesús DA, Hempstead AD, Ramabhadran V, Isberg RR. Bacterial pathogen manipulation of host membrane trafficking. Annual review of cell and developmental biology. 2014 Oct 6;30:79-109.

Attanasio J, Wherry EJ. Costimulatory and coinhibitory receptor pathways in infectious disease. Immunity. 2016 May 17;44(5):1052-68.

Barker LF, Brennan MJ, Rosenstein PK, Sadoff JC. Tuberculosis vaccine research: the impact of immunology. Current opinion in immunology. 2009 Jun 1;21(3):331-8.

Behr MA, Wilson MA, Gill WP, Salamon H, Schoolnik GK, Rane S, Small PM. Comparative genomics of BCG vaccines by whole-genome DNA microarray. Science. 1999 May 28;284(5419):1520-3.

Bekmurzayeva A, Sypabekova M, Kanayeva D. Tuberculosis diagnosis using immunodominant, secreted antigens of Mycobacterium tuberculosis. Tuberculosis. 2013 Jul 1;93(4):381-8.

Bérdy J. Bioactive microbial metabolites. The Journal of antibiotics. 2005 Jan;58(1):1.

Berthet FX, Rasmussen PB, Rosenkrands I, Andersen P, Gicquel B. A Mycobacterium tuberculosis operon encoding ESAT= 6 and a novel low- molecular-mass culture filtrate protein (CFP-10). Microbiology. 1998 Nov 1;144(11):3195-203.

Bhaskar S, Khanna SP, Mukherjee R. Isolation, purification and immunological characterization of novel low molecular weight protein antigen CFP 6 from Maulanaculture Azad filtrate Library, of M. tuberculosis. Aligarh Vaccine. 2000 Muslim Jun 15;18(25):2856 University-66.

Bloom BR, Murray CJ. Tuberculosis: commentary on a reemergent killer. Science. 1992 Aug 21;257(5073):1055-64.

123

Bibliography

Bonev B, Hooper J, Parisot J. Principles of assessing bacterial susceptibility to antibiotics using the agar diffusion method. Journal of antimicrobial chemotherapy. 2008 Mar 12;61(6):1295-301.

Boom WH, Canaday DH, Fulton SA, Gehring AJ, Rojas RE, Torres M. Human immunity to M. tuberculosis: T cell subsets and antigen processing. Tuberculosis. 2003 Feb 1;83(1-3):98-106.

Boulos L, Prevost M, Barbeau B, Coallier J, Desjardins R. LIVE/DEAD® BacLight™: application of a new rapid staining method for direct enumeration of viable and total bacteria in drinking water. Journal of microbiological Methods. 1999 Jul 1;37(1):77-86.

Bowdish DM, Sakamoto K, Kim MJ, Kroos M, Mukhopadhyay S, Leifer CA, Tryggvason K, Gordon S, Russell DG. MARCO, TLR2, and CD14 are required for macrophage cytokine responses to mycobacterial trehalose dimycolate and Mycobacterium tuberculosis. PLoS pathogens. 2009 Jun 12;5(6):e1000474.

Brandt L, Cunha JF, Olsen AW, Chilima B, Hirsch P, Appelberg R, Andersen P. Failure of the Mycobacterium bovis BCG vaccine: some species of environmental mycobacteria block multiplication of BCG and induction of protective immunity to tuberculosis. Infection and immunity. 2002 Feb 1;70(2):672-8.

Brandt L, Elhay M, Rosenkrands I, Lindblad EB, Andersen P. ESAT-6 Subunit Vaccination againstMycobacterium tuberculosis. Infection and immunity. 2000 Feb 1;68(2):791-5.

Brennan PJ. Structure, function, and biogenesis of the cell wall of Mycobacterium tuberculosis. Tuberculosis. 2003 Feb 1;83(1-3):91-7.

MaulanaBrown GD, Herre Azad J, Williams Library, DL, Willment Aligarh JA, Marshall AS,Muslim Gordon S. DectinUniversity-1 mediates the biological effects of β-glucans. Journal of Experimental medicine. 2003 May 5;197(9):1119-24.

124

Bibliography

Brown GD. Dectin-1: a signalling non-TLR pattern-recognition receptor. Nature Reviews Immunology. 2006 Jan;6(1):33.

Chan J, Flynn J. The immunological aspects of latency in tuberculosis. Clinical immunology. 2004 Jan 1;110(1):2-12.

Chan JO, Tanaka K, Carroll D, Flynn J, Bloom BR. Effects of nitric oxide synthase inhibitors on murine infection with Mycobacterium tuberculosis. Infection and immunity. 1995 Feb 1;63(2):736-40.

Chassaing B, Rolhion N, de Vallée A, Sa’ad YS, Prorok-Hamon M, Neut C, Campbell BJ, Söderholm JD, Hugot JP, Colombel JF, Darfeuille-Michaud A. Crohn disease–associated adherent-invasive E. coli bacteria target mouse and human Peyer’s patches via long polar fimbriae. The Journal of clinical investigation. 2011 Mar 1;121(3):966-75.

Chattergoon MA, Kim JJ, Yang JS, Robinson TM, Lee DJ, Dentchev T, Wilson DM, Ayyavoo V, Weiner DB. Targeted antigen delivery to antigen–presenting cells including dendritic cells by engineered Fas-mediated apoptosis. Nature biotechnology. 2000 Sep;18(9):974.

Chen K, Kolls JK. T Cell–mediated host immune defenses in the lung. Annual review of immunology. 2013 Mar 21;31:605-33.

Cipolla D, Chan HK. Inhaled antibiotics to treat lung infection. Pharmaceutical patent analyst. 2013 Sep;2(5):647-63.

Clancy JP, Dupont L, Konstan MW, Billings J, Fustik S, Goss CH, Lymp J, Minic P, Quittner AL, Rubenstein RC, Young KR. Phase II studies of nebulised Arikace in CF patients with Pseudomonas aeruginosa infection. Thorax. 2013 Jun 7:thoraxjnl-2012.

Clarke TB, Davis KM, Lysenko ES, Zhou AY, Yu Y, Weiser JN. Recognition of Maulanapeptidoglycan Azad Library, from the microbiota Aligarh by Nod1 Muslim enhances systemicUniversity innate immunity. Nature medicine. 2010 Feb;16(2):228.

125

Bibliography

Co DO, Hogan LH, Kim SI, Sandor M. Mycobacterial granulomas: keys to a long- lasting host–pathogen relationship. Clinical Immunology. 2004 Nov 1;113(2):130-6.

Colditz GA, Brewer TF, Berkey CS, Wilson ME, Burdick E, Fineberg HV, Mosteller F. Efficacy of BCG vaccine in the prevention of tuberculosis: meta-analysis of the published literature. Jama. 1994 Mar 2;271(9):698-702.

Cole S, Brosch R, Parkhill J, Garnier T, Churcher C, Harris D, Gordon SV, Eiglmeier K, Gas S, Barry Iii CE, Tekaia F. Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence. Nature. 1998 Jun;393(6685):537.

Compton OC, Nguyen ST. Graphene oxide, highly reduced graphene oxide, and graphene: versatile building blocks for carbon‐based materials. small. 2010 Mar 22;6(6):711-23.

Comstock GW. Efficacy of BCG vaccine. JAMA. 1994 Sep 14;272(10):766.

Cook GM, Berney M, Gebhard S, Heinemann M, Cox RA, Danilchanka O, Niederweis M. Physiology of mycobacteria. Advances in microbial physiology. 2009 Jan 1;55:81-319.

Cooper AM, Khader SA. The role of cytokines in the initiation, expansion, and control of cellular immunity to tuberculosis. Immunological reviews. 2008 Dec;226(1):191-204.

Cooper AM, Kipnis A, Turner J, Magram J, Ferrante J, Orme IM. Mice lacking bioactive IL-12 can generate protective, antigen-specific cellular responses to mycobacterial infection only if the IL-12 p40 subunit is present. The Journal of Immunology. 2002 Feb 1;168(3):1322-7. MaulanaCooper AM. Cell Azad-mediated Library, immune responses Aligarh in tuberculosis. Muslim Annual review University of immunology. 2009 Apr 23;27:393-422.

Cosma CL, Sherman DR, Ramakrishnan L. The secret lives of the pathogenic mycobacteria. Annual Reviews in Microbiology. 2003 Oct;57(1):641-76.

126

Bibliography

Cummings RD, McEver RP. C-type lectins. InEssentials of Glycobiology. 2nd edition 2009. Cold Spring Harbor Laboratory Press.

Dalmia N, Ramsay AJ. Prime–boost approaches to tuberculosis vaccine development. Expert review of vaccines. 2012 Oct 1;11(10):1221-33.

Danelishvili L, McGarvey J, Li YJ, Bermudez LE. Mycobacterium tuberculosis infection causes different levels of apoptosis and necrosis in human macrophages and alveolar epithelial cells. Cellular microbiology. 2003 Sep;5(9):649-60.

Daniel J, Maamar H, Deb C, Sirakova TD, Kolattukudy PE. Mycobacterium tuberculosis uses host triacylglycerol to accumulate lipid droplets and acquires a dormancy-like phenotype in lipid-loaded macrophages. PLoS pathogens. 2011 Jun 23;7(6):e1002093.

Dannenberg Jr AM, Rook GA. Pathogenesis of pulmonary tuberculosis: an interplay of tissue-damaging and macrophage-activating immune responses—dual mechanisms that control bacillary multiplication. InTuberculosis 1994 Jan 1 (pp. 459-483). American Society of Microbiology.

Dash M, Chiellini F, Ottenbrite RM, Chiellini E. Chitosan—A versatile semi- synthetic polymer in biomedical applications. Progress in polymer science. 2011 Aug 1;36(8):981-1014.

Davis MM, Bjorkman PJ. T-cell antigen receptor genes and T-cell recognition. Nature. 1988 Aug;334(6181):395.

De Chastellier C. The many niches and strategies used by pathogenic mycobacteria for survival within host macrophages. Immunobiology. 2009 Jul 1;214(7):526- 42.

de Val BP, Villarreal-Ramos B, Nofrarías M, López-Soria S, Romera N, Singh M, MaulanaAbad Azad FX, Xing Library, Z, Vordermeier Aligarh HM, Domingo Muslim M. Goats primed University with BCG and boosted with a recombinant adenovirus expressing Ag85A show enhanced protection agaist tuberculosis. Clinical and Vaccine Immunology. 2012 Jul 3:CVI-00275.

127

Bibliography

Delogu G, Bigi F, Hasnain SE, Cataldi A. 8 Enigmatic Proteins from the Surface: the Erp, PE, and PPE Protein Families. In The Mycobacterial cell envelope 2008 Jan 1 (pp.133-151). American Society of Microbiology.

Demotz S, Grey HM, Sette A. The minimal number of class II MHC-antigen complexes needed for T cell activation. Science. 1990 Aug 31;249(4972):1028-30.

Deng YH, He HY, Zhang BS. Evaluation of protective efficacy conferred by a recombinant Mycobacterium bovis BCG expressing a fusion protein of Ag85A-ESAT-6. Journal of Microbiology, Immunology and Infection. 2014 Feb 1;47(1):48-56.

Denis M, Gregg EO, Ghandirian E. Cytokine modulation of Mycobacterium tuberculosis growth in human macrophages. International journal of immunopharmacology. 1990 Jan 1;12(7):721-7.

