G Protein-Coupled Bile Acid Receptor TGR5 Activation Inhibits Kidney Disease in Obesity and Diabetes

BASIC RESEARCH www.jasn.org

† † Xiaoxin X. Wang,* Michal Herman Edelstein, Uzi Gafter, Liru Qiu,* Yuhuan Luo,* ‡ | Evgenia Dobrinskikh,* Scott Lucia,* Luciano Adorini, Vivette D. D’Agati,§ Jonathan Levi, | | Avi Rosenberg, Jeffrey B. Kopp, David R. Gius,¶ Moin A. Saleem,** and Moshe Levi*

*Department of Medicine, Division of Renal Diseases and Hypertension, University of Colorado Anschutz Medical Campus, Aurora, Colorado; †Rabin Medical Center, Department of Nephrology and Hypertension; Felsenstein Medical Research Center, Sackler School of Medicine, Tel Aviv University, Israel; ‡Intercept, New York, New York; §Department of Pathology, ║ Columbia University, College of Physicians and Surgeons, New York, New York; National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health, Bethesda, Maryland; ¶Northwestern University Feinberg School of Medicine, Chicago, Illinois; and **University of Bristol, Southmead Hospital, Bristol, United Kingdom

ABSTRACT Obesity and diabetes mellitus are the leading causes of renal disease. In this study, we determined the regulation and role of the G protein-coupled bile acid receptor TGR5, previously shown to be regulated by high glucose and/or fatty acids, in obesity-related glomerulopathy (ORG) and diabetic nephropathy (DN). Treatment of diabetic db/db mice with the selective TGR5 agonist INT-777 decreased proteinuria, podocyte injury, mesangial expansion, ﬁbrosis, and CD68 macrophage inﬁltration in the kidney. INT-777 also induced renal expression of master regulators of mitochondrial biogenesis, inhibitors of oxidative stress, and inducers of fatty acid b-oxidation, including sirtuin 1 (SIRT1), sirtuin 3 (SIRT3), and Nrf-1. In- creased activity of SIRT3 was evidenced by normalization of the increased acetylation of mitochondrial superoxide dismutase 2 (SOD2) and isocitrate dehydrogenase 2 (IDH2) observed in untreated db/db mice.

Accordingly, INT-777 decreased mitochondrial H2O2 generation and increased the activity of SOD2, which associated with decreased urinary levels of H2O2 and thiobarbituric acid reactive substances. Furthermore, INT-777 decreased renal lipid accumulation. INT-777 also prevented kidney disease in mice with diet- induced obesity. In human podocytes cultured with high glucose, INT-777 induced mitochondrial biogenesis, decreased oxidative stress, and increased fatty acid b-oxidation. Compared with normal kidney biopsy specimens, kidney specimens from patients with established ORG or DN expressed signiﬁcantly less TGR5 mRNA, and levels inversely correlated with disease progression. Our results indicate that TGR5 activation induces mitochondrial biogenesis and prevents renal oxidative stress and lipid accumulation, establishing a role for TGR5 in inhibiting kidney disease in obesity and diabetes.

J Am Soc Nephrol 27: 1362–1378, 2016. doi: 10.1681/ASN.2014121271

Obesity and diabetes mellitus are the leading causes Received December 29, 2014. Accepted August 12, 2015. 1–5 of renal disease. The pathogenesis of obesity and X.X.W. and M.H.E. contributed equally to this work. 6–14 diabetes associated renal disease is multifactorial. Published online ahead of print. Publication date available at In spite of all the beneﬁcial interventions implemen- www.jasn.org. ted in diabetic patients, including tight glucose and Correspondence: Dr. Moshe Levi, Division of Renal Diseases & blood pressure control, renal disease still progresses Hypertension, University of Colorado Denver, 12700 East 19th in most patients.15,16 Additional treatments able to Avenue, Research 2, Room 7002, Box C281, Aurora, CO 80045, or Dr. Xiaoxin X. Wang, Department of Medicine, University of control pathogenic pathways involved in obesity and Colorado Denver, 12700 East 19th Avenue, Research 2, Room diabetic nephropathy (DN) are required. 7450, Box C281, Aurora, CO 80045. Email: Xiaoxin.Wang@ Bile acids (BAs) act as signaling molecules that ucdenver.edu or [email protected] activate BA receptors which regulate BA homeostasis, Copyright © 2016 by the American Society of Nephrology

1362 ISSN : 1046-6673/2705-1362 JAmSocNephrol27: 1362–1378, 2016 www.jasn.org BASIC RESEARCH as well as glucose homeostasis, lipid homeostasis, and energy RESULTS expenditure. Two major receptors for BA have been identified: the nuclear receptor farnesoid X receptor (FXR), and the Treatment of Diabetic Mice with theTGR5-Specific membrane-bound, G protein-coupled receptor TGR5. Ex- Agonist INT-777 Prevents DN pression and function of TGR5 are distinct from expression TGR5 mRNA expression is decreased in diabetic mice (Figure and function of FXR, although in some cases they are 1A). To explore the role of TGR5 signaling in diabetic kidney complementary.17,18 While the effects of TGR5 in the mus- disease, we treated db/db mice with TGR5 agonist INT-777. cle, brown adipose tissue, immune cells and enteroendo- INT-777 decreased urinary albumin excretion (Figure 1B), crine cells have been studied,19–26 theroleofTGR5inthe glomerular mesangial expansion (Figure 1C), accumulation kidney is not known. of extracellular matrix proteins (Figure 1D), prevented glo- TGR5 (GPBAR1 or GPR131) has been identified as a merular podocyte injury and loss (Figure 1, E–G), and de- membrane BA-activated G protein-coupled receptor creased macrophage accumulation in the kidney (Figure (GPCR, class A).19,20 TGR5 is a member of the rhodopsin- 1H). Thus, INT-777 prevented all of the major phenotypic like subfamily of GPCRs (Class A). TGR5 mRNA is ex- characteristics of DN. These beneficial effects are independent pressed in the gall bladder, kidney, brown adipose tissue, of any alterations in plasma glucose, cholesterol, or arterial liver, intestine, and selected areas of the central nervous systolic blood pressure, but were associated with a marked system. TGR5 is activated by several BAs, lithocholic acid decrease and normalization of plasma triglycerides (Table 1). (LCA) being the most potent natural agonist with an EC50 of 530 nM.17,18 Treatment of Diabetic Mice with INT-777 Increases Upon ligand binding, TGR5 activation leads to the release Renal Mitochondrial Biogenesis, Decreases Oxidative b of the Gas subunit and activation of adenylate cyclase. The Stress, and Increases Fatty Acid -Oxidation increase in intracellular concentration of cyclic AMP acti- INT-777 induces significant increases in mRNA and/or protein vates protein kinase A (PKA), which phosphorylates cAMP- abundance of (1) phospho-AMP kinase (p-AMPK) and phospho- response element binding protein (CREB). Activated CREB ACC (Figure 2, A and B), (2) SIRT1 (Figure 2C), (3)PPARg transactivates its target genes by binding to cAMP-response coactivator-1a (PGC-1a) (Figure 2D), (4) estrogen related re- elements (CREs) contained in their promoter.17,18 ceptor-a (ERRa) (Figure 2E), (5) SIRT3 (Figure 2F), and (6) In brown adipose tissue and muscle, BA-induced nuclear respiratory factor 1 (Nrf-1) (Figure 2G). These are im- increases in cAMP lead to the activation of type 2 iodo- portant mediators of mitochondrial biogenesis, oxidative stress, thyronine deiodinase (D2), which results in increased and fatty acid b-oxidation. SIRT3 activity is increased following intracellular production of thyroid hormone. Activation treatment with INT-777, as manifested by the decreased acety- of the thyroid receptor (TR) increases mitochondrial lation of SIRT3 targets SOD2 (Figure 2H) or IDH2 (Figure 2I). oxidative phosphorylation in muscle and uncoupling in INT-777 (1) decreases mitochondrial ROS production brown adipose tissue, resulting in enhanced energy expen- (Figure 3A), and (2) increases total superoxide dismutase diture.24,27 TGR5 also increases PGC-1a expression, which (SOD) (Figure 3B) and mitochondrial SOD2 (Figure 3C) ac- is a master regulator of mitochondrial biogenesis and me- tivity. This is associated with significant decreases in urinary tabolism.24 In enteroendocrine cells, activation of TGR5 thiobarbituric acid reactive substances (TBARS) (Figure 3D) results in enhanced glucagon-like peptide 1 (GLP1) release, and urinary H2O2 excretion (Figure 3E), which are indicative which induces insulin secretion and improves glucose ho- of a decrease in overall renal oxidative stress. meostasis.17,22,23 INT-777 also (1) decreases DGAT1 (Figure 4A), an enzyme TGR5 activation also has immunomodulatory effects, in critical for triglyceride synthesis, (2)increasesPPAR-a (Figure particular on macrophage function. TGR5 agonists inhibit 4B), a nuclear receptor critical for fatty acid oxidation, (3)increases NF-kB, suppressing LPS-induced increases in IL-1a, IL-1b, uncoupling protein-2 (Figure 4C), and (4) increases carnitine pal- IL-6, and TNF-a production.19,25 By reducing the inflamma- mitoyltransferase Ib (Figure 4D), which mediates fatty acid tory response and lipid loading in macrophages, TGR5 acti- b-oxidation, resulting in decreased (5) renal neutral lipid accumu- vation inhibits atherosclerosis.26,28 lation (Figure 4E). These results are consistent with the capacity of The purpose of the present study was to determine the INT-777 to reduce plasma triglycerides in diabetic mice (Table 1). expression and protective role of TGR5 in obesity-related glomerulopathy (ORG) and DN. Our studies indicate a Treatment of Mice with Diet-Induced Obesity with novel role for TGR5 activation in inducing energy metab- INT-777 Prevents Obesity-Associated Nephropathy olism, mitochondrial biogenesis, and fatty acid oxidation in TGR5 mRNA expression is also decreased in the kidneys of DIO the kidney by activating AMPK, SIRT1, PGC-1a,ERRa,and mice (Figure 5A). INT-777 treatment of DIO mice decreased SIRT3, which lead to prevention of oxidative stress and lipid urinary albumin (Figure 5B), podocyte injury (Figure 5C), ex- accumulation, thus firmly establishing an important role tracellular matrix proteins fibronectin and type IV collagen ac- for TGR5 in preventing kidney disease in obesity and di- cumulation (Figure 5, D and E), and profibrotic growth factors abetes. TGF-b, CTGF, and PAI-1 (Figure 5F), CD68 macrophages

