Phosphatase Regulation by the Ovarian Oncoprotein URI1

Research Collection

Doctoral Thesis

Phosphatase regulation by the ovarian oncoprotein URI1

Author(s): Jonasch, Helene

Publication Date: 2015

Permanent Link: https://doi.org/10.3929/ethz-a-010399708

Rights / License: In Copyright - Non-Commercial Use Permitted

This page was generated automatically upon download from the ETH Zurich Research Collection. For more information please consult the Terms of use.

ETH Library DISS. ETH NO. 22593

Phosphatase regulation by the ovarian oncoprotein URI1

A thesis submitted to attain the degree of DOCTOR OF SCIENCES of ETH ZURICH (Dr. sc. ETH Zurich)

presented by HELENE JONASCH M.Sc. in Pharmaceutical Sciences, University of Basel

born on 21.07.1987 citizen of Austria

accepted on the recommendation of

Prof. Dr. Wilhelm Krek Prof. Dr. Ian Frew Prof. Dr. med. Holger Moch

2015

Abstract

URI1 encodes an unconventional member of the prefoldin family of molecular chaperones that is amplified in a variety of carcinomas including small-cell lung, gastric, breast, and ovarian cancer. Exisiting evidence suggests that the excessive production of URI1 in URI1-amplifed cancer cells fuels evasion from apoptosis. In this setting, mitochondria-localized URI1 detains phosphatase 1 gamma (PP1γ) in inactive complexes thereby sustains S6 kinase 1 (S6K1) survival signaling under conditions of nutrient and/or growth factor deprivation stress. These data suggest that in URI1-amplified cancers such as ovarian cancer, URI1 has properties of an addicting oncogene. To unveil potential novel URI1 oncoprotein functions at mitochondria, we embarked on the identification of URI1-associated mitochondrial proteins. We found the protein phosphatase 1 alpha (PP1α) to assembly into heterotrimeric complexes with URI1 and PP1γ to regulate URI1 phosphorylation alone or in collaboration with PP1γ in a cell type-specific manner. Moreover, we collected evidence suggesting that PP1α/PP1γ and the mammalian target of rapamycin (mTOR)/S6K1 axis oppose each other to dynamically regulate URI1 phophorylation state. Most strinkingly, we identified several proteins of the mitochondrial quality control machinery including the Parkin receptor mitofusin 2 (Mfn2) and the atypical protein phosphatase phosphoglycerate mutase family member 5 (PGAM5). The latter is known to undergo presenilin- associated rhomboid-like protein (PARL)-mediated cleavage and cytoplasmic translocation upon mitochondrial membrane potential dissipation. The processed form PGAM5(Δ24) carries a neo- inhibitor of apoptosis protein (IAP) binding motif enabling IAP antagonism and activation of caspases which sensitizes cells to apoptosis in response to mitochondrial damage. Intriguingly, we identified URI1 to be a major regulator of PGAM5 function by preventing PGAM5(Δ24) generation and translocation to the cytoplasm in ovarian cancer cells. By detaining PGAM5(Δ24) at mitochondria in the presence of the mitochondrial ionophore carbonyl cyanide 3-chlorophenylhydrazone (CCCP), URI1 protects cells from mitochondrial damage stress-induced apoptosis. Consistent with this view, depletion of URI1 renders ovarian cancer cells hypersensitive to CCCP-induced apoptosis in a caspase- and PGAM5-dependent manner. Notably, this protective function of URI1 in mitochondrial stress-induced apoptosis is independent of URI1 amplification status suggesting that URI1 not only acts as an addicting oncogene in ovarian cancer but may additionally display non-oncogene addiction features in the context of mitochondrial stress. Finally, we found that URI1 may further prevent apoptotic signaling by selective autophagic removal of damaged mitochondria mediated by the PTEN- putative kinase 1 (PINK1)/Parkin pathway. We identified URI1 to be required for Parkin self- degradation and its mitochondrial translocation upon mitophagy induction in URI1-amplified OVCAR-8 cells. Together, we propose a novel function of URI1 in the regulation of mitochondrial stress-induced apoptosis in ovarian cancer cells.

Zusammenfassung

URI1 kodiert ein unkonventionelles Mitglied der Prefoldin Familie der molekularen Chaperone, dass in einer Vielzahl von Karzinomen, wie zum Beispiel kleinzelligem Lungen-, Magen-, Brust- und Ovarialkrebs amplifiziert ist. Die vorliegenden Erkenntnisse weisen darauf hin, dass die exzessive Produktion von URI1 in URI1-amplifizierten Krebszellen das Umgehen der Apoptose fördert. In diesem Rahmen hält mitochondrial lokalisiertes URI1 die Protein Phosphatase 1 gamma (PP1γ) in inaktiven Komplexen und erhält dadurch den S6 Kinase 1 (S6K1) Überlebens-Signalweg unter selbst unter Stresskonditionen, die durch Nährstoff- und Wachstumsfakormangel ausgelöst werden. Diese Daten weisen darauf hin, dass URI1 in URI1-amplifizierten Krebsarten wie Ovarialkrebs Eigenschaften eines Abhängigkeits vermittelnden Onkogens hat. Um potentiell neue URI1 Onkoprotein Funktionen an den Mitochondrien zu enthüllen, haben wir mit der Identifizierung von URI1-assoziierten mitochondrialen Proteinen begonnen. Wir fanden, dass die Protein Phosphatase 1 alpha heterotrimere Komplexe mit URI1 und PP1γ bildet um die Phosphorylierung von URI1 alleine oder in Kollaboration mit PP1γ in einer Zelltyp spezifischen Weise zu regulieren. Unsere Daten weisen darauf hin, dass sich PP1α/PP1γ und die mTOR (Ziel des Rapamycins im Säugetier)/S6K1 Achse gegenüberstehen, um den Phosphorylierungsstatus von URI1 dynamisch zu kontrollieren. Am bemerkenswertesten war unsere Identifizierung mehrerer Proteine der mitochondrialen Qualitätskontrollmaschinerie einschliesslich des Parkin-Rezeptors Mitofusin 2 (Mfn2) und der atypischen Phosphatase Phosphoglycerate Mutase Familien Mitglied 5 (PGAM5). PGAM5 wird bei der Zerstörung des mitochondrialen Membranpotentials durch PARL (Präsenilin-assoziiertes Rhomboid-ähnliches Protein) gespalten und die gespaltene Form ins Zytoplasma transportiert. Die prozessierte Form PGAM5(Δ24) trägt ein Neo-Inhibitor der Apoptose Proteine (IAP) Bindungsmotif, das IAP antagonisiert und die Aktivierung von Caspasen ermöglicht, was die Zellen als Reaktion auf mitochondriale Schädigung für Apoptose sensibilisiert. Bemerkenswerterweise haben wir URI1 als wesentlichen Regulator der PGAM5 Funktion identifiziert, indem es in Ovarialkrebszellen die Generierung von PGAM5(Δ24) und dessen Translokation ins Zytoplasma verhindert. Durch Zurückhalten von PGAM5(Δ24) an dem Mitochondrien in der Anwesenheit des mitochondrialen Ionophors Carbonyl Cyanide 3-Chlorophenylhydrazone (CCCP) schützt URI1 vor Apoptose, die durch Beschädigung der Mitochondrien ausgelöst wird. Dementsprechend führt URI1 Knockdown in Ovarialkrebszellen zu einer Hypersensitivität gegenüber CCCP-induzierter Apoptose in einer Caspase- und PGAM5-abhängigen Weise. Bemerkenswerterweise ist diese beschützende Funktion von URI1 in mitochondrialer Stress induzierter Apoptose unabhängig vom URI1 Amplifikationsstatus. Dies weist darauf hin, dass URI1 nicht nur als ein Abhängigkeits vermittelndes Onkogen in Ovarialkrebs agiert, sondern möglicherweise zusätzliche Eigenschaften einer nicht-onkogenen Abhängigkeit in Kontext des mitochondrialen Stresses zeigt. Letztlich haben wir gefunden, dass URI1 möglicherweise durch

selektives autophagisches Entfernen der beschädigten Mitochondrien, ausgeführt durch die PTEN- putative Kinase 1 (PINK1)/Parkin Signalkaskade, apoptotische Signalwege weiter verhindert. Wir stellten fest, dass in URI1-amplifizierten OVCAR-8 Zellen URI1 erforderlich ist für die Parkin Selbstdegradation und dessen mitochondriale Translokation durch Mitophagie-Induktion. Zusammenfassend schlagen wir eine neuartige Funktion von URI1 in der Regulation von mitochondrialer Stress induzierter Apoptose in Ovarialkrebszellen vor.

Acknowledgments

I would like to express my gratitude to Prof. Dr. Wilhelm Krek for giving me the opportunity to work in his laboratory and to discover the field of cancer biology with great scientific freedom. I am deeply grateful for his valuable advice, his enthusiasm, and the chance to continue my project after the doctoral defense.

I would like to show my gratitude to my thesis committee, Prof. Dr. Ian Frew and Prof. Dr. med. Holger Moch, for very constructive discussions and helpful advice.

Special thanks go to Dr. Karen Schrader, who supervised me during the first months and supported me anytime with her friendly advice.

I would like to thank Dr. Matthias Gstaiger and especially Dr. Simon Hauri for competent advice and his excellent work during the mass spectrometry analysis.

I thank Lukas Frischknecht for great discussions and sharing PGAM5 tools, in particular I would like to thank him for generating the PGAM5 antibody.

I am grateful to the past and present lab members for their great help and support. Especially, I thank Dr. Dr. Christian Britschgi and Dr. Stefan Metzler for sharing their deep knowledge as well as my lab mates from H21.2 for cheerful hours in the laboratory. Special thanks also go to Rebekka Stark for her great willingness to help me with cell culture work.

I would like to say thank you to Dr. Rafal Pawlowski and Dr. Werner Kovacs, who took the time to correct and improve my thesis.

I would like to thank Prof. Dr. Viola Heinzelmann-Schwarz for providing me with the HOSE cell lines.

I would like to show my gratitude to Dr. Rico Funhoff and Dr. Axel Vicart, who promoted my scientific development and encouraged me to become a Ph.D. student.

I would like to send my thanks out to Dr. Ruth Leu Marseiler who has accompanied me on my carrier for several years already with her valuable advice.

I would like to express my warmest thanks to my family who has always believed in me and who provide me with their caring support as well as to my partner, Philipp, who has been endlessly attentive, supportive, and understanding.

Table of contents

Abstract ...... 2 Zusammenfassung ...... 3 Acknowledgments ...... 5 Table of contents ...... 6 Table of figures ...... 9 Abbreviations ...... 10

1 Introduction 17 1.1 The molecular pathology of cancer ...... 17 1.1.1 Multistep carcinogenesis and oncogene/non-oncogene addiction ...... 17 1.1.2 Feedback regulation of cancer signaling pathways ...... 18 1.1.3 Ovarian cancer ...... 19 1.2 URI1, an unconventional member of the prefoldin family of chaperones ...... 21 1.2.1 URI1 is a member of the URI1/R2TP complex ...... 21 1.2.2 The mitochondrial URI1/PP1γ axis constitutes a negative feedback program downstream of the mTOR/S6K1 pathway ...... 23 1.2.3 URI1 is an addicting oncogene in ovarian cancer ...... 24 1.3 The diversity of protein phosphatases ...... 26 1.3.1 Reversible protein phosphorylation ...... 26 1.3.2 Classification of protein phosphatases ...... 27 1.3.3 The family of phosphoprotein phosphatases ...... 27 1.4 Mitochondria: a platform of multiple pathways ...... 28 1.4.1 Mitochondrial quality control pathways ...... 28 1.4.2 Apoptosis ...... 32 1.4.3 PGAM5, a novel mitochondrial regulatory protein ...... 34

2 Aims of this study 37

3 Results 38 3.1 Prestudy: establishment of tools ...... 38 3.1.1 The protein phosphatase inhibitor calyculin A triggers URI1 hyperphosphorylation ...... 38 3.1.2 OVCAR-4 and OVCAR-8 are URI1-addicted ovarian cancer cells ...... 38 3.2 Mass spectrometry-based analysis of the mitochondrial URI1 interactome ...... 41

3.3 siRNA-based screen to identify Ser/Thr protein phosphatases regulating URI1 ...... 43 3.4 Regulation of URI1 function by the protein phosphatase PP1α...... 44 3.4.1 PP1α interacts with URI1-PP1γ in a heterotrimeric complex in a P-URI1 S371- dependent manner ...... 44 3.4.2 PP1α and PP1γ co-regulate URI1 phosphorylation in HeLa cells ...... 47 3.4.3 PP1α induces URI1 hyperphosphorylation but not URI1-PP1γ dissociation in URI1- amplified OVCAR-3 cells ...... 49 3.5 Regulation of the PGAM5-based mitochondrial apoptotic pathway by URI1 ...... 52 3.5.1 URI1 endogenously interacts with Mfn2, STOML2, and PGAM5 independent of its phosphorylation at S371 ...... 52 3.5.2 URI1 protects PGAM5 from PARL-mediated cleavage ...... 54 3.5.3 URI1 depletion sensitizes to CCCP-induced apoptosis by releasing PGAM5(∆24) to the cytoplasm ...... 56 3.5.4 Apoptosis caused by URI1 depletion is caspase- and PGAM5-dependent ...... 58 3.6 Is URI1 a driver of mitophagy? ...... 62

4 Discussion 65 4.1 PP1α, a potential phospho-URI1 regulating enzyme ...... 65 4.2 Regulation of the mitochondrial PGAM5 pathway by URI1 ...... 67 4.2.1 The PGAM5-mediated apoptotic pathway ...... 67 4.2.2 Potential role of URI1 in PINK1/Parkin-mediated mitophagy ...... 69 4.2.3 Overall conclusion ...... 71

5 Materials and methods 75 5.1 Cell culture techniques ...... 75 5.1.1 Cell lines and compounds ...... 75 5.1.2 Transient transfections ...... 77 5.1.3 Lentiviral delivery of shRNA and recombinant proteins ...... 79 5.2 Isolation and analysis of cellular proteins ...... 80 5.2.1 Cell lysis and SDS sample preparation ...... 80 5.2.2 SDS-PAGE ...... 80 5.2.3 Subcellular fractionation ...... 84 5.2.4 Immunofluorescence ...... 85 5.3 Analysis of protein interactions ...... 85

5.3.1 Co-immunoprecipitation ...... 85 5.3.2 Double Co-immunoprecipitation ...... 87 5.3.3 In vitro binding assay ...... 87 5.4 Analysis of cell survival and viability ...... 89 5.4.1 Colony formation assay ...... 89 5.4.2 PrestoBlue® assay ...... 89 5.4.3 GFP-Annexin V/PI ...... 90 5.5 siRNA screen for catalytic subunits of protein phosphatases ...... 91 5.5.1 Quantitative RT-PCR ...... 92 5.6 Proteomics ...... 92 5.6.1 Cell harvest ...... 92 5.6.2 Isolation of mitochondria ...... 93 5.6.3 Crosslinking of antibody to the beads ...... 93 5.6.4 Pulldown ...... 93 5.6.5 Washing and elution ...... 94 5.6.6 Mass spectrometry preparation ...... 94 5.6.7 Mass spectrometry ...... 95 5.6.8 Protein identification...... 95

6 References 96

7 Supplementary data 106 7.1 Supplementary figures ...... 106 7.2 Supplementary tables ...... 112

Table of figures

Figure 1 | The hallmarks of cancer ...... 17 Figure 2 | Feedback regulation of cancer signaling pathways ...... 19 Figure 3 | Subunit composition of the prefoldin, URI1, and R2TP complex ...... 22 Figure 4 | The mitochondrial URI1/PP1γ axis constitutes a negative feedback program downstream of the mTOR/S6K1 pathway ...... 24 Figure 5 | URI1 is an addicting oncogene in ovarian cancer ...... 26 Figure 6 | The PINK1/Parkin pathway of mitophagy ...... 32 Figure 7 | The signaling cascades of apoptosis ...... 33 Figure 8 | PGAM5(∆24) triggers apoptosis by IAP antagonism ...... 36 Figure 9 | The protein phosphatase inhibitor calyculin A triggers URI1 hyperphosphorylation ...... 40 Figure 10 | URI1 is required for the survival of OVCAR-4 and OVCAR-8 cells ...... 40 Figure 11 | Sample preparation for MS-based analysis of mitochondrial URI1-Co-IP in OVCAR-3 cells ...... 42 Figure 12 | PP1α and DUSP19 negatively regulate URI1 phosphorylation in control and everolimus-treated cells ...... 43 Figure 13 | PP1α interacts with URI1-PP1γ in a heterotrimeric complex independent of P-URI1 S371 ...... 46 Figure 14 | PP1α and PP1γ oppose URI1 phosphorylation mediated by the mTOR-S6K1 axis in HeLa cells ...... 48 Figure 15 | URI1 function is required for stabilization of basal PP1α levels ...... 50 Figure 16 | PP1α leads to URI1 hyperphosphorylation in OVCAR-3 cells but does not influence URI1-PP1γ complexes ...... 51 Figure 17 | URI1 endogenously interacts with Mfn2, STOML2, and the atypical phosphatase PGAM5 independent of its phosphorylation at S371 ...... 53 Figure 18 | URI1 protects PGAM5 from PARL-mediated cleavage in ovarian cells ...... 54 Figure 19 | URI1 depletion sensitizes to CCCP-induced apoptosis by releasing PGAM5(∆24) to the cytoplasm ...... 56 Figure 20 | CCCP-induced apoptosis caused by URI1 depletion in URI1-amplified OVCAR-8 cells is caspase-dependent ...... 58 Figure 21 | Depending on CCCP, PGAM5’s function is both pro- and anti-apoptotic in URI1- amplified OVCAR-4 cells ...... 61 Figure 22 | URI1 as a potential driver of PINK1/Parkin-mediated mitophagy ...... 63 Figure 23 | Fluorescence-based analysis of URI1-depleted OVCAR-8 cells transiently overexpressing YFP-Parkin ...... 63 Figure 24 | Model proposed for URI1’s function in the PGAM5-based apoptotic pathway in URI1-amplified ovarian cancer cells ...... 73 Figure 25 | Model proposed for URI1’s function in PINK1/Parkin-mediated mitophagy in URI1-amplified OVCAR-8 cells...... 74

Abbreviations

The standard amino acid code was used.

A ACN acetonitrile AhR aryl hydrocarbon receptor APAF1 apoptotic protease-activated factor 1 ASK1 apoptosis signal-regulating kinase 1 ATP adenosine triphosphate AxV Annevin V

B BAD Bcl-2 antagonist of cell death BAK Bcl-2 antagonist or killer BAX BCL-2-associated X protein Bcl-2 B-cell lymphoma 2 BCL2L1 Bcl-2-like 1 BH3 BCL-2 homology 3 BIR baculoviral inhibitor of apoptosis proteins repeat BNIP3 Bcl-2 and adenovirus E1B 19-kDa interacting protein 3 BRAF B-rapidly accelerated fibrosarcoma BRCA1 breast cancer 1, early onset BRCA2 breast cancer 2, early onset

C Caly calyculin A CASP caspase CCCP carbonyl cyanide 3-chlorophenylhydrazone CCLE Cancer Cell Line Encyclopedia CHAPS 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate cIAP cellular inhibitor of apoptosis proteins CID collision induced dissociation CK2 casein kinase 2 CNV copy number variation Co-IP Co-Immunoprecipitation

cyt cytoplasmic

∆ψm mitochondrial membrane potential

↓∆ψm loss of the mitochondrial membrane potential, depolarization DAPI 4',6-diamidino-2-phenylindole ddH2O double-distilled water DMEM Dulbecco’s Modified Eagle’s medium DMP dimethyl pimelimidate DMSO dimethyl sulfoxide DNA deoxyribonucleic acid DNAase deoxyribonuclease doxy doxycycline Drp1 dynamin-related protein 1 DTT dithiothreitol DUSP dual-specificity protein phosphatase

E E. coli Escherichia coli EDTA ethylenediaminetetraacetic acid EGTA ethyleneglycoltetraacetic acid ER estrogen receptor Ever everolimus

F FACS fluorescence-activated cell sorting FCCP carbonyl cyanide p-(trifluoromethoxy)phenylhydrazone FCP/SCP TFIIF-associating component of RNA polymerase II C-terminal domain (CTD) phosphatase 1/small CTD phosphatase) FCS fetal calf serum FIS1 mitochondrial fission protein 1 FUNDC1 FUN14 domain containing 1

G GCCP Good Cell Culture Practice

GFP green fluorescent protein GST glutathione S-transferase GTP guanosine triphosphate

H HAD haloacid dehalogenase HEPES 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid HER2 human epidermal growth factor receptor 2 HGSOC high-grade serous ovarian carcinomas HMBS hydroxymethylbilane synthase HOSE human ovarian surface epithelium HPR horseradish peroxidase HSP90 heat shock protein 90 HTRA2 high-temperature-requirement protein A2

I IAP inhibitors of apoptosis proteins IB immunoblot IBM inhibitor of apoptosis proteins binding motif IGF insulin-like growth factor IgG immunoglobulin G IMM inner mitochondrial membrane IMS intermembrane space IP Immunoprecipitation IVT in vitro translated rhIGF1-1 recombinant human IGF-1

J JNK c-Jun N-terminal kinase

K Keap1 kelch-like ECH-associated protein 1 KRAS Kirsten rat sarcoma viral oncogene homolog

L LB lysogeny broth LC3 microtubule-associated protein 1 light chain 3 LGSOC low-grade serous ovarian carcinomas

λemission emission wavelength

λexcitation excitation wavelength

M MAPK mitogen-activated protein kinase MEK MAPK/extracellular signal-regulated kinase Mfn1 mitofusin 1 Mfn2 mitofusin 2 mit mitochondrial MLKL mixed lineage kinase domain-like protein MOMP mitochondrial outer membrane permeabilization MPP mitochondrial processing peptidase mRNA messenger RNA MS mass spectrometry mTOR mammalian target of rapamycin mTORC1 mammalian target of rapamycin complex 1 MTS mitochondria-targeting sequence MW molecular weight

N NAD+ nicotinamide adenine dinucleotide NaCl sodium chloride NaF sodium fluoride NIX NIP3-like protein X Nrf2 nuclear factor, erythroid 2-like 2 ns not statistically significant nuc nuclear

O O/N overnight OCC ovarian cancer cell line OMM outer mitochondrial membrane 13

Opa1 optic atrophy 1

P P phosphate group PARL presenilin-associated rhomboid-like protein PARP poly(ADP-ribose) polymerase PBS phosphate buffered saline PDRG1 p53 and DNA damage-regulated protein 1 PFA paraformaldehyde PFD prefoldin PGAM5 phosphoglycerate mutase family member 5 PGAM5(Δ24) PGAM5 lacking the first 24 residues, cleaved PGAM5 PGAM5-L long isoform of PGAM5 PGAM5-S short isoform of PGAM5 PI propidium iodide PI3KCA phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha PIHD1 PIH1 domain-containing protein 1 PINK1 PTEN-putative kinase 1 PIP PP1 interacting protein PP1α protein phosphatase 1 α PP1β protein phosphatase 1 β PP1γ protein phosphatase 1 γ PPM Mg2+-dependent protein phosphatase PPP phosphoprotein phosphatase PTEN phosphatase and tensin homolog PTP protein tyrosine phosphatase

Q qRT-PCR quantitative Real-Time Polymerase Chain Reaction

R rhIGF-1 recombinant human insulin-like growth factor 1 RIP1 receptor-interacting protein 1 RIP3 receptor-interacting protein 3 RNA ribonucleic acid

RNAi RNA interference ROS reactive oxygen species RPAP3 RNA polymerase II-associated protein 3 RPB5 RNA polymerase II binding protein 5 RPMI Roswell Park Memorial Institute RT room temperature RVB1 RuvB-like 1 RVB2 RuvB-like 2

S S6K1 S6 kinase 1 SDS-PAGE sodium dodecyl sulfate polyacrylamide gel electrophoresis shRNA short hairpin RNA siRNA small interfering RNA SMAC second mitochondria-derived activator of caspase SQSTM1 sequestosome-1 Src sarcoma STAP1 SKP2-asssociated alpha PFD 1 STOML2 stomatin-like protein 2

T TBS tris buffered saline TBST tris buffered saline with Tween TCEP tris(2-carboxyethyl)phosphine TIM translocase of the inner membrane TIM50 mitochondrial import inner membrane translocase subunit 50 TOM translocase of the outer membrane TOM20 mitochondrial import receptor subunit 20 TP53 tumor protein p53 TRAP1 tumor necrosis factor receptor-associated protein 1 Tris tris(hydroxymethyl)aminomethane TSG tumor suppressor gene

U U ubiquitin UPS ubiquitin proteasome system 15

URI1 unconventional prefoldin RPB5 interactor 1

V VDAC voltage-dependent anion channel

W w/v weight to volume WB Western Blotting WCE whole cell extract WDR92 WD repeat-containing protein 92 Wnt Wingless-related integration site

X XIAP X-linked inhibitor of apoptosis proteins

Y YFP yellow fluorescent protein

Z Z-VAD-FMK N-Benzyloxycarbonyl-Val-Ala-As

1 Introduction 1.1 The molecular pathology of cancer 1.1.1 Multistep carcinogenesis and oncogene/non-oncogene addiction Cancer is described as a disease of uncontrolled proliferation of transformed cells and ranked as the second leading cause of death in the Western world with estimated 8.2 million death cases in 2012 worldwide (ACS, 2014; WHO, 2014). The multistep nature of tumorigenesis is an axiom in cancer research (Nowell, 1976) and prototypically documented in colon cancer (Grady and Markowitz, 2002). This process is driven by the accumulating acquisition of epigenetic abnormalities and somatic mutations in growth-promoting and growth-restricting genes that have been termed oncogenes and tumor suppressor genes (TSGs), respectively (Weinberg, 2014). Hence, Vogelstein (1993) created the concept of cancer as a genetic disease. This multistep carcinogenesis is connected to the appropriation of capabilities essential for the development of malignancy. Hanahan and Weinberg (2000) (2011) proposed them as hallmarks of cancer, underlying and organizing principles to face the complexity of the disease. These features were extended by Luo et al. (2009) who defined additional cancer stress phenotypes that functionally interplay with the classical hallmarks to promote tumorigenesis. These revised hallmarks of cancer, (further complemented by Kroemer and Pouyssegur (2008) (Figure 1) represent a set of tumorigenesis-associated stresses cancer cells have to cope with by stress support pathways to evade their lethality. The phenomenon that these pathways are vulnerable to therapeutic interference but not oncogenic themselves was described as the concept of non-oncogene addiction (Luo et al., 2009).