Desel C, Dorhoi A, Bandermann S, Grode L, Eisele B, Kaufmann SH. Recombinant BCG Δ ure C hly+ Induces Superior Protection Over Parental BCG by Stimulating a Balanced Combination of Type 1 and Type 17 Cytokine Responses. Journal of Infectious Diseases. 2011 Sep 20;204(10):1573-84.

Dey B, Jain R, Khera A, Rao V, Dhar N, Gupta UD, Katoch VM, Ramanathan VD, Tyagi AK. Boosting with a DNA vaccine expressing ESAT-6 (DNAE6) obliterates the protection imparted by recombinant BCG (rBCGE6) against aerosol Mycobacterium tuberculosis infection in guinea pigs. Vaccine. 2009 Dec 10;28(1):63-70.

Dietrich J, Aagaard C, Andersen P, inventors; Statens Serum Institut (SSI), assignee. Vaccines comprising TB10. 4. United States patent US 8,557,258. 2013 Oct 15.

MaulanaDong H, Zhu G, Azad Tamada K,Library, Chen L. B7-H1, Aligarh a third member Muslim of the B7 family, University co- stimulates T-cell proliferation and interleukin-10 secretion. Nature medicine. 1999 Dec;5(12):1365.

128

Bibliography

dos Santos SA, Zarate-Blades CR, de Sa Galetti FC, Brandão IT, Masson AP, Soares EG, Araújo AP, Silva CL. A subunit vaccine based on biodegradable microspheres carrying rHsp65 protein and KLK protects BALB/c mice against tuberculosis infection. Human vaccines. 2010 Dec 1;6(12):1047-53.

Drickamer K. Engineering galactose-binding activity into a C-type mannose-binding protein. Nature. 1992 Nov;360(6400):183.

Dubaniewicz A, Holownia A, Kalinowski L, Wybieralska M, Dobrucki IT, Singh M. Is mycobacterial heat shock protein 16 kDa, a marker of the dormant stage of Mycobacterium tuberculosis, a sarcoid antigen?. Human immunology. 2013 Jan 1;74(1):45-51.

Dube A, Lemmer Y, Hayeshi R, Balogun M, Labuschagne P, Swai H, Kalombo L. State of the art and future directions in nanomedicine for tuberculosis. Expert opinion on drug delivery. 2013 Dec 1;10(12):1725-34.

Ehrt S, Schnappinger D. Mycobacterial survival strategies in the phagosome: defence against host stresses. Cellular microbiology. 2009 Aug;11(8):1170-8.

Eruslanov E, Kusmartsev S. Identification of ROS using oxidized DCFDA and flowcytometry. InAdvanced protocols in oxidative stress II 2010 (pp. 57-72). Humana Press, Totowa, NJ.

Espy MJ, Uhl JR, Sloan LM, Buckwalter SP, Jones MF, Vetter EA, Yao JD, Wengenack NL, Rosenblatt JE, Cockerill F3, Smith TF. Real-time PCR in clinical microbiology: applications for routine laboratory testing. Clinical microbiology reviews. 2006 Jan 1;19(1):165-256.

Etna MP, Giacomini E, Severa M, Coccia EM. Pro-and anti-inflammatory cytokines in tuberculosis: a two-edged sword in TB pathogenesis. InSeminars in immunology 2014 Dec 1 (Vol. 26, No. 6, pp. 543-551). Academic Press.

MaulanaFarinacci Azad M, Weber Library, S, Kaufmann SH. Aligarh The recombinant Muslim tuberculosis University vaccine rBCG ΔureC:: hly+ induces apoptotic vesicles for improved priming of CD4+ and CD8+ T cells. Vaccine. 2012 Dec 14;30(52):7608-14.

129

Bibliography

Fels AO, Cohn ZA. The alveolar macrophage. Journal of applied physiology. 1986 Feb 1;60(2):353-69.

Fiegel J, Clarke R, Edwards DA. Airborne infectious disease and the suppression of pulmonary bioaerosols. Drug discovery today. 2006 Jan 1;11(1-2):51-7.

Figdor CG, van Kooyk Y, Adema GJ. C-type lectin receptors on dendritic cells and Langerhans cells. Nature Reviews Immunology. 2002 Feb;2(2):77.

Fine PE. Bacille Calmette-Guerin vaccines: a rough guide. Clinical Infectious Diseases. 1995 Jan 1:11-4.

Fine PE. Variation in protection by BCG: implications of and for heterologous immunity. The Lancet. 1995 Nov 18;346(8986):1339-45.

Fiorentino DF, Zlotnik A, Mosmann TR, Howard M, O'garra A. IL-10 inhibits cytokine production by activated macrophages. The Journal of Immunology. 1991 Dec 1;147(11):3815-22.

Fisichella M, Dabboue H, Bhattacharyya S, Saboungi ML, Salvetat JP, Hevor T, Guerin M. Mesoporous silica nanoparticles enhance MTT formazan exocytosis in HeLa cells and astrocytes. Toxicology in vitro. 2009 Jun 1;23(4):697-703.

Flannagan RS, Cosío G, Grinstein S. Antimicrobial mechanisms of phagocytes and bacterial evasion strategies. Nature Reviews Microbiology. 2009 May;7(5):355.

Flynn JL, Chan J, Lin PL. Macrophages and control of granulomatous inflammation in tuberculosis. Mucosal immunology. 2011 May;4(3):271.

Fritz JH, Ferrero RL, Philpott DJ, Girardin SE. Nod-like proteins in immunity, inflammation and disease. Nature immunology. 2006 Dec;7(12):1250. Maulana Azad Library, Aligarh Muslim University Gagneux S, Long CD, Small PM, Van T, Schoolnik GK, Bohannan BJ. The competitive cost of antibiotic resistance in Mycobacterium tuberculosis. Science. 2006 Jun 30;312(5782):1944-6.

130

Bibliography

Gan Q, Wang T. Chitosan nanoparticle as protein delivery carrier—systematic examination of fabrication conditions for efficient loading and release. Colloids and Surfaces B: Biointerfaces. 2007 Sep 1;59(1):24-34.

Ganguly N, Giang PH, Gupta C, Basu SK, Siddiqui I, Salunke DM, Sharma P. Mycobacterium tuberculosis secretory proteins CFP-10, ESAT-6 and the CFP10: ESAT6 complex inhibit lipopolysaccharide-induced NF-κB transactivation by downregulation of reactive oxidative species (ROS) production. Immunology and cell biology. 2008 Jan;86(1):98.

Geldmacher C, Ngwenyama N, Schuetz A, Petrovas C, Reither K, Heeregrave EJ, Casazza JP, Ambrozak DR, Louder M, Ampofo W, Pollakis G. Preferential infection and depletion of Mycobacterium tuberculosis–specific CD4 T cells after HIV-1 infection. Journal of Experimental Medicine. 2010 Dec 20;207(13):2869-81.

Gengenbacher M, Kaufmann SH. Mycobacterium tuberculosis: success through dormancy. FEMS microbiology reviews. 2012 May;36(3):514-32.

Gerritsma JS, Hiemstra PS, Gerritsen AF, Prodjosudjadi W, Verweij CL, Van Es LA, Daha MR. Regulation and production of IL‐8 by human proximal tubular epithelial cells in vitro. Clinical & Experimental Immunology. 1996 Feb;103(2):289-94.

Giacomini E, Iona E, Ferroni L, Miettinen M, Fattorini L, Orefici G, Julkunen I, Coccia EM. Infection of human macrophages and dendritic cells with Mycobacterium tuberculosis induces a differential cytokine gene expression that modulates T cell response. The Journal of Immunology. 2001 Jun 15;166(12):7033-41.

Gimmi CD, Freeman GJ, Gribben JG, Gray G, Nadler LM. Human T-cell clonal anergy is induced by antigen presentation in the absence of B7 costimulation. MaulanaProceedings Azad ofLibrary, the National AcademyAligarh of Sciences. Muslim 1993 Jul 15;90(14):6586University- 90.

Gomes MG, Franco AO, Gomes MC, Medley GF. The reinfection threshold promotes variability in tuberculosis epidemiology and vaccine efficacy. Proceedings of

131

Bibliography

the Royal Society of London B: Biological Sciences. 2004 Mar 22;271(1539):617-23.

Goonetilleke NP, McShane H, Hannan CM, Anderson RJ, Brookes RH, Hill AV. Enhanced immunogenicity and protective efficacy against Mycobacterium tuberculosis of bacille Calmette-Guerin vaccine using mucosal administration and boosting with a recombinant modified vaccinia virus Ankara. The Journal of Immunology. 2003 Aug 1;171(3):1602-9.

Govender L, Abel B, Hughes EJ, Scriba TJ, Kagina BM, De Kock M, Walzl G, Black G, Rosenkrands I, Hussey GD, Mahomed H. Higher human CD4 T cell response to novel Mycobacterium tuberculosis latency associated antigens Rv2660 and Rv2659 in latent infection compared with tuberculosis disease. Vaccine. 2010 Dec 10;29(1):51-7.

Gowthaman U, Singh V, Zeng W, Jain S, Siddiqui KF, Chodisetti SB, Gurram RK, Parihar P, Gupta P, Gupta UD, Jackson DC. Promiscuous peptide of 16 kDa antigen linked to Pam2Cys protects against Mycobacterium tuberculosis by evoking enduring memory T-cell response. Journal of Infectious Diseases. 2011 Nov 1;204(9):1328-38.

Grant SS, Kaufmann BB, Chand NS, Haseley N, Hung DT. Eradication of bacterial persisters with antibiotic-generated hydroxyl radicals. Proceedings of the National Academy of Sciences. 2012 Jul 24;109(30):12147-52.

Gupta A, Kaul A, Tsolaki AG, Kishore U, Bhakta S. Mycobacterium tuberculosis: immune evasion, latency and reactivation. Immunobiology. 2012 Mar 1;217(3):363-74.

Gurunathan S, Wu CY, Freidag BL, Seder RA. DNA vaccines: a key for inducing long-term cellular immunity. Current opinion in immunology. 2000 Aug Maulana1;12(4):442 Azad-7. Library, Aligarh Muslim University Ha SJ, Jeon BY, Youn JI, Kim SC, Cho SN, Sung YC. Protective effect of DNA vaccine during chemotherapy on reactivation and reinfection of Mycobacterium tuberculosis. Gene therapy. 2005 Apr;12(7):634.

132

Bibliography

Hall-Stoodley L, Stoodley P. Biofilm formation and dispersal and the transmission of human pathogens. Trends in microbiology. 2005 Jan 1;13(1):7-10.

Harlow E, Lane D. Antibodies: A laboratory manual+ Cold Spring Harbor.

Hashimoto A, Suenaga K, Gloter A, Urita K, Iijima S. Direct evidence for atomic defects in graphene layers. Nature. 2004 Aug;430(7002):870.

He C, Hu Y, Yin L, Tang C, Yin C. Effects of particle size and surface charge on cellular uptake and biodistribution of polymeric nanoparticles. Biomaterials. 2010 May 1;31(13):3657-66.

Henao-Tamayo M, Ordway DJ, Orme IM. Memory T cell subsets in tuberculosis: what should we be targeting?. Tuberculosis. 2014 Sep 1;94(5):455-61.