J Am Soc Nephrol 27: 1362–1378, 2016 TGR5 Modulates Kidney Disease 1363 BASIC RESEARCH www.jasn.org

Figure 1. TGR5 specific agonist INT-777 prevents DN in db/db mice. (A) TGR5 mRNA expression is decreased in the kidneys of mice with diabetes. (B) Urine albumin excretion is decreased with the treatment of INT-777 in db/db mice. (C) Periodic acid Schiff staining indicates marked mesangial expansion in db/db mice and treatment with INT-777 results in a significant decrease in mesangial expansion. (D) Fibronectin immunofluorescence microscopy indicates marked accumulation of glomerular matrix in db/db mice and treatment with INT-777 results in a significant decrease in

1364 Journal of the American Society of Nephrology J Am Soc Nephrol 27: 1362–1378, 2016 www.jasn.org BASIC RESEARCH

Table 1. Metabolic parameters in diabetic mice db/m db/m + INT-777 db/db db/db + INT-777 Final body weight (g) 33.460.43 31.160.83 38.661.76a 36.363.09 Percentage of body weight change 13.461.32 10.663.69 212.861.58a 214.865.5 Kidney weight (g) 0.1660.004 0.1460.005 0.1960.005a 0.1860.008 Plasma glucose (mg/dl) 9869125619 337636a 341645 Plasma TG (mg/dl) 48.863.96 53.565.14 150.5632.3a 70.166.77b Plasma TC (mg/dl) 74.462.91 70.263.48 93.561.89a 87.965.90 Systolic blood pressure (mmHg) 116612 1106911165 10963 Data are means6SEM (n=6 mice in each group). aP,0.05 versus db/m. bP,0.05 versus db/db.

(Figure 5G), proinflammatory cytokine and receptors MCP-1, TGR5 Signaling Acts on Both Glomerular and Tubular TLR2, and TLR4 (Figure 5H). INT-777 also decreased neutral Fractions Isolated from Diabetic Mice lipid accumulation as determined by label-free coherent anti- TGR5 mRNA is expressed in isolated glomeruli and tubules Stokes Raman (CARS) microscopy (Figure 5I). INT-777 in- with a significantly higher level in the tubules (Figure 7A). To duced significant increases in p-AMPK (Figure 5J), PGC-1a determine whether TGR5 acts in glomeruli versus tubules, (Figure 5K), and SIRT3 protein abundance as determined we further checked the regulation of TGR5 targets in glo- both by Western blotting (Figure 5K) and immunofluorescence merular and tubular fractions isolated from db/db mice microscopy (Figure 5L). Increased SIRT3 activity resulted in in- treated with INT-777. In glomeruli, we observed increased creased MnSOD protein abundance (Figure 5M).Therefore, mRNA expression of PGC1a and SIRT3 (Figure 7B). A sim- similar to the actions of INT-777 in diabetic mice, INT-777 ilar increase in PGC1a mRNA and protein (Figure 7C), as prevents the phenotypic manifestations of obesity-related renal well as SIRT3 protein level, was found in the isolated tubule disease in mice with DIO. fraction (Figure 7D). In spite of similar caloric intake, average daily caloric intake low fat 12.860.8 versus low fat + INT-777 12.660.1, P=NS, TGR5 Signaling Modulates Response of Podocytes and high fat 21.761.3 versus high fat + INT-777 18.161.0, P=NS Proximal Tubular Cells to High Glucose (Figure5N),INT-777preventedweightgaininDIOmice Tofurther confirm the glomerular and tubular actions of TGR5 (Table 2). INT-777 also induced significant decreases in signaling and to determine a direct effect of TGR5 activation in plasma triglyceride and cholesterol concentration (Table 2). the kidney independent of any systemic actions, we studied The prevention of weight gain has been seen in previous stud- cultured human podocytes and human proximal tubule cells ies as well21 and may be related to increased mitochondrial with the INT-777 treatment, respectively. TGR5 protein is biogenesis in muscle and browning of adipose tissue. expressed in human podocytes (Figure 7E) and INT-777 induced a rapid increase of cAMP at levels comparable to those Endogenous TGR5 Modulates Renal Expression of observed when using forskolin stimulation (Figure 7F). INT- PGC-1a, ERRa, and SIRT3 777 prevented high glucose-induced mitochondrial apoptosis To determine if TGR5 per se modulates renal expression of as determined by a decrease in activated caspase 3/7 (Figure PGC-1a,ERRa, and SIRT3, we analyzed the kidneys of TGR5 7G) and mitochondrial damage as determined by Mito Green knockout(KO)mice.TGR5KOmicehavesignificant decreases in staining (Figure 7H). INT-777 increased mitochondrial oxy- PGC-1a,ERRa, and SIRT3 protein expression (Figure 6, A–C). gen consumption rate (Figure 7I) and suppressed mitochon- INT-777 did not induce upregulation of PGC-1a, ERRa,or drial ROS production as determined by Mito Sox staining SIRT3inTGR5KOmice(Figure6,A–C). These results are con- (Figure 7J). INT-777 also induced increases in mitochondrial sistent with specificTGR5-mediatedsignalinginducedby p-AMPK (Figure 7K) and PGC-1a protein (Figure 7L). INT- INT-777. In addition, the regulation of these signaling processes 777 prevented podocyte lipid accumulation as determined by in the kidney is specific to the bile acid activated G protein-coupled label-free CARS imaging (Figure 7M), which was mediated receptor TGR5 as the BA-activated nuclear receptor FXR KO mice by a significant decrease in sterol regulatory element-binding have no alterations in PGC-1a or SIRT3 protein (Figure 6D). protein 1 (SREBP-1) (Figure 7N) that would decrease fatty

fibronectin immunostaining. (E) Synaptopodin immunofluorescence microscopy indicates significant decrease in the percentage of immunostaining area in glomerular tufts in db/db mice, which is indicative of decreased podocyte density, and treatment with INT-777 results in preservation of synaptopodin positive area. (F) Nephrin immunofluorescence microscopy shows that the treatment with INT-777 restores the decreased percentage of podocyte marker nephrin positive area in glomerular tuft in db/db kidneys. (G) p57 immunohistochemistry indicates significant decrease in podocyte number in db/db mice, and treatment with INT-777 prevents the loss of podocyte number. (H) CD68 immunofluorescence microscopy indicates the decreased macrophage accumulation by the treatment with INT-777 in db/db kidneys.

J Am Soc Nephrol 27: 1362–1378, 2016 TGR5 Modulates Kidney Disease 1365 BASIC RESEARCH www.jasn.org

Figure 2. Treatment of diabetic mice with INT-777 increases mediators of renal mitochondrial biogenesis. Representative QPCR or Western blot results show that the treatment with INT-777 induces signiﬁcant increases in (A) phospho-AMPK and AMPK protein, (B) phospho-ACC protein, (C) SIRT1 mRNA and protein, (D) PGC-1a protein, (E) ERRa mRNA and protein, (F) SIRT3 mRNA, (G) Nrf1 mRNA, and SIRT3 activity as shown by the decreased acetylation of SIRT3 targets (H) SOD2 and (I) IDH2. acid synthesis, and an increase in PPAR-a, long-chain acyl- serum albumin-palmitate was used as a substrate (Figure CoA dehydrogenase (LCAD), and carnitine palmitoyl 7P), which is indicative of increased fatty acid oxidation transferase-1 (CPT-1) that would increase fatty acid oxida- activity. tion (Figure 7O). Indeed, INT-777 treatment induced an In cultured human proximal tubule cells, there is also increase in the oxygen consumption rate when bovine rapid cAMP response to INT-777 (Figure 7Q). Increased