Figure 1 | The hallmarks of cancer The six hallmarks primarily proposed by Hanahan and Weinberg (top half, white symbols), were complemented with the evasion of the immune surveillance by Kroemer and Pouseegur, and the stress phenotypes by Luo et. al. (lower half, colored symbols). From (Luo et al., 2009) 17

In contrast, oncogene addiction describes the physiological dependency of cancer cells to the sustained activity of an oncogene. Hence, oncogenes are not only a driving force in cancer initiation but are equally important to sustain the malignant phenotype (Weinstein, 2002). The fate of addicting cancer cells undergoing inactivation of an oncogene is differentiation into phenotypically normal cells or death by apoptosis (Weinstein, 2000). This suggests that the malignant phenotype evoked by the myriad of mutations during multistep tumorigenesis is not simply a summation of isolated effects but rather an interplay of multifunctional proteins (Weinstein, 2002). The power of the concept of oncogene addiction lies in its translation to cancer treatment. Molecular targeted agents, drugs that specifically interfere with molecular events evoking the malignant phenotype, provide a novel strategy for cancer therapy. Thus, in contrast to conventional chemotherapy, these innovative drugs provide wider therapeutic windows by sparing normal cells (Stegmeier et al., 2010). Hence, addicting oncogenes were vividly depicted as the Achilles Heel of Cancer by Weinstein (2002). One of the prominent examples are targeted agents blocking the HER2 (human epidermal growth factor receptor 2) receptor in breast and ovarian cancer (Wong et al., 2006).

1.1.2 Feedback regulation of cancer signaling pathways Feedback loops, in which the effector of a process acts back to regulate the same process, are incorporated in virtually all intracellular signaling pathways (Alberts, 2008). In positive feedback, stimulation of a signaling system triggers an effector-mediated amplification of the initial signal (Figure 2A). In contrast, stimulation of a signaling system leading to an effector-mediated inhibition of the same system is termed negative feedback and will be focused on in the following (Figure 2B) (Weinberg, 2014). It is well known that oncogenic mutations cause constitutively active signaling pathways leading to dysregulation of cancer-prone processes such as proliferation, survival, or apoptosis. However, subsequently, constitutively active negative feedback loops would counteract these effects leading to unchanged signaling outputs (Figure 2C). Thus, to maintain oncogenically augmented signaling outputs and to elicit their phenotype, cancer cells are obliged to abrogate the negative feedback inhibition. This can be achieved either by directly disabling the feedback system (Figure 2D) or by rendering core components of the system pathway insensitive to the negative feedback control (Figure 2E). For example, amplification of URI1 in ovarian cancer cells directly abrogates PP1γ (protein phosphatase 1 gamma)-mediated negative feedback on S6K1 (S6 kinase 1) survival signaling (see 1.2.3) (Theurillat et al., 2011). The second mechanism applies to tumors with mutant BRAFV600E (B-rapidly accelerated fibrosarcoma) insensitive to feedback inhibition of RAF/MEK (mitogen- activated protein kinase (MAPK) extracellular signal-regulated kinase) signaling (Lito et al., 2012). Importantly, as outlined in Chapter 1.1.1, such oncogenic events and the signaling pathways that they disturb are promising targets for personalized therapies (Theurillat et al., 2011).

Figure 2 | Feedback regulation of cancer signaling pathways (A) Positive and (B) negative feedback in normal cells. (C) Oncogenically activated (*) signaling pathways cause constitutive negative feedback loops leading to unchanged signaling outputs. Cancer cells abrogate the feedback inhibition by directly disabling the feedback systems (D) or by rendering core components unresponsive to negative feedback inhbition (E). Adapted from W. Krek

1.1.3 Ovarian cancer 1.1.3.1 Epidemiology and therapy Ovarian cancer ranks as the fifth most common cause of cancer-related death in women in the Western world (Stewart and Kleihues, 2003), however, it is the most lethal of all gynecologic malignancies (Brucks, 1992; Jemal et al., 2008). The high mortality rates are ascribed to the diagnosis of up to 80% of cases only at advanced stage disease due to unspecific abdominal symptoms and limited early detection methods (Bast et al., 2009). Disastrously, at this stage effective treatment options are very limited leading to an overall ovarian cancer 5-year survival rate of around 30% (Kim et al., 2012b). Due to this insidious characteristic, ovarian cancer is often termed the silent killer (Goff et al., 2000). The standard treatment of advanced ovarian cancer is cytoreductive surgery, the partial removal of the tumor bulk, combined with first-line platinum-based chemotherapy and taxane-based agents (Kim et al., 2012a). Over the past three decades, the combination of carboplatin-paclitaxel was established as a gold standard in ovarian cancer chemotherapy. Although patients with advanced ovarian cancer show 19

a response rate and complete response of 80% and 40-60%, respectively, most of them relapse leading to a progression-free survival of only 18 months (Bast et al., 2009).

1.1.3.2 The cellular and molecular heterogeneity of ovarian carcinomas Based on the tissue of origin, ovarian cancer is classified into epithelial, stromal, and germ cell tumors (Agarwal and Kaye, 2003). The epithelial subtype accounts for 90% of all ovarian cancers and is further divided into four major histological classes: serous (70%), endometrioid (10-20%), clear cell (10%), and mucinous (3%) (Cho and Shih, 2009). Thus, ovarian carcinomas exhibit remarkable complexity and heterogeneity at the cellular, but also at the molecular level where multiple genetic and epigenetic abnormalities have been reported. On the basis of their molecular features, ovarian carcinomas are categorized into two groups designated type I and II (Kurman and Shih, 2010). Type I tumors, including low-grade serous, low-grade endometrioid, clear cell, and mucinous carcinomas, present at low stage and clinical indolence. In contrast, type II tumors, which encompass high-grade serous, high-grade endometrioid, and undifferentiated tumors, are highly aggressive neoplasms at advanced stage (Kurman and Shih, 2010). As the serous type is the most frequent, low-grade serous ovarian carcinomas (LGSOC) and high-grade serous ovarian carcinomas (HGSOC) are prototypic for type I and type II tumors, respectively, and will be focused on in the following. In LGSOC, mutations commonly occurring are KRAS (Kirsten rat sarcoma viral oncogene homolog), BRAF, PTEN (phosphatase and tensin homolog), ERBB2 (encoding HER2), CTNNB1 (encoding β-catenin), and PI3KCA (phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha) but are rarely detected in HGSOC (Bast et al., 2009). Thus, type I tumors are mainly characterized by aberrant MAPK/PTEN, and Wnt (Wingless-related integration site)/β-catenin signaling (Cho and Shih, 2009). In contrast, HGSOC exhibit very high frequency of TP53 (tumor protein p53) and BRCA1/2 (breast cancer 1/2, early onset) mutations as well as CCNE1 (encoding Cyclin E1) amplification (Bast et al., 2009; TGCA research network, 2011). Hence, chromosomal instability and widespread copy number changes are common features in type II tumors (Bowtell, 2010). Overall, translation of these molecular insights to develop personalized treatment strategies is a current challenge in ovarian cancer research.

1.1.3.3 The origin of ovarian cancer The discovery that tumors arise from normal tissue, rather than being foreign invasions from the outside world, and can consequently be traced back to their site of origin, is the basis of today´s cancer classification (Weinberg, 2014). However, in the case of ovarian cancer, recent reports provide cogent evidence that its traditional annotation might be obsolete. Among researchers and oncologists there was the consensus that ovarian carcinomas derive from the ovarian surface epithelium (mesothelium) and that subsequent metaplastic changes give rise to the development of the different cell types. These

tumors exhibit morphological features similar to the normal cells lining different organs in the female genital tract. Hence, serous, endometrioid, clear cell, and mucinous carcinomas morphologically resemble nonneoplastic cells of the fallopian tube, endometrium, endocervix or gastrointestinal tract, and urinary bladder, respectively (Kim et al., 2012a). This histological similarity is based on a common embryonical origin of these epithelia, the coelomic mesothelium (Cho and Shih, 2009). However, strikingly, these tumor types do not show any resemblance with normal ovarian epithelial cells, their alleged progenitors (Kurman and Shih, 2010). In light of this finding, HGSOC have been proposed to originally derive from precursor epithelial lesions in the distal fimbriated end of the fallopian tube, whereas endometrioid/clear cell and mucinous tumors have been ascribed to ovarian endometriosis and metastatic gastrointestinal tumors, respectively (Bowtell, 2010; Prat, 2012). Direct experimental prove for the fallopian-theory was elegantly delivered in a mouse model by Perets et al. (2013). They specifically inactivated TSGs commonly lost or mutated in human high-grade serous ovarian cancer cells (BRCA1 (or BRCA2), TP53, and PTEN) in fallopian tube but not ovarian surface epithelial cells. Strikingly, they documented HGSOC histologically and genetically similar to the human tumors. Furthermore, removal of the murine fallopian tubes completely prevented HGSOC. In summary, although the mesothelial origin cannot be excluded, these novel insights suggest that what we have traditionally considered as primary ovarian carcinomas are in fact secondary. Provocatively, ovarian cancer might be a hypernym for a range of distinct diseases that share an anatomical location (Bowtell, 2010).

1.2 URI1, an unconventional member of the prefoldin family of chaperones 1.2.1 URI1 is a member of the URI1/R2TP complex Unconventional prefoldin RPB5 (RNA polymerase II binding protein 5) interactor 1 (URI1) is an unconventional member of the prefoldin (PFD) family of chaperones. Conventional members of this family are small molecular weight proteins (14-23 kDa) composed of N- and C-terminal α-helical coiled-coil structures that are connected by either one (β-class PFDs) or two (α-class PFD) β hairpins. PFDs 1-6 have been shown to assemble into an α2β4 heterohexameric complex, referred to as the prefoldin complex, featuring a jellyfish-like structure with its six long coiled coils protruding from the double β barrel platform (Figure 3) (Siegert et al., 2000). Molecular chaperones are housekeeping proteins required for essential functions such as folding of newly translated polypeptides into three- dimensional conformations, inhibition of protein aggregation, and assembly of multiprotein complexes involved in transcriptional processes (Whitesell and Lindquist, 2005; Young et al., 2004). The prefoldin complex functions as a molecular chaperone in actin and tubulin folding (Vainberg et al., 1998). Although URI1 contains all features of an α-class PFD, it is considerably larger due to its

additional RPB5-binding domain and a long acidic C-terminal extension. Similarly to the prefoldins, URI1 assembles into the multiprotein URI1 complex containing another α-class prefoldin, SKP2- associated alpha PFD 1 (STAP1), and the three β-class prefoldins PFD2, PFD6, and PDRG1 (p53 and DNA damage-regulated protein 1) (Figure 3) (Gstaiger et al., 2003). Although the URI1 and prefoldin complex have PDF2 and PDF6 in common, they have been shown to exist as independent rather than overlapping structures. Furthermore, assuming that the URI1 complex forms a similar heterohexameric α2β4 complex as the prefoldin complex, it has been postulated that one of the β-class PFDs (PFD2, PDF6, PDRG1) is present in two copies (Gstaiger and Krek, unpublished). A distinct feature of the URI1 complex is the presence of additional non-PFD subunits, including RPB5 and members of the R2TP complex (Figure 3). This complex is composed of the four subunits RVB1 (RuvB-like 1; also termed TIP48), RVB2 (RuvB-like 2; also termed TIP49), RPAP3 (RNA polymerase II-associated protein 3; also termed hSpagh), and PIHD1 (PIH1 domain-containing protein 1) and further interacts with HSP90 (heat shock protein 90) and WDR92 (WD repeat-containing protein 92; also termed Monad) (Boulon et al., 2010; Dorjsuren et al., 1998; Gstaiger et al., 2003; Mita et al., 2013). Current evidence indicates that the URI1/R2TP complex functions as a molecular chaperone in the assistance of cytoplasmic assembly of RNA polymerase II (Boulon et al., 2010).

Figure 3 | Subunit composition of the prefoldin, URI1, and R2TP complex The prefoldin and URI1 complexes are two independent heterohexameric complexes composed of each two α-class PFDs (elongated symbols) and four β-class PFDs (round symbols), whereas the fourth β-class PFD of the URI1 complex is unkown (PFDx). The crystal structure of the prefoldin complex has the appearance of a jellyfish (lower panel, orange: α-class PFD, blue: β-class PFD, from (Siegert et al., 2000)). The URI1 complex interacts with the non- PFDs RPB5 and members of the R2TP complex.

1.2.2 The mitochondrial URI1/PP1γ axis constitutes a negative feedback program downstream of the mTOR/S6K1 pathway URI1 was discovered as a downstream effector of the mammalian target of rapamycin (mTOR), a central controller of cell growth by integrating a plethora of growth factor and nutrient-regulated signaling pathways (Gstaiger et al., 2003). In response to signals sensed by receptor tyrosine kinases, mTOR (more specifically mTORC1, the mTOR complex 1) modulates the activity of effector proteins such as S6K1, which promotes cell survival and protein synthesis (Sabatini, 2006). S6K1 mediates its survival function by coordinating the activity of Bcl-2 (B-cell lymphoma 2) family members of pro- (e.g., BAD (Bcl-2 antagonist of cell death) and BAK (Bcl-2 antagonist or killer) and anti-apoptotic

(e.g., Bcl-2 and Bcl-XL) proteins. In the absence of survival cues, BAD is dephosphorylated and tightly associates with Bcl-2 at the outer mitochondrial membrane to inhibit its pro-survival function and subsequently provokes apoptosis (Figure 4) (Datta et al., 2000). In contrast, insulin-like growth factor (IGF)1 treatment leads to S6K1-mediated phosphorylation of BAD at S136 and its segregation to the cytosol where it associates with 14-3-3 proteins to liberate Bcl-2 pro-survival signaling (Datta et al., 2000; Harada et al., 2001). This survival-promoting phosphorylation of BAD is counterbalanced by phosphatases, including the protein phosphatase PP1γ. Djouder et al. (2007) reported that URI1 is a downstream target of S6K1 and associates with PP1γ at mitochondria (Figure 4). The un(der)phosphorylated form of URI1 binds to PP1γ and functions as its inhibitor, whereas IGF1 stimulates S6K1-mediated phosphorylation of URI1 at S371 leading to disassembly of URI1-PP1γ complexes. Liberated PP1γ then proceeds to dephosphorylate S6K1 and BAD at T389 and S136, respectively. On the basis of these findings, a model was proposed in which URI1 assembles into a complex with PP1γ depending on its phosphorylation state to set the mitochondrial threshold in accordance to growth factor and nutrient availability conveyed via the mTOR-S6K1 axis. Thus, acute S6K1 activation is counterbalanced by a mitochondrial negative feedback loop evoking the phosphorylation of URI1 and the subsequent liberation of PP1γ, which dampens S6K1 survival signaling (Djouder et al., 2007; Theurillat et al., 2011).

Figure 4 | The mitochondrial URI1/PP1γ axis constitutes a negative feedback program downstream of the mTOR/S6K1 pathway URI1 associates with PP1γ at mitochondria and functions as its inhibitor whereas nutritional and growth factor cues trigger S6K1-mediated phosphorylation of URI1 at S371 and dissociation of URI1-PP1γ complexes. Liberated PP1γ proceeds to dephosphorylate S6K1 and BAD which dampens the survival signaling. Adapted from C. Britschgi

1.2.3 URI1 is an addicting oncogene in ovarian cancer Intriguingly, the chromosomal locus 19q12 where URI1 resides was found to be amplified in a variety of carcinomas including small-cell lung, endometrium, stomach, breast, and ovarian cancer. Moreover, this amplicon has been shown to correlate with resistance to platinum-based therapy in ovarian cancer. In human ovarian tumors, URI1 amplification is linked to URI1 overexpression and was detected in a subset of carcinomas with no preference for histological subtypes outline in Chapter 1.1.3.2 but not in other ovarian malignancies or normal ovarian surface epithelium (HOSE). Importantly, URI1 amplification significantly correlated with poor disease-specific patient’s survival (Theurillat et al., 2011). Apart from URI1, around seven genes are coamplified within the 19q12 locus in ovarian carcinomas including CCNE1, which encodes Cyclin E1 (Etemadmoghadam et al., 2009; Theurillat et al., 2011). Cyclin E1 is a positive cell cycle regulator that has been traditionally linked to the tumor biology of the 19q12 amplicon in a several cancer types (Lin et al., 2000; Schraml et al., 2003). However, existing evidence suggests that URI1 is the only coding gene within the 19q12 amplicon that has properties of an addicting oncogene (Davis et al., 2013; Theurillat et al., 2011). Thus, colony formation assays in 19q12-amplified (OVCAR-3 and FU-OV-1) and 19q12-non amplified (TOV-21G and SKOV3) ovarian cancer cells as well as in immortalized HOSE cells revealed that while Cyclin

E1 is essential in all cell lines studied, URI1 depletion selectively affected colony formation of cells with a 19q12 amplification (Figure 5A). Moreover, URI1’s function was shown to be required both for de novo tumorigenesis as well tumor progression after tumor establishment in OVCAR-3 xenograft mouse models (Theurillat et al., 2011). One pathway describing the underlying mechanism of URI1-driven tumorigenesis was elucidated by Theurillat et al. (2011) and is outlined in Figure 5B. They indicated that the URI1 oncoprotein promotes cell survival under nutrient and growth factor deprivation stress by sustained S6K1 survival signaling. Thus, excessively produced URI1 protein caused by 19q12 amplification detains PP1γ in inactive complexes at mitochondria leading to elevated levels of phosphorylated S6K1 and BAD at T389 and S136, respectively. Futhermore, URI1 amplification was reported to mediate increased resistance to cisplatin and the mTOR inhibitor rapamycin. Of particular importance for the study presented here are observations implying that URI1 protein upregulation and its phosphorylation at S371 are uncoupled. Thus, little variance of S371 phosphorylated URI1 was detected in ovarian (cancer) cell lines with different URI1 protein levels (Figure 5C). In summary, URI1 is an addicting oncoprotein that fuels evasion from apoptosis and contributes to chemotherapy resistance by abrogation of the PP1γ-mediated feedback loop in 19q12-amplified ovarian cancers. In agreement with the conceptual power of oncogene addiction outlined in Chapter 1.1.1, small molecules specifically disrupting URI1-PP1γ complexes could provide promising opportunities for the targeted treatment of 19q12-amplified ovarian carcinomas. However, apoptosis caused by URI1 depletion is only partially rescued by S6K1 overexpression suggesting that this is only one mechanism of URI1-driven ovarian carcinogenesis and that yet to be elucidated pathways may contribute to URI1-mediated suppression of apoptosis (Theurillat et al., 2011).

Beyond its driving power in ovarian cancer, URI1 was recently shown to initiate and promote multistep hepatocarcinogenesis by DNA damage (Tummala et al., 2014). HSP90, which was above described to be part of the URI1/R2TP complex, also associates with the aryl hydrocarbon receptor (AhR) and estrogen receptor (ER). Tummala et al. (2014) reported that cytoplasmic URI1/HSP90 complexes prevent AhR- and ER-mediated transcription of enzymes implicated in the L- tryptophan/kynurenine/nicotinamide adenine dinucleotide (NAD+) metabolism resulting in genotoxic stress and tumor initiation. Importantly, URI1 protein expression was enhanced in human hepatocellular carcinomas and correlated with poor survival.

B C

Figure 5 | URI1 is an addicting oncogene in ovarian cancer (A) Colony formation assay (left panel) and quantification (right panel) of URI1-depleted ovarian (cancer) cells lines with two different short hairpin RNAs (URI-KD1 and URI-KD2). (B) Model proposing URI1 as an addicting oncoprotein by promoting S6K1-mediated surival under nutrient and growth factor deprivation stress by abrogation of the PP1γ-dependent feedback loop. (C) Immunoblot analysis of URI1 and phospho-URI1 S371 in different ovarian (cancer) cell lines. From Theurillat et al. (2011)

1.3 The diversity of protein phosphatases 1.3.1 Reversible protein phosphorylation Protein phosphorylation, discovered by Edmond Fischer and Edwin Krebs (1955), is defined as the covalent addition of the phosphate group of an ATP molecule to the serine (Ser), threonine (Thr), or tyrosine (Tyr) side chain of a target protein by protein kinases (Alberts, 2008). This reaction is reversed by protein phosphatases that catalyze the hydrolytic removal of the phosphate group, called dephosphorylation. Analysis of the human phosphoproteome revealed that P-Ser, P-Thr, and P-Tyr account for approximately 86.4%, 11.8%, and 1.8% respectively (Olsen et al., 2006). Reversible protein phosphorylation is one of the most widespread post-translational modifications affecting the 26

activity, subcellular localization, conformation, structure, and stability of around 30% of all cellular proteins including protein kinases and phosphatases itself (Cohen, 2000; Hunter, 2000). Hence, it is a fundamental regulatory mechanism in almost all cellular processes including growth, division, metabolism, cell cycle progression, and apoptosis (Ceulemans and Bollen, 2004; Manning et al., 2002). Consequently, aberrant protein phosphorylation is a cause of several human pathologies such as diabetes, rheumatoid arthritis, and cancer (Katsogiannou et al., 2014). In the latter, the driving force of mutationally activated kinases (e.g. Raf) or inactivated phosphatases (e.g. PTEN) is well- characterized.

1.3.2 Classification of protein phosphatases According to their substrate specificity, protein phosphatases are assigned to the protein tyrosine phosphatase (PTP) superfamily, which include dual-specificity protein phosphatases (DUSP), or the family of protein serine/threonine (Ser/Thr) phosphatases. Additionally, the FCP/SCP (TFIIF- associating component of RNA polymerase II C-terminal domain (CTD) phosphatase-1/small CTD phosphatase) and HAD (haloacid dehalogenase) proteins represent a distinct family of protein phosphatases based on their active-site aspartate serving as a nucleophile (Moorhead et al., 2007). In contrast, the PTPs superfamily, which is categorized as Class I-III phosphatases, uses an cysteine- based catalysis mechanism (Tonks, 2006). According to their structure, protein Ser/Thr protein phosphatases are classified as the phosphoprotein phosphatase (PPP) and Mg2+-dependent protein phosphatase (PPM) family (Cohen, 2004). Members of both families are metalloenzymes that catalyze dephosphorylation of their substrates through metal-activated water molecules (Pereira et al., 2011).