Hess J, Miko D, Catic A, Lehmensiek V, Russell DG, Kaufmann SH. Mycobacterium bovis Bacille Calmette–Guérin strains secreting listeriolysin of Listeria monocytogenes. Proceedings of the National Academy of Sciences. 1998 Apr 28;95(9):5299-304.

Hickman SP, Chan J, Salgame P. Mycobacterium tuberculosis induces differential cytokine production from dendritic cells and macrophages with divergent effects on naive T cell polarization. The Journal of Immunology. 2002 May 1;168(9):4636-42.

Hirsch CS, Ellner JJ, Russell DG, Rich EA. Complement receptor-mediated uptake and tumor necrosis factor-alpha-mediated growth inhibition of Mycobacterium tuberculosis by human alveolar macrophages. The Journal of Immunology. 1994 Jan 15;152(2):743-53.

Hmama Z, Peña‐Díaz S, Joseph S, Av‐Gay Y. Immunoevasion and immunosuppression of the macrophage by M ycobacterium tuberculosis. Immunological reviews. 2015 Mar;264(1):220-32. Maulana Azad Library, Aligarh Muslim University Hoebe K, Janssen E, Beutler B. The interface between innate and adaptive immunity. Nature immunology. 2004 Oct 1;5(10):971.

Hoft DF, Blazevic A, Abate G, Hanekom WA, Kaplan G, Soler JH, Weichold F, Geiter L, Sadoff JC, Horwitz MA. A new recombinant bacille Calmette-

133

Bibliography

Guerin vaccine safely induces significantly enhanced tuberculosis-specific immunity in human volunteers. The Journal of infectious diseases. 2008 Nov 15;198(10):1491-501.

Horwitz, M.A., Harth, G., Dillon, B.J. and Masleša-Galić, S., 2000. Recombinant bacillus Calmette–Guérin (BCG) vaccines expressing the Mycobacterium tuberculosis 30-kDa major secretory protein induce greater protective immunity against tuberculosis than conventional BCG vaccines in a highly susceptible animal model. Proceedings of the National Academy of Sciences, 97(25), pp.13853-13858. Baumann S, Eddine AN, Kaufmann SH. Progress in tuberculosis vaccine development. Current opinion in immunology. 2006 Aug 1;18(4):438-48.

Houben EN, Nguyen L, Pieters J. Interaction of pathogenic mycobacteria with the host immune system. Current opinion in microbiology. 2006 Feb 1;9(1):76-85.

Hoving JC, Wilson GJ, Brown GD. Signalling C‐Type lectin receptors, microbial recognition and immunity. Cellular microbiology. 2014 Feb;16(2):185-94.

Huygen K. The immunodominant T-cell epitopes of the mycolyl-transferases of the antigen 85 complex of M. tuberculosis. Frontiers in immunology. 2014 Jul 9;5:321.

Indrigo J, Hunter Jr RL, Actor JK. Cord factor trehalose 6, 6′-dimycolate (TDM) mediates trafficking events during mycobacterial infection of murine macrophages. Microbiology. 2003 Aug 1;149(8):2049-59.

Ishikawa E, Mori D, Yamasaki S. Recognition of mycobacterial lipids by immune receptors. Trends in immunology. 2017 Jan 1;38(1):66-76.

Jackson M, Phalen SW, Lagranderie M, Ensergueix D, Chavarot P, Marchal G, McMurray DN, Gicquel B, Guilhot C. Persistence and protective efficacy of MaulanaaMycobacterium Azad tuberculosis Library, auxotroph Aligarh vaccine. InfectionMuslim and immunit Universityy. 1999 Jun 1;67(6):2867-73.

Jain R, Dey B, Dhar N, Rao V, Singh R, Gupta UD, Katoch VM, Ramanathan VD, Tyagi AK. Enhanced and enduring protection against tuberculosis by

134

Bibliography

recombinant BCG-Ag85C and its association with modulation of cytokine profile in lung. PLoS One. 2008 Dec 4;3(12):e3869.

Jakob U, Gaestel M, Engel K, Buchner J. Small heat shock proteins are molecular chaperones. Journal of Biological Chemistry. 1993 Jan 25;268(3):1517-20.

Je JY, Kim SK. Chitosan derivatives killed bacteria by disrupting the outer and inner membrane. Journal of agricultural and food chemistry. 2006 Sep 6;54(18):6629-33.

Kabelitz D. Expression and function of Toll-like receptors in T lymphocytes. Current opinion in immunology. 2007 Feb 1;19(1):39-45.

Kaech SM, Tan JT, Wherry EJ, Konieczny BT, Surh CD, Ahmed R. Selective expression of the interleukin 7 receptor identifies effector CD8 T cells that give rise to long-lived memory cells. Nature immunology. 2003 Dec;4(12):1191.

Karakousis PC, Bishai WR, Dorman SE. Mycobacterium tuberculosis cell envelope lipids and the host immune response. Cellular microbiology. 2004 Feb;6(2):105-16.

Kaufmann SH, Hussey G, Lambert PH. New vaccines for tuberculosis. The Lancet. 2010 Jun 12;375(9731):2110-9.

Kaufmann SH. Fact and fiction in tuberculosis vaccine research: 10 years later. The Lancet infectious diseases. 2011 Aug 1;11(8):633-40.

Kaufmann SH. Recent findings in immunology give tuberculosis vaccines a new boost. Trends in immunology. 2005 Dec 1;26(12):660-7.

Kaufmann SH. Tuberculosis vaccines: time to think about the next generation. InSeminars in immunology 2013 Apr 1 (Vol. 25, No. 2, pp. 172-181). MaulanaAcademic Azad Press. Library, Aligarh Muslim University

Kawai T, Akira S. Toll-like receptors and their crosstalk with other innate receptors in infection and immunity. Immunity. 2011 May 27;34(5):637-50.

135

Bibliography

Khan N, Gowthaman U, Pahari S, Agrewala JN. Manipulation of costimulatory molecules by intracellular pathogens: veni, vidi, vici!!. PLoS pathogens. 2012 Jun 14;8(6):e1002676.

Khasnobis S, Escuyer VE, Chatterjee D. Emerging therapeutic targets in tuberculosis: post-genomic era. Expert opinion on therapeutic targets. 2002 Feb 1;6(1):21- 40.

Khera A, Singh R, Shakila H, Rao V, Dhar N, Narayanan PR, Parmasivan CN, Ramanathan VD, Tyagi AK. Elicitation of efficient, protective immune responses by using DNA vaccines against tuberculosis. Vaccine. 2005 Dec 1;23(48-49):5655-65.

Kleinnijenhuis J, Oosting M, Joosten LA, Netea MG, Van Crevel R. Innate immune recognition of Mycobacterium tuberculosis. Clinical and Developmental Immunology. 2011 Apr 7;2011.

Ko JA, Park HJ, Hwang SJ, Park JB, Lee JS. Preparation and characterization of chitosan microparticles intended for controlled drug delivery. International journal of pharmaceutics. 2002 Dec 5;249(1-2):165-74.

Kong CU, Ng LG, Nambiar JK, Spratt JM, Weninger W, Triccas JA. Targeted induction of antigen expression within dendritic cells modulates antigen- specific immunity afforded by recombinant BCG. Vaccine. 2011 Feb 4;29(7):1374-81.

Kong J, Yu S. Fourier transform infrared spectroscopic analysis of protein secondary structures. Acta biochimica et biophysica Sinica. 2007 Aug;39(8):549-59.

Koppolu B, Zaharoff DA. The effect of antigen encapsulation in chitosan particles on uptake, activation and presentation by antigen presenting cells. Biomaterials. 2013 Mar 1;34(9):2359-69. Maulana Azad Library, Aligarh Muslim University Krug A, Towarowski A, Britsch S, Rothenfusser S, Hornung V, Bals R, Giese T, Engelmann H, Endres S, Krieg AM, Hartmann G. Toll‐like receptor expression reveals CpG DNA as a unique microbial stimulus for plasmacytoid

136

Bibliography

dendritic cells which synergizes with CD40 ligand to induce high amounts of IL‐12. European journal of immunology. 2001 Oct 1;31(10):3026-37.

Kuo JH, Jan MS, Chang CH, Chiu HW, Li CT. Cytotoxicity characterization of catanionic vesicles in RAW 264.7 murine macrophage-like cells. Colloids and Surfaces B: Biointerfaces. 2005 Mar 25;41(2-3):189-96.

Lalvani A, Brookes R, Wilkinson RJ, Malin AS, Pathan AA, Andersen P, Dockrell H, Pasvol G, Hill AV. Human cytolytic and interferon γ-secreting CD8+ T lymphocytes specific for Mycobacterium tuberculosis. Proceedings of the National Academy of Sciences. 1998 Jan 6;95(1):270-5.

Langlois RA, Legge KL. Respiratory dendritic cells: mediators of tolerance and immunity. Immunologic research. 2007 Nov 1;39(1-3):128-45.

Lee W, VanderVen BC, Fahey RJ, Russell DG. Intracellular Mycobacterium tuberculosis exploits host-derived fatty acids to limit metabolic stress. Journal of Biological Chemistry. 2013 Jan 10:jbc-M112.

Lee YC, Lee RT. Carbohydrate-protein interactions: basis of glycobiology. Accounts of chemical research. 1995 Aug 1;28(8):321-7.

Levitte S, Adams KN, Berg RD, Cosma CL, Urdahl KB, Ramakrishnan L. Mycobacterial acid tolerance enables phagolysosomal survival and establishment of tuberculous infection in vivo. Cell host & microbe. 2016 Aug 10;20(2):250-8.

Li L, Qiao D, Fu X, Lao S, Zhang X, Wu C. Identification of M. tuberculosis-specific Th1 cells expressing CD69 generated in vivo in pleural fluid cells from patients with tuberculous pleurisy. PLoS One. 2011 Aug 22;6(8):e23700.

Li X, Kong X, Shi S, Zheng X, Guo G, Wei Y, Qian Z. Preparation of alginate coated chitosan microparticles for vaccine delivery. BMC biotechnology. 2008 MaulanaDec;8(1):89. Azad Library, Aligarh Muslim University

Li Y, Wang Y, Liu X. The role of airway epithelial cells in response to mycobacteria infection. Clinical and Developmental Immunology. 2012 Apr 18;2012.

137

Bibliography

Li Z, Zhang H, Fan X, Zhang Y, Huang J, Liu Q, Tjelle TE, Mathiesen I, Kjeken R, Xiong S. DNA electroporation prime and protein boost strategy enhances humoral immunity of tuberculosis DNA vaccines in mice and non-human primates. Vaccine. 2006 May 22;24(21):4565-8.

Lian T, Ho RJ. Trends and developments in liposome drug delivery systems. Journal of pharmaceutical sciences. 2001 Jun 1;90(6):667-80.

Lin PL, Flynn JL. Understanding latent tuberculosis: a moving target. The Journal of Immunology. 2010 Jul 1;185(1):15-22.

Lindestam Arlehamn CS, Sette A. Definition of CD4 immunosignatures associated with MTB. Frontiers in immunology. 2014 Mar 24;5:124.

Liu J, Barry CE, Besra GS, Nikaido H. Mycolic acid structure determines the fluidity of the mycobacterial cell wall. Journal of Biological Chemistry. 1996 Nov 22;271(47):29545-51.

Liu M, Fréchet JM. Designing dendrimers for drug delivery. Pharmaceutical science & technology today. 1999 Oct 1;2(10):393-401.