1366 Journal of the American Society of Nephrology J Am Soc Nephrol 27: 1362–1378, 2016 www.jasn.org BASIC RESEARCH

decrease in TGR5 mRNA in the kidney biopsies of DNand ORG subjects (Figure 8D), we were unable to determine major and consistent differences in TGR5 protein level in glomeruli or tubules. There are several possible explanations for the discordant results in human diabetic tissue, with TGR5 mRNA being reduced while TGR5 protein appears unaf- fected by diabetes. These reasons include a biologic difference (e.g., prolonged protein half-life in diabetes compared with normal) and a methodologic difference (e.g., reduced dynamic range of immunohistochemistry compared with RT-PCR). Further, pathologic processes in humans are complex, and protein expression patterns may reflect underly- ing diseases, aging, co-morbidities, and the effects of medications. In addition, our inabil- ity to detect a change in glomerular or tubular TGR5proteininspiteofadecreaseinTGR5 mRNA may be due to the specificity of the currently available antibodies. However, the decrease in TGR5 mRNA is significantly correlated with (1) level of proteinuria (Figure 8E), (2) glomerulosclerosis (Figure 8F), (3) initial eGFR (Figure 8G), and (4) follow-up eGFR and progression of kidney disease (Figure 8H). Definition of slow versus rapid progression of eGFR decline in relationship of initial TGR5 mRNA level is based on initial and follow-up eGFR. In the whole patient cohort, the median rate of GFR decline was 0.6 ml/min/month (Sup- plemental Table 1). To study the association Figure 3. Treatment of diabetic mice with INT-777 decreases oxidative stress. (A) of TGR5 mRNA with longitudinal eGFR Mitochondrial ROS generation is increased in mitochondria isolated from db/db mice decline, we analyzed TGR5 expression after and treatment with INT-777 decreased mitochondrial ROS generation. (B) Total SOD classifying the patients into two groups: (A) activity is decreased in the kidneys of db/db mice and treatment with INT-777 increases slow progressors: eGFR decline below total SOD activity. (C) Mitochondrial SOD activity is decreased in mitochondria isolated 0.6 ml/min/month versus (B) fast progres- from db/db mice and treatment with INT-777 increases mitochondrial SOD activity. (D) sors: eGFR decline above 0.6 ml/min/month. Urinary TBARS excretion, a marker of oxidative stress, is increased in db/db mice and Median time for starting dialysis was 18 treatment with INT-777 decreases urinary TBARS excretion. (E) Urinary H2O2 excretion, a marker of oxidative stress, is increased in db/db mice and treatment with INT-777 months in the fast progressors group versus decreases urinary H2O2 excretion. 60 months for the slow progressors group. On biopsy day the group’s demographic data TGR5 signaling led to the increased SIRT3 activity as shown were different only in HbA1c levels and age. The faster eGFR by the reduction of acetylated SOD2 (Figure 7R). decline group showed significantly lower expression of TGR5 (Figure 8H). The decrease in TGR5 mRNA also correlated with TGR5 Signaling in Human Kidney Disease in Obesity decreases in (5) the glomerular podocyte markers nephrin and and Diabetes podocin (Figure 8, I and J). TGR5 is also expressed in human kidney, with much higher In addition, the TGR5 targets PGC-1a, SIRT3, and ERRa TGR5 mRNAexpression inthetubules compared withglomeruli that we identified in the mouse kidney, as well as human po- (Figure 8A). TGR5 protein is also expressed in the glomeruli and docytes and proximal tubular cells, are also regulated in the tubules as determined by immunohistochemistry (Figure 8B) human diabetic kidney, with significant decreases in PGC-1a and immunofluorescence microscopy (Figure 8C), using two (Figure 8K), SIRT3 (Figure 8L), and ERRa mRNA (Figure different anti-human TGR5 antibodies. In spite of a significant 8M). In fact the PGC-1a mRNA levels both correlate with

J Am Soc Nephrol 27: 1362–1378, 2016 TGR5 Modulates Kidney Disease 1367 BASIC RESEARCH www.jasn.org

cause and mechanism for decreased TGR5 expression in obesity and in diabetes. While these studies indicate the rele- vance of TGR5 to human disease, they are only correlative and do not provide a direct cause and effect relationship. We therefore utilized two well-studied mouse models of obesity and diabetes to determine whether TGR5 agonists would have any utility in prevention of DN and ORG. As in human disease, we found that TGR5 mRNA expression is also decreased in mouse models of diabetes and obesity. To determine the role of TGR5 in these conditions, we used the specific TGR5 agonist INT-777 (6a-ethyl-23(S)-methyl-cholic acid), a semisynthetic cholic acid derivative with systemic bioavailability.29 INT-777, due to its relatively low intestinal absorption, can effectively activate TGR5 in enteroendocrine cells, triggering GLP-1 secretion, and because of its systemic biodistribution can activate TGR5 in different districts, including the kidney.30 INT-777 treatment in mice with DIO leads to enhanced mitochondrial function in muscle, brown adipose tissue, and enteroendocrine cells, resulting in increased energy expenditure and incretin secretion, and inducing a range of beneficial metabolic effects that include resistance to weight gain and hepatic steatosis, preser- Figure 4. Treatment of diabetic mice with INT-777 decreases lipid accumulation. (A) vation of liver and pancreatic function, and Representative images of oil red O staining, which stains for neutral lipids, show that maintenance of glucose homeostasis and 21 neutral lipid accumulation in kidneys of db/db mice is prevented by the treatment with insulin sensitivity. In addition, INT-777 INT-777. The decrease in neutral lipid accumulation is associated with decrease in (B) exerts, via TGR5 activation, immune DGAT1, mediator of triglyceride synthesis, and increases in (C) PPAR-a, (D) UCP-2, and modulatory and anti-inflammatory effects (E) CPT1B, mediators of fatty acid synthesis. leading to inhibition of macrophage NF- kB signaling and to prevention of atherosclerotic lesion formation.26,28 TGR5 mRNA expression (Figure 8N) and initial eGFR In db/db mice, treatment with INT-777 decreases albu- (Figure 8O). minuria, mesangial expansion, extracellular matrix protein accumulation, podocyte loss, and macrophage infiltration. TGR5 activates AMPK, SIRT1, PGC-1a,ERRa,SIRT3,and DISCUSSION Nrf-1, indicating activation of mitochondrial biogenesis.31–45 This is consistent with several observations in animal models Our data demonstrate decreased TGR5 mRNA expression, and humans linking reduced mitochondrial function and ox- with an inverse correlation between TGR5 expression level and idative phosphorylation to the development of type 2 diabe- progression of kidney disease defined by decrease in eGFR, tes.46 INT-777 also activates the TGR5-D2 signaling pathway, glomerulosclerosis, proteinuria, and direct correlation with and robustly increases mitochondrial activity and oxidative expression of the podocyte markers nephrin and podocin. phosphorylation.21 We found that INT-777 prevents diabe- Studies in cultured human podocytes and glomerular endo- tes-induced mitochondrial ROS generation, while it reverses thelial cells indicate that high glucose and/or fatty acids, two the diabetes-induced decrease in superoxide dismutase activ- metabolic perturbations common in diabetes and obesity, ity. The net result is that INT-777 prevents diabetes-induced induce downregulation of TGR5, thus providing a potential increases in urinary H2O2 and TBARS, well-established

1368 Journal of the American Society of Nephrology J Am Soc Nephrol 27: 1362–1378, 2016 www.jasn.org BASIC RESEARCH

Figure 5. TGR5 specific agonist INT-777 prevents nephropathy in diet-induced obesity mice. (A) TGR5 mRNA expression is decreased in the kidneys of mice with diet-induced obesity. (B) Urinary albumin excretion is increased in mice fed a high fat (HF) diet and treatment with INT- 777 decreases albuminuria. (C) Nephrin immunofluorescence microscopy shows that the percentage of podocyte marker nephrin positive area in glomerular tuft, indicative of podocyte density, is restored by the treatment with INT-777 in db/db kidneys. (D) Fibronectin immunofluorescence microscopy indicates marked accumulation of glomerular matrix in HF mice and treatment with INT-777 results in asignificant decrease in fibronectin immunostaining. (E) Type IV collagen immunofluorescence microscopy indicates that the marked accumulation of glomerular matrix in HF mice is significantly decreased by the treatment with INT-777. (F) Profibrotic growth factors TGF-b, CTGF, and PAI-1 expression are increased in HF diet and treatment with INT-777 results in marked decreases in the expression of these profibrotic growth factors. (G) CD68 immunofluorescence microscopy indicates significant increase in immunostaining in HF mice, which is indicative of increased macrophage accumulation, and treatment with INT-777 results in decrease of CD68 immunostaining. (H) Proin- flammatory cytokines MCP-1, TLR2, and TLR4 expression are increased in HF diet and treatment with INT-777 results in marked decreases in the expression of these proinflammatory cytokines. (I) Coherent anti-stokes Raman scattering (CARS) microscopy imaging indicates increased lipid accumulation in the kidneys of HF mice and treatment with INT-777 results in decreased lipid accumulation. (J and K) Representative Western blots show that INT-777 treatment increases expression of mediators of mitochondrial biogenesis, including p-AMPK (J), PGC-1a and SIRT3 (K). Increased SIRT3 expression with the INT-777 treatment is further manifested by immunofluorescence (L, green SIRT3, red F-actin). (M) Treatment of HF mice with INT-777 induced increased mitochondrial SOD protein. (N) Average caloric intake shows no difference in HF mice with INT-777 treatment from HF mice without treatment.

J Am Soc Nephrol 27: 1362–1378, 2016 TGR5 Modulates Kidney Disease 1369 BASIC RESEARCH www.jasn.org