1.3.3 The family of phosphoprotein phosphatases With each around 100 genes, the number of protein tyrosine kinases approximates that of protein tyrosine phosphatases. Intriguingly, the Ser/Thr kinases encoded by the mammalian genome outnumber the around 40 protein Ser/Thr phosphatases by more than eightfold (Moorhead et al., 2007). Hence, the diversity of protein Ser/Thr phosphatases, in decisive contrast to the opposing Ser/Thr kinases, does not lie in the number of encoding genes but rather in their ability to form heteromeric complexes (Virshup and Shenolikar, 2009). The PPP family consists of the members PP1, PP2A (PP2), PP2B (PP3 or calcineurin), PP4, PP5, PP6, and PP7 (Pereira et al., 2011). Except for PP5 and PP7, these enzymes are composed of a catalytic C subunit that never exists free in vivo but rather interacts with a host of proteins specific to the according PPP member. As protein Ser/Thr phosphatases belonging to the PPM family function as monomers, this is a unique feature of the PPP members (Cohen, 2004). The most extensively studied protein Ser/Thr phosphatase are PP1 and PP2A which together account for over 90% of the eukaryotic phosphatase activity (Xiao et al., 2010) and

prototypically represent the diversification strategy of the PPP family. PP1, on which will be focus in the following, is the most important protein phosphatase regarding substrate diversity.

1.3.3.1 The phosphoprotein phosphatase 1 The PP1 catalytic subunit (PP1C) is encoded by the three distinct genes PPP1CA, PPP1CB, and

PPP1CC generating the ubiquitously expressed isoforms PP1α, PP1β, and PP1γ1/PP1γ2, respectively, whereas PP1γ2 is testis-specific and generated by alternative splicing (Ceulemans and Bollen, 2004; Cohen, 2002). The PP1C isoforms exhibit an identical catalytic mechanism and nearly 90% amino acid sequence identity with the highest variance in their N- and C-terminal extremities (Ceulemans et al., 2002; Cohen, 2002). Due to this fact, in vitro studies on isolated catalytic subunits in the past contributed to the widespread belief that phosphatases are generally unspecific and promiscuous enzymes (Sacco et al., 2012; Virshup and Shenolikar, 2009). However, invariably, the PP1s are multimeric holoenzymes, consisting of only a small number of catalytic C subunits combining with a large variety of structurally unrelated interactors. Based on this exceptional characteristic, Bollen et al. (2010) defined PP1 as a date hub, a protein capable of interacting with numerous partners whereas only a few can bind simultaneously. The substrate specificity, subcellular localization, and tissue distribution of PP1 is not determined by the catalytic C subunit itself but rather by the composition of the holoenzyme. At this level, the number of protein Ser/Thr kinases and phosphatases is balanced. In conclusion, the exquisite in vivo specificity and diversity of PP1 is based on its combinatory complexity (Heroes et al., 2013). So far over 200 PP1 interacting proteins (PIPs) have been validated, but bioinformatics-based screens estimated the PP1 interactome to be considerably larger (Bollen et al., 2010; Hendrickx et al., 2009). The PIPs can be categorized as PP1 substrates (e.g. BRAC1), inhibitors (e.g. Inhibitor-2), and substrate-targeting subunits (Bollen et al., 2010; Hurley et al., 2007; Liu et al., 2002). In line with this concept, URI1 can be classified as an PIP targeting PP1 to mitochondria where its functions at its inhibitor (Bollen et al., 2010). The remarkable in vivo specificity of PP1 created by the complexity of its toolkit is further supported by diverse PIP regulatory mechanisms such as cell type-dependent expression, controlled proteolysis, or phosphorylation (Bollen et al., 2010).

1.4 Mitochondria: a platform of multiple pathways 1.4.1 Mitochondrial quality control pathways Mitochondria are major platforms for diverse functions central to the physiology of eukaryotic cells including ATP production and cell death execution and thus maintenance of a viable pool is fundamental to cellular homeostasis (Nunnari and Suomalainen, 2012). Dysfunctional mitochondria excessively produce reactive oxygen species (ROS) which cause severe damage to cellular DNA and 28

proteins and in the last resort results in apoptosis, the programmed cell death (see 1.4.2). Therefore, mitochondrial quality is incessantly and tightly controlled by four major pathways involving AAA proteases, lysosomal removal of vesicles, mitochondrial dynamics, and mitophagy (Ashrafi and Schwarz, 2013; Chan, 2006). Two AAA protease complexes, embedded into the inner mitochondrial membrane (IMM), represent a mitochondrial-specific proteolytic system by degrading unfolded membrane proteins (Langer et al., 2001). In addition, Soubannier et al. (2012) presented a lysosome- based pathway in which vesicles budding from mitochondria sequester selected cargo and deliver them to the lysosome for degradation. This steady-state mechanism is further enhanced by oxidative stress suggesting a selective function in removal of oxidized mitochondrial proteins.

1.4.1.1 Mitochondrial dynamics The aforementioned quality control pathways involve the removal and degradation of only a subset of mitochondrial proteins, whereas mitochondrial dynamics and mitophagy affect the entire organelle. Mitochondria are not autonomous organelles but rather form highly dynamic cooperating networks by continuous fission and fusion, regulated by a group of large GTPases of which the precise mechanism is unclear. Mitochondrial fusion depends on both the outer mitochondrial membrane (OMM) components Mfn1 (mitofusin 1) and Mfn2 (mitofusin 2) as well as the IMM protein Opa1 (optic atrophy 1) (Knott et al., 2008). In mitochondrial fission, the OMM anchored FIS1 (mitochondrial fission protein 1) serves as a receptor to which cytosolic Drp1 (dynamin-related protein 1) is recruited to (Youle and van der Bliek, 2012). Exchange of intramitochondrial content including lipids, metabolites and mitochondrial DNA is considered as the primary function of mitochondrial fusion leading to complementation of mitochondria and rescue of damaged organelles (Westermann, 2010). While fusion mixes the content of parent mitochondria with an intact mitochondrial membrane potential (∆ψm), the voltage gradient across the IMM (Alberts, 2008), fission events generate divergently polarized daughters (Twig et al., 2008b). Twig et al. (2008a) demonstrated that fission results in uneven daughter organelles with one organelle that exhibits an increased ∆ψm and is subsequently reintegrated into the mitochondrial network whereas the depolarized (↓∆ψm) daughter is segregated from the pool. The fate of these depolarized mitochondria as well as organelles that are superfluous, old, and damaged beyond repair is their elimination via mitophagy (Youle and van der Bliek, 2012).

1.4.1.2 Mitophagy Mitophagy is a selective form of autophagy, one of the major cellular catabolic pathways. Autophagy describes the engulfment of a cytoplasmic portion into a double-membrane vesicle, termed autophagosome, its maturation into the autolysosome by fusion with the lysosome and finally the degradation and recycling of the internal material (Mizushima, 2007). In mitophagy, the most well-

recognized mechanism is driven by the PINK1/Parkin pathway (Figure 6) (Narendra and Youle,

2011). In healthy mitochondria with an intact ∆ψm, the Ser/Thr kinase PINK1 (PTEN-putative kinase 1) is constantly synthesized in the cytosol and imported into mitochondria directed by its mitochondria-targeting sequence (MTS). This transport is driven by the TOM (translocase of the outer membrane) and TIM (translocase of the inner membrane) complex whereas the last step is associated with cleavage of the MTS mediated by the mitochondrial processing peptidase (MPP) (Greene et al., 2012; Jin and Youle, 2012). PINK1 is then further cleaved by the IMM resident protease PARL (presenilin-associated rhomboid-like protein) and rapidly degraded (Jin et al., 2010). Hereby, healthy polarized mitochondria maintain PINK1 at very low levels. However, loss of ∆ψm triggers PINK1 stabilization on the OMM in association with the TOM complex which serves as a flag for damaged mitochondria (Bertolin et al., 2013; Hasson et al., 2013; Lazarou et al., 2012; Narendra et al., 2010). Experimentally, mitochondrial depolarization (also termed mitochondrial uncoupling) is most widely triggered by the ionophore carbonyl cyanide 3-chlorophenylhydrazone (CCCP; and its fluoro derivative FCCP) that dissipates the H+ gradient and thus destroys the electron transport chain of the oxidative phosphorylation system (East et al., 2014). Following accumulation on ∆ψm-deficient mitochondria, PINK1 is autophosphorylated at S228 and S402 (Okatsu et al., 2012). This self- activation induces PINK1-mediated phosphorylation of the cytosolic E3 ubiquitin ligase Parkin and abolishment of its autoinhibitory state (Caulfield et al., 2014; Shiba-Fukushima et al., 2012). Intriguingly, in addition to phosphorylation of Parkin at S65, that lies within its ubiquitin-like domain, PINK1 has been demonstrated to phosphorylate ubiquitin itself at the same residue to further boost Parkin activity (Kane et al., 2014; Kazlauskaite et al., 2014; Koyano et al., 2014). Subsequently, Parkin translocates to mitochondria to ubiquitinate several OMM proteins including Mfn1, Mfn2, TOM, VDAC (voltage-dependent anion channel), and Parkin itself (Chaugule et al., 2011; Sarraf et al., 2013). PINK1-phosphorylated Mfn2 has been demonstrated as a mitochondrial receptor for Parkin recruitment (Chen and Dorn, 2013). Geisler et al. (2010) revealed that Parkin-ubiquitinated proteins recruit the autophagic adapter p62/SQSTM1 (sequestosome-1) to mitochondria that is essential for their clearance. P62 was previously shown to directly interact with autophagosome-bound LC3 (microtubule-associated protein 1 light chain 3) to mediate autophagic degradation of ubiquitinated proteins. Hence, p62 recognizes Parkin-ubiquitinated substrates and drives the recruitment of autophagosome membranes to the mitochondria which finally leads to degradation of the entire organelle (Pankiv et al., 2007).

Beyond the PINK1/Parkin axis, which is classified as ubiquitin-mediated mitophagy, three other receptor-mediated pathways involving LC3-interacting OMM proteins exist (Okamoto, 2014). During maturation of reticulocytes to erythrocytes, mitochondria are selectively removed by mitophagy mediated by NIX (NIP3-like protein X; also termed BNIP3L) (Youle and Narendra, 2011). BNIP3 (Bcl-2 and adenovirus E1B 19-kDa interacting protein 3) as well as FUNDC1 (FUN14 domain

containing 1) are specific regulators of hypoxia-induced mitophagy, whereas the latter is activated upon dephosphorylation of inhibitory sites (Okamoto, 2014). In response to hypoxia, the Scr (sarcoma) kinase is inactivated leading to FUNDC1 dephosphorylation at Y18 and mitochondrial removal (Liu et al., 2012). Similarly, dissipation of ∆ψm induces mitophagy by loss of casein kinase 2 (CK2)-dependent FUNDC1 phosphorylation at S13 (see 1.4.3) (Chen et al., 2014).

Overall, the mitochondrial quality control machinery can be considered to follow a certain hierarchy. Single unfolded or damaged mitochondrial proteins are degraded by the AAA protease system or delivered to the lysosome via mitochondrial-derived vesicles. Damage affecting a wider range of mitochondrial contents can be complemented or rescued by fusion mechanisms. However, if mitochondrial insult exceeds a certain threshold, fission ensures the segregation of unhealthy mitochondria from the viable network that subsequently undergo mitophagy. Existing evidence emphasizes the requirement of fragmentation prior to mitophagy and suggests that the PINK1/Parkin axis directly regulates mitochondrial dynamics by promoting fission and/or inhibiting fusion events (Deng et al., 2008; Gomes and Scorrano, 2013; Yu et al., 2011). However, mitochondrial fission is also observed as an early event in apoptosis and several studies reported a delay in caspase activation and cell death itself upon DRP1 inhibition (Detmer and Chan, 2007; Youle and van der Bliek, 2012). Therefore, depending on the weight of mitochondrial damage, fragmentation may promote either mitophagy or apoptosis.

Figure 6 | The PINK1/Parkin pathway of mitophagy

(left panel) In healthy mitochondria with an intact ∆ψm, the Ser/Thr kinase PINK1 is constantly imported into mitochondria via the TOM/TIM complex, processed by MPP and PARL and finally degraded. (right panel) Upon loss of ∆ψm, PINK1 accumulates at mitochondria and catalyzes phosphorylation of itself, Parkin, and ubiquitin. Subsequently, Parkin translocates to its mitochondrial receptor Mfn2 to ubiquitinate serval OMM proteins including TOM, Mfn2, and Parkin itself which triggers p62/SQSTM1-mediated autophagic removal. U = ubiquitin, P = phosphate group

1.4.2 Apoptosis Apoptosis is a complex program of cellular self-destruction and proceeds through either the intrinsic (mitochondrial) or extrinsic (death receptor-mediated) pathway both of which converge in the activation of the executioner caspases, caspase 3 and caspase 7 (Figure 7) (Tait and Green, 2010). The intrinsic pathway, which will be focused on in the following, is activated in response to a wide range of intracellular stimuli such as DNA damage, chemotherapeutic agents, or growth factor withdrawal (Vucic et al., 2011). Importantly, evasion from this pathway is regarded as a hallmark of cancer (Hanahan and Weinberg, 2000). Intrinsic death stimuli activate the pro-apoptotic BH3 (BCL-2 homology 3)-only family proteins which promote the assembly of BAX (BCL-2-associated X protein)-BAK oligomers within the OMM. These channels initiate mitochondrial outer membrane permeabilization (MOMP), a process that is counteracted by anti-apoptotic BCL-2 proteins (Taylor et al., 2008) MOMP causes the release of intermembrane space (IMS) proteins including cytochrome c, which binds apoptotic protease-activated factor 1 (APAF1) to form the apoptosome (Youle and Strasser, 2008). This complex drives the activation of the initiator caspase 9, which proceeds to cleave and activate caspase 3 and 7. These caspases orchestrate the demolition of the cell through cleavage of numerous proteins including the 32

nuclear enzyme PARP (poly(ADP-ribose) polymerase), a well-recognized marker for apoptosis (Lazebnik et al., 1994; Vucic et al., 2011). Apart from cytochrome c, MOMP triggers the release of the IMM proteins SMAC (second mitochondria-derived activator of caspase) and HTRA2 (high-temperature-requirement protein A2; also termed OMI) which neutralize the caspase inhibitory function of XIAP (X-linked inhibitor of apoptosis proteins) (Tait and Green, 2010). IAPs compromise a family of cytosolic anti-apoptotic proteins that block cell death at the level caspase activation. They contain both a RING ubiquitin ligase domain and characteristic baculoviral IAP repeat (BIR) domain that recognizes substrates and promotes their degradation, including themselves (Varfolomeev et al., 2007; Vucic et al., 2011). Whereas XIAP was shown to directly bind and inhibit caspase 3, 7, and 9, cellular IAPs (cIAP; mainly cIAP1 and cIAP2) were shown to be no potent caspase inhibitors but instead associate with SMAC to prevent it from blocking XIAP-mediated caspase inhibition (Fulda and Vucic, 2012). Allies of caspases such as SMAC and HTRA2 antagonize IAPs through their IAP-binding motif (IBM). However, at the same time, they are IAP substrates and subjected to ubiquitination and degradation in this mutually antagonistic relationship (MacFarlane et al., 2002; Zhuang et al., 2013).

Figure 7 | The signaling cascades of apoptosis Apoptosis proceeds through either the intrinsic or extrinsic pathway both of which converge in the activation of the executioner caspases, caspase 3 and caspase 7. Whereas the extrinsic pathway is activated through death receptors, the intrinsic pathway responses to a wide range of stimuli leading to the activation of BH3-only family proteins which promote the assembly of BAX-BAK channels and MOMP. Subsequently, cytochrome c is released from the IMS and binds to APAF1 to form the apoptosome. This complex initiates a proteolytic cascade that finally activates caspase 3 and 7 which orchestrate the demolition of the cell through cleavage of numerous proteins. Together with cytochrome c, the IMM proteins SMAC and HTRA2 are released and block XIAP- mediated caspase inhibition. From Tait and Green (2010)

1.4.3 PGAM5, a novel mitochondrial regulatory protein The annotation and classification of the broad array of human protein phosphatases outlined in Chapter 1.3.2 suggests that these enzymes cover all cellular protein dephosphorylation events. However, unexpectedly, several other proteins structurally and catalytically different from the known protein phosphatases have been identified to possess phosphatase activity (Sadatomi et al., 2013). One of these atypical protein phosphatases is the phosphoglycerate mutase family member 5 (PGAM5). It belongs to the evolutionary conserved PGAM family, the founder member of which converts 3- phosphoglycerate to 2-phosphoglycerate during glycolysis (Jedrzejas, 2000). A common feature of this family is a highly conserved catalytic His-based core, designated as the PGAM domain, and most members are metabolic enzymes (Jedrzejas, 2000; Takeda et al., 2009). However, the first evidence that PGAM5 lacks this authentic mutase activity but instead acts as a protein Ser/Thr phosphatase was given recently by Takeda et al. (2009). They demonstrated that PGAM5 dephosphorylates the inhibitory sites of ASK1 (apoptosis signal-regulating kinase 1) and subsequently activates the stress- responsive JNK (c-Jun N-terminal kinase) and p38 pathways. PGAM5 presents as two splice variants differing in their C-termini, the long and the short isoform PGAM5-L (32 kDa) and PGAM5-S (28 kDa), respectively, originated from the PGAM5 gene located on chromosome 12 (Lo and Hannink, 2006). Although these isoforms were reported to exhibit distinct biological functions, the majority of reports focused on PGAM5-L (hereinafter referred to as PGAM5) (Lo and Hannink, 2008; Wang et al., 2012). Lo and Hannink (2008) characterized PGAM5 as a mitochondrial protein targeted to the OMM by an N-terminal mitochondrial-localization sequence and its catalytic C-terminus facing the cytoplasm. However, two subsequent studies reported PGAM5 to be localized to the IMM with its catalytic C- terminus facing the intermembrane space (Lu et al., 2014; Sekine et al., 2012). Thus, in spite of a consensus that PGAM5 is a unique mitochondrial resident protein, its sublocalization in this organelle remains debated (Chen et al., 2014).

Although PGAM5 was first and only recently shown to interact with the apoptosis regulator Bcl-XL (Lo and Hannink, 2006), already now it is known as a protein with a remarkable diverse and complex function (Sadatomi et al., 2013). PGAM5 was identified as a novel substrate and regulator of the Keap1 (kelch-like ECH-associated protein 1)-dependent ubiquitin ligase complex (Lo and Hannink, 2006; Lo and Hannink, 2008). The Keap1/Nrf2 (nuclear factor, erythroid 2-like 2) system is one of the main cellular defense mechanisms against oxidative stress which inhibits Keap1-dependent ubiquitination of the transcription factor Nrf2 to enable expression of cytoprotective genes. Lo and Hannink (2008) suggested a role of PGAM5 in mitochondrial redox homeostasis by tethering the Keap1/Nrf2 complex to mitochondria and suppression of Nrf-2 dependent gene expression. Most prominently, recent findings describe PGAM5 as a crucial regulator of both cell death and mitochondrial quality control pathways. Similar to PINK1, PGAM5 was reported to undergo PARL- mediated cleavage in its N-terminal transmembrane domain generating the cleaved form 34

PGAM5(∆24) lacking the first 24 residues. However, in contrast to PINK1, PGAM5 cleavage occurred in response to CCCP-induced ∆ψm loss or staurosporine-triggered apoptosis but not in steady-state conditions (Figure 8) (Sekine et al., 2012; Zhuang et al., 2013). Thus, PARL-mediated processing of PGAM5 and PINK1 is reciprocally and non-competitively regulated depending on the mitochondrial health status (Sekine et al., 2012). Moreover, Zhuang et al. (2013) demonstrated that PGAM5(∆24) but not the full-length protein is both a substrate and antagonist of XIAP and cIAP1. The N-terminus of full-length PGAM5 masks the internal IBM sequence at residue 25 and anchors it to mitochondria, whereas PGAM5 cleavage reveals this neo-IBM motif and induces PGAM5(∆24) translocation to the cytoplasm. Strikingly, they suggested that cytosolic PGAM5(∆24) antagonizes binding of IAPs to activated caspases and thus triggers apoptosis and the subsequent loss of XIAP and cIAP1 (Figure 8). Thus, they presented PGAM5(∆24) as another ally of caspases similar to SMAC and HTRA2 (see 1.4.2). Furthermore, PGAM5 was also proposed to function in necroptosis, a programmed and regulated form of necrosis. Wang et al. (2012) described PGAM5 as a downstream target of the RIP3 responsible for recruiting the necrosome complex RIP1-RIP3-MLKL (receptor-interacting protein 1/3- mixed lineage kinase domain-like protein) to mitochondria. They reported that RIP3 subsequently phosphorylates and activates PGAM5-S which in turn dephosphorylates the inhibitory S637 site of Drp1 and thereby promotes mitochondrial fission. Although they stated that mitochondrial fragmentation is an obligatory step for necrosis execution, the underlying mechanism remains elusive (Kanamaru et al., 2012). Several recent reports, however, questioned the role of the PGAM5-Drp1 axis in necroptosis as they were unable to reproduce the data presented by Wang et al. (2012) (Marshall and Baines, 2014). Based on their own data and evaluation of the current knowledge, Marshall and Baines (2014) even raise the possibility that mitochondria are dispensable for this form of necrosis. In spite of this discrepancy, the finding that PGAM5 promotes mitochondrial fission was supported by other reports (Imai et al., 2010; Lo and Hannink, 2008). In accordance with the connection between mitochondrial fragmentation and autophagic removal outlined in Chapter 1.4.1, PGAM5 was illustrated to function in mitophagy via two distinct pathways. Lu et al. (2014) reported that PGAM5 is required for PINK1 stabilization at the OMM of damaged mitochondria by protecting it from PARL- mediated degradation at the IMM. Remarkably, this study causally linked in vivo PGAM5 function to Parkinson’s disease and thereby presented the first PGAM5 mouse model. They found that mice deficient for PGAM5 display dopaminergic neurodegeneration and a Parkinson’s disease-like movement phenotype and suggested that this phenotype is caused by dysfunctional PINK1-mediated mitophagy. The second report describing PGAM5 as a mitophagy-inducing protein is based on its function in FUNDC1-mediated mitochondrial clearance. Chen et al. (2014) showed that PGAM5 reverses the inhibitory effect of CK2 on ↓∆ψm-induced mitophagy by dephosphorylating FUNDC1 at Ser13 and thereby enhancing its interaction with LC3. Furthermore, a model was proposed in which the anti-apoptotic Bcl-2-family member BCL2L1 (BCL2-like 1; also termed Bcl-XL) associates with

PGAM5 at the OMM in normoxic conditions to inhibit its function towards S13 phosphorylated FUNCD1. Wu et al. (2014) indicated that hypoxia-induced BCL2L1 degradation liberates PGAM5 which proceeds to promote FUNDC1-mediated mitophagy.

Figure 8 | PGAM5(∆24) triggers apoptosis by IAP antagonism (left panel) PGAM5 is an unique mitochondrial resident protein, however, its mitochondrial sublocalization remains debated. (right panel) Dissipation of ∆ψm triggers PARL-mediated PGAM5 cleavage generating the cleaved form PGAM5(∆24) that translocates to the cytoplasm and triggers apoptosis by unblocking active caspases (CASP) through IAP antagonism.

2 Aims of this study Our laboratory previously described URI1 as an addicting oncoprotein in ovarian cancer by abrogation of the PP1γ-mediated feedback program depending on its phosphorylation at S371 (Djouder et al., 2007; Theurillat et al., 2011). Based on the fact that i) phosphorylation is usually a reversible modification and ii) the previous findings that URI1 protein levels do not correlate with its S371 phosphorylation and that iii) treatment of cells with the protein phosphatase inhibitor calyculin A causes URI1 hyperphosphorylation, we hypothesized that yet to be identified protein phosphatases oppose S6K1-mediated URI1 phosphorylation. Thus, in this study we aimed to identify URI1- associated protein phosphatases and to investigate their role in URI1-driven ovarian carcinogenesis. In particular, we sought to discover protein phosphatases that catalyze dephosphorylation of URI1 at S371 to control assembly of URI1-PP1γ complexes. Importantly, deregulation of such protein phosphatases could enhance the URI1 ovarian cancer phenotype by strengthening the inhibitory binding between URI1 and PP1γ to further disable PP1γ-mediated attenuation of S6K1 survival signaling.

Moreover, we aimed to explore the mitochondrial URI1 interactome and to elucidate other yet unidentified URI1 binding partners important for its oncoprotein function in ovarian cancer.