Lowrie DB, Tascon RE, Bonato VL, Lima VM, Faccioli LH, Stavropoulos E, Colston MJ, Hewinson RG, Moelling K, Silva CL. Therapy of tuberculosis in mice by DNA vaccination. Nature. 1999 Jul;400(6741):269.

Lu CW, Hung Y, Hsiao JK, Yao M, Chung TH, Lin YS, Wu SH, Hsu SC, Liu HM, Mou CY, Yang CS. Bifunctional magnetic silica nanoparticles for highly efficient human stem cell labeling. Nano letters. 2007 Jan 10;7(1):149-54.

Lu Y, Xu Y, Yang E, Wang C, Wang H, Shen H. Novel recombinant BCG coexpressing Ag85B, ESAT‐6 and Rv2608 elicits significantly enhanced cellular immune and antibody responses in C57BL/6 mice. Scandinavian Maulanajournal ofAzad immunology. Library, 2012 Sep;76(3):271 Aligarh-7. Muslim University MacMicking JD, North RJ, LaCourse R, Mudgett JS, Shah SK, Nathan CF. Identification of nitric oxide synthase as a protective locus against tuberculosis. Proceedings of the National Academy of Sciences. 1997 May 13;94(10):5243-8.

138

Bibliography

Mahairas GG, Sabo PJ, Hickey MJ, Singh DC, Stover CK. Molecular analysis of genetic differences between Mycobacterium bovis BCG and virulent M. bovis. Journal of bacteriology. 1996 Mar 1;178(5):1274-82.

Mamiatis T, Fritsch EF, Sambrook J, Engel J. Molecular cloning–A laboratory manual. New York: Cold Spring Harbor Laboratory. 1982, 545 S., 42$. Acta Biotechnologica. 1985;5(1):104-.

Mangtani P, Abubakar I, Ariti C, Beynon R, Pimpin L, Fine PE, Rodrigues LC, Smith PG, Lipman M, Whiting PF, Sterne JA. Protection by BCG vaccine against tuberculosis: a systematic review of randomized controlled trials. Clinical infectious diseases. 2013 Dec 13;58(4):470-80.

Marchesi JR, Sato T, Weightman AJ, Martin TA, Fry JC, Hiom SJ, Wade WG. Design and evaluation of useful bacterium-specific PCR primers that amplify genes coding for bacterial 16S rRNA. Applied and environmental microbiology. 1998 Feb 1;64(2):795-9.

Marin ND, París SC, Vélez VM, Rojas CA, Rojas M, García LF. Regulatory T cell frequency and modulation of IFN-gamma and IL-17 in active and latent tuberculosis. Tuberculosis. 2010 Jul 1;90(4):252-61.

Mata-Haro V, Cekic C, Martin M, Chilton PM, Casella CR, Mitchell TC. The vaccine adjuvant monophosphoryl lipid A as a TRIF-biased agonist of TLR4. Science. 2007 Jun 15;316(5831):1628-32.

Mazurek J, Ignatowicz L, Kallenius G, Svenson SB, Pawlowski A, Hamasur B. Divergent effects of mycobacterial cell wall glycolipids on maturation and function of human monocyte-derived dendritic cells. PLoS One. 2012 Aug 3;7(8):e42515.

McGhee JR, Mestecky J, Dertzbaugh MT, Eldridge JH, Hirasawa M, Kiyono H. The Maulanamucosal Azad immune Library, system: from Aligarh fundamental concepts Muslim to vaccine University development. vaccine. 1992 Jan 1;10(2):75-88.

McGreal EP, Miller JL, Gordon S. Ligand recognition by antigen-presenting cell C- type lectin receptors. Current opinion in immunology. 2005 Feb 1;17(1):18- 24.

139

Bibliography

McShane H, Jacobs WR, Fine PE, Reed SG, McMurray DN, Behr M, Williams A, Orme IM. BCG: myths, realities, and the need for alternative vaccine strategies. Tuberculosis. 2012 May 1;92(3):283-8.

McShane H, Pathan AA, Sander CR, Keating SM, Gilbert SC, Huygen K, Fletcher HA, Hill AV. Recombinant modified vaccinia virus Ankara expressing antigen 85A boosts BCG-primed and naturally acquired antimycobacterial immunity in humans. Nature medicine. 2004 Nov;10(11):1240.

Medzhitov R. Recognition of microorganisms and activation of the immune response. Nature. 2007 Oct 17;449(7164):819.

Meerak J, Wanichwecharungruang SP, Palaga T. Enhancement of immune response to a DNA vaccine against Mycobacterium tuberculosis Ag85B by incorporation of an autophagy inducing system. Vaccine. 2013 Jan 21;31(5):784-90.

Minnikin DE. Chemical principles in the organization of lipid components in the mycobacterial cell envelope. Research in microbiology. 1991 Jan 1;142(4):423-7.

Moghimi SM, Hunter AC, Murray JC. Nanomedicine: current status and future prospects. The FASEB journal. 2005 Mar;19(3):311-30.

Mogues T, Goodrich ME, Ryan L, LaCourse R, North RJ. The relative importance of T cell subsets in immunity and immunopathology of airborne Mycobacterium tuberculosis infection in mice. Journal of Experimental Medicine. 2001 Feb 5;193(3):271-80.

Mollenkopf HJ, Groine-Triebkorn D, Andersen P, Hess J, Kaufmann SH. Protective efficacy against tuberculosis of ESAT-6 secreted by a live Salmonella typhimurium vaccine carrier strain and expressed by naked DNA. Vaccine. Maulana2001 Jul Azad16;19(28-29):4028 Library,-35. Aligarh Muslim University

Monney L, Sabatos CA, Gaglia JL, Ryu A, Waldner H, Chernova T, Manning S, Greenfield EA, Coyle AJ, Sobel RA, Freeman GJ. Th1-specific cell surface

140

Bibliography

protein Tim-3 regulates macrophage activation and severity of an autoimmune disease. Nature. 2002 Jan;415(6871):536.

Mosmann TR, Fong TA. Specific assays for cytokine production by T cells. Journal of immunological methods. 1989 Jan 17;116(2):151-8.

Mosser DM, Edwards JP. Exploring the full spectrum of macrophage activation. Nature reviews immunology. 2008 Dec;8(12):958.

Mukamolova GV, Turapov O, Malkin J, Woltmann G, Barer MR. Resuscitation- promoting factors reveal an occult population of tubercle bacilli in sputum. American journal of respiratory and critical care medicine. 2010 Jan 15;181(2):174-80.

Neyrolles O, Guilhot C. Recent advances in deciphering the contribution of Mycobacterium tuberculosis lipids to pathogenesis. Tuberculosis. 2011 May 1;91(3):187-95.

Nicoletti I, Migliorati G, Pagliacci MC, Grignani F, Riccardi C. A rapid and simple method for measuring thymocyte apoptosis by propidium iodide staining and flow cytometry. Journal of immunological methods. 1991 Jun 3;139(2):271-9.

Niederweis M. Mycobacterial porins–new channel proteins in unique outer membranes. Molecular microbiology. 2003 Sep;49(5):1167-77.

Nikaido H. Molecular basis of bacterial outer membrane permeability revisited. Microbiology and molecular biology reviews. 2003 Dec 1;67(4):593-656.

No HK, Park NY, Lee SH, Meyers SP. Antibacterial activity of chitosans and chitosan oligomers with different molecular weights. International journal of food microbiology. 2002 Mar 25;74(1-2):65-72.

Normington K, Kohno K, Kozutsumi Y, Gething MJ, Sambrook J. S. cerevisiae Maulanaencodes Azad an Library, essential protein Aligarh homologous Muslim in sequence and University function to mammalian BiP. Cell. 1989 Jun 30;57(7):1223-36.

Ocaña-Guzman R, Torre-Bouscoulet L, Sada-Ovalle I. TIM-3 regulates distinct functions in macrophages. Frontiers in immunology. 2016 Jun 13;7:229.

141

Bibliography

O'Donnell MA, Aldovini A, Duda RB, Yang H, Szilvasi A, Young RA, DeWolf WC. Recombinant Mycobacterium bovis BCG secreting functional interleukin-2 enhances gamma interferon production by splenocytes. Infection and immunity. 1994 Jun 1;62(6):2508-14.

Okamura H, Kashiwamura SI, Tsutsui H, Yoshimoto T, Nakanishi K. Regulation of interferon-γ production by IL-12 and IL-18. Current opinion in immunology. 1998 Jun 1;10(3):259-64.

Olszewska-Pazdrak B, Casola A, Saito T, Alam R, Crowe SE, Mei F, Ogra PL, Garofalo RP. Cell-specific expression of RANTES, MCP-1, and MIP-1α by lower airway epithelial cells and eosinophils infected with respiratory syncytial virus. Journal of virology. 1998 Jun 1;72(6):4756-64.

Onwueme KC, Vos CJ, Zurita J, Ferreras JA, Quadri LE. The dimycocerosate ester polyketide virulence factors of mycobacteria. Progress in lipid research. 2005 Sep 1;44(5):259-302.

Orme IM. Beyond BCG: the potential for a more effective TB vaccine. Molecular medicine today. 1999 Nov 1;5(11):487-92.

Orr MT, Beebe EA, Hudson TE, Moon JJ, Fox CB, Reed SG, Coler RN. A dual TLR agonist adjuvant enhances the immunogenicity and protective efficacy of the tuberculosis vaccine antigen ID93. PloS one. 2014 Jan 3;9(1):e83884.

Pahari S, Kaur G, Aqdas M, Negi S, Chatterjee D, Bashir H, Singh S, Agrewala JN. Bolstering immunity through pattern recognition receptors: a unique approach to control tuberculosis. Frontiers in immunology. 2017 Aug 2;8:906.

Pahari S, Kaur G, Negi S, Aqdas M, Das DK, Bashir H, Singh S, Nagare M, Khan J, Agrewala JN. Reinforcing the Functionality of Mononuclear Phagocyte System to Control Tuberculosis. Frontiers in immunology. 2018 Feb 9;9:193. Maulana Azad Library, Aligarh Muslim University Parida SK, Kaufmann SH. Novel tuberculosis vaccines on the horizon. Current opinion in immunology. 2010 Jun 1;22(3):374-84.

Park HD, Guinn KM, Harrell MI, Liao R, Voskuil MI, Tompa M, Schoolnik GK, Sherman DR. Rv3133c/dosR is a transcription factor that mediates the

142

Bibliography

hypoxic response of Mycobacterium tuberculosis. Molecular microbiology. 2003 May;48(3):833-43.

Parrish NM, Dick JD, Bishai WR. Mechanisms of latency in Mycobacterium tuberculosis. Trends in microbiology. 1998 Mar 1;6(3):107-12.

Peyron P, Vaubourgeix J, Poquet Y, Levillain F, Botanch C, Bardou F, Daffé M, Emile JF, Marchou B, Cardona PJ, de Chastellier C. Foamy macrophages from tuberculous patients' granulomas constitute a nutrient-rich reservoir for M. tuberculosis persistence. PLoS pathogens. 2008 Nov 11;4(11):e1000204.

Pieters J. Mycobacterium tuberculosis and the macrophage: maintaining a balance. Cell host & microbe. 2008 Jun 12;3(6):399-407.