Figure 5. Continued. markers of oxidative stress. In addition, INT-777 also pre- anti-fibrotic effects induced by INT-777 treatment in chronic vents lipid accumulation in the kidney by decreasing DGAT1, kidney disease. an enzyme involved in triglyceride synthesis, and increasing The role of TGR5 in regulating PGC-1a,ERRa,andSIRT3, PPAR-a, an uncoupling protein-2, and CPT1b,aninducerof important elements in the control of mitochondrial biogene- fattyacidoxidationandenergyuncoupling. sis, antioxidant generation, and fatty acid b-oxidation, is il- Treatment of DIO mice with INT-777 decreased urinary lustrated by the observation that PGC-1a,ERRa,andSIRT3 albumin excretion, podocyte loss, accumulation of extracel- mRNA expression are decreased in the kidneys of patients with lular matrix proteins, expression of profibrotic growth factors ORG and DN. We have found that PGC-1a,ERRa,andSIRT3 TGFb, CTGF, and PAI-1, accumulation of CD68 positive mac- protein expression are also reduced in the kidneys of TGR5 KO rophages, and expression of proinflammatory cytokines MCP- mice. Additionally, treatment with INT-777 in TGR5 KO mice 1, TLR2, and TLR4. INT-777 also decreased accumulation of does not induce PGC-1a,ERRa, and SIRT3, further indicat- lipids and induced AMPK, PGC-1a, and SIRT3 expression. As ing the key role of TGR5 in their upregulation and the spec- AMPK activation has been found to markedly reduce glomer- ificity of INT-777 as a TGR5 agonist. ular TGF-b, collagen, and fibronectin accumulation in several In previous studies we had demonstrated that agonists of mousemodelsofdiabetickidneydisease,32 our findings FXR, the BA-activated nuclear receptor, can prevent diabetes suggest an important role for the anti-inflammatory and and obesity-related kidney disease.47–49 In contrast, the effects of streptozotocin-induced hyperglycemia in the kidney were markedly accentuated Table 2. Metabolic parameters in diet-induced obesity mice in FXR KO mice.49 The effects of TGR5 in LF LF + INT-777 HF HF + INT-777 the kidney, however, are distinct from FXR, Final body weight (g) 29.560.29 28.660.48 51.960.54a 40.761.43b as in FXR KO mice, unlike in TGR5 KO Percentage of body weight change 23.061.31 22.263.14 121.664.54a 62.065.64b mice, we did not see regulation of PGC-1a Kidney weight (g) 0.1760.007 0.1660.005 0.2260.007a 0.2060.010 or SIRT3, thereby differentiating TGR5 from a Plasma glucose (mg/dl) 22667 190611 234613 203617 FXR actions in the kidney. 6 6 6 a 6 b Plasma TG (mg/dl) 33.8 2.60 39.6 1.6 76.2 5.10 48.8 4.38 Because beneficial effects of TGR5 ago- 6 6 6 a 6 b Plasma TC (mg/dl) 151.5 3.99 163.6 5.30 202.5 5.21 153.0 7.61 nism could be mediated by its multiple Systolic blood pressure (mmHg) 11466 1126511063 11266 extrarenal effects to regulate metabo- 6 Data are means SEM (n=6 mice in each group). LF, low-fat diet; HF, high-fat diet. 19–26 aP,0.05 versus LF. lism, we also performed studies in bP,0.05 versus HF. human podocytes cultured in the presence

1370 Journal of the American Society of Nephrology J Am Soc Nephrol 27: 1362–1378, 2016 www.jasn.org BASIC RESEARCH

Figure 6. Endogenous TGR5 modulates renal expression of mediators in mitochondrial biogenesis and anti-oxidative stress. (A–C) Kidneys from TGR5 deficient mice express less PGC-1a protein (A), ERRa protein (B), and SIRT3 protein (C), compared with wild type mice. Treatment with INT-777 does not reverse the decreased expression in kidneys of TGR5 knockout mice. (D) In contrast, PGC-1a and SIRT3 protein are not altered in the kidneys of FXR knockout mice. of high glucose and treated with INT-777. INT-777 repro- effects in enhancing mitochondrial biogenesis, decreasing mito- duced most of the effects seen in vivo. INT-777 increased mi- chondrial ROS generation and inducing fatty acid tochondrial biogenesis and podocyte mitochondrial oxygen b-oxidation.39,45,55 Indeed, TGR5 activation in the kidney consumption rate and decreased mitochondrial ROS produc- leads to decreased oxidative stress and lipid accumulation, ef- tion. INT-777 activated AMPK and PGC-1a, and prevented fects also observed in cultured podocytes treated with INT-777. high glucose induced podocyte lipid accumulation. The pre- In agreement with earlier studies, which have shown that vention of lipid accumulation was mediated by inhibition of TGR5 regulates energy metabolism and energy expenditure in fatty acid synthesis mediated by SREBP-1 and activation of the muscle,21,24 our studies also indicate that in spite of similar fatty acid oxidation mediated PPAR-a,LCAD,andCPT-1b. food intake, mice with high fat diet-induced obesity treated with Accordingly, in podocytes INT-777 induced fatty acid oxida- INT-777 gain significantly less weight than their untreated tion as determined by increased oxygen consumption rate, counterparts. Our studies were not designed to measure energy when cultured in the presence of palmitate. expenditure in the kidney. However, the regulation of mito- Mitochondrial dysfunction has been proposed to play a chondrial biogenesis in cultured podocytes, with increased mi- critical role in the pathogenesis and complications of type 2 tochondrial respiration and fatty acid b-oxidation, suggests that diabetes mellitus and obesity.50–53 A recent urine metabolo- TGR5 may also increase energy expenditure in the kidney. mics-based study revealed evidence for suppression of mito- In summary, our results indicate that TGR5 expression and chondrial activity in diabetickidneydisease,aswellas activity is impaired in the kidneys of humans and rodents with decreased expression of PGC-1a mRNA.51 Our results are in obesity and diabetes. TGR5 activation induces mitochondrial agreement with these findings and furthermore indicate that biogenesis, while preventing renal oxidative stress and lipid TGR5 is an important regulator of PGC-1a in the kidney. It accumulation, firmly establishing an important role for TGR5 needs to be determined whether TGR5 activates PGC-1a via a activation in inhibiting kidney disease in obesity and diabetes. PKA and p-CREB signaling pathway, via activation of AMPK which phosphorylates and activates PGC-1a, or via activation of SIRT1 which deacetylates and activates PGC-1a.35 CONCISE METHODS Previous studies have shown reduced PGC-1a levels in the diabetic kidney associated with reduced AMPK, reduced Animal Models: Diabetic Mice mitochondrial content, and reduced mitochondrial complex Eight-week-old male db/m and db/db mice (BLKS/J genetic back- activity, and have demonstrated a beneficial effect of AMPK ground) were obtained from Jackson Laboratories (Bar Harbor, ME). activation in preventing kidney disease in mouse models of They were maintained on a 12-h light/12-h dark cycle. They were fed obesity and diabetes.32,54 It is likely that these beneficial effects for 12 weeks a regular chow diet or the TGR5 agonist 6a-ethyl-23(S)- were mediated, at least in part, via activation of PGC-1a. methylcholic acid (6-EMCA, INT-777), 30 mg/kg body weight/day, PGC-1a is a master regulator of mitochondrial biogenesis. admixed with chow.21 One week prior to the end of the study the Our results in mice with diabetes and obesity and cultured mice were placed in metabolic cages for a 24-h urine collection. At human podocytes indicate that TGR5 stimulates the AMPK- the end of the study period, following anesthesia, blood was drawn SIRT1-PGC-1a axis, resulting in increased and even restored from the aorta for chemistry and the kidneys were rapidly removed mitochondrial biogenesis. and processed for histology and immunofluorescence microscopy, TGR5 is also associated with activation of ERRa and SIRT3, a RNA extraction for real-time PCR (QPCR), protein extraction for downstream target gene of PGC-1a, which have important Western blotting, or mitochondria isolation.

J Am Soc Nephrol 27: 1362–1378, 2016 TGR5 Modulates Kidney Disease 1371 BASIC RESEARCH www.jasn.org

Figure 7. TGR5 signaling acts on both glomerular and tubular fractions. (A) mRNA level of TGR5 in isolated mouse glomeruli and tubules. (B) Treatment with INT-777 increases PGC1a and SIRT3 mRNA in isolated glomeruli from db/db mice. (C and D) Treatment with INT-777 increases PGC1a mRNA and protein level (C) and SIRT3 protein level (D) in the tubule fraction of db/db mice. (E) Both immunofluorescence microscopy and Western blot indicate the expression of TGR5 in cultured human podocytes. (F) INT-777 induces cAMP induction in cultured human podocytes. (G) Treatment with INT-777 prevents apoptosis, indicated by activated caspase 3/7, in human podocytes cultured with high glucose (HG) condition. (H) HG induces decrease in mitochondrial number as determined by Mito Green fluorescence staining, which is prevented by treatment with INT-777. (I) Treatment of HG podocytes with INT-777 increases oxygen consumption rate. (J) HG induces podocyte oxidative stress and ROS production as determined by MitoSox Red fluorescence staining, which is prevented by treatment with INT-777. (K) Treatment of podocytes with INT-777 increases p-AMPK protein. (L) HG induces decrease in PGC-1a protein, which is prevented by treatment with INT-777. (M) INT-777 prevents HG induced podocyte lipid accumulation as determined by CARS microscopy imaging. (N) HG induces increase in nuclear SREBP-1 protein, a transcriptional factor which is a master regulator of fatty acid and triglyceride synthesis, which is prevented by treatment with INT-777. (O) Treatment with INT-777 prevents HG induced decrease in PPAR-a, LCAD and CPT-1B, mediators of fatty acid b-oxidation. (P) Treatment of HG podocytes increases fatty acid b-oxidation rate. (Q) INT-777 induces cAMP induction in cultured human proximal tubule cells. (R) INT-777 increases SIRT3 activity in cultured human proximal tubule cells as shown by the reduction of acetylated SOD2.