3 Results 3.1 Prestudy: establishment of tools 3.1.1 The protein phosphatase inhibitor calyculin A triggers URI1 hyperphosphorylation We first sought to reproduce previous observations by Djouder et al. (2007) showing that treatment of cells with the protein phosphatase inhibitor calyculin A causes URI1 hyperphosphorylation. To this end, HeLa cells were treated with everolimus, a derivative of the mTOR-inhibitor rapamycin blocking S6K1 activity, alone or combined with calyculin A (Figure 9A). As reported before, the slower migrating, hyperphosphorylated URI1 species was converted into a faster migrating, un(der)phosphorylated form of URI1 upon everolimus treatment (Djouder et al., 2007). Similarly, total S6K1 migrated faster in lysates form everolimus-treated cells. Thus, the slower migrating URI1 band corresponds to phosphorylated URI1 (P-URI1) mediated by S6K1 function. Upon calyculin A treatment, we observed a conversion of the faster migrating un(der)phosphorylated form of URI1 to a presumably hyperphosphorylated URI1 species migrating even slower than P-URI1 in the control condition. Co-treatment of cells with everolimus and calyculin A resulted in URI1 species migrating again at the same rate as control cells but more P-URI1 was observed compared to the control condition. In conclusion, URI1 hyperphosphorylation induced by protein phosphatase inhibition competes with URI1 dephosphorylation caused by S6K1 inactivation. These observations suggest that the URI1 phosphorylation state is indeed dynamically regulated by yet unknown protein phosphatases opposing S6K1-mediates phosphorylation of URI1 at S371. As our laboratory previously reported PP1γ as an URI1-associated protein phosphatase, we evaluated its influence on URI1 phosphorylation. To this end, PP1γ-depleted HeLa cells were treated with everolimus alone or combined with calyculin A and protein lysates were immunoblotted for URI1 (Figure 9B). We detected a slight but not dramatic reduction of un(der)phosphorylated URI1 upon PP1γ knockdown and treatment with both drugs suggesting that this is not the (only) P-URI1 regulating protein phosphatase.

3.1.2 OVCAR-4 and OVCAR-8 are URI1-addicted ovarian cancer cells As we aimed to discover novel URI1 oncoprotein functions in ovarian carcinogenesis, ovarian cell lines with distinct URI1 features were required. Our laboratory previously established a panel of four human ovarian cancer cell lines (OCCs) of different URI1 dependency and a non-cancerous ovarian surface epithelial cell line (HOSE) (Theurillat et al., 2011). In this study, the panel was extended to the URI1-amplified and overexpressed OVCAR-4 and OVCAR-8 OCCs (Table 1). The latter ones were previously reported to

be URI1-addicted by Davis et al. (2013). To confirm their dependency on URI1, colony formation assays were performed revealing massively reduced cell survival of URI1-depleted OVCAR-4 and OVCAR-8 cells (Figure 10A-B). Thus, as for OVCAR-3 and FU-OV-1 cells, URI1 is required for the survival of OVCAR-4 and OVCAR-8 cells. Additionally, the URI1-non amplified IGROV-1 (Etemadmoghadam et al., 2013) and the URI1-amplified COV318 and ONGO-DG-1 (Cancer Cell Line Encyclopedia analysis see Supplementary Table 1 and Supplementary Figure 1) OCCs were used in this study but not characterized for their URI1 dependency. All OCCs depicted in Table 1 are of serous epithelial subtype, except for IGROV-1 and TOV-21G cells, which are of mixed epithelial and clear cell histology, respectively. The cell lines are described in more detail in Table 3.

Table 1 | Panel of human ovarian cell lines used in this study

URI1-non amplified cell lines URI1-amplified and overexpressed cell lines Ovarian surface epithelial cells: HOSE6-3 Ovarian cancer cells: Ovarian cancer cells: IGROV-1*, TOV-21G, and SKOV3 COV318*, ONCO-DG-1*, OVCAR-3, OVCAR-4*, OVCAR-8*, and FU-OV-1 * Cell lines added to the existing panel described by Theurillat et al. (2011).

Figure 9 | The protein phosphatase inhibitor calyculin A triggers URI1 hyperphosphorylation (A) HeLa cells were treated with 100 nM everolimus (Ever) O/N (overnight), exposed to 30 nM calyculin A (Caly) for 15 min, and the lysates were immunoblotted for the indicated proteins. (B) HeLa cells were transfected with siRNA targeting PP1γ (siPP1γ(6)) or the control siRNA (siCtr), treated with 100 nM everolimus O/N, exposed to 30 nM calculin A for 15 min, and the lysates were immunoblotted for the indicated proteins.

Figure 10 | URI1 is required for the survival of OVCAR-4 and OVCAR-8 cells (A) Colony formation assay and (B) immunoblotting of OVCAR-4 and OVCAR-8 cells with URI1 depletion by a lentiviral construct (shURI1(2)) or the control construct (shCtr).

3.2 Mass spectrometry-based analysis of the mitochondrial URI1 interactome To explore the mitochondrial URI1 interactome and to identify potential URI1-associated protein phosphatases, a URI1-Co-Immunopreciptitation (Co-IP) was performed in the mitochondrial fraction of URI1-addicted OVCAR-3 cells and analyzed by mass spectrometry (MS). To this end, mitochondria were isolated from OVCAR-3 cells and purity of the subcellular fractionation was verified by immunoblotting for specific markers (Figure 11A-B). Control IgG and URI1 antibody were crosslinked to Sepharose beads and the reaction efficiency was demonstrated by silver staining (Figure 11C). The antibody-beads complexes were used for IgG and URI1 Co-IP in the mitochondrial lysate of OVCAR-3 cells. Samples were taken during different steps of the procedure (Figure 11D-E) verifying that URI1 was depleted from the input lysate, pulled down and eluted by URI1-crosslinked Sepharose beads specifically but not the IgG control.

The IgG and URI1-Co-IP samples were analyzed by MS by Dr. Simon Hauri1. In total, 165 URI1 interactors were detected (Supplementary Table 3) including the URI1 complex components STAP1, PDRG1, PFD2, and PFD6. As expected, no other prefoldins were detected which further demonstrates that although the URI1 and prefoldin complex have PFD2 and PFD6 in common, they exist as independent structures (Gstaiger et al., 2003). As reported before, URI1 was detected to interact with the R2TP complex members RVB1, RVB2, PIHD1, RPAP3, HSP90, and WDR92 (Boulon et al., 2010; Gstaiger et al., 2003; Mita et al., 2013). Other already known URI1 binding partners were found including RPB5 and PP1γ (Djouder et al., 2007; Dorjsuren et al., 1998).

Analysis of the 165 obtained proteins by Dr. Yann Christinat using the g:Profiler and DAVID database revealed no enrichment for general biological pathways (data not shown). However, apart from PP1γ, three other protein phosphatases were detected namely PP1α (protein phosphatase 1 alpha), PGAM5, and TIM50 (mitochondrial import inner membrane translocase subunit 50), a subunit of the TIM23 complex (Table 2) (Yamamoto et al., 2002). The latter was found to possess intrinsic dual-specific phosphatase activity (Duncan et al., 2013; Guo et al., 2004). However, due to its low spectral counts detected in this study, TIM50 was not further followed up. Most strikingly, in addition to PGAM5 and TIM50, other components of the mitochondrial quality machinery have been found to interact with URI1 namely Mfn2 and the IMS protein STOML2 (stomatin-like protein 2) (Table 2). The latter ones were previously proposed to interact with each other (Hajek et al., 2007).

1 Group of Dr. Matthias Gstaiger, Institute of Molecular Systems Biology, ETH Zurich 41

Table 2 | Novel mitochondrial URI1 interactors discovered in this study

Symbol Full name Ratio1 Spectral counts IgG Spectral counts URI1 Mfn2 mitofusin 2 100 0 25 phosphoglycerate mutase family PGAM5 5 3 15 member 5 PP1α protein phosphatase 1 alpha 100 0 20 STOML2 stomatin-like protein 2 28 4 112 mitochondrial import inner TIM50 100 0 2 membrane translocase subunit 50 1Ratio of spectral counts detected in the URI1 pulldown to spectral counts detected in the IgG pulldown

Figure 11 | Sample preparation for MS-based analysis of mitochondrial URI1-Co-IP in OVCAR-3 cells (A) OVCAR-3 cells were factionated and immunoblotted for markers specific to the cytoplasmic (cyt, β-actin), nuclear (nuc, Lamin A) and mitochondrial (mit, Porin) fraction (B) Ponceau staining corresponding to the immunoblot shown in Figure A verifying even loading of all fractions. (C) Silver staining of IgG and URI1 antibodies before and after crosslinking to Sepharose beads. Crosslinking successfully prevented release of heavy and light IgG chains from antibodies incubated with Sepharose beads after boiling at 95°C. (D) URI1 immunoblotting of input lysate (LYS), depleted lysates (DEPL), eluted beads (BEAD), and eluates (ELU) of IgG and URI1 pulldown in the mitochondrial fraction of OVCAR-3 cells. (E) Silver staining of eluted beads (BEAD) and eluates (ELU) of IgG and URI1 pulldown in the mitochondrial fraction of OVCAR-3 cells.

3.3 siRNA-based screen to identify Ser/Thr protein phosphatases regulating URI1 To identify protein phosphatases regulating URI1 by dephosphorylation at Ser-371, a small interfering RNA (siRNA) screen for catalytic subunits of Ser/Thr and dual-specific phosphatases was performed. To this end, HeLa cells were depleted of single proteins by pooled siRNAs, treated with DMSO (dimethyl sulfoxide) or 100 nM everolimus overnight (O/N) and analyzed by URI1 immunoblotting (Supplementary Figure 2-3). We analyzed knockdown levels of three proteins of which the corresponding antibodies were available in our laboratory by immunoblotting illustrating siRNA transfection efficiency achieved in our setting (Supplementary Figure 4). Knockdown of protein phosphatases leading to URI1 hyperphosphorylation in control and everolimus-treated cells were defined as positive hits. These hits were reevaluated in a second siRNA screening round for reproducibility. In conclusion, PP1α, which has already been identified to be a physical URI1 interactor (see 3.2) and DUSP19 (dual-specificity phosphatase 19) were identified to negatively regulate phospho-URI1 in control and everolimus-treated cells (Figure 12A-C).

Figure 12 | PP1α and DUSP19 negatively regulate URI1 phosphorylation in control and everolimus-treated cells HeLa cells were transfected with 50 and 100 nM pooled siRNAs targeting (A) DUSP19 (siDUSP19) and (B) PP1α (siPP1α) or control siRNA (siGFP), treated with 100 nM everolimus (Ever) O/N, and the lysates were immunoblotted for URI1. (C) Knockdown efficiency was verified by quantitative RT-PCR (qRT-PCR) and mRNA expresssion levels were normalized to HMBS.

3.4 Regulation of URI1 function by the protein phosphatase PP1α 3.4.1 PP1α interacts with URI1-PP1γ in a heterotrimeric complex in a P-URI1 S371-dependent manner Based on the identification of PP1α as an overlapping hit in the MS and siRNA-based URI1 analysis (Table 2 and Figure 12), we performed a functional analysis of this protein phosphatase. To confirm that PP1α physically interacts with URI1, endogenous URI1 was immunoprecipitated from OVCAR-3 cells and the sample was immunoblotted for PP1α (Figure 13A). Additionally, the reciprocal Co-IP was performed in HeLa cells (Figure 13B). In both experiments PP1α and URI1 co- precipitated. Thus, URI1 and PP1α interact with each other at the endogenous level. As PP1α and PP1γ share 91% amino acid homology, we speculated that PP1α might bind to the same

C-terminal URI1357-420 fragment as PP1γ (Djouder et al., 2007). In an in vitro binding assay, GST- purified URI1357-420 was incubated with in vitro translated (IVT), radiolabeled PP1α and PP1γ. Indeed, both PP1 isoforms were detected in the GST-URI1357-420 pulldown but not in the GST control, confirming that these phosphatases share the same URI-binding site (Figure 13C).

As the URI1357-420 fragment encompasses residue S371, we explored if PP1α binding to URI1 depends on phosphorylation at Ser-371 as it was previously shown for PP1α (Djouder et al., 2007). To this end, both phosphatases were immunoprecipitated from serum starved and rhIGF-1 (recombinant human insulin-like growth factor 1)-stimulated HeLa cells to investigate their binding to unphosphorylated and phosphorylated URI1, respectively. Immunoblotting confirmed that both PP1 isoforms were pulled-down specifically by the corresponding antibody (Figure 13D-E). As described by Djouder et al. (2007), URI1-PP1γ complexes were drastically reduced in IGF-1 restimulated cells compared to the serum starved condition. Similarly, URI1-associated PP1α decreased upon IGF-1 restimulation. Given the above results, and the fact that the kinetics of URI1 phosphorylation matched that of URI1-PP1α complex formation, we speculate that URI1-PP1α interaction might be S371-depedent, as previously described for PP1γ. To investigate the subcellular distribution of URI-PP1 complexes, the nuclear, cytoplasmic, and mitochondrial fractions of HeLa cells were subjected to PP1α and PP1γ-IPs (Figure 13F-G). Quantification of PP1α- and PP1γ-associated URI1 showed that the main fraction of both complexes is localized to the cytoplasm (~70-80%) and the remaining detected at mitochondria (~17-27%). Only ~1% of URI1-PP1 complexes were nuclear. As URI1-PP1α and URI1-PP1γ complexes exhibit a similar subcellular pattern, we hypothesized that URI1 may exist in a heterotrimeric complex with both phosphatases. In this regard, a double immunoprecipitation was performed by sequential PP1α and PP1γ pulldown. Indeed, URI1 was found in the final sample confirming that PP1α and PP1γ exist in the same URI1 complex (Figure 13H).

Figure 13 | PP1α interacts with URI1-PP1γ in a heterotrimeric complex independent of P-URI1 S371 (A) OVCAR-3 cell lysates were subjected to IgG or URI1-IP and immunoblotted for PP1α. The whole cell extract (WCE) was directly processed for immunoblotting to serve as an input control. (B) HeLa cell lysates were subjected to

IgG or PP1α-IP and immunoblotted for URI1. (C) Purified GST alone or tagged to the fragment URI1357-420 was incubated with IVT, 35S-Methionine labeled PP1α or PP1γ and subjected to autoradiography (upper panel). Prior to that, the gel was stained with Coomassie Blue to ensure equal loading (lower panel). (D) HeLa cells were serum starved (0% FCS) O/N and stimulated with 100 ng/mL rhIGF-1 for indicated times, subjected to IgG, PP1α, or PP1γ- IP and immunoblotted for URI1 (left panel). The corresponding input lysates were immunoblotted for the indicated proteins (right panel). (E) Quantification of Panel D (left) normalized to the corresponding serum starved (0 min rhIGF-1) time point. (F) HeLa cells were fractionated and the obtained cytoplasmic (cyt), nuclear (nuc), and mitochondrial (mit) fractions were subjected to IgG, PP1α, or PP1γ- IP and immunoblotted for URI1 (left panel). The input lysates were immunoblotted for markers specific to the cytoplasmic (β-actin), nuclear (Lamin A), and mitochondrial (VDAC) fraction (right panel). (G) Quantification of Panel F (left). (H) HeLa cells were subjected to sequential PP1α and PP1γ-IP or the control IgG and immunoblotted for URI1.

3.4.2 PP1α and PP1γ co-regulate URI1 phosphorylation in HeLa cells As we detected an increase of URI1 phosphorylation upon PP1α depletion in the siRNA-based screen, we studied the role of this phosphatase in the regulation of URI1 phosphorylation further. Since PP1α, PP1β, and PP1γ proteins are over 90% identical, all isoforms of the catalytic PP1 subunit were included into our analysis. We performed single PP1α, PP1β, and PP1γ knockdown in HeLa cells (Figure 14A) and analyzed the URI1 phosphorylation state. Immunoblotting for PP1α, PP1β, and PP1γ confirmed that these proteins were targeted by the corresponding siRNA with very high specificity. Unexpectedly, PP1α knockdown did not trigger URI1 hyperphosphorylation in HeLa cells, which were previously applied for the siRNA screen. Additionally, the URI1 phosphorylation state was unaffected by PP1β or PP1γ depletion. As in our screen PP1α depletion was carried out by pooled siPP1α(9) and siPP1α(10), we performed an immunoblotting analysis in HeLa cells transfected with single siRNAs (Supplementary Figure 5). We observed that siPP1α(9) caused a PP1α and PP1γ double knockdown whereas siPP1α(10) targeted PP1α specifically. Intriguingly, URI1 hyperphosphorylation was only detected in cells transfected with siPP1α(9) suggesting that both PP1 isoforms are required to regulate P-URI1 in HeLa cells. Indeed, PP1α/PP1γ but not PP1β/PP1γ double depletion performed by a combination of specific siRNAs triggered URI1 hyperphosphorylation (Figure 14A). Furthermore, co-depletion of both PP1 isoforms but not a single PP1α or PP1γ knockdown led to sustained URI1 hyperphosphorylation in serum starved or everolimus-treated cells (Figure 14B-D). In conclusion, PP1α/PP1γ and the mTOR-S6K1 axis oppose each other to dynamically regulate the URI1 phosphorylation state in HeLa cells.

Figure 14 | PP1α and PP1γ oppose URI1 phosphorylation mediated by the mTOR-S6K1 axis in HeLa cells (A) HeLa cells were transfected with single or combined siRNAs targeting PP1α (siPP1α(10)), PP1β (siPP1β(5+ 6)), and PP1γ (siPP1γ(6)), or the control siRNA (siCtr) and the lysates were immunoblotted for URI1. (B) HeLa cells were transfected with siPP1α(10), siPP1γ(6), or siCtr, serum starved (SS) with 0% FCS for 0-8h, and the lysates were immunoblotted for URI1. (C) HeLa cells were co-transfected with siPP1α(10) and siPP1γ(6) or siCtr, serum starved (SS) for 0-8h, and the lysates were immunoblotted for URI1. (D) HeLa cells were transfected with single or combined siPP1α(10) and siPP1γ(6) or siCtr, treated with 100 nM everolimus O/N, and the lysates were immunoblotted for URI1.

3.4.3 PP1α induces URI1 hyperphosphorylation but not URI1-PP1γ dissociation in URI1-amplified OVCAR-3 cells We next sought to investigate the PP1α function in the context of ovarian cancer where URI1 acts as a driving oncoprotein. To this end, URI1-amplified OVCAR-3 cells were subjected to URI1 knockdown and their lysates immunoblotted for PP1α (Figure 15A-B). Interestingly, PP1α protein levels dropped in URI1-depleted OVCAR-3 cells, which was also observed for HeLa cells and the human osteosarcoma cell line U2OS (Figure 15C-D). However, PP1α levels were not elevated in ectopically URI1-overexpressing HeLa cells compared to the control condition (Figure 15E). In line with this observation, we detected no correlation of PP1α nor PP1γ protein levels with URI1 in different OCCs (Figure 15F). Thus, basal PP1α protein levels require URI1 for stabilization; however, URI1 overexpression is not linked to elevated PP1α levels. We next tested whether PP1α controls phosphorylation of URI1 in ovarian cancer. To this end, the URI1-addicted OCCs FU-OV-1, OVCAR-3, and OVCAR-8 were depleted of the isoforms of the catalytic PP1 subunit. We detected URI1 hyperphosphorylation in PP1α, but not PP1β or PP1γ- depleted OVCAR-3 cells (Figure 16A). However, URI1 phosphorylation state was unaffected in FU-OV-1 and OVCAR-8 cells in any condition (data not shown). We could exclude RNAi off-target effects by reexpression of an siRNA-resistant PP1α (mutPP1α) that escapes RNAi showing that URI1 hyperphosphorylation is specifically induced by PP1α depletion in OVCAR-3 cells (Figure 16B). Supporting the hypothesis that PP1α controls P-URI1 in OVCAR-3 cells, mutPP1α overexpression led to enhanced URI1 dephosphorylation in the control cells. The above results raised the possibility that PP1α regulates URI1-PP1γ complexes by dephosphorylation of P-URI1 S371. To test this hypothesis, PP1α-depleted OVCAR-3 lysates were subjected to PP1γ-IP and immunoblotted for URI1 (Figure 16C). However, we detected no changes in URI1-associated PP1γ in OVCAR-3 nor in OVCAR-8 cells (Figure 16D). Given that is has been previously shown that S371 phosphorylation regulates URI1-PP1γ complexes, we consider it unlikely for PP1α to dephosphorylate URI1 at S371.

Figure 15 | URI1 function is required for stabilization of basal PP1α levels (A) OVCAR-3 cells were depleted of URI1 by a lentiviral construct (shURI1(1)) and the control vector (shCtr) or the corresponding doxycycline-inducible constructs (B) (shURI1(2)-teton and shCtr-teton, respectively) and the lysates were immunoblotted for the indicated proteins. (C) HeLa and USO2 (D) cells were transfected with pooled siRNA targeting URI1 (siURI1) or the control siRNA (siCtr), and the lysates were immunoblotted for the indicated proteins. (E) HeLa cells were transiently overexpressed with URI1 or the control vector and the lysates were immunoblotted for the indicated proteins. (F) Lysates of ovarian cancer cells with different URI1 levels and the non-cancerous HOSE cell lines were immunoblotted for the indicated proteins.

Figure 16 | PP1α leads to URI1 hyperphosphorylation in OVCAR-3 cells but does not influence URI1-PP1γ complexes (A) OVCAR-3 cells were transfected with siRNAs targeting PP1α (siPP1α(10)), PP1β (siPP1β(5+6)), and PP1γ (siPP1γ(6)) or the control siRNA (siCtr) and the lysates were immunoblotted for URI1. (B) OVCAR-3 cells were transfected with siCtr or siPP1α(10), transiently overexpressed with mutPPP1α or the control vector, and immunoblotted for URI1. (C) OVCAR-3 and (D) OVCAR-8 cells were transfected with siPP1α(10) or siCtr, subjected to IgG or PP1γ-IP and immunoblotted for URI1 (left panel). The corresponding input lysates were immmunoblotted for the indicated proteins (right panel).

3.5 Regulation of the PGAM5-based mitochondrial apoptotic pathway by URI1 3.5.1 URI1 endogenously interacts with Mfn2, STOML2, and PGAM5 independent of its phosphorylation at S371 As we found URI1 to interact with proteins of the mitochondrial quality control machinery (see Table 2), we set off to study its oncogenic function in this context in human ovarian cancer. To confirm that Mfn2, PGAM5, and STOML2 physically interact with URI1 as suggested by the MS- based approach, endogenous URI1 was immunoprecipitated and the samples were immunoblotted for the corresponding proteins (Figure 17A). To analyze PGAM5, we generated a polyclonal rabbit antibody against the full-length protein. In addition to URI1 pulldown, reciprocal Co-IPs were performed and URI1 was detected in all samples (Figure 17B). Thus, URI1 endogenously interacts with Mfn2, PGAM5, and STOML2. Based on the fact that URI1 is detected at the mitochondrial surface but in contrast to the OMM anchored proteins PGAM5 and STOML2 lacks an MTS (Djouder et al., 2007), it was tempting to consider that these proteins target URI1 to mitochondria. To this end, HeLa and OVCAR-3 cells were depleted of PGAM5 and Mfn2, respectively and the mitochondrial fractions were isolated (Figure 17C). URI1 levels accessed by immunoblotting analysis remained unchanged in all conditions implying that URI1’s mitochondrial localization is independent of PGAM5 and STOML2. As previous experiments indicated that PP1α, in addition to PP1γ, is the second protein phosphatase that binds URI1 depending on its phosphorylation at S371 (Figure 13D-E), we investigated whether URI1-PGAM5 complexes are similarly regulated. To this end, HeLa cells were stimulated with rhIGF-1 triggering S6K1-mediated phosphorylation of URI1 at S371 (Djouder et al., 2007) and URI1 was immunoprecipitated from these cells (Figure 17D). Intriguingly, URI1-PGAM5 complexes remained unchanged suggesting that PGAM5 interacts with URI1 independent of its phosphorylation at S371. Additionally, P-URI1 levels remained unchanged upon PGAM5 depletion (Figure 17E) in untreated and everolimus-exposed cells suggesting that this phosphatase does not influence URI1 phosphorylation in contrast to PP1α and PP1γ (Figure 14).

Figure 17 | URI1 endogenously interacts with Mfn2, STOML2, and the atypical phosphatase PGAM5 independent of its phosphorylation at S371 (A) OVCAR-3 (Mfn2 and PGAM5) and OVCAR-8 (STOML2) cells were subjected to IgG or URI1-IP and immunoblotted for the corresponding proteins. The whole cell extract (WCE) was directly processed for immunoblotting to serve as an input control. (B) OVCAR-4, 293T, and OVCAR-8 cells were subjected to Mfn2, PGAM5, and STOML2-IP respectively or the corresponding IgG-IP, and immunoblotted for URI1. (C) HeLa (left panel) and OVCAR-8 (right panel) cells were transfected with siRNA targeting PGAM5 (siPGAM5(2)), Mfn2 (siMfn2(6)), or the control siRNA (siCtr) and mitochondria were isolated by subcellular fractionation and immunoblotted for URI1. (D) (left panel) HeLa cells were treated with 100 ng/mL rhIGF-1 for 1-4h, subjected to IgG or URI1-IP, and immunoblotted for PGAM5. (right panel) P-S6K1 T-389 immunoblotting analysis of corresponding input lysates. (E) HeLa cells were transfected with siPGAM5(2) or siCtr, treated with 100 nM everolimus (Ever) O/N, and the lysates were immoblotted for URI1.