Pozzi LA, Maciaszek JW, Rock KL. Both dendritic cells and macrophages can stimulate naive CD8 T cells in vivo to proliferate, develop effector function, and differentiate into memory cells. The Journal of Immunology. 2005 Aug 15;175(4):2071-81.

Prego C, Paolicelli P, Díaz B, Vicente S, Sánchez A, González-Fernández Á, Alonso MJ. Chitosan-based nanoparticles for improving immunization against hepatitis B infection. Vaccine. 2010 Mar 19;28(14):2607-14.

Pym AS, Brodin P, Majlessi L, Brosch R, Demangel C, Williams A, Griffiths KE, Marchal G, Leclerc C, Cole ST. Recombinant BCG exporting ESAT-6 confers enhanced protection against tuberculosis. Nature medicine. 2003 May;9(5):533.

Qiao D, Yang BY, Li L, Ma JJ, Zhang XL, Lao SH, Wu CY. ESAT‐6‐and CFP‐10‐specific Th1, Th22 and Th17 cells in tuberculous pleurisy may contribute to the local immune response against Mycobacterium tuberculosis infection. Scandinavian journal of immunology. 2011 Apr;73(4):330-7.

MaulanaQie YQ, AzadWang JL, LiuLibrary, W, Shen H, ChenAligarh JZ, Zhu BD, Muslim Xu Y, Zhang XL,University Wang HH. More Vaccine Efficacy Studies on the Recombinant Bacille Calmette‐Guerin Co‐expressing Ag85B, Mpt64190–198 and Mtb8. 4. Scandinavian journal of immunology. 2009 Apr;69(4):342-50.

143

Bibliography

Raafat D, Von Bargen K, Haas A, Sahl HG. Insights into the mode of action of chitosan as an antibacterial compound. Applied and environmental microbiology. 2008 Jun 15;74(12):3764-73.

Rabea EI, Badawy ME, Stevens CV, Smagghe G, Steurbaut W. Chitosan as antimicrobial agent: applications and mode of action. Biomacromolecules. 2003 Nov 10;4(6):1457-65.

Radošević K, Wieland CW, Rodriguez A, Weverling GJ, Mintardjo R, Gillissen G, Vogels R, Skeiky YA, Hone DM, Sadoff JC, van der Poll T. Protective immune responses to a recombinant adenovirus type 35 tuberculosis vaccine in two mouse strains: CD4 and CD8 T-cell epitope mapping and role of gamma interferon. Infection and immunity. 2007 Aug 1;75(8):4105-15.

Rahman S, Magalhaes I, Rahman J, Ahmed RK, Sizemore DR, Scanga CA, Weichold F, Verreck F, Kondova I, Sadoff J, Thorstensson R. Prime-boost vaccination with rBCG/rAd35 enhances CD8+ cytolytic T-cell responses in lesions from Mycobacterium tuberculosis–infected primates. Molecular Medicine. 2012;18(1):647.

Rao CN, Seshadri R, Govindaraj A, Sen R. Fullerenes, nanotubes, onions and related carbon structures. Materials Science and Engineering: R: Reports. 1995 Dec 1;15(6):209-62.

Reed SG, Coler RN, Dalemans W, Tan EV, Cruz EC, Basaraba RJ, Orme IM, Skeiky YA, Alderson MR, Cowgill KD, Prieels JP. Defined tuberculosis vaccine, Mtb72F/AS02A, evidence of protection in cynomolgus monkeys. Proceedings of the National Academy of Sciences. 2009 Jan 31:pnas-0712077106.

Reiley WW, Calayag MD, Wittmer ST, Huntington JL, Pearl JE, Fountain JJ, Martino CA, Roberts AD, Cooper AM, Winslow GM, Woodland DL. ESAT-6-specific MaulanaCD4 T cellAzad responses Library, to aerosol Mycobacterium Aligarh tuberculosis Muslim infection University are initiated in the mediastinal lymph nodes. Proceedings of the National Academy of Sciences. 2008 Aug 5;105(31):10961-6.

Riccardi C, Nicoletti I. Analysis of apoptosis by propidium iodide staining and flow cytometry. Nature protocols. 2006 Oct;1(3):1458.

144

Bibliography

Rinaudo M, Milas M, Le Dung P. Characterization of chitosan. Influence of ionic strength and degree of acetylation on chain expansion. International Journal of Biological Macromolecules. 1993 Oct 1;15(5):281-5.

Rodríguez-Güell E, Agustí G, Corominas M, Cardona PJ, Luquin M, Julián E. Mice with pulmonary tuberculosis treated with Mycobacterium vaccae develop strikingly enhanced recall gamma interferon responses to M. vaccae cell wall skeleton. Clinical and Vaccine Immunology. 2008 May 1;15(5):893-6.

Rosenberg AH, Lade BN, Dao-shan C, Lin SW, Dunn JJ, Studier FW. Vectors for selective expression of cloned DNAs by T7 RNA polymerase. Gene. 1987 Dec 31;56(1):125-35.

Rothfuchs AG, Bafica A, Feng CG, Egen JG, Williams DL, Brown GD, Sher A. Dectin-1 interaction with Mycobacterium tuberculosis leads to enhanced IL- 12p40 production by splenic dendritic cells. The Journal of immunology. 2007 Sep 15;179(6):3463-71.

Roy I, Ohulchanskyy TY, Pudavar HE, Bergey EJ, Oseroff AR, Morgan J, Dougherty TJ, Prasad PN. Ceramic-based nanoparticles entrapping water-insoluble photosensitizing anticancer drugs: A novel drug− carrier system for photodynamic therapy. Journal of the American Chemical Society. 2003 Jul 2;125(26):7860-5.

Russell DG, Barry CE, Flynn JL. Tuberculosis: what we don’t know can, and does, hurt us. Science. 2010 May 14;328(5980):852-6.

Russell DG, Cardona PJ, Kim MJ, Allain S, Altare F. Foamy macrophages and the progression of the human tuberculosis granuloma. Nature immunology. 2009 Sep;10(9):943.

Sahariah P, Masson M. Antimicrobial chitosan and chitosan derivatives: A review of Maulanathe Azad structure Library,–activity relationship. Aligarh Biomacromolecules. Muslim University 2017 Oct 3;18(11):3846-68.

Salgame P. Host innate and Th1 responses and the bacterial factors that control Mycobacterium tuberculosis infection. Current opinion in immunology. 2005 Aug 1;17(4):374-80.

145

Bibliography

Scanga CA, Mohan VP, Yu K, Joseph H, Tanaka K, Chan J, Flynn JL. Depletion of CD4+ T cells causes reactivation of murine persistent tuberculosis despite continued expression of interferon γ and nitric oxide synthase 2. Journal of Experimental Medicine. 2000 Aug 7;192(3):347-58.

Schmid G. Nanoparticles. Wiley VCH; 2005.

Schnappinger D, Ehrt S, Voskuil MI, Liu Y, Mangan JA, Monahan IM, Dolganov G, Efron B, Butcher PD, Nathan C, Schoolnik GK. Transcriptional adaptation of Mycobacterium tuberculosis within macrophages: insights into the phagosomal environment. Journal of Experimental Medicine. 2003 Sep 1;198(5):693-704.

Schubert OT, Mouritsen J, Ludwig C, Röst HL, Rosenberger G, Arthur PK, Claassen M, Campbell DS, Sun Z, Farrah T, Gengenbacher M. The Mtb proteome library: a resource of assays to quantify the complete proteome of Mycobacterium tuberculosis. Cell host & microbe. 2013 May 15;13(5):602- 12.

Seeliger JC, Holsclaw CM, Schelle MW, Botyanszki Z, Gilmore SA, Tully SE, Niederweis M, Cravatt BF, Leary JA, Bertozzi CR. Elucidation and chemical modulation of sulfolipid-1 biosynthesis in Mycobacterium tuberculosis. Journal of Biological Chemistry. 2012 Mar 9;287(11):7990-8000.

Senol G, Erer OF, Yalcin YA, Coskun M, Gündüz AT, Biçmen C, Ertas M, Özkan SA. Humoral immune response against 38-kDa and 16-kDa mycobacterial antigens in tuberculosis. European Respiratory Journal. 2007 Jan 1;29(1):143- 8.

Sharma N, Agrewala JN. Potent role of vaccines prepared from macrophages infected with live bacteria in protection against Mycobacterium tuberculosis and MaulanaSalmonella Azad typhimurium Library, infections. TheAligarh Journal of infectiousMuslim diseases. University 2004 Jul 1;190(1):107-14.

Sharma SK, Mohan A. Extrapulmonary tuberculosis. Indian Journal of Medical Research. 2004 Oct 1;120:316-53.

146

Bibliography

Shaw MH, Reimer T, Kim YG, Nuñez G. NOD-like receptors (NLRs): bona fide intracellular microbial sensors. Current opinion in immunology. 2008 Aug 1;20(4):377-82.

Sherman DR, Voskuil M, Schnappinger D, Liao R, Harrell MI, Schoolnik GK. Regulation of the Mycobacterium tuberculosis hypoxic response gene encoding α-crystallin. Proceedings of the National Academy of Sciences. 2001 Jun 19;98(13):7534-9.

Shi C, Chen L, Chen Z, Zhang Y, Zhou Z, Lu J, Fu R, Wang C, Fang Z, Fan X. Enhanced protection against tuberculosis by vaccination with recombinant BCG over-expressing HspX protein. Vaccine. 2010 Jul 19;28(32):5237-44.

Siddiqui KF, Amir M, Agrewala JN. Understanding the biology of 16 kDa antigen of Mycobacterium tuberculosis: scope in diagnosis, vaccine design and therapy. Critical reviews in microbiology. 2011 Nov 1;37(4):349-57.

Siddiqui KF, Amir M, Khan N, Rama Krishna G, Sheikh JA, Rajagopal K, Agrewala JN. Prime‐boost vaccination strategy with bacillus Calmette–Guérin (BCG) and liposomized alpha‐crystalline protein 1 reinvigorates BCG potency. Clinical & Experimental Immunology. 2015 Aug;181(2):286-96.

Singh SV, Sohal JS, Kumar N, Gupta S, Chaubey KK, Rawat KD, Chakraborty S, Tiwari R, Dhama K. Recent approaches in diagnosis and control of Mycobacterial infections with special reference to Mycobacterium avium subspecies paratuberculosis. Adv. Anim. Vet. Sci. 2014;2(1S):1-1.

Singh V, Gowthaman U, Jain S, Parihar P, Banskar S, Gupta P, Gupta UD, Agrewala MaulanaJN. Azad Coadministration Library, of interleukins Aligarh 7 and 15Muslim with bacille CalmetteUniversity-Guerin mounts enduring T cell memory response against Mycobacterium tuberculosis. The Journal of infectious diseases. 2010 Aug 1;202(3):480-9.

Skeiky YA, Lodes MJ, Guderian JA, Mohamath R, Bement T, Alderson MR, Reed SG. Cloning, Expression, and Immunological Evaluation of Two Putative

147

Bibliography

Secreted Serine Protease Antigens ofMycobacterium tuberculosis. Infection and immunity. 1999 Aug 1;67(8):3998-4007.

Skeiky YA, Sadoff JC. Advances in tuberculosis vaccine strategies. Nature Reviews Microbiology. 2006 Jun;4(6):469.