Diet-Induced Obesity Mice FXR KO Mice Eight-week-old C57BL/6J mice were obtained from Jackson Labora- FXR generalized KO mice, on the C57BL/6J genetic background, tories (Bar Harbor, ME). They were maintained on a 12-h light/12-h originally generated by Frank Gonzalez,56 were obtained from The dark cycle. They were fed for 12 weeks a low (10 kcal %) fat diet from Jackson Laboratory (Bar Harbor, ME). Research Diets (D12450), or a high (60 kcal %) fat diet from Research Animal studies and relative protocols adhered to the National Diets (D12492) supplemented with no addition or the TGR5 agonist Institutes of Health Guide for the Care and Use of Laboratory Animals 6a-ethyl-23(S)-methylcholic acid (6-EMCA, INT-777), 30 mg/kg and were approved by the Animal Care and Use Committee at the body weight/day. At the end of the treatment period, mice were stud- University of Colorado Denver. ied as above. Glomerular and Tubulo-Interstitial Cell Isolation from TGR5 KO Mice Mice TGR5 generalized KO mice and their littermates were a generous gift Mouse glomeruli were isolated from kidney cortex using the iron oxide from Dr. Johan Auwerx and Dr. Kristina Schoonjans, Lausanne, injection method as described elsewhere.57 Those not collected for glo- Switzerland.21 meruli in the puriﬁcation process were saved as the tubular fraction. The

1372 Journal of the American Society of Nephrology J Am Soc Nephrol 27: 1362–1378, 2016 www.jasn.org BASIC RESEARCH

Figure 7. Continued. purity of glomerular and tubular preparation was verified under Biosystems) for 14 cycles of pre-amplification according to the man- microscopy as well as podocin (glomerular) and tubular (NaPi-2a) ufacturer’s protocol using target gene assays (Applied Biosystems). markers. Candidate gene expression was analyzed by real-time RT-PCR, performed as described previously,61 using the TaqMan and SYBR Human Kidney Samples system based on real-time detection of accumulated fluorescence Formalin-fixed paraffin-embedded (FFPE) tissue specimen renal biopsy (ABI Prism Step One; PerkinElmer, Foster City, CA). Fluorescence material was obtained from the archives of the Columbia Renal foreachcyclewasquantitativelyanalyzedbyanABIStepOne Pathology Laboratory and from pathologic archives of the Department sequence detection system (PerkinElmer). In order to control for of Pathology at Rabin Medical Center. Kidney samples were obtained variation in the amount of DNA that was available for PCR in the from leftover portions of diagnostic kidney biopsies of patients with different samples, gene expression of the target sequence was nor- DN (n=34) or ORG (n=33) and normal kidneys (n=17). malized in relation to the expression of an endogenous control, 18S Control biopsies were renal biopsies that appeared normal by rRNA or RPLPO (large ribosomal protein). histologic,immunofluorescence,andelectronmicroscopicexamination. These controls were either obtained from renal biopsies performed for Definition of Slow Versus Rapid Progression of eGFR minimal isolated proteinuria or hematuria or tissue from uninvolved Decline in Relationship of Initial TGR5 mRNA Level portions of a kidney at the time of nephrectomy for tumor or from This is based on initial and follow-up eGFR. In the whole patient cohort, candidate renal donors.58 DN kidney biopsies were from Rabin Medical the median rate of GFR decline was 0.6 ml/min/month (Supplemental Center. Table 1). To study the association of TGR5 mRNA with longitudinal ORG was defined morphologically as focal segmental glomeruloscle- eGFR decline, we analyzed TGR5 expression after classifying the pa- rosis and glomerulomegaly occurring in obese patients with a body mass tients into two groups: (A) slow progressors: eGFR decline below 0.6 ml/ index higher than 30 kg/m.59,60 Nine biopsy-proven ORG were from min/monthversus (B) fast progressors: eGFR decline above 0.6 ml/min/ Rabin Medical Center archive and 24 were from Columbia University. month. Median time for starting dialysis was 18 months in the fast Total RNA was isolated using RNeasy FFPE columns (Qiagen, progressors group versus 60 months for the slow progressors group. Valencia,CA).Themanufacturer’s protocol was followed with the On biopsy day the group’s demographic data were different only in exception of increased (overnight) proteinase K digestion time. HbA1c levels and age on the biopsy day. The faster eGFR decline group RNA quantity and quality were determined by measuring OD at showed significantly lower expression of TGR5 (Figure 8H). 260 and 280 nm on a NanoDrop spectrophotometer (NanoDrop Technologies, Wilmington, DE). RNA was converted to cDNA using Laser Capture Microdissection (LCM) RevertAid First Strand cDNA Synthesis Kit (Fermentas); cDNA was LCM was performed using the PALM Micro Beam instrument (PALM, then amplified using TaqMan PreAmp Master Mix (Applied Carl Zeiss, Germany). FFPE blocks used were cut into sections (5 mm

J Am Soc Nephrol 27: 1362–1378, 2016 TGR5 Modulates Kidney Disease 1373 BASIC RESEARCH www.jasn.org

Figure 8. TGR5 signaling in human kidney disease in obesity and diabetes. (A) TGR5 mRNA expression in LCM acquired glomeruli and tubule-interstitium fraction from human kidney biopsies. (B) Immunofluorescence microscopy shows the TGR5 expression in human kidneys from both non-diabetic controls and diabetic subjects. The localization of TGR5 expression is found in both glomeruli and tubule-interstitium. Blow-up images show the staining in the boxed areas. Scale bar: 10 mm. (C) TGR5 immunohistochemistry using human kidney biopsies. (D) Human TGR5 mRNA is decreased in kidney biopsies from subjects with DN or ORG compared with subjects with normal kidneys. (E) TGR5 mRNA expression in the kidney biopsies is inversely correlated with proteinuria. (F) TGR5 mRNA expression in the kidney biopsies is inversely correlated with global sclerosis as determined by histology. (G) TGR5 mRNA expression in the kidney biopsies is directly correlated with initial eGFR. (H) TGR5 mRNA expression in the kidney biopsies correlates with rate of decline of eGFR, an indicator of renal disease progression. (I) TGR5 mRNA expression in the kidney biopsies is directly correlated with nephrin mRNA expression. (J) TGR5 mRNA expression in the kidney biopsies is directly correlated with podocin mRNA expression. (K–M) TGR5 signaling related molecules, PGC1a (K), SIRT3 (L), and ERRa (M) mRNA level is decreased in kidney biopsies from subjects with DN or ORG compared with subjects with normal kidneys. (N) TGR5 mRNA expression in the kidney biopsies is directly correlated with PGC1a mRNA expression. (O) PGC1a mRNA expression in the kidney biopsies is directly correlated with eGFR. thick) onto PALM membrane slides (PALM, Carl Zeiss), baked and Quantitative Real-Time PCR deparaffinized with xylene, lightly stained with hematoxylin and eo- Quantitative real-time PCR was performed as previously de- – – sin, and air-dried. All the glomeruli or the tissue surrounding the scribed.47 49,62 67 Primer sequences are listed in Supplemental Table 2. captured glomeruli were microdissected and captured on PALM ad- hesive cap tubes followed by total RNA extraction using the RNeasy Western Blotting FFPE Kit (Qiagen). Western blotting was performed as previously described.47–49,62–67 The The study was approved by the Rabin Medical Center Institutional antibodies against PGC-1a (EMD Millipore, Billerica, MA), p-AMPK, Ethics Committee and by the Columbia University Institutional p-ACC, AMPK, SIRT1, SIRT3 (Cell Signaling Technology, Danvers, Review Board. MA), ERRa (Epitomics, Burlingame, CA), SOD2 (Enzo Life Sciences, Farmingdale, NY), acetylated SOD2,68 and acetylated IDH2 (Genetel Urine Chemistry Laboratories, Madison, WI) were used for Western blotting. Urinealbuminandcreatinineconcentrationsweredeterminedusing kits from Exocell (Philadelphia, PA). Urinary H2O2 and TBARS Mitochondria Isolation level was measured using the kits from Thermo Fisher Scientific Freshly excised kidneys were homogenized with a small Dounce (Rockford, IL) and Bioassay Systems (Hayward, CA), respectively. homogenizer in isolation buffer (50 ml 0.1 M Tris-MOPS, 5 ml 0.1 M

1374 Journal of the American Society of Nephrology J Am Soc Nephrol 27: 1362–1378, 2016 www.jasn.org BASIC RESEARCH

Figure 8. Continued.

EGTA-Tris, 100 ml 1 M sucrose in 500 ml nanopure water, pH 7.4). (University of Colorado Denver) with antibody from R&D Systems The homogenate was centrifuged first at 800 g,4°Cfor10minto (Minneapolis, MN) (catalog number MAB4286). remove tissue debris. The supernatant was centrifuged at 8000 g,4°C for 10 min twice to obtain a mitochondrial pellet. The preparation Immunohistochemical Staining was resuspended in a small amount of isolation buffer. The mito- De-identified renal biopsy sections (Columbia University, John Hopkins chondrial protein concentration was measured with a BCA protein University, and Rabin Medical Center (Petah Tikva, Israel)) were used assay kit (Pierce, Rockford, IL). The isolated mitochondria were used under IRB guidelines. Briefly, staining was performed on 5 mm formalin- immediately for ROS measurements or were stored at 280°C until fixed paraffin-embedded sections. Heat-induced antigen retrieval further analysis. (pH 9) and peroxide block was performed in preparation for incubation with anti-TGR5 rabbit polyclonal antibody (1:200 for 2 h; Sigma- Mitochondrial ROS Measurement Aldrich, product number HPA062890) and detection with DAB. H2O2 generation was used to measure the ROS in isolated mitochondria using Amplex Red (Life Technologies) as specified.69 Quantification of Morphology All quantifications were performed in a masked manner. Using SOD Activity Measurement coronal sections of the kidney, 30 consecutive glomeruli per mouse, The total SOD and mitochondrial SOD activities were measured by six mice per group were examined for evaluation of glomerular using SOD Assay kit from Cayman Chemical (Ann Arbor, MI). mesangial expansion. The index of the mesangial expansion was definedasratioofmesangialarea/glomerulartuftarea.Themesangial Histology Staining and Immunofluorescence area was determined by assessment of the PAS-positive and nucleus- Microscopy free area in the mesangium using ScanScope image analyzer (Aperio Sections (2 mm thick) cut from 10% formalin-fixed, paraffin- Technologies, Vista, CA). ImageJ software was used to quantify the embedded kidney samples were used for periodic acid-Schiff synaptopodin or nephrin immunofluorescence by measuring the (PAS) staining and immunohistochemistry for p5770 (performed percentage of the positive staining area in glomerular tuft area. p57 by Kelly Hudkins and Charles Alpers, University of Washington, staining quantification was as described and the glomerular tuft area Seattle). Frozen sections were used for oil red staining of neutral was used as a denominator to assess podocyte number.71 lipid (cholesterol esters and triglycerides) deposits or for immunostaining for fibronectin and type IV collagen (Sigma-Aldrich), neph- Podocyte Culture rin (a gift from Dr. Lawrence Holzman, University of Pennsylvania, Human podocytes were maintained in RPMI 1640, 1% Insulin- Philadelphia,PA),synaptopodin (Sigma-Aldrich), and CD68 (AbD Transferrin-Selenium, 10% fetal bovine serum, 100 U/ml penicillin, Serotec, Raleigh, NC), and imaged with a laser scanning confocal and 100 mg/ml streptomycin at 33°C as previously described.72–77 microscope (LSM 510; Carl Zeiss, Jena, Germany). TGR5 immuno- Podocyte differentiation was induced by thermo-shifting the cells fluorescence was performed on human renal biopsy sections from 33°C to 37°C for 10 days. Podocytes were then treated for