3.5.2 URI1 protects PGAM5 from PARL-mediated cleavage We next analyzed Mfn2, PGAM5, and STOML2 protein levels in an OCC panel with different URI1 levels and in a non-cancerous ovarian cell line. As these proteins have been described to function in mitochondrial quality control, the cells were exposed to the ionophore CCCP that dissipates the mitochondrial membrane potential ∆ψm leading to the well-established stabilization of PINK1 (Narendra et al., 2010), except for FU-OV-1 cells where PINK1 was not detected (Figure 18A). As described before, CCCP triggered PGAM5 cleavage generating a faster migrating cleaved form termed PGAM5(∆24) (Sekine et al., 2012; Zhuang et al., 2013). In agreement with Sekine et al. (2012), PGAM5(∆24) detected by our homemade antibody corresponded to PARL-mediated processing of PGAM5 in response to CCCP exposure as it was rescued by PARL depletion (Figure 18B). In our setting, Mfn2 and STOML2 levels remained unchanged upon CCCP treatment in all cell lines. However, immunoblotting for PGAM5 revealed that its CCCP-induced cleavage was enhanced in URI1-non amplified OCCs compared to URI1-amplified OCCs. Since URI1 levels inversely correlate with CCCP-induced PGAM5(Δ24) generation, it raises the possibility that URI1 is a key regulator of PGAM5 stability. To investigate this hypothesis, CCCP-triggered PGAM5 cleavage was analyzed over time in URI1- depleted OCCs and a non-cancerous ovarian cell line (Figure 18C-G). Importantly, URI1 knockdown greatly enhanced PGAM5(Δ24) generation in untreated and CCCP-exposed ovarian (cancer) cells independent of their URI1 status, except for SKOV3 cells, which appeared to be more resistant to CCCP-induced PGAM5(∆24) generation. Both forms of PGAM5 slightly accumulated over time in URI1-amplified cell lines exposed to CCCP. Intriguingly, this effect was also observed upon URI1 overexpression in the URI1-non amplified OCC TOV-21G (Figure 18H). Thus, URI1 is a general protector of PGAM5 stability and promotes its accumulation in URI1-addicted OCCs upon dissipation of ∆ψm.

Figure 18 | URI1 protects PGAM5 from PARL-mediated cleavage in ovarian cells (A) OVCAR-3 cells were transfected with siRNA targeting PARL (siPARL(1), siPARL(2)) or the control siRNA (siCtr), treated with 10 µM CCCP for 2h, and lysates were immunoblotted for PGAM5. (B) Immunoblotting analysis of Mfn2, PGAM5, and STOML2 in a panel of URI1-non amplified (HOSE6-3, TOV-21G, and SKOV3) and URI1- amplified (OVCAR-8, OVCAR-4, and FU-OV-1) OCCs treated with 20 µM CCCP for 20 or 60 min. (C-G) 20 µM CCCP timecourse (0-90 min) in URI1-non amplified (C) HOSE6-3, (D) TOV-21G, (E) SKOV3, and URI1-amplified (F) OVCAR-4, and (G) FU-OV-1 cells under URI1 depletion by a lentiviral construct (shURI1(2)) or the control vector (shCtr) and immunoblotting analysis of the lysates for the indicated proteins (H) 20 µM CCCP timecourse (0- 90 min) in URI1-non amplified TOV-21G cells transiently overexpressed with URI1 or the control vector and immunoblotting analysis of the lysates for the indicated proteins. 54

3.5.3 URI1 depletion sensitizes to CCCP-induced apoptosis by releasing PGAM5(∆24) to the cytoplasm As PGAM5Δ24 was reported to be mainly localized to the cytoplasm (Zhuang et al., 2013), the subcellular distribution of PGAM5 was studied under URI1 knockdown and CCCP treatment. PGAM5 was immunoblotted in the mitochondrial and cytoplasmic fraction of URI1-non amplified SKOV3 and URI1-amplified OVCAR-4 cells. As expected, CCCP triggered PGAM5 cleavage at mitochondria in both control and URI1-depleted SKOV3 cells (Figure 19A). However, no dramatic increase of PGAM5(Δ24) translocation to the cytoplasm was detected in any condition. Intriguingly, URI1 knockdown by itself massively triggered PGAM5 cleavage and its translocation to the cytoplasm in OVCAR-4 cells and this effect was enhanced by CCCP treatment (Figure 19B). Together with PGAM5(∆24) cytoplasmic translocation, XIAP levels decreased as reported before likely by self-ubiquitination (Zhuang et al., 2013) which was not observed in SKOV3 cells. In OVCAR-4 control cells, CCCP induced PGAM5 accumulation at mitochondria. As Zhuang et al. (2013) reported cytoplasmic PGAM5(∆24) to cause apoptosis by IAP inhibition, we analyzed cell survival of URI1-depleted OCCs under prolonged CCCP exposure. URI1-non amplified and URI1-amplified OCCs were stained with combined Annexin V/propidium iodide (PI) and immunoblotted for PARP cleavage under URI1 knockdown (Figure 19C-I). In agreement with previous studies reporting an apoptotic effect of CCCP in different cell types (Charan et al., 2014; de Graaf et al., 2004; Sayeed et al., 2010), we detected increased apoptosis in all CCCP-treated ovarian cell lines, except for SKOV3, which again appeared to be more resistant. Strikingly, URI1 depletion significantly augmented CCCP-triggered apoptosis in all cell lines analyzed whereas this effect was less pronounced in SKOV3 cells. In summary, we demonstrated that URI1 depletion sensitizes ovarian cells to CCCP-induced apoptosis independent of their URI1 amplification status and further suggest that URI1’s protective function is mediated by retaining PGAM5(∆24) at mitochondria to prevent XIAP self-degradation.

Figure 19 | URI1 depletion sensitizes to CCCP-induced apoptosis by releasing PGAM5(∆24) to the cytoplasm Immunoblotting analysis of the mitochondrial (left panel) and cytoplasmic (middle panel) fraction and comparison of both (right panel) in SKOV3 (A) and OVCAR-4 (B) cells under URI1 knockdown by a lentiviral construct (shURI1(2)) treated with 20 µM CCCP for 1h. (C) Annexin V/PI staining in URI1-non amplified HOSE6-3, TOV- 21G, and SKOV3 cells and URI1-amplified OVCAR-3, OVCAR-4, and OVCAR-8 cells under URI1 depletion by a lentiviral construct (shURI1(2)) or the control vector (shCtr) treated with 10 µM CCCP O/N. The analysis was performed in triplicates and the values were normalized to the corresponding shCtr DMSO sample. Error bars indicate mean ± SD. Statistical significance was determined by one-way ANOVA and Dunnett correction for multiple testing (ns= not statistically significant, **P = 0.0006, ***P<0.0001). Significance indicated in the graph corresponds to the shURI1(2) CCCP sample compared to the corresponding shCtr CCCP sample. (D-I) Immunoblotting analysis corresponding to Figure (C). 56

3.5.4 Apoptosis caused by URI1 depletion is caspase- and PGAM5- dependent The above outlined findings imply that enhanced survival in CCCP-treated ovarian cells is mediated by sustained IAP signaling and subsequent caspase inhibition. To investigate this hypothesis, apoptosis was analyzed by combined Annexin V/PI staining and immunoblotting for PARP cleavage in URI1-addicted OVCAR-8 cells under URI1 knockdown and CCCP-treatment combined with the pan-caspase inhibitor zVAD-FMK (Figure 20A-C). Indeed, caspase inhibition completely rescued CCCP-triggered apoptosis under URI1 knockdown. Similarly, CCCP-induced loss of cell viability assessed in a PrestoBlue® assay was rescued by zVAD-FMK in URI1-depleted OVCAR-8 cells with different CCCP concentrations (Figure 20D). URI1 knockdown did not cause apoptosis in untreated cells although we and others previously proved URI1-dependency of this cell line (Figure 10) (Davis et al., 2013). However, we detected a 50% reduction in cell viability in URI1-depleted OVCAR-8 cells by PrestoBlue® assay (Figure 20D) suggesting that apoptosis is likely to occur at later time points compared to our experimental setting. In summary, CCCP-induced apoptosis caused by URI1 knockdown in OVCAR-8 cells is caspase-dependent. To further test whether PGAM5(∆24) generation and its cytoplasmic translocation is the driving force of apoptosis detected in our setting, we analyzed OVCAR-4 cells under both URI1 and PGAM5 depletion. Strikingly, we were able to partially rescue apoptosis caused by URI1 knockdown by PGAM5 co-depletion (Figure 21A-B). Conversely, rescue of apoptosis under URI1 depletion and CCCP treatment through PGAM5 knockdown was marginal in OVCAR-4 cells suggesting that these cells exhibit an unexpected PGAM5-dependency under CCCP exposure. We therefore analyzed apoptosis by combined Annexin V/PI staining in PGAM5-depleted URI1-non amplified and URI1- amplified OCCs (Figure 21C-G). As observed before, CCCP triggered a slight increase in apoptosis in control cells except for SKOV3 cells. Intriguingly, PGAM5 knockdown caused apoptosis only in URI1-addicted cell lines under CCCP exposure. Thus, URI1-amplified ovarian cancer cell lines depend on PGAM5 for their survival under mitochondrial stress conditions.

Figure 20 | CCCP-induced apoptosis caused by URI1 depletion in URI1-amplified OVCAR-8 cells is caspase- dependent (A) OVCAR-8 cells with doxycycline-inducible URI1 knockdown (shURI1(2)-teton) or the control construct (shCtr- teton) were treated with 10 µm CCCP ± 100 µm zVAD-FMK O/N and apoptosis was analyzed by Annexin V/PI staining in triplicates and the values were normalized to the shCtr-teton DMSO sample. Error bars indicate mean ± SD. Statistical significance was determined by one-way ANOVA and Dunnett correction for multiple testing (***P<0.0001). (B) Immunoblotting analysis corresponding to Panel A. (C) Representative images of FACS analysis corresponding to Panel A. (D) The cells were treated with 1.25-10 µM CCCP ± 100 µM zVAD-FMK O/N and cell viability was analyzed by PrestoBlue® assay in sextuplicates and the values were normalized to the shCtr-teton DMSO sample. Error bars indicate mean ± SD. Statistical significance was determined as described above. 58

Figure 21 | Depending on CCCP, PGAM5’s function is both pro- and anti-apoptotic in URI1-amplified OVCAR-4 cells (A) OVCAR-4 cells were transfected with single or combined siRNAs targeting PGAM5 (siPGAM5(3)) and URI1 (siURI1(2)) or the control siRNA (siCtr), treated with 10 µM CCCP O/N, and analyzed by Annexin/PI staining. The analysis was performed in triplicates and the values were normalized to the corresponding siCtr DMSO sample. Error bars indicate mean ± SD. Statistical significance was determined by one-way ANOVA and Dunnett correction for multiple testing (**P = 0.004, ***P<0.0001). (B) Immunoblotting analysis corresponding to Panel A. (C) URI1-non amplified TOV-21G and SKOV3 as well as URI1-amplified OVCAR-4 and OVCAR-3 cells were transfected with siCtr or siPGAM5(3), treated with 10 µM CCCP O/N, and analyzed by Annexin V/PI staining. The analysis was performed in triplicates and the values were normalized to the corresponding siCtr DMSO sample. Statistical significance was determined as indicated above (ns= not statistically significant, ***P<0.0001). Significance indicated in the graph corresponds to the siPGAM5(3) CCCP sample compared to the corresponding siCtr CCCP sample. (D-G) Immunoblotting analysis corresponding to Panel C.

3.6 Is URI1 a driver of mitophagy? In this study, we demonstrated that URI1 prevents mitochondrial stress-induced apoptosis by protecting PGAM5 from CCCP-induced cleavage and its translocation to the cytoplasm in ovarian (cancer) cells lines independent of their URI1 amplification status. Unexpectedly, we found that URI1- amplified OCCs are at the same time dependent on PGAM5 for their survival in the context of CCCP, suggesting that this atypical protein phosphatase also exhibits antiapoptotic functions apart from its role in cell death by IAP inhibition. Only very recently, PGAM5 was found to be crucial for the removal of damaged mitochondria by both PINK1- and FUNDC1-mediated mitophagy (Chen et al., 2014; Lu et al., 2014). Also in our system, PGAM5 depletion prevented CCCP-induced Mfn2 degradation (Figure 22A). Furthermore, we detected Mfn2 in the mitochondrial URI1 interactome (Table 2), a mitochondrial receptor to which Parkin translocates upon PINK1-mediated phosphorylation to initiate engulfment of damaged organelles (Chen and Dorn, 2013). Hence, we sought to study the role of URI1 in PINK1-driven mitophagy. Parkin was transiently overexpressed in URI1-amplified OVCAR-8 cells. As established previously,

CCCP treatment induced ↓∆ψm-mediated PINK1 stabilization at the OMM and Parkin-dependent degradation of mitochondrial proteins (Figure 22B) (Narendra et al., 2010; Sarraf et al., 2013). According to other studies, CCCP triggered decrease of Parkin levels by autoubiquitination and accumulation of the key autophagosomal marker LC3B-II, the cleaved and lipidated form of LC3B (Chaugule et al., 2011; Narendra et al., 2008). Strikingly, URI1 depletion inhibited CCCP-induced Parkin and TOM20 (mitochondrial import receptor subunit 20) degradation, two markers that are routinely used to assess mitophagy. Additionally, CCCP-dependent PINK1 accumulation was less pronounced in URI1-depleted cells. As Lu et al. (2014) reported PGAM5 to be required for PINK1 accumulation at the OMM, our findings could point towards a role of URI1 in PGAM5-mediated mitophagy. However, degradation of other proteins analyzed in Figure 22B was not affected by URI1 depletion. To test whether URI1 interferes with mitochondrial Parkin translocation, we applied a fluorescence- based approach with transiently overexpressed Parkin fused to yellow fluorescent protein (YFP) in OVCAR-8 cells. Efficiency of URI1 knockdown was confirmed by immunoblotting analysis (Supplementary Figure 6). Consistent with the literature, Parkin was diffusely expressed in the cytoplasm of untreated cells and translocated to the mitochondrial marker TOM20 upon CCCP exposure of control cells, leading to perinuclear clustering (Figure 22C) (Vives-Bauza et al., 2010). Intriguingly, this effect appeared to be delayed or less prominent in URI1-depleted cells with the same technical settings. Furthermore, only in these cells did CCCP trigger accumulation of TOM20- negative YFP-Parkin aggregates. As reported before, mitochondrial fragmentation was detected in all CCCP treated cells (Otera et al., 2010).

Given the above results, we speculate that URI1 is a mitophagic driver in the PINK1/Parkin pathway where it appears to be required for efficient Parkin translocation as well as self- and TOM20 degradation.

Figure 22 | URI1 as a potential driver of PINK1/Parkin-mediated mitophagy (A) OVCAR-3 cells were transfected with siRNA targeting PGAM5 (siPGAM5(3)) or the control siRNA (siCtr), treated with 10 µM for 2h and their lysates were immunoblotted for Mnf2. (B) HA-tagged Parkin was transiently overexpressed in OVCAR-8 cells with doxycycline-inducible URI1 knockdown (shURI1(2)-teton) or the control construct (shCtr-teton), treated with 20 µM CCCP for 0.5-6h and immunoblotted for the outer mitochondrial membrane (OMM) proteins PINK1, Parkin, Mfn2, and TOM20, the inner mitochondrial membrane (IMM) protein TIM50, and the mitochondrial matrix (Matrix) protein TRAP1 (tumor necrosis factor receptor-associated protein 1) as well as the cleavaged and lipidated form of LC3B, LC3B-II.

Figure 23 | Fluorescence-based analysis of URI1-depleted OVCAR-8 cells transiently overexpressing YFP- Parkin Representative pictures of OVCAR-8 cells with (A) the control construct (shCtr-teton) or (B) doxycycline-inducible URI1 knockdown (shURI1(2)-teton) transiently overexpressed with YFP-Parkin (green), immunostained for TOM20 (red) and DAPI (blue), and treated with DMSO or 20 µM CCCP for 6 and 10h. Confocal images were taken with a confocal laser scanning microscope (Leica SP2 FCS) at 63x magnification. Overlay images are presented in the third column. Higher magnification views of the boxed areas are shown in the insets. 63

4 Discussion Our laboratory previously presented that URI1, an unconventional member of the prefoldin family of chaperones, is an addicting oncoprotein in ovarian cancer by constitutively detaining PP1γ in inactive complexes depending on its phosphorylation at S371 (Djouder et al., 2007; Theurillat et al., 2011). However, existing evidence suggest that additional, yet to be elucidated mechanisms may contribute to URI1-driven suppression of apoptosis in ovarian carcinogenesis. Here we explored the URI1 interactome to discover novel URI1 binding partners and to elucidate their role in ovarian cancer. Since URI1 is as member of the URI1/R2TP complex (Boulon et al., 2010; Gstaiger et al., 2003; Mita et al., 2013), we detected all known members of this multiprotein complex, supporting the specificity and robustness of the MS-based approach that has been used in this study. Here we present PP1α and PGAM5 as two novel URI1-associated proteins and suggest that URI1 may serve as a platform for different protein phosphatases.

4.1 PP1α, a potential phospho-URI1 regulating enzyme Based on previous observations that i) treatment of cells with the protein phosphatase inhibitor calyculin A causes URI1 hyperphosphorylation as well as that ii) URI1 protein upregulation and its S371 phosphorylation are uncoupled, we hypothesized that yet unknown protein phosphatase(s) oppose S6K1-mediated URI1 phosphorylation at S371 and control URI1-PP1γ complexes (Djouder et al., 2007; Theurillat et al., 2011). In an siRNA-based screen for protein phosphatases, we detected PP1α and DUSP19 to negatively regulate phospho-URI1. Because PP1α, the alpha isoform of the PP1 catalytic C subunit, has been identified in both the MS approach and siRNA screen described above, we performed its functional analysis. PP1α was previously proposed to be involved in the cell cycle checkpoint control function of the TSGs retinoblastoma protein and BRCA1. Furthermore, PPP1CA gene amplification and protein overexpression was reported in oral squamous cell carcinoma cell lines (Hsu et al., 2006; Liu et al., 1999; Liu et al., 2002).

In this study, we showed that PP1α endogenously interacts with the C-terminal URI357-420 fragment, which encompasses residue S371 and was previously identified to be sufficient for PP1γ interaction. Furthermore, we suggested that URI1-PP1α are complexes dependent on phosphorylation of URI1 at S371, as previously described for PP1γ. In agreement with previous data revealing URI1 as a nuclear, cytoplasmic, and mitochondrial protein, we found that URI1 assembles into complexes with both PP1α and PP1γ in all three fractions in a similar subcellular distribution pattern (Djouder et al., 2007). These results raised the possibility that URI1 may exist in a heterotrimeric complex with both PP1α and PP1γ. Indeed, we revealed that URI1 simultaneously interacts with both phosphatases and that

PP1α and PP1γ bind to each other. To our knowledge, interactions among different PP1C isoforms have not been studied so far. We further demonstrated that PP1α and PP1γ co-regulate URI1 phosphorylation in HeLa cells and that their simultaneous depletion leads to URI1 hyperphosphorylation similar to that found in lysates from cells treated with calyculin A. In line with this finding, calyculin A was determined to inhibit the activity of PP1 and PP2A phosphatases (Fujiki and Suganuma, 2009). Djouder et al. (2007) proposed a model in which liberated PP1γ dephosphorylates S6K1 as part of its negative feedback program, which in turn attenuates S6K1 activity and phosphorylation of URI1 at S371 (Figure 4). Given this observation, detection of URI1 hyperphosphorylation in PP1γ-depleted cells would not be surprising. However, only PP1α/PP1γ co-depletion but not a single knockdown of PP1γ nor PP1α affected the URI1 phosphorylation state in HeLa cells and phospho-S6K1 T389 levels remained unchanged in all conditions. Conversely, based on the fact that the PP1γ-dependent negative feedback system operates at low levels under growth factor and nutrient-rich conditions, potential impact of PP1α/PP1γ double knockdown on S6K1 phosphorylation is likely to be observed only under serum deprived conditions. To test this hypothesis, PP1α/PP1γ co-depleted HeLa cells were serum starved or exposed to the mTOR inhibitor everolimus. In cells with PP1α/PP1γ knockdown, we detected sustained URI1 hyperphosphorylation but no elevated phospho-S6K1 T389 levels compared to the control condition. Taken together, these results suggest that PP1α/PP1γ directly control phosphorylation of URI1 rather than modify its upstream effector S6K1. Thus, PP1α/PP1γ and the mTOR/S6K1 axis oppose each other to dynamically regulate the URI1 phosphorylation state in HeLa cells. However, in vitro phosphatase assays are required to confirm whether URI1 is indeed a direct substrate of PP1α/PP1γ. In contrast to HeLa cells, PP1α depletion was found to be sufficient to drive URI1 hyperphosphorylation in OVCAR-3 cells. However, this effect was not observed in other URI1- amplified OCCs analyzed. Furthermore, we demonstrated that PP1α does not control assembly of URI1-PP1γ complexes. Thus, although we were unable to detect phospho-URI1 S371 in PP1α- depleted OVCAR-3 cell lysates it is unlikely that PP1α catalyzes dephosphorylation of URI1 at S371. However, PP1α may fulfill other important functions in the context of URI1. The observation that PP1α stability depends on URI1 in different cell lines supports this hypothesis.

Since URI1 hyperphosphorylation observed in the experimental conditions described in this thesis does not necessarily involve modification of the S371 site, other strategies may be applied to identify phospho-URI1 S371 regulating protein phosphatases. Furthermore, URI1-PP1γ complexes also remained unchanged upon depletion of the second hit that came out of the MS-based URI1 analysis, DUSP19 (data not shown). The analysis was further complicated by the fact that depletion of one PP1C isoform was compensated by upregulation of another in our setting, a redundancy that was also observed previously (Chen et al., 2013).

PP1 phosphatases function as multimeric holoenzymes, consisting of a catalytic C subunit assembled with a large variety of structurally unrelated interacting partners which determine the substrate specificity, subcellular localization, and tissue distribution of the phosphatase complexes (Bollen et al., 2010; Heroes et al., 2013). Although so far over 200 PIPs have been validated, in our URI1 proteomics study we only detected the Ser/Thr kinase Nek2 that functions as a regulator of centromsome structures (Fry, 2002). However, Nek2 is restricted to the nucleus and only around 1% of URI1-PP1 complexes were found in the nuclear fraction. Thus, other proteins may serve as PIPs in our experimental conditions. Intriguingly, URI1 itself displays all features of a PIP: it targets PP1 to different subcellular localizations (PP1α and PP1γ), functions as its inhibitor (PP1γ), and probably also as its substrate (PP1α/PP1γ). Importantly, our laboratory previously identified PP1β in a similar MS- based approach to associate with cytoplasmic and nuclear URI1 (unpublished data). Taken together, URI1 may function as a platform for PP1s and PIP by targeting PP1Cs to different subcellular localizations and modulating their function in a cell type (and context)-dependent manner.

4.2 Regulation of the mitochondrial PGAM5 pathway by URI1 4.2.1 The PGAM5-mediated apoptotic pathway PGAM5 was only recently identified as an atypical protein phosphatase lacking its authentic mutase activity (Takeda et al., 2009). During the last years, PGAM5 emerged as a unique mitochondrial regulatory protein with remarkably diverse and complex functions. Most prominently, PGAM5 was reported as a crucial controller of both cell death and mitochondrial quality control. As our laboratory previously demonstrated that URI1 elicits its oncoprotein function by abrogating the mitochondrial apoptosis pathway in ovarian cancer (Theurillat et al., 2011), we sought to elucidate its function in the PGAM5-based cell death pathway.

Here we show that full-length PGAM5 endogenously interacts with URI1 independent of its phosphorylation at S371. In spite of a consensus that PGAM5 is a mitochondrial protein, its sublocalization in this organelle remains debated and needs to be clarified also in our experimental conditions. Taken together with the previous report describing URI1 as an OMM resident protein (Djouder et al., 2007), we hypothesize that URI1 binds to OMM-anchored PGAM5 or indirectly to its IMM form. Preliminary data further suggest that URI1 may also interact with PGAM5(∆24). These Co-IP studies are technically challenging as PGAM5(Δ24) immunoblotted in URI1-IPs interferes with the IgG light chains. Thus, IgG and URI1 antibody were crosslinked to Sepharose beads as described before (see 3.2) and used for pulldown in HeLa cell lysates (Supplementary Figure 7). PGAM5 immunoblotting suggested that both the full-length and cleaved protein interacts with URI1 however, further technical improvements are required to enhance the specificity.