Skinner MA, Yuan S, Prestidge R, Chuk D, Watson JD, Tan PL. Immunization with heat-killed Mycobacterium vaccae stimulates CD8+ cytotoxic T cells specific for macrophages infected with Mycobacterium tuberculosis. Infection and immunity. 1997 Nov 1;65(11):4525-30.

Skjøt RL, Brock I, Arend SM, Munk ME, Theisen M, Ottenhoff TH, Andersen P. Epitope mapping of the immunodominant antigen TB10. 4 and the two homologous proteins TB10. 3 and TB12. 9, which constitute a subfamily of the esat-6 gene family. Infection and immunity. 2002 Oct 1;70(10):5446-53.

Smith CV, Sharma V, Sacchettini JC. TB drug discovery: addressing issues of persistence and resistance. Tuberculosis. 2004 Jan 1;84(1-2):45-55.

Smith RM, Drobniewski F, Gibson A, Montague JD, Logan MN, Hunt D, Hewinson G, Salmon RL, O’Neill B. Mycobacterium bovis infection, United Kingdom. Emerging infectious diseases. 2004 Mar;10(3):539.

Song H, Sandie R, Wang Y, Andrade-Navarro MA, Niederweis M. Identification of outer membrane proteins of Mycobacterium tuberculosis. Tuberculosis. 2008 Nov 1;88(6):526-44.

Soppimath KS, Aminabhavi TM, Kulkarni AR, Rudzinski WE. Biodegradable polymeric nanoparticles as drug delivery devices. Journal of controlled release. 2001 Jan 29;70(1-2):1-20.

Srivastava S, Ernst JD. Cutting edge: Direct recognition of infected cells by CD4 T Maulanacells is requiredAzad for Library, control of intracellular Aligarh Mycobacterium Muslim tuberculosis University in vivo. The Journal of Immunology. 2013 Jul 1:1301236.

Stanley SA, Raghavan S, Hwang WW, Cox JS. Acute infection and macrophage subversion by Mycobacterium tuberculosis require a specialized secretion

148

Bibliography

system. Proceedings of the National Academy of Sciences. 2003 Oct 28;100(22):13001-6.

Stepanović S, Vuković D, Dakić I, Savić B, Švabić-Vlahović M. A modified microtiter-plate test for quantification of staphylococcal biofilm formation. Journal of microbiological methods. 2000 Apr 1;40(2):175-9.

Sternberg EM. Neural regulation of innate immunity: a coordinated nonspecific host response to pathogens. Nature Reviews Immunology. 2006 Apr;6(4):318.

Stewart GR, Robertson BD, Young DB. Tuberculosis: a problem with persistence. Nature Reviews Microbiology. 2003 Nov;1(2):97.

Strohmeier GR, Fenton MJ. Roles of lipoarabinomannan in the pathogenesis of tuberculosis. Microbes and Infection. 1999 Jul 1;1(9):709-17.

Studier FW, Moffatt BA. Use of bacteriophage T7 RNA polymerase to direct selective high-level expression of cloned genes. Journal of molecular biology. 1986 May 5;189(1):113-30.

Studier FW. Use of T7 RNA polymerase to direct expression of cloned genes. Methods Enzymol.. 1990;185:60-89.

Sugawara I, Sun L, Mizuno S, Taniyama T. Protective efficacy of recombinant BCG Tokyo (Ag85A) in rhesus monkeys (Macaca mulatta) infected intratracheally with H37Rv Mycobacterium tuberculosis. Tuberculosis. 2009 Jan 1;89(1):62- 7.

Sugawara I, Yamada H, Mizuno S. STAT1 knockout mice are highly susceptible to pulmonary mycobacterial infection. The Tohoku journal of experimental medicine. 2004;202(1):41-50.

Sun R, Skeiky YA, Izzo A, Dheenadhayalan V, Imam Z, Penn E, Stagliano K, MaulanaHaddock Azad S, Library, Mueller S, Fulkerson Aligarh J, Scanga Muslim C. Novel recombinant University BCG expressing perfringolysin O and the over-expression of key immunodominant antigens; pre-clinical characterization, safety and protection against challenge with Mycobacterium tuberculosis. Vaccine. 2009 Jul 16;27(33):4412-23.

149

Bibliography

Sun X, Li Y. Colloidal carbon spheres and their core/shell structures with noble‐metal nanoparticles. Angewandte Chemie. 2004 Jan 23;116(5):607-11.

Swain SL, Agrewala JN, Brown DM, Jelley‐Gibbs DM, Golech S, Huston G, Jones SC, Kamperschroer C, Lee WH, McKinstry KK, Román E. CD4+ T‐cell memory: generation and multi‐faceted roles for CD4+ T cells in protective immunity to influenza. Immunological reviews.

Tailleux L, Waddell SJ, Pelizzola M, Mortellaro A, Withers M, Tanne A, Castagnoli PR, Gicquel B, Stoker NG, Butcher PD, Foti M. Probing host pathogen crosstalk by transcriptional profiling of both Mycobacterium tuberculosis and infected human dendritic cells and macrophages. PloS one. 2008 Jan 2;3(1):e1403.

Tan Q, Xie WP, Min R, Dai GQ, Xu CC, Pan HQ, Miao CD, Yang Z, Xu WG, Wang H. Characterization of Th1-and Th2-type immune response in human multidrug-resistant tuberculosis. European journal of clinical microbiology & infectious diseases. 2012 Jun 1;31(6):1233-42.

Tan T, Lee WL, Alexander DC, Grinstein S, Liu J. The ESAT‐6/CFP‐10 secretion system of Mycobacterium marinum modulates phagosome maturation. Cellular microbiology. 2006 Sep;8(9):1417-29.

Taylor JL, Turner OC, Basaraba RJ, Belisle JT, Huygen K, Orme IM. Pulmonary necrosis resulting from DNA vaccination against tuberculosis. Infection and immunity. 2003 Apr 1;71(4):2192-8.

Thi EP, Lambertz U, Reiner NE. Sleeping with the enemy: how intracellular pathogens cope with a macrophage lifestyle. PLoS pathogens. 2012 Mar 22;8(3):e1002551.

Torrado E, Cooper AM. IL-17 and Th17 cells in tuberculosis. Cytokine & growth Maulanafactor reviews. Azad 2010 Library,Dec 1;21(6):455 -Aligarh62. Muslim University

Trinchieri G. Interleukin-12: a cytokine at the interface of inflammation and immunity. InAdvances in immunology 1998 Jan 1 (Vol. 70, pp. 83-243). Academic Press.

150

Bibliography

Tsenova L, Harbacheuski R, Moreira AL, Ellison E, Dalemans W, Alderson MR, Mathema B, Reed SG, Skeiky YA, Kaplan G. Evaluation of the Mtb72F polyprotein vaccine in a rabbit model of tuberculous meningitis. Infection and immunity. 2006 Apr 1;74(4):2392-401.

Tullius MV, Harth G, Horwitz MA. Glutamine synthetase GlnA1 is essential for growth of Mycobacterium tuberculosis in human THP-1 macrophages and guinea pigs. Infection and immunity. 2003 Jul 1;71(7):3927-36.

Ulrichs T, Kaufmann SH. New insights into the function of granulomas in human tuberculosis. The Journal of Pathology: A Journal of the Pathological Society of Great Britain and Ireland. 2006 Jan;208(2):261-9.

Van Crevel R, Ottenhoff TH, van der Meer JW. Innate immunity to Mycobacterium tuberculosis. Clinical microbiology reviews. 2002 Apr 1;15(2):294-309.

Van de Veerdonk FL, Teirlinck AC, Kleinnijenhuis J, Kullberg BJ, van Crevel R, van der Meer JW, Joosten LA, Netea MG. Mycobacterium tuberculosis induces IL‐17A responses through TLR4 and dectin‐1 and is critically dependent on endogenous IL‐1. Journal of leukocyte biology. 2010 Aug;88(2):227-32.

Van de Vosse E, Hoeve MA, Ottenhoff TH. Human genetics of intracellular infectious diseases: molecular and cellular immunity against mycobacteria and salmonellae. The Lancet infectious diseases. 2004 Dec 1;4(12):739-49.

Van Dissel JT, Soonawala D, Joosten SA, Prins C, Arend SM, Bang P, Tingskov PN, Lingnau K, Nouta J, Hoff ST, Rosenkrands I. Ag85B–ESAT-6 adjuvanted with IC31® promotes strong and long-lived Mycobacterium tuberculosis specific T cell responses in volunteers with previous BCG vaccination or tuberculosis infection. Vaccine. 2011 Mar 3;29(11):2100-9.

Van Eden W, Van der Zee R, Prakken B. Heat-shock proteins induce T-cell regulation Maulanaof Azad chronic inflammation. Library, Nature Aligarh Reviews Immunology. Muslim 2005 Apr;5(4):318. University

Van Pinxteren LA, Cassidy JP, Smedegaard BH, Agger EM, Andersen P. Control of latent Mycobacterium tuberculosis infection is dependent on CD8 T cells. European journal of immunology. 2000 Dec;30(12):3689-98.

151

Bibliography

Van Soolingen D. Molecular epidemiology of tuberculosis and other mycobacterial infections: main methodologies and achievements. Journal of internal medicine. 2001 Jan;249(1):1-26.

Vergne I, Chua J, Singh SB, Deretic V. Cell biology of Mycobacterium tuberculosis phagosome. Annu. Rev. Cell Dev. Biol.. 2004;20:367-94.

Vergne I, Gilleron M, Nigou J. Manipulation of the endocytic pathway and phagocyte functions by Mycobacterium tuberculosis lipoarabinomannan. Frontiers in cellular and infection microbiology. 2015 Jan 12;4:187.

Vilaplana C, Montané E, Pinto S, Barriocanal AM, Domenech G, Torres F, Cardona PJ, Costa J. Double-blind, randomized, placebo-controlled Phase I Clinical Trial of the therapeutical antituberculous vaccine RUTI®. Vaccine. 2010 Jan 22;28(4):1106-16.

Voskuil MI, Schnappinger D, Visconti KC, Harrell MI, Dolganov GM, Sherman DR, Schoolnik GK. Inhibition of respiration by nitric oxide induces a Mycobacterium tuberculosis dormancy program. Journal of Experimental Medicine. 2003 Sep 1;198(5):705-13.

Waddell RD, Chintu C, Lein AD, Zumla A, Karagas MR, Baboo KS, Habbema JD, Tosteson AN, Morin P, Tvaroha S, Arbeit RD. Safety and immunogenicity of a five-dose series of inactivated Mycobacterium vaccae vaccination for the prevention of HIV-associated tuberculosis. Clinical Infectious Diseases. 2000 Jun 1;30(Supplement_3):S309-15.

Wakamoto Y, Dhar N, Chait R, Schneider K, Signorino-Gelo F, Leibler S, McKinney JD. Dynamic persistence of antibiotic-stressed mycobacteria. Science. 2013 Jan 4;339(6115):91-5.

Wang F, Cassidy C, Sacchettini JC. Crystal structure and activity studies of the MaulanaMycobacterium Azad tuberculosis Library, β-lactamase Aligarh reveal its critical Muslim role in resistance University to β-lactam antibiotics. Antimicrobial agents and chemotherapy. 2006 Aug 1;50(8):2762-71.

152

Bibliography

Wang T, Bai J, Jiang X, Nienhaus GU. Cellular uptake of nanoparticles by membrane penetration: a study combining confocal microscopy with FTIR spectroelectrochemistry. ACS nano. 2012 Jan 17;6(2):1251-9.