J Am Soc Nephrol 27: 1362–1378, 2016 TGR5 Modulates Kidney Disease 1375 BASIC RESEARCH www.jasn.org

48 h with control (10 mM glucose + 20 mM mannitol as osmotic pump/probe wavelength was chosen to excite the CH2 Raman vibra- 2 control), high glucose (30 mM), or high glucose plus INT-777 tional stretch at 2845 cm 1 present in lipids. The resulting CARS signal (10 mM). Mouse podocytes (line AI) were cultured similarly, with is at approximately 662 nm. A 603 1.2 NA objective (U Plan S Apo 603 the addition of 30 units/ml of mouse interferon gamma.78 IR W, Olympus America, Center Valley, PA) is used to focus the laser beams onto the sample. The laser powers measured at the objective are Proximal Tubule Cell Culture typically ,70 mW for both the 816 nm and 1064 nm laser beams Human proximal tubules were maintained in RPMI 1640, 1% depending on the power necessary to image the sample. The pump/ Insulin-Transferrin-Selenium, 10% fetal bovine serum, 100 U/ml probe power is set at twice the Stokes power because this laser must penicillin, and 100 mg/ml streptomycin at 33°C. Cell differentia- serve both the pump and probe functions in generating a CARS signal. tion was induced by thermo-shifting the cells from 33°C to 37°C for An external non-descanned detector in the epi direction is used to mea- 3–5 days. Proximal tubules were then treated for 48 h with 10 mM sure the TPAF signal from the sample through a 420–520 nm emission normal glucose control, high glucose (30 mM), or high glucose filter (hq470/100m-2p; Chroma Technology, Bellows Falls, VT). The plus INT-777 (10 mM). CARS signal is measured in the forward direction with another non- descanned external detector through a 640–680 nm emission filter Mitochondrial Oxygen Consumption Rate (hq660/40m-2p; Chroma Technology). The pixel dwell time is 10 ms Measurements of mitochondrial oxygen consumption rate were and the image pixel resolution is 1600 by 1600. A Kalman averaging performed on Seahorse XF24 Extracellular Flux Analyzer (Seahorse filter set to three scans/line time is used during image acquisition to Bioscience, Billerica, MA). For these measurements 1.75 3 104 po- improve the signal-to-noise ratio of the acquired images. docytes per well were seeded in 24-well microplates for 7 days. Base- m line OCR was measured in control (vehicle) or INT-777 (10 Moras Statistical Analysis indicated) treated cells. Todetermine fatty acid b-oxidation cells were Results are presented as the means6SEM for at least three indepen- treated with BAS-complexed palmitate (0.5 mM) followed by treat- dent experiments. Data were analyzed by ANOVA and Student–New- ment with control or INT-777 (10 mM). man–Keuls tests for multiple comparisons or by t test for unpaired data between two groups. Statistical significance was accepted at the Podocyte Staining for Mitochondrial ROS and P,0.05 level. Mitochondrial Number Human podocytes were cultured in 35 mm glass bottom culture dishes (MatTek Ashland, MA) for 10 days at 37°C. After culturing in ACKNOWLEDGMENTS the control or high glucose with or without INT-777 treatment, cells were incubated with (1) 200 nM Mitotracker deep green (Mito Green) (Life Technologies, Grand Island, NY) for 20 min to deter- We thank Dr. Stephen Hewitt and Kris Ylaya (Experimental Pathology mine mitochondrial number or (2)5mM MitoSox Red (Life Tech- Laboratory, NCI at National Institutes of Health [NIH]) for IHC support. ( nologies) for 10 min to determine mitochondrial ROS at 37°C before These studies were supported by grants from NIH 1R01- taking images with a laser scanning confocal microscope LSM 510 DK098336,toM.Levi,X.Wang,Y.Luo,andE.Dobrinskikh),VA (Carl Zeiss, Jena, Germany). Alternatively, human podocytes seeded (1I01BX001954,toM.Levi,X.Wang,Y.Luo,andE.Dobrinskikh), ’ in black-wall clear-bottom 96-well plates for 10 days were used for NIH (U24-DK076169, to M. Herman Edelstein, V.D. D Agati, and direct fluorescence measurement of Mito Green or MitoSox Red M. Levi), and Intercept (to M. Levi). staining with Synergy 2 Microplate Readers (BioTek, Winooski, VT). DISCLOSURES CARS Microscopy We performed CARS microscopy for label-free imaging of lipid Moshe Levi is a recipient of grant support from Intercept through the deposits in podocytes as previously described.79–81 Briefly, the CARS University of Colorado. Luciano Adorini is an employee of Intercept. images were acquired using our custom CARS-TPAF (two-photon autofluorescence) multimodal platform Olympus FV-1000 micro- REFERENCES scope (Olympus America, Center Valley, PA) coupled to a picoEmer- aldä system(APE;AngewandtePhysikundElektronik,Berlin, Germany) which is internally pumped by a picosecond laser (High- 1. Dietz WH: Implications of the energy gap for the prevention and treatment of childhood obesity. AmJPrevMed42: 560–561, 2012 Q Laser, Rankweil, Austria; part of Newport Corporation, Irvine, CA) 2. May AL, Kuklina EV, Yoon PW: Prevalence of cardiovascular disease risk generating two beams, approximately 5 W at 532 nm and 1 W at 1064 factors among US adolescents, 1999-2008. Pediatrics 129: 1035–1041, 2012 nm. The repetition rate is 80 MHz with a pulse width of approxi- 3. Boyle JP, Thompson TJ, Gregg EW, Barker LE, Williamson DF: Pro- mately 6 ps. The 532 nm output feeds an optical parametric oscillator jection of the year 2050 burden of diabetes in the US adult population: (OPO) that generates an 816 nm laser beam with a maximum of dynamic modeling of incidence, mortality, and prediabetes prevalence. Popul Health Metr 8: 29, 2010 approximately 1 W of power. The generated 816 nm laser beam 4. Odermatt A: The Western-style diet: a major risk factor for impaired (pump and probe) is combined with the 1064 nm laser beam (Stokes) kidney function and chronic kidney disease. Am J Physiol Renal Physiol and sent into the microscope to excite the sample for imaging. The 301: F919–F931, 2011