To investigate whether URI1 may affect the PGAM5 status, CCCP-triggered PGAM5 cleavage was analyzed over time in URI1-depleted OCCs and a non-cancerous ovarian cell line. We revealed that URI1 protects PGAM5 from PARL-mediated cleavage in untreated and CCCP-exposed ovarian cancer and HOSE cells independent of their URI1 amplification status. As PGAM5(∆24) was reported to be mainly localized to the cytoplasm (Zhuang et al., 2013), we sought to study the subcellular distribution of PGAM5 in our setting. Intriguingly, URI1 knockdown by itself triggered massive PGAM5 cleavage and its cytoplasmic translocation in URI1-amplified OVCAR-4 cells, an effect that was enhanced by CCCP treatment. In contrast, URI1-non amplified SKOV3 cells with URI1 knockdown exhibited only slight PGAM5(∆24) generation upon CCCP exposure and no dramatic increase in its translocation to the cytoplasm. However, preliminary experiments in HOSE6-3 cells suggest that elevated levels of cytoplasmic PGAM5(∆24) may also occur in URI1-depleted cell lines with no URI1 amplification (Supplementary Figure 8). Together with PGAM5(∆24) cytoplasmic translocation, XIAP levels decreased in OVCAR-4 cells as reported before (Zhuang et al., 2013), which was not observed in SKOV3 cells. Further IP-based studies are needed to confirm the endogenous interaction between PGAM5(∆24) and XIAP in our setting. Conversely, we detected accumulation of both full-length and cleaved PGAM5 in CCCP-treated OVCAR-4 cells, an effect that was also observed in URI1-amplified OVCAR-8 cells (Supplementary Figure 9), but neither in SKOV3 nor HOSE6-3 cells. Further IP-based studies will show whether these conditions lead to an increase in URI1-PGAM5 complex formation. As cytoplasmic PGAM5(∆24) was demonstrated to elicit apoptosis by antagonizing IAPs, we analyzed cell survival of URI1-depleted OCCs under prolonged CCCP exposure. Strikingly, CCCP- induced apoptosis was strongly augmented in URI1-depleted cells compared to the control condition. In line with the above-discussed fractionation experiments, we observed this phenomenon in all ovarian (cancer) cell lines except for SKOV3. Further subcellular fractionation studies under prolonged CCCP corresponding to the Annexin V/PI experiments will show whether the subcellular localization of PGAM5(∆24) indeed reflects the levels of detected apoptosis. We further demonstrated that the pan-caspase inhibitor zVAD-FMK rescued CCCP-induced apoptosis under URI1 knockdown in OVCAR-8 cells. Importantly, caspase inhibition did not prevent PGAM5(∆24) generation indicating that PGAM5 cleavage occurred upstream of apoptosis. However, although URI1 depletion was efficient in the doxycycline-inducible OVCAR-8 pools, enhanced PGAM5 cleavage upon URI1 knockdown was only observed in stable knockdown cell pools with the same URI1 target sequence (Supplementary Figure 10). Thus, experiments performed with the doxycycline-inducible OVCAR-8 pools need to be repeated with stable knockdown cell pools to verify that the observed effects are not restricted to the inducible system. Moreover, to exclude off-target effects, rescue experiments with an shRNA-resistant URI1 construct are required.

Intriguingly, we could partially rescue URI1-depletion-triggered apoptosis in OVCAR-4 cells by PGAM5 co-depletion. This observation suggests that URI1 addiction in ovarian cancer is mediated by abrogation of the PGAM5-based mitochondrial apoptotic pathway on one hand, and likely by disabling the PP1γ-dependent negative feedback inhibition on the other hand. Further Annexin V/PI experiments in URI1/PGAM5/PP1γ-depleted URI1-amplified OCCs could reveal whether URI1 indeed fuels evasion from apoptosis by modulating both pathways. Conversely, rescue of apoptosis under URI1 depletion and CCCP treatment through PGAM5 knockdown was marginal in OVCAR-4 cells. Further apoptosis measurements in different OCCs unexpectedly showed that URI1-amplified ovarian cancer cell lines selectively depend on PGAM5 for their survival when exposed to CCCP.

Based on the data discussed above, we propose the following model for URI1’s function in the PGAM5-based mitochondrial apoptotic pathway in URI1-amplified OCCs: In normal and untreated cells, URI1 protects PGAM5 from PARL-mediated cleavage (Figure 24A). If these cells are exposed to CCCP, PGAM5 is still protected and only slightly converted into PGAM5(∆24), which is retained at mitochondria by URI1. Furthermore, full-length PGAM5 accumulates at mitochondria to exhibit a yet unknown anti-apoptotic function (Figure 24B). The finding that both forms of PGAM5 accumulate in ectopically URI1-overexpressed TOV-21G cells in a CCCP-dependent manner may correspond to this situation. However, subcellular fractionation experiments need to be performed to determine whether this accumulation is mitochondrial. Next, untreated and URI1-depleted cells undergo apoptosis due to enhanced PGAM5(∆24) generation and its translocation to the cytoplasm where it antagonizes IAPs. Additionally, other pathways seem to contribute to URI1 knockdown- induced apoptosis (Figure 24C). CCCP treatment in URI1-depleted cells further fuels the PGAM5- based pro-apoptotic axis as PGAM5(∆24) generation is augmented and full-length PGAM5 is not stabilized anymore to elicit its anti-apoptotic function (Figure 24D).

4.2.2 Potential role of URI1 in PINK1/Parkin-mediated mitophagy The above outlined model raises the question whether PGAM5 possesses an anti-apoptotic or pro- survival function in the context of CCCP. Only recently, PGAM5 was shown to promote PINK1- as well as FUNDC1-mediated mitophagy upon dissipation of ∆ψm (Chen et al., 2014; Lu et al., 2014). Also in our system, PGAM5 depletion prevented CCCP-induced Mfn2 degradation. Apart from PGAM5, our URI1 proteomics analysis revealed other components of the mitochondrial quality control machinery including STOML2, TIM50, and Mfn2, whereas the latter was identified as a mitochondrial receptor for Parkin translocation (Figure 25A) (Chen and Dorn, 2013). Thus, we sought to investigate the role of URI1 in the PINK1/Parkin axis of mitophagy. According to previous reports, CCCP triggered PINK1 accumulation and degradation of mitochondrial proteins including Parkin itself in URI1-amplified OVCAR-8 cells (Narendra et al., 2010; Sarraf et al., 2013). An immunoblot analysis of autophagic adapter protein p62, which is expected to be degraded upon mitophagy, would 69

further strengthen this conclusion. Moreover, markers specific to different organelles (e.g. endoplasmic reticulum, peroxisomes) need to be included into the analysis to prove that mitophagy rather than general autophagy occurred in our setting. Strikingly, URI1 depletion in OVCAR-8 cells induced CCCP-dependent Parkin and TOM20 accumulation whereas PINK1 stabilization was less pronounced compared to control cells. However, degradation of other proteins analyzed was not affected by URI1 depletion. Furthermore, endogenous Parkin was not sufficient to drive CCCP or FCCP-dependent degradation of mitochondrial proteins in our setting (data not shown), which was also observed in other reports (Rakovic et al., 2013). To date, Parkin is almost exclusively studied through overexpression approaches and its physiological (endogenous) function remains controversial (Ashrafi et al., 2014). To test whether URI1 interferes with mitochondrial Parkin translocation, we applied a fluorescence-based approach with transiently overexpressing YFP-Parkin OVCAR-8 cells. Upon CCCP exposure, Parkin translocation to the mitochondrial marker TOM20 appeared to be less pronounced or delayed in URI1-depleted cells. Accumulation of lipidated LC3 and perinuclear clustering of TOM20-YFP-Parkin aggregates suggest that the observed effects correspond to mitophagy rather than selective degradation of single OMM proteins (Ichimura et al., 2000; Okatsu et al., 2010; Vives-Bauza et al., 2010). Further experiments including different mitochondrial markers such as VDAC or TRAP1 could reveal whether the TOM20-negative YFP-Parkin aggregates observed in CCCP-exposed and URI1-depleted cells are also mitochondrial or correspond to other structures/organelles.

In conclusion, our results imply a potential role of URI1 as a driver of PINK1/Parkin-mediated mitophagy, where it appears to be required for efficient Parkin translocation as well as self- and TOM20 degradation (Figure 25B). However, analysis of additional URI-amplified as well as URI1- non amplified OCCs is required. Future experiments need to answer the question whether impaired Parkin translocation is linked to aberrant Parkin ubiquitination and whether these effects are caused by attenuated CCCP-dependent PINK1 stabilization in URI1-depleted OVCAR-8 cells. For fluorescence- based Parkin translocation studies, signal quantification and colocalization analysis are needed, which was complicated in our setting by heterogeneous YFP-parkin expression as well as apoptosis caused by URI1 knockdown and prolonged CCCP exposure. In this regard, quantitative and time-lapsed live- cell microscopy of URI1-depleted cells stably expressing Parkin could be very useful to investigate whether CCCP-induced Parkin translocation is defective or delayed under URI1 knockdown. Subcellular fractionation experiments in this setting could help additionally answer this question. Moreover, whole-organelle techniques need to be applied to confirm that our results point towards complete mitophagic removal rather than ubiquitin proteasome system (UPS)-driven removal of selected OMM proteins. Electron microscopy is used as a gold standard to show mitophagy, but other fluorescence-based techniques such as visualization of the pH-dependent excitation changes in the mitochondrial targeted coral protein Keima may also provide vital insights (Bingol et al., 2014;

Katayama et al., 2011). Applying these techniques to a panel of OCCs with different URI1 dependency may answer the question whether URI1 drives PINK1/Parkin (and/or FUNDC1)-mediated mitophagy as part of its oncogenic function.

4.2.3 Overall conclusion In summary, the data presented in this study indicate that URI1 promotes cell survival under mitochondrial stress conditions by preventing PGAM5(∆24) generation and its cytoplasmic pro- apoptotic signaling. Thus, URI1 is a major protector from mitochondrial damage as URI1 depletion renders ovarian cells hypersensitive to CCCP-induced apoptosis independent of their URI1 amplification status. Consequently, the view of URI1 acting solely as an addicting oncogene in tumorigenesis may have to be revised as our findings point toward an additional non-oncogene addiction under mitochondrial stress conditions. In support of this notion, unpublished data from our laboratory revealed that also URI1-non amplified cancers can acquire a dependency on the URI1 complex for their survival.

Preliminary data suggest that URI1 may further prevent mitochondrial-stress induced apoptosis by autophagic elimination of damaged mitochondria. As URI1-amplified OCCs were shown to selectively dependent on PGAM5 function for their survival under CCCP exposure, this atypical protein phosphatase may act as a double-edged sword in URI1-driven tumorigenesis. We hypothesize that under mitochondrial stress conditions, URI1 favors PGAM5 accumulation to promote its anti- apoptotic function in PINK1/Parkin (and/or FUNDC1)-mediated mitophagy. However if URI1 is lost, PGAM5 is subjected to PARL-mediated cleavage and thereby unmasks its pro-apoptotic function. If this hypothesis applies, CCCP-induced apoptosis in URI1-dependent ovarian cancer cells with URI1/PGAM5 co-depletion could be rescued by ectopic reexpression of a PARL-uncleavable PGAM5 mutant. General autophagy has been recognized to play a double-faceted role in carcinogenesis. Whereas cancer cells depend on autophagy to survive during nutrient deprivation and hypoxia, autophagy- deficiency is considered to promote genome damage and tumor progression (Hippert et al., 2006; Mathew et al., 2007). The role of mitophagy in cell survival remains controversial and almost unexplored in carcinogenesis as most studies inhibited general autophagy as selective mitophagy inhibitors are unavailable (Boland et al., 2013). However, mitophagy likely plays a similar dual role in tumorigenesis as general autophagy dependent on the tumor type and stage of progression (Lu et al., 2013). Accordingly, recent reports proposed that the PINK1/Parkin pathway constitutes a damage- gated molecular switch that either promotes mitophagy or apoptosis depending on the severity of mitochondrial damage and the nature of stress signals (Carroll et al., 2014; Zhang et al., 2014).

In our study, we demonstrated that PGAM5 endogenously interacts with URI1. However, in vitro binding assays need to be performed to confirm whether these two proteins directly associate with each other and if so, which URI1 site is required for this interaction. As our laboratory previously established URI1 as a PP1γ inhibitor, we need to determine whether PGAM5’s catalytic activity is similarly restricted when bound to URI1. Moreover, URI1 is part of the multiprotein URI1/R2TP complex (Gstaiger et al., 2003) and manipulation of additional key subunits (e.g., STAP1) could reveal if only URI1 or the entire complex mediates the observed effects. Preliminary experiments failed to show an interaction between STAP1 and PGAM5 (data not shown). However, STAP1 depletion significantly decreased URI1 levels in OVCAR-8 cells (Supplementary Figure 11) suggesting that URI1’s function is dependent on its complex formation also in our stetting. If this hypothesis can be confirmed, modulation of the PGAM5 pathway may be mediated by the chaperone function of the URI1/(R2TP) complex.

Depending on the type of stress cue, URI1 can now be considered to modulate distinct pathways to sustain cell survival such as the PP1γ-mediated feedback program (Djouder et al., 2007) or the apoptotic PGAM5(∆24)/IAP axis. In line with this, we found that HeLa cells exposed to H2O2 undergo URI1 hyperphosphorylation and an increase of URI1-PGAM5 complex formation (Supplementary Figure 12A-B). Together with preliminary results indicating an endogenous interaction of URI1 and Keap1 (Supplementary Figure 12C), URI1 may regulate the PGAM5/Keap1/Nrf2 axis in response to oxidative stress (Lo and Hannink, 2008).

Figure 24 | Model proposed for URI1’s function in the PGAM5-based apoptotic pathway in URI1-amplified ovarian cancer cells (A) In normal and untreated cells, URI1 protects PGAM5 from PARL-mediated cleavage. (B) CCCP treatment leads to a slight increase in PGAM5(∆24), which is retained at mitochondria by URI1. Full-length PGAM5 accumulates at mitochondria to exhibit a yet unknown anti-apoptotic function. (C) Untreated and URI1-depleted cells undergo apoptosis due to enhanced PGAM5(∆24) generation and its translocation to the cytoplasm where it antagonized IAPs. (D) CCCP-exposed and URI1-depleted cells exhibit augmented apoptosis due to further PGAM5(∆24) generation and absent anti-apoptotic singaling by full-length PGAM5.

Figure 25 | Model proposed for URI1’s function in PINK1/Parkin-mediated mitophagy in URI1-amplified OVCAR-8 cells (A) The Mfn2 and STOML2 interactor URI1 seems to be required for PINK1/Parkin-mediated mitophagy upon dissipation of ∆ψm as (B) URI1 depletion attenuates CCCP-dependent PINK1 stabilization, affects Parkin translocation to mitochondria and Parkin self- as well as TOM20 degradation.

5 Materials and methods 5.1 Cell culture techniques

5.1.1 Cell lines and compounds

Cell culture work was performed according to Good Cell Culture Practice (GCCP) in a laminar flow hood and cells were cultivated at 37°C and 5% CO2 in a humidified incubator. Cell culture dishes and plates were purchased from greiner bio-one. DMEM (Dulbecco’s Modified Eagle’s medium), DMEM/F-12 – GlutaMAX™-I and RPMI (Roswell Park Memorial Institute) Medium 1640 – GlutaMAX™-I were purchased from Gibco®. Medium 199 and MCDB 105 Medium were purchased from Sigma-Aldrich®. All cell culture media were used antibiotic-free and supplemented with 10% normal fetal calf serum (FCS) (Amimed) or tetracycline-free FCS (BioConcept). Cells were stored in 90% FCS/10% DMSO in liquid nitrogen using cryotubes. Cells were counted by a Z2TM Coulter® Counter (BECKMAN COULTER) measuring cells above the corresponding upper size given in Table 3.

Calyculin A, everolimus (RD001), recombinant human IGF-1 (rhIGF-1), rapamycin, and Z-VAD- FMK (N-Benzyloxycarbonyl-Val-Ala-Asp(O-Me) fluoromethyl ketone) were purchased from Cell Signaling Technology®, R&D Systems, Selleckchem, Calbiochem, and MBL® respectively, dissolved in DMSO and stored at -20°C. Carbonyl cyanide 3-chlorophenylhydrazone (CCCP) was purchased from Sigma, dissolved in DMSO and stored in amber Eppendorf tubes at -80°C. Importantly, CCCP aliquots were used only once as freezing and thawing cycles have been shown to reduce the activity.

Table 3 | Description of cell lines

LOT Size Cell line Medium* Tissue Disease Origin References Supplier Catalog number number [μm]* (van den DMEM SIGMA- 07071903 COV318 human ovary serous carcinoma peritoneal ascites Berg-Bakker 11CO11 10 +2 mM L-glutamine ALDRICH® Sigma et al., 1993) poorly differentiated ovary (Emoto et al., FU-OV-1 DMEM/F-12 human ovary serous carcinoma DSMZ ACC 444 - 10.5 of 65-year-old patient 1999) human HEK DMEM ATCC® CRL- embryonic - - - ATCC 59587035 9.5 293T/17 +2 mM L-glutamine 11268™ kidney DMEM ATCC® CCL- HeLa human cervix adenocarcinoma 31-year-old-patient (Gey, 1952) ATCC - 9.5 +2 mM L-glutamine 2™ Prof. Viola human ovarian MCDB 105 : (Tsao et al., Heinzelmann, HOSE6-3 surface - healthy volunteers - - 10 Medium 199 (1:1) 1995) University Hospital epithelium Basel mainly endometrioid DMEM carcinoma with (Benard et al., IGROV-1 human ovary 47-year old patient - - - 11 +2 mM L-glutamine serous, clear cell, 1985) and undifferentiated areas 49-year old patient, ONCO- (Grimm et al., RPMI-1640 human ovary serous carcinoma crosscontaminated with DSMZ ACC 507 2 10 DG-1 1992) OVCAR-3 cell line (Hamilton et OVCAR-3 RPMI-1640 human ovary serous carcinoma ascites of 60-year-old patient NCI - 0507708 12 al., 1983) (Hamilton et OVCAR-4 RPMI-1640 human ovary serous carcinoma 42-year-old patient NCI - 0507673 12 al., 1984) (Hamilton et OVCAR-8 RPMI-1640 human ovary serous carcinoma 64-year-old patient NCI - 0507712 11 al., 1984) ascites of (Fogh et al., ATCC® HTB- SKOV3 RPMI-1640 human ovary serous carcinoma ATCC - 11 64-year-old patient 1977) 77™ ovary of 62-year-old (Provencher et ATCC® CRL- TOV-21G RPMI-1640 human ovary clear cell carcinoma ATCC - 9.5 patient, grade 3, stage III al., 2000) 11730™ DMEM (Ponten and ATCC® HTB- U2OS bone osteosarcoma 15-year old patient ATCC - 9.5 +2 mM L-glutamine Saksela, 1967) 96™ *Settings used for Coulter® Counter

5.1.2 Transient transfections

5.1.2.1 Transient siRNA transfection

Small interfering RNA (siRNA) was used for transient gene suppression (see Table 4).

Table 4 | List of siRNAs

Catalog Name Target gene Target sequence (5’-3’) Supplier number AllStars Negative Control, no sequence siCtr - Qiagen SI03650318 available siMfn2(6) MFN2 ATGGACAGCCCTGGTATTGAT Qiagen SI04217430 (Sekine et al., siPARL(1) PARL CCCAGAAGGGAGGCTTGCCATTATT - 2012) (Sekine et al., siPARL(2) PARL CCTATCCTATAAGGAGTCTCATAAA - 2012) siPGAM5(2) PGAM5 CTCGGCCGTGGCGGTAGGGAA Qiagen SI00643825 siPGAM5(3) PGAM5 CCCGCCCGTGTCTCATTGGAA Qiagen SI00643825 siPP1α(10) PPP1CA AAGAGACGCTACAACATCAAA Qiagen SI02225755 siPP1α(9) PPP1CA CCGCAATTCCGCCAAAGCCAA Qiagen SI02225748 siPP1β(5) PPP1CB TACGAGGATGTCGTCCAGGAA Qiagen SI02225762 siPP1β(6) PPP1CB CACTATTGGATGTGATTCTAA Qiagen SI02759204 siPP1γ(6) PPP1CC AACATCGACAGCATTATCCAA Qiagen SI02225776 siSTAP1 STAP1 SMARTpool DharmaconTM M-004455-00 siURI1(2) URI1 AAAGAGGGTTTCAAAGTTTAA Qiagen SI00322448 siURI1(6) URI1 TGGGCTCGACTTGAAGAACTA Qiagen SI04200525 siURI1(7) URI1 CAGGACGCCTGCAGACATTTA Qiagen SI04233607 siURI1(8) URI1 CACCGGAAAGAACATGTAAGA Qiagen SI04255097

Transfection of adherent cells with OligofectamineTM (Day 1) A number of 250 x 103 cells were seeded per well of a 6-well plate. (Day 2) A transfection reagent mix was prepared with 15 μL OligofectamineTM Transfection Reagent (invitrogenTM) in 60 μL Opti-MEM® (invitrogenTM) per reaction and incubated for 5 min at RT. For each well, 34-68 pmol siRNA were diluted in 170 μL Opti-MEM® and 75 μL of the transfection reagent mix were added. This mix was incubated for 20 min at RT. The medium was removed and the cells were washed twice with Opti-MEM®. Then, 455 μL Opti-MEM® and the OligofectamineTM-siRNA mix were added to the cells. After incubation of 6h, 2 mL of medium was pipetted on the cells. (Day 3) The cells were seeded according to the experimental needs. (Day 5) The cells were harvested.

Reverse transfection with Lipofectamine® RNAiMAX (Day 1) A transfection reagent mix was prepared with 5 μL Lipofectamine® RNAiMAX Transfection Reagent (invitrogenTM) in 250 μL Opti-MEM® per reaction and incubated for 5 min at RT. For each well, 100 pmol siRNA were diluted in 250 μL Opti-MEM® and 250 μL of the transfection reagent

mix were added. This mix was incubated for 20 min at RT. Then, the mix was added to 150-250 x 103 cells per well of a 6-well plate in a total volume of 3 mL. (Day 2) The cells were seeded according to the experimental needs. (Day 4) The cells were harvested.

5.1.2.2 Transient plasmid DNA transfection

Lipofectamine® 2000 DNA Transfection Reagent (invitrogenTM) was used for transient transfection of plasmids listed in Table 5.

(Day 1) The cells were seeded in a 10 cm dish so that 90% confluency was reached the next day. (Day 2) A transfection reagent mix was prepared with 20-30 μL Lipofectamine® 2000 DNA Tranfection Reagent in 500 μL Opti-MEM® (invitrogenTM) per reaction and incubated for 5 min at RT. For each plate, 10-15 μg of the target plasmid were diluted in 500 μL Opti-MEM® and 500 μL of the transfection reagent mix were added. This mix was incubated for 20 min at RT. Then, the mix was added dropwise to the cells. The medium was changed after 4 to 6 h. (Day 3) The cells were seeded according to the experimental needs. (Day 4-5) The cells were harvested.

Table 5 | List of plasmids for transfection

Name Insert Vector Supplier Catalog number HA-Parkin Parkin pRK5 Addgene 17613 PP1α resistant to mutPP1α pcDNA3.1(+) cloned in this study1 - siPP1α(10) PP1α (for IVT) PP1α pcDNA3.1(+) cloned in this study1 - PP1γ (for IVT) HA-PP1γ pcDNA3 (Djouder et al., 2007) - HA-URI1 (codon URI1 pcDNA3.1+ (Djouder et al., 2007) - optimized) vector - pcDNA3.1+ Invitrogen V790-20 YFP-Parkin YFP-Parkin eYFP-C1 Addgene 23955 1 Cloning of this plasmid is described below

Cloning of plasmids PP1α 3xFLAG-PP1α in a pCMV10 vector was provided by Wang et al. (2011) and used as a template for Phusion® High-Fidelity PCR (Thermo Scientific) with the following primers:

Forward: 5’-ATC AAG CTT ACC GGT GCC ACC ATG TCC GAC AGC GAG AAG CT-3’ Reverse: 5’- GAT GGA TCC ACG CGT CTA TTT CTT GGC TTT GGC GG-3’

The PCR product was double digested with BamHI/HindIII and subcloned into a pcDNA3.1+ vector.

mutPP1α PP1α in a pcDNA3.1+ vector described above was used as a template for QuikChange Site-Directed Mutagenesis (Agilent Technologies) with the following primers:

Forward: 5’-CTA TGG TTT CTA CGA TGA GTG CAA AAG GCG CTA TAA TAT CAA ACT GTG GAA AAC CTT CAC-3’ Reverse: 5’-GTG AAG GTT TTC CAC AGT TTG ATA TTA TAG CGC CTT TTG CAC TCA TCG TAG AAA CCA TAG-3’

5.1.3 Lentiviral delivery of shRNA and recombinant proteins shRNA Short hairpin RNA (shRNA) was used for stable gene silencing and all materials were purchased from Sigma-Aldrich. URI1-targeting shRNA (#TRCN0000074239 and #TRCN0000074242) was cloned into a pLKO.1-puro (=shURI1(1) and shURI1(2) respectively) or doxycycline-inducible pLKO.1- puro vector (=shURI1(1)-teton and shURI1(2)-teton, respectively). Accordingly, scrambled control shRNA was cloned into both vectors (=shCtr and shCtr-teton). For experiments performed with the pLKO.1-teton system, tetracycline-free FCS was used and cells were induced with 1 μg/mL doxycycline for three to four days and the medium was replaced every 24h.