Warren E, Teskey G, Venketaraman V. Effector mechanisms of neutrophils within the innate immune system in response to Mycobacterium tuberculosis infection. Journal of clinical medicine. 2017 Feb 7;6(2):15.

Wayne LG, Hayes LG. An in vitro model for sequential study of shiftdown of Mycobacterium tuberculosis through two stages of nonreplicating persistence. Infection and immunity. 1996 Jun 1;64(6):2062-9.

Weeratna RD, Makinen SR, McCluskie MJ, Davis HL. TLR agonists as vaccine adjuvants: comparison of CpG ODN and Resiquimod (R-848). Vaccine. 2005 Nov 1;23(45):5263-70.

Weischenfeldt J, Porse B. Bone marrow-derived macrophages (BMM): isolation and applications. Cold Spring Harbor Protocols. 2008 Dec 1;2008(12):pdb- rot5080.

Weissleder R, Kelly K, Sun EY, Shtatland T, Josephson L. Cell-specific targeting of nanoparticles by multivalent attachment of small molecules. Nature biotechnology. 2005 Nov;23(11):1418.

Wheeler PR, Ratledge C. Metabolism of Mycobacterium tuberculosis. InTuberculosis 1994 Jan 1 (pp. 353-385). American Society of Microbiology.

Wiker HG, Harboe M. The antigen 85 complex: a major secretion product of Mycobacterium tuberculosis. Microbiological reviews. 1992 Dec 1;56(4):648- 61.

Wilking JN, Zaburdaev V, De Volder M, Losick R, Brenner MP, Weitz DA. Liquid transport facilitated by channels in Bacillus subtilis biofilms. Proceedings of Maulanathe Azad National AcademyLibrary, of Sciences. Aligarh 2013 Jan 15;110(3):848 Muslim-52. University

Wilson K. Preparation of genomic DNA from bacteria. Current protocols in molecular biology. 2001 Oct;56(1):2-4.

153

Bibliography

Wolf AJ, Desvignes L, Linas B, Banaiee N, Tamura T, Takatsu K, Ernst JD. Initiation of the adaptive immune response to Mycobacterium tuberculosis depends on antigen production in the local lymph node, not the lungs. Journal of Experimental Medicine. 2008 Jan 21;205(1):105-15.

World Health Organization. Global tuberculosis control: surveillance, planning, financing: WHO Report 2007. World Health Organization; 2007.

World Health Organization, Global Tuberculosis Programme. Global tuberculosis control: WHO report. WHO; 2008.

World Health Organization. Global tuberculosis control: epidemiology, strategy, financing: WHO report 2009. World Health Organization; 2009.

World Health Organization, editor. Global tuberculosis report 2013. World Health Organization; 2013.

World Health Organization. Global tuberculosis report 2015. World Health Organization; 2015.

World Health Organization. Global tuberculosis report 2016.

World Health Organization. Global tuberculosis report 2017. 2017. Google Scholar. 2018.

Wu W, Wieckowski S, Pastorin G, Benincasa M, Klumpp C, Briand JP, Gennaro R, Prato M, Bianco A. Targeted delivery of amphotericin B to cells by using functionalized carbon nanotubes. Angewandte Chemie. 2005 Oct 7;117(39):6516-20.

Yamamoto M, Sato S, Hemmi H, Hoshino K, Kaisho T, Sanjo H, Takeuchi O, Sugiyama M, Okabe M, Takeda K, Akira S. Role of adaptor TRIF in the MyD88-independent toll-like receptor signaling pathway. Science. 2003 Aug Maulana1;301(5633):640 Azad-3. Library, Aligarh Muslim University

Yamasaki S, Ishikawa E, Sakuma M, Hara H, Ogata K, Saito T. Mincle is an ITAM- coupled activating receptor that senses damaged cells. Nature immunology. 2008 Oct;9(10):1179.

154

Bibliography

Yang SC, Hsueh PR, Lai HC, Teng LJ, Huang LM, Chen JM, Wang SK, Shie DC, Ho SW, Luh KT. High prevalence of antimicrobial resistance in rapidly growing mycobacteria in Taiwan. Antimicrobial agents and chemotherapy. 2003 Jun 1;47(6):1958-62.

Young D, Dye C. The development and impact of tuberculosis vaccines. Cell. 2006 Feb 24;124(4):683-7.

Yuan Y, Crane DD, Simpson RM, Zhu Y, Hickey MJ, Sherman DR, Barry CE. The 16-kDa α-crystallin (Acr) protein of Mycobacterium tuberculosis is required for growth in macrophages. Proceedings of the National Academy of Sciences. 1998 Aug 4;95(16):9578-83.

Zambrano MM, Kolter R. Mycobacterial biofilms: a greasy way to hold it together. Cell. 2005 Dec 2;123(5):762-4.

Zhang M, Gong J, Lin Y, Barnes PF. Growth of virulent and avirulentMycobacterium tuberculosis strains in human macrophages. Infection and immunity. 1998 Feb 1;66(2):794-9.

Maulana Azad Library, Aligarh Muslim University

155

Bibliography

Publications

1. Nida Mubin, Susanta Pahari, Owais Mohammad, Swaleha Zubair. Mycobacterium tuberculosis host cell interaction: Role of latency associated protein Acr-1 in differential modulation of macrophages. PLoS One. 2018 Nov 5;13(11): e0206459. doi: 10.1371/journal.pone.0206459. eCollection 2018.

2. Nida Mubin, Mohd. Saad Umar, Swaleha Zubair, Owais Mohammad. Selective

targeting of 4SO4-N-Acetyl-Galactosamine functionalized M.tb protein loaded chitosan nanoparticle to macrophages: correlation with activation of Immune System (Provisionally accepted in Frontier in Microbiology doi: 10.3389/fmicb.2018.02469).

3. Gurwinder Kaur, Amit Arora, Sathyaseelan Sathyabama, Nida Mubin, Sheenam Verma,Shanmugam Mayilraj and Javed N. Agrewala. Genome sequencing, assembly,annotation and analysis of Staphylococcus xylosus strain DMB3‑ Bh1 reveals genes responsible for pathogenicity. Gut Pathog. 2016 Nov 8;8:55. doi: 10.1186/s13099-016-0139-8. eCollection 2016.

4. Sathyaseelan Sathyabama, Gurwinder Kaur, Amit Arora, Sheenam Verma, Nida Mubin, Shanmugam Mayilraj and Javed N Agrewala. Genome sequencing, annotation and analysis of Salmonella enterica sub species salamae strain DMA. Gut Pathog. 2014 Apr 11;6(1):8. doi: 10.1186/1757-4749-6-8.

5. Gurwinder Kaur, Sathyaseelan Sathyabama, Amit Arora, Sheenam Verma, Nida Mubin, Javed N Agrewala.and Shanmugam Mayilraj. Genome sequencing, annotation and comparative genomic analysis of Shigella dysenteriae strain SD1D. Gut Pathog. 2014 Jul Gut Pathog. 2014 Jul 11;6:28. doi: 10.1186/1757- 4749-6-28. eCollection 2014.

Maulana Azad Library, Aligarh Muslim University

156

RESEARCH ARTICLE Mycobacterium tuberculosis host cell interaction: Role of latency associated protein Acr-1 in differential modulation of macrophages

1 2 1 3 Nida Mubin , Susanta Pahari , Mohammad OwaisID *, Swaleha Zubair *

1 Molecular Immunology Laboratory, Interdisciplinary Biotechnology Unit, Aligarh Muslim University, Aligarh, India, 2 Immunology Laboratory, CSIR-Institute of Microbial Technology, Chandigarh, India, 3 Department of Computer Science, Aligarh Muslim University, Aligarh, India

* [email protected] (SZ); [email protected] (MO) a1111111111 a1111111111 a1111111111 Abstract a1111111111 a1111111111 Mycobacterium tuberculosis (M.tb) contrives intracellular abode as a strategy to combat antibody onslaught. Additionally, to thrive against hostile ambiance inside host macrophages, the pathogen inhibits phago-lysosomal fusion. Finally, to further defy host cell offensives, M.tb opts for dormant phase, where it turns off or slows down most of its metabolic OPEN ACCESS process as an added stratagem. While M.tb restrains most of its metabolic activities during Citation: Mubin N, Pahari S, Owais M, Zubair S dormancy, surprisingly latency-associated alpha-crystallin protein (Acr-1) is expressed (2018) Mycobacterium tuberculosis host cell most prominently during this phase. Interestingly, several previous studies described the interaction: Role of latency associated protein Acr- potential of Acr-1 to induce the robust immuno-prophylactic response in the immunized 1 in differential modulation of macrophages. PLoS ONE 13(11): e0206459. https://doi.org/10.1371/ host. It is intriguing to comprehend the apparent discrepancy that the microbe M.tb overex- journal.pone.0206459 presses a protein that has the potential to prime host immune system against the pathogen

Editor: Martin E. Rottenberg, Karolinska Institutet, itself. Keeping this apparent ambiguity into consideration, it is imperative to unravel intrica- SWEDEN cies involved in the exploitation of Acr-1 by M.tb during its interaction with host immune

Received: April 13, 2018 cells. The present study suggests that Acr-1 exhibits diverse role in the maturation of macrophages (MΦs) and related immunological responses. The early encounter of bone marrow Accepted: October 13, 2018 derived immune cells (pre-exposure during differentiation to MΦs) with Acr-1 (AcrMΦpre), Published: November 5, 2018 results in hampering of their function. The pre-exposure of naïve MΦs with Acr-1 induces Copyright: © 2018 Mubin et al. This is an open the expression of TIM-3 and IL-10. In contrast, exposure of fully differentiated MΦs to Acr-1 access article distributed under the terms of the results in their down-modulation and induces the phosphorylation of STAT-1 and STAT-4 in Creative Commons Attribution License, which permits unrestricted use, distribution, and host MΦs. Furthermore, Acr-1 mediated activation of MΦs results in the induction of Th1 reproduction in any medium, provided the original and Th17 phenotype by activated T lymphocyte. author and source are credited.

Data Availability Statement: All relevant data are within the manuscript and its Supporting InformationMaulanafiles. Azad Library, Aligarh Muslim University

Funding: The authors received no specific funding for this work. Introduction

Competing interests: The authors have declared Mycobacterium sps. adapt intracellular niche as a stratagem to evade antibody onslaught. Inci- that no competing interests exist. dentally, it chose macrophages, the first line defender of the host, as a sheltered resort [1, 2].