1376 Journal of the American Society of Nephrology J Am Soc Nephrol 27: 1362–1378, 2016 www.jasn.org BASIC RESEARCH

5. Thomas G, Sehgal AR, Kashyap SR, Srinivas TR, Kirwan JP, 27. Bianco AC, Kim BW: Deiodinases: implications of the local control of Navaneethan SD: Metabolic syndrome and kidney disease: a sys- thyroid hormone action. JClinInvest116: 2571–2579, 2006 tematic review and meta-analysis. Clin J Am Soc Nephrol 6: 2364– 28. Miyazaki-Anzai S, Masuda M, Levi M, Keenan AL, Miyazaki M: Dual 2373, 2011 activation of the bile acid nuclear receptor FXR and G-protein-coupled 6. Bobulescu IA: Renal lipid metabolism and lipotoxicity. Curr Opin receptor TGR5 protects mice against atherosclerosis. PLoS One 9: Nephrol Hypertens 19: 393–402, 2010 e108270, 2014 7. Forbes JM, Coughlan MT, Cooper ME: Oxidative stress as a major 29. Pellicciari R, Sato H, Gioiello A, Costantino G, Macchiarulo A, Sadeghpour culprit in kidney disease in diabetes. Diabetes 57: 1446–1454, 2008 BM, Giorgi G, Schoonjans K, Auwerx J: Nongenomic actions of bile 8. Gurley SB, Coffman TM: The renin-angiotensin system and diabetic acids. Synthesis and preliminary characterization of 23- and 6,23-alkyl- nephropathy. Semin Nephrol 27: 144–152, 2007 substituted bile acid derivatives as selective modulators for the G-protein 9. Hunley TE, Ma LJ, Kon V: Scope and mechanisms of obesity-related coupled receptor TGR5. JMedChem50: 4265–4268, 2007 renal disease. Curr Opin Nephrol Hypertens 19: 227–234, 2010 30. Roda A, Pellicciari R, Gioiello A, Neri F, Camborata C, Passeri D, De 10. Mauer SM: Structural-functional correlations of diabetic nephropathy. Franco F, Spinozzi S, Colliva C, Adorini L, Montagnani M, Aldini R: Kidney Int 45: 612–622, 1994 Semisynthetic bile acid FXR and TGR5 agonists: physicochemical 11. Qian Y, Feldman E, Pennathur S, Kretzler M, Brosius FC 3rd: From fi- properties, pharmacokinetics, and metabolism in the rat. J Pharmacol brosis to sclerosis: mechanisms of glomerulosclerosis in diabetic ne- Exp Ther 350: 56–68, 2014 phropathy. Diabetes 57: 1439–1445, 2008 31. Hardie DG, Ross FA, Hawley SA: AMPK: a nutrient and energy sensor 12. Ruan XZ, Varghese Z, Moorhead JF: An update on the lipid nephro- that maintains energy homeostasis. Nat Rev Mol Cell Biol 13: 251–262, toxicity hypothesis. Nat Rev Nephrol 5: 713–721, 2009 2012 13. Weinberg JM: Lipotoxicity. Kidney Int 70: 1560–1566, 2006 32. Dugan LL, You YH, Ali SS, Diamond-Stanic M, Miyamoto S, DeCleves 14. Zhu Y, Usui HK, Sharma K: Regulation of transforming growth factor AE, Andreyev A, Quach T, Ly S, Shekhtman G, Nguyen W, Chepetan A, beta in diabetic nephropathy: implications for treatment. Semin Le TP, Wang L, Xu M, Paik KP, Fogo A, Viollet B, Murphy A, Brosius F, Nephrol 27: 153–160, 2007 Naviaux RK, Sharma K: AMPK dysregulation promotes diabetes-related 15. de Boer IH, Rue TC, Hall YN, Heagerty PJ, Weiss NS, Himmelfarb J: reduction of superoxide and mitochondrial function. J Clin Invest 123: Temporal trends in the prevalence of diabetic kidney disease in the 4888–4899, 2013 United States. JAMA 305: 2532–2539, 2011 33. Finck BN, Kelly DP: PGC-1 coactivators: inducible regulators of energy 16. Rosolowsky ET, Skupien J, Smiles AM, Niewczas M, Roshan B, Stanton R, metabolism in health and disease. JClinInvest116: 615–622, 2006 Eckfeldt JH, Warram JH, Krolewski AS: Risk for ESRD in type 1 diabetes 34. Handschin C, Spiegelman BM: Peroxisome proliferator-activated re- remains high despite renoprotection. J Am Soc Nephrol 22: 545–553, 2011 ceptor gamma coactivator 1 coactivators, energy homeostasis, and 17. Thomas C, Pellicciari R, Pruzanski M, Auwerx J, Schoonjans K: Targeting metabolism. Endocr Rev 27: 728–735, 2006 bile-acid signalling for metabolic diseases. Nat Rev Drug Discov 7: 35. Fernandez-Marcos PJ, Auwerx J: Regulation of PGC-1a,anodalreg- 678–693, 2008 ulator of mitochondrial biogenesis. Am J Clin Nutr 93: 884S–90, 2011 18. Tiwari A, Maiti P: TGR5: an emerging bile acid G-protein-coupled re- 36. Scarpulla RC: Metabolic control of mitochondrial biogenesis through ceptor target for the potential treatment of metabolic disorders. Drug the PGC-1 family regulatory network. Biochim Biophys Acta 1813: Discov Today 14: 523–530, 2009 1269–1278, 2011 19. Kawamata Y, Fujii R, Hosoya M, Harada M, Yoshida H, Miwa M, 37. Soriano FX, Liesa M, Bach D, Chan DC, Palacín M, Zorzano A: Evidence Fukusumi S, Habata Y, Itoh T, Shintani Y, Hinuma S, Fujisawa Y, Fujino for a mitochondrial regulatory pathway defined by peroxisome pro- M: A G protein-coupled receptor responsive to bile acids. JBiolChem liferator-activated receptor-gamma coactivator-1 alpha, estrogen- 278: 9435–9440, 2003 related receptor-alpha, and mitofusin 2. Diabetes 55: 1783–1791, 2006 20. Maruyama T, Miyamoto Y, Nakamura T, Tamai Y, Okada H, Sugiyama E, 38. Villena JA, Kralli A: ERRalpha: a metabolic function for the oldest or- Nakamura T, Itadani H, Tanaka K: Identification of membrane-type receptor phan. Trends Endocrinol Metab 19: 269–276, 2008 for bile acids (M-BAR). Biochem Biophys Res Commun 298: 714–719, 2002 39. Ranhotra HS: Estrogen-related receptor alpha and mitochondria: tale 21. Thomas C, Gioiello A, Noriega L, Strehle A, Oury J, Rizzo G, of the titans [published online ahead of print September 15, 2014]. Macchiarulo A, Yamamoto H, Mataki C, Pruzanski M, Pellicciari R, J Recept Signal Transduct Res doi:10.3109/10799893.2014.959592 Auwerx J, Schoonjans K: TGR5-mediated bile acid sensing controls 40. Huss JM, Torra IP, Staels B, Giguère V, Kelly DP: Estrogen-related re- glucose homeostasis. Cell Metab 10: 167–177, 2009 ceptor alpha directs peroxisome proliferator-activated receptor alpha 22. Katsuma S, Hirasawa A, Tsujimoto G: Bile acids promote glucagon-like signaling in the transcriptional control of energy metabolism in cardiac peptide-1 secretion through TGR5 in a murine enteroendocrine cell and skeletal muscle. Mol Cell Biol 24: 9079–9091, 2004 line STC-1. Biochem Biophys Res Commun 329: 386–390, 2005 41. Kitada M, Kume S, Kanasaki K, Takeda-Watanabe A, Koya D: Sirtuins as 23. Rizzo G, Passeri D, De Franco F, Ciaccioli G, Donadio L, Rizzo G, Orlandi possible drug targets in type 2 diabetes. Curr Drug Targets 14: 622– S, Sadeghpour B, Wang XX, Jiang T, Levi M, Pruzanski M, Adorini L: 636, 2013 Functional characterization of the semisynthetic bile acid derivative 42. Houtkooper RH, Pirinen E, Auwerx J: Sirtuins as regulators of metab- INT-767, a dual farnesoid X receptor and TGR5 agonist. Mol Pharmacol olism and healthspan. Nat Rev Mol Cell Biol 13: 225–238, 2012 78: 617–630, 2010 43. Brenmoehl J, Hoeflich A: Dual control of mitochondrial biogenesis by 24. Watanabe M, Houten SM, Mataki C, Christoffolete MA, Kim BW, Sato sirtuin 1 and sirtuin 3. Mitochondrion 13: 755–761, 2013 H, Messaddeq N, Harney JW, Ezaki O, Kodama T, Schoonjans K, Bianco 44. Nogueiras R, Habegger KM, Chaudhary N, Finan B, Banks AS, Dietrich AC, Auwerx J: Bile acids induce energy expenditure by promoting in- MO, Horvath TL, Sinclair DA, Pfluger PT, Tschöp MH: Sirtuin 1 and tracellular thyroid hormone activation. Nature 439: 484–489, 2006 sirtuin 3: physiological modulators of metabolism. Physiol Rev 92: 25. Keitel V, Reinehr R, Gatsios P, Rupprecht C, Görg B, Selbach O, Häussinger 1479–1514, 2012 D, Kubitz R: The G-protein coupled bile salt receptor TGR5 is expressed in 45. Bause AS, Haigis MC: SIRT3 regulation of mitochondrial oxidative liver sinusoidal endothelial cells. Hepatology 45: 695–704, 2007 stress. Exp Gerontol 48: 634–639, 2013 26. Pols TW, Nomura M, Harach T, Lo Sasso G, Oosterveer MH, Thomas C, 46. Kwak SH, Park KS, Lee KU, Lee HK: Mitochondrial metabolism and Rizzo G, Gioiello A, Adorini L, Pellicciari R, Auwerx J, Schoonjans K: diabetes. J Diabetes Investig 1: 161–169, 2010 TGR5 activation inhibits atherosclerosis by reducing macrophage in- 47. Jiang T, Wang XX, Scherzer P, Wilson P, Tallman J, Takahashi H, Li J, flammation and lipid loading. Cell Metab 14: 747–757, 2011 Iwahashi M, Sutherland E, Arend L, Levi M: Farnesoid X receptor

J Am Soc Nephrol 27: 1362–1378, 2016 TGR5 Modulates Kidney Disease 1377 BASIC RESEARCH www.jasn.org