5.1.3.1 Virus production

(Day 1) Low-passage HEK 293T cells were seeded in 10 cm dishes with 5 x 106 cells per dish. (Day 2) A transfection reagent mix was prepared with 18 μL X-tremeGENE 9 DNA Transfection Reagent (Roche) in 222 uL Opti-MEM® (invitrogen®) per reaction and incubated for 5 min at RT. Meanwhile, a DNA mix was prepared with 2.25 μg psPAX2 (packaging plasmid) and 0.75 μg pMD2.G (envelope plasmid) in 30 μL in Opti-MEM®. The target shRNA or DNA plasmid was prepared using 3 μg in 30 μL Opti-MEM® and 30 μL of the DNA mix and 240 μL of the transfection reagent mix were added, respectively. This mix with a total volume of 300 μL was incubated for 20 min at room temperature. Then the mix was added dropwise to HEK 293T cells and incubated for 12 to 15h. (Day 3) The medium was changed. (Day 5) The virus was harvested, filtered using a 0.45 μM filter and either stored at -80°C or directly used for cell infection.

5.1.3.2 Viral infection of host cells

(Day 1) Adherent or suspensions cells in a 10 cm dish were infected with 1 mL virus in the presence of 8 μg/mL polybrene. (Day 3) Cells subjected to shRNA treatment were selected with 2 μg/mL puromycin for three days.

5.2 Isolation and analysis of cellular proteins 5.2.1 Cell lysis and SDS sample preparation

TNN buffer [in ddH2O]

 50 mM Tris pH 7.5  5 mM EDTA

 250 mM NaCl  0.5% NP-40

 50 mM NaF

Stored at 4°C

5x Laemmli [in 100 mM Tris pH 6.8]  20% glycerol  4% SDS  0.2% bromophenol blue  200 mM DTT

Stored at RT

All steps were performed at 4°C. The cells were washed twice with cold PBS (phosphate buffered saline), scraped from the dish in the same buffer and transferred to an Eppendorf tube. The cells were centrifuged at 300 rcf for 5 min. The supernatant was removed and the cell pellets were resuspended in TNN buffer and lysed for 20 min. The samples were centrifuged at 16.1 x 103 rcf for 10 min and the supernatant was transferred into a new Eppendorf tube. The samples were either stored at -80°C or directly processed as described below. The protein concentration was determined by Bradford assay (Bio-Rad). The samples were adjusted to equal protein concentrations by 5x Laemmli buffer in safe- lock Eppendorf tubes. The samples were vortexed and boiled at 95°C for 5 min and shortly centrifuged.

5.2.2 SDS-PAGE

SDS-PAGE running buffer

 1g SDS  14.41 g Glycine

 3.03 g Tris  ad 1L ddH2O Stored at RT

The SDS samples were separated by SDS-PAGE (sodium dodecyl sulfate polyacrylamide gel electrophoresis) using the Mini-PROTEAN® Tetra System (Bio-Rad). SDS-PAGE gels with different acrylamide concentrations were casted according to the target protein molecular weight (MW). To visualize URI1 phospho-shifts, big 6% SDS-PAGE gels were prepared with dimensions of 16.5 x 22 cm.

5.2.2.1 Coomassie Blue staining

Coomassie Blue staining solution

 2.5 g Coomassie Brilliant Blue R-250  450 mL methanol

 100 mL acetic acid  400 mL ddH2O Stored at RT

Coomassie Blue destaining solution  450 mL methanol  100 mL acetic acid

 ad 1L ddH2O Stored at RT

SDS-PAGE gels were stained with Coomassie Brilliant Blue R-250 for 20 min and washed in Coomassie Blue destaining solution for 1h or O/N by replacing the solution several times.

5.2.2.2 Silver staining

SDS-PAGE gels were fixed in 40% ethanol/10% acetic acid/50% ddH2O. The gels were washed in water for 1h by replacing the water four times. The gels were sensitized in 0.02% Na2S2O3 and then washed in water three times for each 5 min. The gels were incubated in freshly prepared 0.2%

AgNO3/0.076% formaldehyde for 20 min at 4°C in the dark and in the following washed twice in water for each 1 min. The gels were developed in freshly prepared 6% Na2CO3/0.05% formaldehyde for several minutes until the dark brown bands were visible and in the following washed in water for 1 min. The staining was terminated by incubation in 5% acetic acid for 5 min. The gels were stored in 1% acetic acid at 4°C.

5.2.2.3 Western blotting and immunostaining Semi-dry transfer

Semi-dry transfer buffer  2.9 g Glycine  0.37 g SDS  5.8 g Tris  200 mL ethanol

 ad 1L ddH2O Stored at 4°C 81

Ponceau S stock solution [in 1% acetic acid]  3% w/v Ponceau S

Ponceau working solution  1 mL Ponceau working solution  1 mL acetic acid

 30 mL ddH2O Stored at RT

The SDS -PAGE gels were transferred on nitrocellulose membranes (Optitran®, GE Healthcare) by the semi-try transfer systems Trans-Blot® SD and Trans-Blot® TurboTM (Bio-Rad) using Whatman® paper (GE Healthcare). The membranes were stained with Ponceau S solution.

Immunostaining

ECL solution: 2 mL Solution A + 200 μL Solution B + 0.3 μL 30% H2O2

Solution A

 0.1 M Tris pH 8.8  3 mM luminol

 ad 1L ddH2O

Stored at 4°C

Solution B

 220 mg p-hydroxycoumarin acid  50 mL DMSO

Stored at RT

(Day 1) The membranes were blocked with 5% milk in TBS-Tween (TBST) for at least 30 min at RT.

The membranes were incubated with the primary antibody (see Table 6) diluted in milk O/N at 4°C on a tube roller. (Day 2) The membranes were washed three times in TBST for each 10 min. The membranes were incubated with the corresponding secondary horseradish peroxidase (HRP)- conjugated antibody (invitrogen®) for 1h at RT on a tube roller. The membranes were washed again three times in TBST for each 10 min. The membranes were developed using ECL solution on FUJI X- ray-Films Super RX (FUJIFILM) by a FUJIFILM developer or the ImageQuant LAS4000® mini (GE Healthcare) and quantified by ImageJ software.

Table 6 | List of primary antibodies

Catalog Target protein Supplier MW [kDa]* Antibody type** Host*** number Cell Keap1 Signaling 4678 60-64 P R Technology® Lamin A Santa Cruz sc-20680 69 P R Cell 16 (full-length), LC3B 2775 P R Signaling 14 (cleaved) Mfn2 Abcam ab50838 86 P R Parkin Abcam ab77924 55 M M PARL Abnova PAB13061 30 P R BD 113 (full-length), PARP 556362 M M Biosciences 89 (cleaved) 32 (full-length), PGAM51 homemade - P R 30 (cleaved) Novus 67 (full-length), 45 PINK1 BC100-494 P R Biologicals and 55 (cleaved) Porin Calbiochem 529532 32 M M PP1α Santa Cruz sc-6104 37 P G PP1β Santa Cruz sc-6106 36 P G PP1γ Santa Cruz sc-6108 35 P G Cell P-S6K1 T389 Signaling 9205 70 P R Technology® Cell S6K1 Signaling 9202 70 P R Technology® Homemade STAP1 (Gstaiger et - 18 M M al., 2003) STOML2 Proteintech 10348-1-AP 39 P R TIM50 Abcam ab109436 40 M R TOM20 Santa Cruz sc-11415 16 P R TRAP1 Santa Cruz sc-135944 75 M M homemade URI1 for IP (Gstaiger et 179-2-1 90 M M al., 2003) homemade URI1 for WB (Gstaiger et 179-58-1 90 M M al., 2003) VDAC Millipore AB10527 33 P R Cell XIAP Signaling 2045 53 M R Technology® Sigma- β-actin A5316 42 M M Aldrich * Molecular weight (MW) of detected band by SDS-PAGE gel analysis ** M = monoclonal, P = polyclonal *** G = goat, M = mouse, R = rabbit 1 The antibody generation is described below

Generation of the PGAM5 antibody The bacterial expression plasmid pGEX-4T encoding full-length human GST-PGAM5 was obtained from Prof. K. Takeda (Imai et al., 2010). Recombinant GST-PGAM5 was purified as described below (see 5.3.3.2). The PGAM5 polyclonal antibody was generated in rabbits by Eurogentec (Belgium). The antibody was column-purified by Lukas Frischknecht2 by counter-purification for GST followed by purification for GST-PGAM5. Specificity of the obtained antibody was verified by siRNA knockdown of PGAM5 and Western Blotting as well as immunoprecipitation (as described in 5.3.1) of the protein.

5.2.3 Subcellular fractionation

Fractionation buffer [in ddH2O]  220 mM mannitol  70 mM sucrose  10 mM HEPES pH 7.5  1 mM EDTA

Freshly supplemented with protease and phosphatase inhibitors before use:  1: 100 cOmplete (Roche)  1:50 PhoSTOP (Roche)

Stored at 4°C

All steps were performed at 4°C. The cells were cultivated in one 15 cm dish for each condition. The cells were washed twice with fractionation buffer, scraped from the dish in the same buffer and transferred to a 15 mL Falcon tube. The cells were centrifuged at 2200 rpm for 5 min on a Heraeus Megafuge 40R centrifuge (Thermo Scientific). The supernatant was removed and the cell pellet was resuspended in fractionation buffer (300-500 μL per 15 cm dish). The cells were homogenized with a Potter S Homogenizer (sartorius) performing 20 to 25 strokes at a speed of 1000-1500 min-1. The cells were centrifuged at 2200 rpm for 5 min. The supernatant (= cytoplasmic and mitochondrial fraction) was transferred to an Eppendorf tube and centrifuged at 16.1 x 103 rcf for 20 min at an Eppendorf table centrifuge. The resulting supernatant was transferred into a new Eppendorf tube (=cytoplasmic fraction). The remaining cell pellet (= mitochondrial fraction) was washed three times with fractionation buffer (centrifugation: 16.1 x 103 rcf, 20 min) and lysed in TNN buffer as described before (5.2.1).. The remaining pellet (= nuclear fraction) was washed three times with fractionation buffer (centrifugation: 2200 rpm, 5 min) and lysed in TNN buffer.

2 Group of Prof. W. Krek, Institute of Molecular Health Sciences, ETH Zurich 84

5.2.4 Immunofluorescence (Day 1) OVCAR-8 shCtr-teton and URI1(2)-teton cells were induced with doxycycline. (Day 2 and 3) The medium was replaced and fresh doxycycline was added. (Day 4) The cells were seeded in triplicates on coverslips placed in 12-well plates. (Day 5) The cells were treated with 20 µM CCCP for 6 and 10 h. The medium was removed and the cells were washed three times with PBS. The cells were fixed with 4% paraformaldehyde (PFA) for 15 min at 37°C and 5% CO2 and in the following washed three times with PBS. The cells were permeabilized with 0.2% TritonTM X-100 for 10 min at RT and in the following washed three times with PBS. Blocking was performed by incubation of cells in 1% glycine for 10 min at RT and then washed again three times with PBS. The coverslips were incubated upside down with the TOM20 antibody (see Table 6) diluted 1:100 in PBS/0.05% Tween for 1h at RT in a humid chamber. The coverslips were placed back into the 12-well plate and washed three times with PBS. The coverslips were incubated upside down with the secondary Anti-Rabbit Alexa Fluor® 647 secondary antibody (invitrogen®) combined with DAPI (1 mg/mL) diluted 1:500 and 1:1000 in PBS/0.05% Tween, respectively for 1h at RT in a dark humid chamber. The coverslips were placed back into the 12-well plate and washed three times with PBS. The coverslips were mounted on SUPERFROST® PLUS slides (Thermo Scientific) by Mowiol. (Day 6) To prevent drying, the coverslips were sealed with nailpolish. The samples were either stored at 4°C in the dark or directly analyzed on a laser scanning confocal microscope (Leica SP2 FCS) at 63x magnification at the ScopeM facility ETH Zurich.

5.3 Analysis of protein interactions 5.3.1 Co-immunoprecipitation

TNN buffer [in ddH2O]

 50 mM Tris pH 7.5  5 mM EDTA

 150 or 250 mM NaCl  0.5% NP-40

 50 mM NaF

Stored at 4°C

For the CHAPS TNN buffer, 0.3% CHAPS was used instead of 0.5% NP-40.

Endogenous interaction of two proteins was confirmed by Co-immunoprecipitation (Co-IP). Thereby, pulldown of an immobilized antibody specific to a known antigen (bait protein) and immunoblotting for the potential binding partner (prey protein) was performed. For each interaction, different buffers and beads have been used as indicated in Table 7.

Table 7 | Conditions used for Co-immunoprecipitations

Bait Prey Buffer Beads Mnf2 URI1 CHAPS TNN (100 mM NaCl) Dynabeads® Protein A STOML2 URI1 CHAPS TNN (100 mM NaCl) Recombinant Protein G Agarose URI1 STOML2 TNN (250 mM NaCl) Recombinant Protein G Agarose URI1 PGAM5 TNN (100 mM NaCl) Protein G SepharoseTM 4 Fast Flow URI1 PP1α TNN (250 mM NaCl) Protein G SepharoseTM 4 Fast Flow PP1γ, PP1α URI1 TNN (250 mM NaCl) Protein G SepharoseTM 4 Fast Flow

Protein lysate adjustment Cells were cultivated on 15 cm plates and lysed as described before (see 5.2.1). The samples were adjusted to a protein amount of at least 1 mg in 2 mL safe-lock Eppendorf tubes in a total volume of 1 mL. For input control, an SDS sample was prepared with a protein concentration of 1 μg/μL.

5.3.1.1 Co-immunoprecipitation by Sepharose and Agarose beads All steps were performed at 4°C. The samples were precleared for 30 min on a slowly rotating wheel with 50 or 100 μL of Protein G SepharoseTM 4 Fast Flow (GE Healthcare) or Agarose beads (invitrogenTM), respectively. The samples were centrifuged at 16.1 x 103 rcf for 3 min and the supernatant was transferred into a new safe-lock Eppendorf tube. Then, 2-10 μg of the bait antibody or the corresponding IgG control were added. The samples were incubated for 2h on a slowly rotating wheel. Then, 50 or 100 μL of Sepharose or Agarose beads were added. The samples were incubated for 1h on a slowly rotating wheel. The samples were washed three times with 1 mL TNN buffer by short centrifugation (11 sec, until 16.1 x 103 rcf). Finally, 10-15 μL of 5x Laemmli buffer were added to the beads and the samples were vortexed and boiled at 95°C for 5 min. The samples were run on a SDS-PAGE gel and 20 μL of the input SDS sample was used.

5.3.1.2 Co-immunoprecipitation by Dynabeads® The Dynabeads® were vortexed in the vial for 30 sec. Then, 50 μL of the beads were transferred into a safe-lock Eppendorf tube. The tube was placed on a magnet and the supernatant was removed. Then, 2-10 μg of the antibody were diluted in 200 μL PBS with 0.02% Tween®-20 and incubated with rotation for 10 min at RT. The tube was placed on a magnet and the supernatant was removed. The tube was removed from the magnet and the beads were washed with PBS with 0.02% Tween®-20 by gentle pipetting. The tube was placed on a magnet and the supernatant was removed. The protein lysates were added to the beads and incubated for 2h at 4°C on a slowly rotating wheel. The tube was placed on a magnet and the supernatant was removed. The samples were washed three times with 1 mL TNN buffer by removing the tube from the magnet and gentle pipetting. Then, 10 μL of 5 x Laemmli buffer were added to the beads and the samples were vortexed and boiled at 95°C for 5 min.

The tubes were placed on a magnet and the supernatant was run on a SDS-PAGE gel including 20 μL of the input SDS sample.

5.3.2 Double Co-immunoprecipitation (Day 1) Five 15 cm dishes of HeLa cells were cultivated to 70% confluency. All following steps were performed at 4°C. (Day 2) The cells were lysed in TNN buffer (250 mM NaCl) and four safe-lock Eppendorf tubes were prepared with each 4 mg protein lysate. For input control, an SDS sample was prepared with a protein concentration of 1 μg/μL. Each two IPs were set up with 10 μL PP1α and 0.4

μL IgGgoat antibody (Sigma-Aldrich®) and incubated for 2h on a rotating wheel. Then, 40 μL of SepharoseTM 4 Fast Flow beads were added, the samples were incubated for 1h on a rotating wheel and washed three times with 1 mL TNN buffer by short centrifugation (11 sec, until 16.1 x 103 rcf). The beads were dried by a syringe and incubated with 20 μg PP1α blocking peptide (Santa Cruz, #sc-6104 P) for 30 min on a shaker. Then, 500 μL TNN buffer were added and the samples were vortexed. The beads were pelleted by short centrifugation (11 sec, until 16.1 x 103 rcf) and the supernatant containing the release PP1α protein complexes were transferred into a new safe-lock Eppendorf tube. Then, 300 μL TNN buffer were added to the dry beads and the samples were shortly centrifuged (11 sec, until 16.1 x 103 rcf) and the supernatant was added to the Eppendorf tube. The pooled samples were used to set up each two IPs with 10 μL PP1γ (lysate of PP1α pulldown) and 0.4 μL IgGgoat (lysate of IgGgoat pulldown) antibody, respectively. The samples were incubated for 2h on a rotating wheel. Then, 40 μL of SepharoseTM 4 Fast Flow beads were added, the samples were incubated for 1h on a rotating wheel and washed three times with 1 mL TNN buffer by short centrifugation (11 sec, until 16.1 x 103 rcf). Finally, 10 μL of 5x Laemmli buffer were added to the beads and the samples were vortexed and boiled at 95°C for 5 min. The corresponding samples were pooled and run on a SDS-PAGE gel including 20 μL of the SDS input control.

5.3.3 In vitro binding assay The glutathione S-transferase (GST)-tagged URI1(357-420) fragment was cloned into a pGEX-4T-1 vector as described before (Djouder et al., 2007) and GST alone in the same vector was used as a negative control.

5.3.3.1 Recombinant GST-tagged protein expression

NETN buffer [in ddH O] 2  100 mM NaCl  0.5% NP-40  20 mM Tris pH 8  0.5 mM EDTA  1 mg/mL lysozyme Freshly supplemented with the following reagents before use:  1: 100 cOmplete (Roche)  1:50 PhoSTOP (Roche)  1 mM DTT  1 μg/mL DNase Stored at 4°C

Lysogeny broth (LB) medium was supplemented with 100 μg/mL ampicillin (AppliChem). (Day 1) Escherichia coli (E. coli) Tuner cells (provided by Dr. Yanyan Xuan3) were transformed with the corresponding GST-tagged plasmid. Then, 2 mL of LB medium were inoculated and this preculture was incubated O/N at 37° C and 220 rpm (Thermo Scientific). (Day 2) The preculture was added to 100 mL LB medium and incubated at 37°C and 220 rpm for 1-2 h until an OD600 of 0.4-0.6 was reached. IPTG was added to a final concentration of 0.1 mM and the culture was incubated at 37°C and 220 rpm for 3-4 h. The cells were centrifuged at 5000 rpm and 4°C for 15 min on a Heraeus Megafuge 40R centrifuge and the supernatant was discarded. The cells were resuspended in 30 mL NETN buffer and disrupted by a French Press. The lysate was centrifuged at 13 x 103 rpm and 4°C for 20 min. The supernatant containing the GST-tagged protein was either stored at -80°C or directly used for GST purification.

5.3.3.2 GST purification, in vitro translation, and pulldown First, 1 mL of GST-containing lysate was thawed on ice and an input sample of 10 μL was added to 10 μL Laemmli buffer and boiled at 95°C for 5 min. Then, 50 μL of 50% slurry Glutathione Sepharose® 4B (GE Healthcare) beads were added. The sample was incubated for 1h at 4°C on a rotating wheel. The beads were washed three times with TNN buffer (see 5.2.1) by centrifugation at 5000 rpm and 4°C for 3 min. The beads were resuspended in 500 μL TNN buffer and 6 μL of in vitro translated (IVT) protein were added. IVT was performed by the TNT® T7 Coupled Reticulocyte Lysate System (Promega). For a 50 μL reaction, the following components were first mixed on ice and then incubated at 30°C for 90 min:  25 μL TNT® Rabbit Reticulocyte Lysate  2 μL TNT® Reaction Buffer  1 μL Amino Acid Mixture, Minus Methionine, 1 mM  1.5 μg DNA template  RNasin Ribonuclease Inhibitor (40u/μL)

3 Group of Prof. W. Krek, Institute of Molecular Health Scienes, ETH Zurich 88

 TNT® T7 RNA Polymerase  4 μL 35S-Methionine (1 Ci/mmol) (HARTMANN ANALYTIC)

 ad 50 μL ddH2O The IVT protein was either snap frozen and stored at -20°C or directly used. The mix was incubated for 2h at 4°C on a rotating wheel. The beads were washed three times with 1 mL TNN buffer by short centrifugation (11 sec, until 16.1 x 103 rcf). Then, 10 μL of 5x Laemmli buffer were added to the beads and the sample was vortexed and boiled at 95°C for 5 min. The sample was run on a SDS- PAGE gel including the input control. The gel was enhanced by EN3HANCE® (PerkinElmer®) for 1h, then washed in water for 20 min and dried on a Whatman® paper (GE Healthcare) at 80°C for 30 min. The dried gel was exposed to X50 HYPERFILM MP films (Fisher Scientific) for 3 days and developed on a FUJIFILM developer.

5.4 Analysis of cell survival and viability 5.4.1 Colony formation assay

Crystal violet staining solution [in ddH2O]  0.5% w/v crystal violet  70% methanol Stored at RT

Colony formation assay was performed to assess long-term cell proliferation and survival.

To obtain single cells, the cells were trypsinized and resuspended several times. A number of 7.5 x 103 (OVCAR-8) or 12.5 x 103 (OVCAR-4) cells were seeded per well of a 6-well plate in triplicates. OVCAR-8 and OVCAR-4 cells were cultured for 14 and 11 days, respectively and the medium was replaced several times. Then, the medium was removed and the cells were stained with crystal violet staining solution for 20 min. For washing, the plates were plunged into water.

5.4.2 PrestoBlue® assay The PrestoBlue® assay was performed to quantitatively measure cell viability and short-term survival.

(Day 1) OVCAR-8 shCtr-teton and shURI1(2)-teton cells were induced with doxycycline. (Day 2 and 3) The medium was replaced and fresh doxycycline was added. (Day 4) A number of 10 x 103 OVCAR-8 cells were seeded per well of a 96-well plate in octuplicates and a volume of 100 μL. To the first and the last column of the 96-well plate, medium only was added. After 7h, the cells were treated with 100 μL of 2.5, 5, 10, and 20 μM CCCP or the corresponding volume of DMSO to reach a final concentration of 1.25, 2.5, 5, and 10 μM CCCP. For rescue experiments, the cells were treated

with 20 μM CCCP alone or combined with 200 μM Z-VAD-FMK in a total volume of 100 μL to reach a final concentration of 10 μM and 100 μM, respectively. (Day 5) In the morning, the cells were washed twice with PBS by a HydroSpeed™ plate washer (TECAN). The cells were incubated with PrestoBlue® Cell Viability Reagent (invitrogen®) diluted 1:10 in PBS and incubated for 1h at 37°C and 5°C CO2. The plates were analyzed on an Infinite® M1000 PRO microplate reader (TECAN) at

λexcitation = 560 nm and λemission = 590 nm. The gain was set to reach an optimal value in OVCAR-8 shCtr-teton cells. Due to humidity and temperature variations, the values of the first and the last row were excluded so that for each condition sextuplicates were included into the following analysis. The average of the medium only control (wells of the first and last column of the plate) was considered as background and subtracted from the values. The values were normalized to the shCtr-teton DMSO control and presented as relative cell viability.