PLOS ONE | https://doi.org/10.1371/journal.pone.0206459 November 5, 2018 1 / 17 Kaur et al. Gut Pathog (2016) 8:55 DOI 10.1186/s13099-016-0139-8 Gut Pathogens

GENOME REPORT Open Access Genome sequencing, assembly, annotation and analysis of Staphylococcus xylosus strain DMB3‑Bh1 reveals genes responsible for pathogenicity Gurwinder Kaur1†, Amit Arora1†, Sathyaseelan Sathyabama2, Nida Mubin2, Sheenam Verma2, Shanmugam Mayilraj1*‡ and Javed N. Agrewala2*‡

Abstract Background: Staphylococcus xylosus is coagulase-negative staphylococci (CNS), found occasionally on the skin of humans but recurrently on other mammals. Recent reports suggest that this commensal bacterium may cause diseases in humans and other animals. In this study, we present the first report of whole genome sequencing of S. xylosus strain DMB3-Bh1, which was isolated from the stool of a mouse. Results: The draft genome of S. xylosus strain DMB3-Bh1 consisted of 2,81,0255 bp with G C content of 32.7 mol%, 2623 predicted coding sequences (CDSs) and 58 RNAs. The final assembly contained 12 contigs+ of total size 2,81,0255 bp with N50 contig length of 4,37,962 bp and the largest contig assembled measured 7,61,338 bp. Fur- ther, an interspecies comparative genomic analysis through rapid annotation using subsystem technology server was achieved with Staphylococcus aureus RF122 that revealed 36 genes having similarity with S. xylosus DMB3-Bh1. 35 genes encoded for virulence, disease and defense and 1 gene encoded for phages, prophages and transposable elements. Conclusions: These results suggest co linearity in genes between S. xylosus DMB3-Bh1 and S. aureus RF122 that contribute to pathogenicity and might be the result of horizontal gene transfer. The study indicates that S. xylosus DMB3-Bh1 may be a potential emerging pathogen for rodents. Keywords: Coagulase-negative staphylococci, Staphylococcus aureus, CDSs, Rapid annotation using subsystem technology (RAST), EzTaxon, Virulence, Disease and defense

Background species are whole genome sequenced, assembled and Genus Staphylococcus was initially proposed by Ogston annotated some of these are: Staphylococcus aureus [1]. Later on emended by Rosenbach [2]. At present, the strain N315 [3], Staphylococcus carnosus strain TM 300 genus consists of 49 species and 26 sub-species (http:// [4], Staphylococcus epidermidis strain ATCC 1228 [5], www.bacterio.net/staphylococcus.html). Till date, 35 Staphylococcus haemolyticus strain JCSC 1435 [6], Staph- ylococcus lugdunensis strain HKU09-01 [7], Staphylococ- cus pseudointermidus strain ED 99 [8], Staphylococcus *Correspondence: [email protected]; [email protected] saprophyticus strain ATCC 15305 [9], Staphylococcus †Gurwinder Kaur, Amit Arora are first authors, equal contributors warneri strain SG 1 [10], Staphylococcus xylosus strain ‡Shanmugam Mayilraj and Javed N. Agrewala contributed equally to this workMaulana Azad Library, AligarhSMQ-121 [11] Muslimand Staphylococcus University cohnii subsp. cohnii 1 Microbial Type Culture Collection and Gene Bank (MTCC), CSIR-Institute [12]. Various members of the genus Staphylococcus are of Microbial Technology, Sector 39‑A, Chandigarh 160036, India commensals and inhabitant of the skin and upper res- 2 Immunology Laboratory, CSIR-Institute of Microbial Technology, Sector 39‑A, Chandigarh 160036, India piratory tracts of mammals [13]. S. aureus is the most

© The Author(s) 2016. This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/ publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Kaur et al. Gut Pathogens 2014, 6:28 http://www.gutpathogens.com/content/6/1/28

GENOME ANNOUNCEMENT Open Access Genome sequencing, annotation and comparative genomic analysis of Shigella dysenteriae strain SD1D Gurwinder Kaur1†, Sathyaseelan Sathyabama2†,AmitArora1, Sheenam Verma2, Nida Mubin2,JavedNAgrewala2* and Shanmugam Mayilraj1*

Abstract Background: Shigellosis is an acute form of gastroenteritis caused by the bacteria belonging to the genus Shigella. It is the most common cause of morbidity and mortality in children. Shigella belongs to the family Enterobactericeae, which is a Gram-negative and rod shaped bacterium. In the present study, we report the draft genome of Shigella dysenteriae strain SD1D, which was isolated from the stool sample of a healthy individual. Results: Based on 16S rRNA gene sequence and phylogenetic analysis, the strain SD1D was identified as Shigella dysenteriae. The draft genome of SD1D consisted of 45, 93, 159 bp with a G + C content of 50.7%, 4, 960 predicted CDSs, 75 tRNAs and 2 rRNAs. The final assembly contained 146 contigs of total length 45, 93, 159 bp with N50 contig length of 77, 053 bp; the largest contig assembled measured 3, 85, 550 bp. Conclusions: We have for the first time performed the whole genome sequencing of Shigella dysenteriae strain SD1D. The comparative genomic analysis revealed several genes responsible for the pathogenesis, virulence, defense, resistance to antibiotics and toxic compounds, multidrug resistance efflux pumps and other genomic features of the bacterium. Keywords: Shigella dysenteriae, Shigellosis, G + C content, EzTaxon, RAST

Background reference to epidemics. The current gold standard for the The genus Shigella was first proposed by Shiga in 1898 detection of Shigella species in fecal specimens involves [1] and later on emended by Castellani and Chalmers in isolation, growth and identification of Shigella in the cul- 1919 [2]. At present, the genus Shigella consists of four tures. Isolates of Shigella can also be identified using sero- recognized species Shigella dysenteriae [2], Shigella boydii logical tests [6]. Understanding the antibiotic resistance [3], Shigella flexneri [2] and Shigella sonnei [4]. Shigella dys- patterns of Shigellae and molecular characterization of enteriae is the type species of the genus Shigella. Shigellosis plasmids and other genetic elements are also epidemiolog- is caused by any of the four above mentioned species of ically useful. All the four species of the genus Shigella have Shigella. Shigellosis is a form of acute gastroenteritis, in- been whole genome sequenced: Shigella boydii (02 iso- volving inflammation in the gastrointestinal tract resulting lates) strain BS512, Shigella dysenteriae (01 isolate) strain in vomiting, abdominal pain, diarrhea and cramping. The M131649, Shigella flexneri 2a (04 isolates) strain 2457T virulence associated with S. dysenteriae is due to the pro- and Shigella sonnei (02 isolates) strain 53G. For the first duction of an exotoxin called Shiga toxin (Stx), which is time we have performed whole genome sequencing, as- not excreted by the microorganism, but is released only sembly and annotation of strain Shigella dysenteriae during cell lysis [5]. Identification of Shigella species is im- SD1D, which was isolated from the stool sample of healthy portant because of its role in diseases with particular individual. In order to understand the correlation between Shigella dysenteriae strain SD1D and Shigella spp.,itisim-

*Maulana Correspondence: [email protected] Azad; [email protected] Library, Aligarhperative to explore Muslim the genome of University the strain SD1D and †Equal contributors perform a comparative genomic analysis with Shigella spp. 2Immunology Laboratory, CSIR-Institute of Microbial Technology, Sector 39A, This would unveil the pathogenic potential of this strain Chandigarh 160036, India 1Microbial Type Culture Collection and Gene bank, CSIR-Institute of Microbial in healthy individuals. In the current study, the complete Technology, Sector 39A, Chandigarh 160036, India genome sequence of Shigella dysenteriae strain SD1D

© 2014 Kaur et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Sathyabama et al. Gut Pathogens 2014, 6:8 http://www.gutpathogens.com/content/6/1/8

GENOME ANNOUNCEMENT Open Access Genome sequencing, annotation and analysis of Salmonella enterica sub species salamae strain DMA-1 Sathyaseelan Sathyabama2†, Gurwinder Kaur1†, Amit Arora1, Sheenam Verma2, Nida Mubin2, Shanmugam Mayilraj1* and Javed N Agrewala2*

Abstract Background: The genus Salmonella is Gram-negative which belongs to the family Enterobacteriaceae. In this study, we have sequenced the whole genome of the strain DMA-1, which was isolated from mouse stool sample and identified as Salmonella enterica subspecies salamae. Results: The strain DMA-1 was closely related at the 16S rRNA gene sequence level with the members of the genus Salmonella: Salmonella enterica subspecies salamae DSM 9220T (100%), followed by Salmonella enterica subspecies diarizonae (99.1%), Salmonella enterica subspecies enterica (99.0%) and Salmonella enterica subspecies indica (98.5%). We obtained the draft genome of S. enterica subspecies salamae strain DMA-1 with a size of 4,826,209 bp and mean G+C content of 52.0 mol%. Conclusions: We for the first time, sequenced the entire genome of the strain DMA-1 which was isolated from the mouse stool sample and identified it as Salmonella enterica, sub species salamae. Further, we subjected the whole genome sequencing data for annotation that revealed several genes responsible for the pathogenesis, virulence, defense, metabolism and other genomic features. Keywords: Salmonella enterica subspecies salamae, RAST, EzTaxon

Background ATP and fermentation in the absence of oxygen. At During a study on identifying bacterial diversity of mouse present, the genus Salmonella consists of three species stool samples, strain DMA-1 was isolated on tryptone and six sub species. The Salmonella enterica subspecies soya agar (TSA, HiMedia, Mumbai, India). The strain include: S. enterica subspecies enterica (subspecies I), S. DMA-1 was subjected to polyphasic taxonomic studies enterica subspecies salamae (subspecies II), S. enterica to identify the exact taxonomic status. The polyphasic subspecies arizonae (subspecies IIIa), S. enterica subspe- taxonomical studies involved phenotypic, biochemical cies diarizonae (subspecies IIIb), S. enterica subspecies characterization and 16S rRNA gene sequencing that houtenae (subspecies IV) and S. enterica subspecies indica identified it as Salmonella entericasubspeciessalamae. (subspecies V). S. enterica includes the majority of Sal- The genus Salmonella was first proposed in 1952 by monella strains isolated from humans and warm blooded Kauffmann and Edwards [1]. Later on, it was emended animals. But Salmonella bongori is typically obtained from in 1987 by Le Minor and Popoff [2]. The members of the cold blooded animals [3]. Most of the rodents present in genus Salmonella are Gram-negative, rod shaped, faculta- laboratories are susceptible to Salmonella infections. tive anaerobes capable of aerobic respiration producing Rodent feces cause infections via fecal-oral transmission, when a susceptible rodent ingests the bacteria present in *Maulana Correspondence: [email protected] Azad; [email protected] Library, Aligarhtheir feed or contaminated Muslim drinking University water. Immunocom- †Equal contributors promised caretakers of these rodents may get serious ill- 1 Microbial Type Culture Collection and Gene bank (MTCC), CSIR-Institute of ness, which in some cases develop into life threatening Microbial Technology, Sector 39-A, Chandigarh, India 2Immunology Laboratory, CSIR-Institute of Microbial Technology, Sector 39-A, diseases. Therefore in laboratories incoming rodents are Chandigarh, India

© 2014 Sathyabama et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. U R K U N D

Urkund Analysis Result

Analysed Document: Thesis Nida GH9219 AMU.rtf (D43448994) Submitted: 11/3/2018 8:17:00 AM Submitted By: [email protected] Significance: 1 %

Sources included in the report: https://openarchive.ki.se/xmlui/handle/10616/41292 https://openarchive.ki.se/xmlui/handle/10616/45538 https://openarchive.ki.se/xmlui/handle/10616/41052 https://openarchive.ki.se/xmlui/handle/10616/46111 https://bmcinfectdis.biomedcentral.com/articles/10.1186/1471-2334-14-S1-S2 https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3634041/ https://www.researchgate.net/ publication/303469489_Cholesterol_Corrects_Altered_Conformation_of_MHC- II_Protein_in_Leishmania_donovani_Infected_Macrophages_Implication_in_Therapy

Instances where selected sources appear:

Maulana Azad Library, Aligarh Muslim University