modulates renal lipid metabolism, fibrosis, and diabetic nephropathy. 66. Wang Z, Jiang T, Li J, Proctor G, McManaman JL, Lucia S, Chua S, Levi Diabetes 56: 2485–2493, 2007 M: Regulation of renal lipid metabolism, lipid accumulation, and glo- 48. Wang XX, Jiang T, Shen Y, Adorini L, Pruzanski M, Gonzalez FJ, Scherzer P, merulosclerosis in FVBdb/db mice with type 2 diabetes. Diabetes 54: Lewis L, Miyazaki-Anzai S, Levi M: The farnesoid X receptor modulates 2328–2335, 2005 renal lipid metabolism and diet-induced renal inflammation, fibrosis, and 67. Sun L, Halaihel N, Zhang W, Rogers T, Levi M: Role of sterol regulatory proteinuria. Am J Physiol Renal Physiol 297: F1587–F1596, 2009 element-binding protein 1 in regulation of renal lipid metabolism and 49. Wang XX, Jiang T, Shen Y, Caldas Y, Miyazaki-Anzai S, Santamaria H, glomerulosclerosis in diabetes mellitus. JBiolChem277: 18919– Urbanek C, Solis N, Scherzer P, Lewis L, Gonzalez FJ, Adorini L, Pruzanski 18927, 2002 M, Kopp JB, Verlander JW, Levi M: Diabetic nephropathy is accelerated 68. Tao R, Coleman MC, Pennington JD, Ozden O, Park SH, Jiang H, Kim by farnesoid X receptor deficiency and inhibited by farnesoid X receptor HS, Flynn CR, Hill S, Hayes McDonald W, Olivier AK, Spitz DR, Gius D: activation in a type 1 diabetes model. Diabetes 59: 2916–2927, 2010 Sirt3-mediated deacetylation of evolutionarily conserved lysine 122 50. Tzameli I: The evolving role of mitochondria in metabolism. Trends regulates MnSOD activity in response to stress. Mol Cell 40: 893–904, Endocrinol Metab 23: 417–419, 2012 2010 51. Sharma K, Karl B, Mathew AV, Gangoiti JA, Wassel CL, Saito R, Pu M, 69. Starkov AA: Measurement of mitochondrial ROS production. Methods Sharma S, You YH, Wang L, Diamond-Stanic M, Lindenmeyer MT, Mol Biol 648: 245–255, 2010 Forsblom C, Wu W, Ix JH, Ideker T, Kopp JB, Nigam SK, Cohen CD, 70. Griffin SV, Krofft RD, Pippin JW, Shankland SJ: Limitation of podocyte Groop PH, Barshop BA, Natarajan L, Nyhan WL, Naviaux RK: Metab- proliferation improves renal function in experimental crescentic glo- olomics reveals signature of mitochondrial dysfunction in diabetic merulonephritis. Kidney Int 67: 977–986, 2005 kidney disease. JAmSocNephrol24: 1901–1912, 2013 71. Zhang J, Yanez D, Floege A, Lichtnekert J, Krofft RD, Liu ZH, Pippin JW, 52. Cheng Z, Almeida FA: Mitochondrial alteration in type 2 diabetes and Shankland SJ: ACE-inhibition increases podocyte number in experi- obesity: an epigenetic link. Cell Cycle 13: 890–897, 2014 mental glomerular disease independent of proliferation. JReninAn- 53. Reidy K, Kang HM, Hostetter T, Susztak K: Molecular mechanisms of giotensin Aldosterone Syst 16: 234–248, 2015 diabetic kidney disease. J Clin Invest 124: 2333–2340, 2014 72. Herman-Edelstein M, Thomas MC, Thallas-Bonke V, Saleem M, Cooper 54. Towler DA: Mitochondrial ROS deficiency and diabetic complications: ME, Kantharidis P: Dedifferentiation of immortalized human podocytes AMP[K]-lifying the adaptation to hyperglycemia. JClinInvest123: in response to transforming growth factor-b: a model for diabetic po- 4573–4576, 2013 docytopathy. Diabetes 60: 1779–1788, 2011 55. Qiu X, Brown K, Hirschey MD, Verdin E, Chen D: Calorie restriction 73. Saleem MA, O’Hare MJ, Reiser J, Coward RJ, Inward CD, Farren T, Xing reduces oxidative stress by SIRT3-mediated SOD2 activation. Cell CY, Ni L, Mathieson PW, Mundel P: A conditionally immortalized hu- Metab 12: 662–667, 2010 man podocyte cell line demonstrating nephrin and podocin expres- 56. Sinal CJ, Tohkin M, Miyata M, Ward JM, Lambert G, Gonzalez FJ: sion. J Am Soc Nephrol 13: 630–638, 2002 Targeted disruption of the nuclear receptor FXR/BAR impairs bile acid 74. Welsh GI, Hale LJ, Eremina V, Jeansson M, Maezawa Y, Lennon R, Pons and lipid homeostasis. Cell 102: 731–744, 2000 DA, Owen RJ, Satchell SC, Miles MJ, Caunt CJ, McArdle CA, Pavenstädt 57. Feng X, Lu TC, Chuang PY, Fang W, Ratnam K, Xiong H, Ouyang X, H, Tavaré JM, Herzenberg AM, Kahn CR, Mathieson PW, Quaggin SE, Shen Y, Levy DE, Hyink D, Klotman M, D’Agati V, Iyengar R, Klotman PE, Saleem MA, Coward RJ: Insulin signaling to the glomerular podocyte is He JC: Reduction of Stat3 activity attenuates HIV-induced kidney injury. critical for normal kidney function. Cell Metab 12: 329–340, 2010 JAmSocNephrol20: 2138–2146, 2009 75. Abe Y, Sakairi T, Kajiyama H, Shrivastav S, Beeson C, Kopp JB: Bio- 58. Hodgin JB, Borczuk AC, Nasr SH, Markowitz GS, Nair V, Martini S, energetic characterization of mouse podocytes. Am J Physiol Cell Eichinger F, Vining C, Berthier CC, Kretzler M, D’Agati VD: A molecular Physiol 299: C464–C476, 2010 profile of focal segmental glomerulosclerosis from formalin-fixed, 76. Matsumoto T, Hess S, Kajiyama H, Sakairi T, Saleem MA, Mathieson paraffin-embedded tissue. Am J Pathol 177: 1674–1686, 2010 PW, Nojima Y, Kopp JB: Proteomic analysis identifies insulin-like 59. Kambham N, Markowitz GS, Valeri AM, Lin J, D’Agati VD: Obesity-related growth factor-binding protein-related protein-1 as a podocyte product. glomerulopathy: an emerging epidemic. Kidney Int 59: 1498–1509, 2001 Am J Physiol Renal Physiol 299: F776–F784, 2010 60. Tobar A, Ori Y, Benchetrit S, Milo G, Herman-Edelstein M, Zingerman 77. Sakairi T, Abe Y, Kopp JB: TGF-beta1 reduces Wilms’ tumorsuppressorgene B, Lev N, Gafter U, Chagnac A: Proximal tubular hypertrophy and en- expression in podocytes. Nephrol Dial Transplant 26: 2746–2752, 2011 larged glomerular and proximal tubular urinary space in obese subjects 78. Kajiyama H, Titus S, Austin CP, Chiotos K, Matsumoto T, Sakairi T, Kopp with proteinuria. PLoS One 8: e75547, 2013 JB: Tetracycline-inducible gene expression in conditionally immortal- 61. Herman-Edelstein M, Scherzer P, Tobar A, Levi M, Gafter U: Altered ized mouse podocytes. Am J Nephrol 29: 153–163, 2009 renal lipid metabolism and renal lipid accumulation in human diabetic 79. Lim RS, Kratzer A, Barry NP, Miyazaki-Anzai S, Miyazaki M, Mantulin nephropathy. J Lipid Res 55: 561–572, 2014 WW, Levi M, Potma EO, Tromberg BJ: Multimodal CARS microscopy 62. Jiang T, Liebman SE, Lucia MS, Li J, Levi M: Role of altered renal lipid determination of the impact of diet on macrophage infiltration and lipid metabolism and the sterol regulatory element binding proteins in the accumulation on plaque formation in ApoE-deficient mice. J Lipid Res pathogenesis of age-related renal disease. Kidney Int 68: 2608–2620, 2005 51: 1729–1737, 2010 63. Jiang T, Liebman SE, Lucia MS, Phillips CL, Levi M: Calorie restriction 80. Lim RS, Suhalim JL, Miyazaki-Anzai S, Miyazaki M, Levi M, Potma EO, modulates renal expression of sterol regulatory element binding pro- Tromberg BJ: Identification of cholesterol crystals in plaques of ath- teins, lipid accumulation, and age-related renal disease. JAmSoc erosclerotic mice using hyperspectral CARS imaging. J Lipid Res 52: Nephrol 16: 2385–2394, 2005 2177–2186, 2011 64. Jiang T, Wang Z, Proctor G, Moskowitz S, Liebman SE, Rogers T, Lucia 81. Suhalim JL, Chung CY, Lilledahl MB, Lim RS, Levi M, Tromberg BJ, MS, Li J, Levi M: Diet-induced obesity in C57BL/6J mice causes in- Potma EO: Characterization of cholesterol crystals in atherosclerotic creased renal lipid accumulation and glomerulosclerosis via a sterol plaques using stimulated Raman scattering and second-harmonic regulatory element-binding protein-1c-dependent pathway. JBiol generation microscopy. Biophys J 102: 1988–1995, 2012 Chem 280: 32317–32325, 2005 65. Wang XX, Jiang T, Shen Y, Santamaria H, Solis N, Arbeeny C, Levi M: Vitamin D receptor agonist doxercalciferol modulates dietary fat- induced renal disease and renal lipid metabolism. Am J Physiol Renal This article contains supplemental material online at http://jasn.asnjournals. Physiol 300: F801–F810, 2011 org/lookup/suppl/doi:10.1681/ASN.2014121271/-/DCSupplemental.

1378 Journal of the American Society of Nephrology J Am Soc Nephrol 27: 1362–1378, 2016 Supplementary Table 1:

1 Supplementary Table 2: Primer Sequences used for RT-QPCR

Forward primer sequences Reverse primer sequences mTGR5 5’-TGCTTCTTCCTAAGCCTACTACT 5’-CTGATGGTTCCGGCTCCATAG mSIRT1 5’-TGATTGGCACCGATCCTCG 5’-CCACAGCGTCATATCATCCAG mSIRT3 5’-GAGCGGCCTCTACAGCAAC 5’-

GGAAGTAGTGAGTGACATTGGG mERR 5’-CAGGGAGGGAAGGGATGG 5’-TGAGGAGAGGAGCGAAGG mNrf-1 5’- 5’-GCTGCCGTGGAGTTGAGG

AGTATGCTAAGTGCTGATGAAGAC mNrf-2 5’-CTTTAGTCAGCGACAGAAGGAC 5’-

AGGCATCTTGTTTGGGAATGTG mDGAT1 5’- 5’-

CTGATCCTGAGTAATGCAAGGTT TGGATGCAATAATCACGCATGG mPPAR 5’-TCGCTATCCAGGCAGAAGG 5’-

AACAACAACAATAACCACAGACC mUCP2 5’-CAGCGCCAGATGAGCTTTG 5’-GGAAGCGGACCTTTACCACA mCPT1b 5’-TGTTAGAGAACGATAAGG 5’-CGCATTATTCAAGAAGAG hSOD2 5’-CTGGAACCTCACATCAAC 5’-GTACTTCTCCTCGGTGAC hLCAD 5’-AAGTGATGTTGTGATTGTAGTTG 5’-GAATAGTTCTGCGGTATCCTG hCPT1b 5’-ATCTTCTTCTTCCGCCAAA 5’-GGTCAAGTTGCTGGTCTT hPPAR 5’-CAGATGCCACCAGGAGAAC 5’-TGAGGAGACCACAGGAACC