5.4.3 GFP-Annexin V/PI Annexin V and propidium iodide (PI) double staining was used to quantitatively analyze apoptosis by flow cytometry. Externalization of phosphatidylserine as an early event in apoptotic cells was monitored by Annexin V labelling. Membrane-permeabilization indicating late apoptosis or necrosis was visualized by PI staining. His-Annexin V conjugated to a green fluorescent protein (GFP) (hereinafter referred to as GFP-Annexin V) and mCherry (hereinafter referred to as Cherry-Annexin V) were provided by Prof. C. Borner (Egger et al., 2003).

PI [in PBS]

 69 μM propidium iodide  38 mM sodium citrate tribasic dihydrate

Stored at 4°C

Annexin V binding buffer [in ddH2O]

 140 mM NaCl  2.5 mM CaCl2

 10 mM HEPES pH 7.4

Stored at 4°C

(Day 1) Cells were trypsinized and adjusted to a concentration of 80 x 103 (HOSE6-3), 70 x 103 (OVCAR-8), 45 x 103 (OVCAR-3), or 25 x 103 (OVCAR-4, SKOV-3, TOV-21G) cells per mL. For FACS (Fluorescence-activated cell sorting) analysis, cells were seeded in triplicates on 12-well plates (1 mL/well). For western blot analysis, cells were seeded in 6-well plates (2.5 mL/well). After 7h, the cells were treated with 1 mL (12-well plate) or 2.5 mL (6-well plate) of 20 μM CCCP or the corresponding volume of DMSO to reach a final concentration of 10 μM and incubated O/N. (Day 2) The medium was transferred to 5 mL BD FalconTM tubes (BD Biosciences) that were kept on ice. The cells were washed once with cold PBS and this solution was included into the corresponding tube. The 90

cells were trypsinized at 37° and 5% CO2, resuspended in PBS/10% FCS and transferred to the corresponding BD FalconTM tube. The wells were rinsed with PBS/10% FCS this solution was included into the corresponding tube. The cells were centrifuged at 400 x g for 3 min. The supernatant was removed and cells were washed with 1 mL Annexin V binding buffer (FACS samples) or 3 mL cold PBS (WB (Western Blotting) samples). The supernatant was removed and the WB samples were lysed in TNN buffer as described before (5.2.1). GFP-Annexin V and Cherry-Annexin V were diluted in a ratio of 1: 2500 and 1:500 in Annexin V binding buffer, respectively, and 50 μL of this solution was added to the FACS samples. The samples were gently vortexed and incubated at RT for 30 min in the dark. Then, 150 μL of Annexin V binding buffer were added. Just prior to the analysis, 5 μL of PI were added to the cells and the samples were vortexed. The samples were measured on a BD AccuriTM C6 Flow Cytometer (BD Biosciences) by the BD CSampler Software couting 5000-10´000 events per sample. Color compensation was performed using Annexin V (AxV) or PI single stained samples. Percentage of single (AxV+/PI-, AxV-/PI+) and double-positive (AxV+/PI+) cells was assessed by measuring GFP-Annexin V (logarithmic scale, horizontal axis) with dectector FL1 (detects λemission =

533/30) and PI (logarithmic scale, vertical axis) with detector FL3 (detects λemission = 670 nm LP). The data were analyzed by FlowJo software and presented as relative increase in apoptotic cells (AxV+/PI- + AxV+/PI+).

5.5 siRNA screen for catalytic subunits of protein phosphatases The QIAGEN Human Phosphatase siRNA Set V2.0 targeting 206 human phosphatases and phosphatase-associated genes was used to select all 44 catalytic subunits of Ser/Thr and dual-specific protein phosphatases. As PGAM5 was detected in the URI1-Co-IP MS analysis (Table 2), this atypical Ser/Thr phosphatase was also included so that the siRNA screen was performed with a total number of 45 genes listed in Supplementary Table 2 . For each gene, 1-4 siRNAs were purchased from QIAGEN and pooled accordingly. GFP siRNA was used as a negative control and siRNA targeting Lamin A/C was included as a positive control for knockdown efficiency tested by WB. The screen was performed in HeLa cells transfected with OligofectamineTM and a final concentration of 34 pmol siRNA.

(Day 1 and 2) HeLa cells were transfected according to the procedure described in 5.1.2.1. (Day 3) Cells of one well of a 6-well plate (corresponding to silencing of 1 gene) were trypsinized and split 1:2.5 in two 10 cm dishes for WB analysis. The cells left on the 6-well plate were maintained for quantitative RT-PCR analysis (see 5.5.1) (Day 4) The cells cultivated in 10 cm dishes were treated with 100 nM everolimus O/N. (Day 5) The cells were harvested as described before (see 5.2.1) and the protein lysates were run on big 6% SDS-PAGE gels.

5.5.1 Quantitative RT-PCR The cells cultured in 6-well plates described above were washed with PBS and RNA extraction was performed using the Nucleospin RNA II kit (MACHEREY-NAGEL). RNA was transcribed into cDNA using EcoDryTM Premix (Random Hexamers) (Clontech). Quantitative RT-PCR (pRT-PCR) reactions were prepared with SYBR® Green Master Mixes (Life Technologies) and the following primers:

DUSP19_Forward: 5’-TAT GTG CAG GAC CTT AGC TCG-3’ DUSP19_Reverse: 5’-GAG CAG CAT CTT GTG ACC CT-3’ PPP1CA_Forwarad: 5’-ACC GCA TCT ATG GTT TCT ACG A-3’ PPP1CA_Reverse: 5’-TTG AAG CAG TCA GTG AAG GTT T-3’

The reactions were run on a Light Cycler LC4800 (Roche) and the data was normalized to gene expression of HMBS.

5.6 Proteomics To ensure high quality and purity of the mass spectrometry (MS) analysis, commonly occurring keratine contaminations were avoided by working with a laboratory coat and tied up hair. All buffers were prepared with high purity ddH2O and sterile filtered prior to use.

5.6.1 Cell harvest OVCAR-3 cells were grown in 15 cm dishes to 70% confluency. In total, 160 dishes were sequentially grown and collected. All following steps were performed in a cold room. Cells of 20 dishes were washed twice with fractionation buffer (see 5.2.3), scraped in the same buffer, transferred into 15 mL Falcon tubes and centrifuged at 2200 rpm for 5 min on a Heraeus Megafuge 40R centrifuge (Thermo Scientific). After removal of the supernatant, the cell pellets were snap-frozen and stored at -80°C.

5.6.2 Isolation of mitochondria

MS TNN buffer [in ddH2O]

 50 mM Tris pH 7.5  250 mM NaCl

 5 mM EDTA  0.5 mM EGTA

 0.5% NP-40  0.2 mM Na3VO4

 50 mM NaF

Freshly supplemented with protease and phosphatase inhibitors before use:

 1: 100 cOmplete (Roche)  1:50 PhoSTOP (Roche)

Stored at 4°C

The detergent free MS TNN buffer was prepared without NP-40, cOmplete nor PhoSTOP.

All steps were performed in a cold room. The cell pellets were thawed on ice and 10 mL of cold fractionation buffer was added to each 15 mL Falcon tube containing cells of 20 dishes. Subcellular fractionation was performed as described before (5.2.3) by the Potter S Homogenizer with 25 strokes at a speed of 1000 min-1. The content of each Falcon tube was fractionated separately and all samples were pooled for the following steps. The mitochondrial fraction was lysed in 10 mL MS TNN buffer as described before (5.2.1) and 100 μL of lysate were kept for WB analysis.

5.6.3 Crosslinking of antibody to the beads For 1 mL 50% slurry beads, 2 mg of antibody were used. Each 400 μL of 50% slurry Protein G SepharoseTM 4 Fast Flow (GE Healthcare) in PBS were mixed with 160 μL IgG2κa (5 μg/μL) (eBioscience) or 750 μL URI1 IP antibody (~1 μg/μL) and incubated for 2.5h at RT on a rotating wheel. The beads were washed twice with 4 mL 0.2 M sodium borate buffer pH 9 by centrifugation at 4000 rpm for 3 min. The beads were resuspended in 4 mL borate buffer and a 10 μL sample was removed (=before) for later analysis. Then, 10.5 mg DMP were added to reach a final concentration of 20 mM and the samples were incubated for 30 min at RT on a rotating wheel. A 10 μL sample was removed (=after) for later analysis. The beads were washed twice with 0.2 M ethanolamine pH 8 and incubated in the same buffer for 2h at RT on a rotating wheel. The beads were washed twice with PBS and stored in the same buffer. The coupling efficiency was verified by silver staining of a SDS-PAGE gel as described before (5.2.2.2).

5.6.4 Pulldown All steps were performed in a cold room. The mitochondrial lysate was precleared with 240 μL 50% slurry Protein G SepharoseTM 4 Fast Flow (washed twice with MS TNN buffer) in a 15 mL Falcon tube for 1h at a rotating wheel. A volume of 20 μL was kept for later WB analysis (=LYS). The 93

sample was divided into two parts and each 120 μL of slurry Protein G SepharoseTM 4 Fast Flow coupled to URI1 or IgG2κa antibody were added. For each IgG2κa and URI1 pulldown, ~35 mg of total protein lysate were used. The samples were incubated in 15 mL Falcon tubes for 4h at a slowly rotating wheel. The beads were pelleted by centrifugation at 800 rpm for 3 min at a Heraeus Megafuge 40R (Thermo Scientific) and resuspended in MS TNN buffer. A volume of 20 μL was kept for WB analysis (=DEPL).

5.6.5 Washing and elution The beads were loaded on Micro Bio-Spin® columns (Bio-Rad) and washed four times with each 1 mL MS TNN buffer by pipetting slowly up and down but no flipping. The remnant liquid in the columns was removed using a pipette. The beads were washed four times with each 1.5 mL detergent free MS TNN buffer until bubbles were completely removed. Elution was performed three times with each 150 μL 1M glycine pH 2.5. The remnant liquid in the columns was added to the eluates using a pipette.

5.6.6 Mass spectrometry preparation

Immediately after elution, the eluates were neutralized by 50 μL 1M NH4HCO3 pH 8.8. To verify that a pH of 7 was reached, the samples were tested dropwise by a pH-indicator strip (Merck). A volume of 20 μL was kept each for WB and silver stain analysis (=ELU). The remnant beads were resuspended in 450 μL Laemmli buffer and a volume of 20 μL was kept each for WB and silver stain analysis

(=BEAD). Then, 200 mM TCEP in NH4CO3 was added to the eluates to a final concentration of 5 mM and samples were incubated at 37°C for 40 min. In the following, 200 mM iodoacetamide was added to the eluates to a final concentration of 10 mM and the samples were incubated at RT for 30 min in the dark. Each 1 μg of trypsin (Sequencing Grade Modified Trypsin, Promega) was added to the eluates and the samples were incubated at 37°C O/N. The next day, the samples were acidified with 10% formic acid. To verify that a pH of 2-3 was reached, the samples were tested dropwise by a pH- indicator strip. Then, 50% ACN (acetonitrile) was added to a final concentration of 1%. In the following, Ultra-Micro SpinColumnsTM (Harward) were prepared: a. The columns were washed twice with 200 μL pure ACN and centrifugation at 1000 rpm for 3 min on an Eppendorf Centrifuge 5415 D. b. Equilibration was performed three times by adding each 200 μL 0.1% formic acid and centrifugation at 1000 rpm for 3 min. The samples were loaded on the columns by avoiding bubbles and centrifuged at 1000 rpm for 3 min. This step was repeated until the entire samples were loaded. The flow through was added to the top of the column followed by centrifugation at 1000 rpm for 4 min. The columns were washed three times with each 200 μL 0.1% formic acid/5% ACN and centrifugation at 1000 rpm for 3 min. The samples

were eluted twice by adding each 100 μL 0.1% formic acid/50% ACN and centrifugation at 1000 rpm for 3 min. The samples were stored at -80°C.

5.6.7 Mass spectrometry This part was performed and written by Dr. Simon Hauri4. Tandem mass spectrometry analysis was performed on a LTQ Orbitrap XL (Thermo Fisher Scientific) connected to by a Proxeon EASY-nLC II liquid chromatography system (Thermo Fisher Scientific). Peptide separation was carried out using a 3 µm Magic C18 AQ RP-HPLC column (75 µm x 10 cm). Column equilibration and sample load were performed with 0.1% formic acid, 2% acetonitrile at constant 250 bar and 1 µl/min flow rate. The gradient was run using 0.1% formic acid, 98% acetonitrile using a linear gradient from 5% to 35% over 60 min at a flow rate of 300 nl/min. One high resolution MS scan in the Orbitrap (60,000 @ 400 m/z) was followed by MS/MS scans of the 6 most abundant signals. For fragmentation, collision induced dissociation (CID) was used at a normalized collision energy of 35. Charge state screening was enabled and unassigned or singly charged ions were rejected. The dynamic exclusion window was set to 15 s and limited to 300 entries. Only MS precursors that exceeded a threshold of 150 ion counts were allowed to trigger MS/MS scans. The ion accumulation time was set to 500 ms (MS) and 250 ms (MS/MS) using a target setting of 106 (MS) and 104 (MS/MS) ions. The obtained raw files were converted to mzXML using the ProteoWizard (Chambers et al., 2012).

5.6.8 Protein identification This part was performed and written by Dr. Simon Hauri. Acquired Thermo searched with X!Tandem (Craig and Beavis, 2004) against the human swissprot reference proteome database (http://www.uniprot.org). The database was extended with reverse decoy sequences for all entries. X!Tandem parameters were set to full tryptic digest (KR/P) allowing for 2 missed cleavages. Static peptide modification was set for cysteine carbamidomethylation (+57.021465 amu) and dynamic peptide modification for methionine oxidation (+ 15.99492 amu) and phosphorylation of serine, threonine and tyrosine (+79.966331 amu). The precursor mass error tolerance used was 25 ppm and the fragment mass error tolerance 0.5 amu. The resulting peptide spectrum matches were statistically evaluated using the trans proteomic pipeline v.4.5.1 (Deutsch et al., 2010), demanding a protein false discovery rate of <1%. The obtained pep.xml and prot.xml files were used as input for the software tool Abacus to calculate normalized spectral counts (Fermin et al., 2011).

4 Group of Dr. Matthias Gstaiger, Institute of Molecular Systems Biology, ETH Zurich 95

6 References

ACS, A. C. S. (2014). Cancer Facts & Figures 2014.

Agarwal, R., and Kaye, S. B. (2003). Ovarian cancer: strategies for overcoming resistance to chemotherapy. Nat Rev Cancer 3, 502-516.

Alberts, B. (2008). Molecular biology of the cell, 5th edn (New York: Garland Science).

Ashrafi, G., Schlehe, J. S., LaVoie, M. J., and Schwarz, T. L. (2014). Mitophagy of damaged mitochondria occurs locally in distal neuronal axons and requires PINK1 and Parkin. J Cell Biol 206, 655-670.

Ashrafi, G., and Schwarz, T. L. (2013). The pathways of mitophagy for quality control and clearance of mitochondria. Cell Death Differ 20, 31-42.

Bast, R. C., Jr., Hennessy, B., and Mills, G. B. (2009). The biology of ovarian cancer: new opportunities for translation. Nat Rev Cancer 9, 415-428.

Benard, J., Da Silva, J., De Blois, M. C., Boyer, P., Duvillard, P., Chiric, E., and Riou, G. (1985). Characterization of a human ovarian adenocarcinoma line, IGROV1, in tissue culture and in nude mice. Cancer Res 45, 4970-4979.

Bertolin, G., Ferrando-Miguel, R., Jacoupy, M., Traver, S., Grenier, K., Greene, A. W., Dauphin, A., Waharte, F., Bayot, A., Salamero, J., et al. (2013). The TOMM machinery is a molecular switch in PINK1 and PARK2/PARKIN-dependent mitochondrial clearance. Autophagy 9, 1801-1817.

Bingol, B., Tea, J. S., Phu, L., Reichelt, M., Bakalarski, C. E., Song, Q., Foreman, O., Kirkpatrick, D. S., and Sheng, M. (2014). The mitochondrial deubiquitinase USP30 opposes parkin-mediated mitophagy. Nature 510, 370-375.

Boland, M. L., Chourasia, A. H., and Macleod, K. F. (2013). Mitochondrial dysfunction in cancer. Front Oncol 3, 292.

Bollen, M., Peti, W., Ragusa, M. J., and Beullens, M. (2010). The extended PP1 toolkit: designed to create specificity. Trends Biochem Sci 35, 450-458.

Boulon, S., Pradet-Balade, B., Verheggen, C., Molle, D., Boireau, S., Georgieva, M., Azzag, K., Robert, M. C., Ahmad, Y., Neel, H., et al. (2010). HSP90 and its R2TP/Prefoldin-like cochaperone are involved in the cytoplasmic assembly of RNA polymerase II. Mol Cell 39, 912-924.

Bowtell, D. D. (2010). The genesis and evolution of high-grade serous ovarian cancer. Nat Rev Cancer 10, 803- 808.

Brucks, J. A. (1992). Ovarian cancer. The most lethal gynecologic malignancy. Nurs Clin North Am 27, 835- 845.

Carroll, R. G., Hollville, E., and Martin, S. J. (2014). Parkin sensitizes toward apoptosis induced by mitochondrial depolarization through promoting degradation of Mcl-1. Cell Rep 9, 1538-1553.

Caulfield, T. R., Fiesel, F. C., Moussaud-Lamodiere, E. L., Dourado, D. F., Flores, S. C., and Springer, W. (2014). Phosphorylation by PINK1 releases the UBL domain and initializes the conformational opening of the E3 ubiquitin ligase Parkin. PLoS Comput Biol 10, e1003935.

Ceulemans, H., and Bollen, M. (2004). Functional Diversity of Protein Phosphatase-1, a Cellular Economizer and Reset Button, Vol 84).

Ceulemans, H., Stalmans, W., and Bollen, M. (2002). Regulator-driven functional diversification of protein phosphatase-1 in eukaryotic evolution. Bioessays 24, 371-381.

Chambers, M. C., Maclean, B., Burke, R., Amodei, D., Ruderman, D. L., Neumann, S., Gatto, L., Fischer, B., Pratt, B., Egertson, J., et al. (2012). A cross-platform toolkit for mass spectrometry and proteomics. Nature biotechnology 30, 918-920.

Chan, D. C. (2006). Mitochondria: dynamic organelles in disease, aging, and development. Cell 125, 1241-1252.

Charan, R. A., Johnson, B. N., Zaganelli, S., Nardozzi, J. D., and LaVoie, M. J. (2014). Inhibition of apoptotic Bax translocation to the mitochondria is a central function of parkin. Cell Death Dis 5, e1313.

Chaugule, V. K., Burchell, L., Barber, K. R., Sidhu, A., Leslie, S. J., Shaw, G. S., and Walden, H. (2011). Autoregulation of Parkin activity through its ubiquitin-like domain. Embo j 30, 2853-2867.

Chen, G., Han, Z., Feng, D., Chen, Y., Chen, L., Wu, H., Huang, L., Zhou, C., Cai, X., Fu, C., et al. (2014). A regulatory signaling loop comprising the PGAM5 phosphatase and CK2 controls receptor-mediated mitophagy. Mol Cell 54, 362-377.

Chen, P. C., Li, C., Wang, D., Luo, Z. W., Fu, S. J., Li, X., Li, Z. L., Chen, X. W., Li, L., Huang, Z. X., et al. (2013). PP-1alpha and PP-1gamma display antagonism and differential roles in tumorigenicity of lung cancer cells. Curr Mol Med 13, 220-227.

Chen, Y., and Dorn, G. W., 2nd (2013). PINK1-phosphorylated mitofusin 2 is a Parkin receptor for culling damaged mitochondria. Science 340, 471-475.

Cho, K. R., and Shih, I. M. (2009). Ovarian cancer. Annu Rev Pathol 4, 287-313.

Cohen, P. (2000). The regulation of protein function by multisite phosphorylation--a 25 year update. Trends Biochem Sci 25, 596-601.

Cohen, P. T. (2002). Protein phosphatase 1--targeted in many directions. J Cell Sci 115, 241-256.

Cohen, P. W. (2004). Overview of protein serine/threonine phosphatases. In Protein Phosphatases, J. Ariño, and D. Alexander, eds. (Springer Berlin Heidelberg), pp. 1-20.

Craig, R., and Beavis, R. C. (2004). TANDEM: matching proteins with tandem mass spectra. Bioinformatics (Oxford, England) 20, 1466-1467.

Datta, S. R., Katsov, A., Hu, L., Petros, A., Fesik, S. W., Yaffe, M. B., and Greenberg, M. E. (2000). 14-3-3 proteins and survival kinases cooperate to inactivate BAD by BH3 domain phosphorylation. Mol Cell 6, 41-51.

Davis, S. J., Sheppard, K. E., Pearson, R. B., Campbell, I. G., Gorringe, K. L., and Simpson, K. J. (2013). Functional analysis of genes in regions commonly amplified in high-grade serous and endometrioid ovarian cancer. Clin Cancer Res 19, 1411-1421. de Graaf, A. O., van den Heuvel, L. P., Dijkman, H. B., de Abreu, R. A., Birkenkamp, K. U., de Witte, T., van der Reijden, B. A., Smeitink, J. A., and Jansen, J. H. (2004). Bcl-2 prevents loss of mitochondria in CCCP- induced apoptosis. Exp Cell Res 299, 533-540.

Deng, H., Dodson, M. W., Huang, H., and Guo, M. (2008). The Parkinson's disease genes pink1 and parkin promote mitochondrial fission and/or inhibit fusion in Drosophila. Proc Natl Acad Sci U S A 105, 14503-14508.

Detmer, S. A., and Chan, D. C. (2007). Functions and dysfunctions of mitochondrial dynamics. Nat Rev Mol Cell Biol 8, 870-879.

Deutsch, E. W., Mendoza, L., Shteynberg, D., Farrah, T., Lam, H., Tasman, N., Sun, Z., Nilsson, E., Pratt, B., Prazen, B., et al. (2010). A guided tour of the Trans-Proteomic Pipeline. Proteomics 10, 1150-1159.

Djouder, N., Metzler, S. C., Schmidt, A., Wirbelauer, C., Gstaiger, M., Aebersold, R., Hess, D., and Krek, W. (2007). S6K1-mediated disassembly of mitochondrial URI/PP1gamma complexes activates a negative feedback program that counters S6K1 survival signaling. Mol Cell 28, 28-40.

Dorjsuren, D., Lin, Y., Wei, W., Yamashita, T., Nomura, T., Hayashi, N., and Murakami, S. (1998). RMP, a novel RNA polymerase II subunit 5-interacting protein, counteracts transactivation by hepatitis B virus X protein. Mol Cell Biol 18, 7546-7555.

East, D. A., Fagiani, F., Crosby, J., Georgakopoulos, N. D., Bertrand, H., Schaap, M., Fowkes, A., Wells, G., and Campanella, M. (2014). PMI: A DeltaPsi Independent Pharmacological Regulator of Mitophagy. Chem Biol 21, 1585-1596.

Egger, L., Schneider, J., Rheme, C., Tapernoux, M., Hacki, J., and Borner, C. (2003). Serine proteases mediate apoptosis-like cell death and phagocytosis under caspase-inhibiting conditions. Cell Death Differ 10, 1188-1203.

Emoto, M., Oshima, K., Ishiguro, M., Iwasaki, H., Kawarabayashi, T., and Kikuchi, M. (1999). Establishment and characterization of a serous papillary adenocarcinoma cell line of the human ovary in a serum-free culture. Pathol Res Pract 195, 237-242.

Etemadmoghadam, D., deFazio, A., Beroukhim, R., Mermel, C., George, J., Getz, G., Tothill, R., Okamoto, A., Raeder, M. B., Harnett, P., et al. (2009). Integrated genome-wide DNA copy number and expression analysis identifies distinct mechanisms of primary chemoresistance in ovarian carcinomas. Clin Cancer Res 15, 1417- 1427.

Etemadmoghadam, D., Weir, B. A., Au-Yeung, G., Alsop, K., Mitchell, G., George, J., Australian Ovarian Cancer Study, G., Davis, S., D'Andrea, A. D., Simpson, K., et al. (2013). Synthetic lethality between CCNE1 amplification and loss of BRCA1. Proc Natl Acad Sci U S A 110, 19489-19494.

Fermin, D., Basrur, V., Yocum, A. K., and Nesvizhskii, A. I. (2011). Abacus: a computational tool for extracting and pre-processing spectral count data for label-free quantitative proteomic analysis. Proteomics 11, 1340-1345.

Fischer, E. H., and Krebs, E. G. (1955). Conversion of phosphorylase b to phosphorylase a in muscle extracts. J Biol Chem 216, 121-132.

Fogh, J., Wright, W. C., and Loveless, J. D. (1977). Absence of HeLa cell contamination in 169 cell lines derived from human tumors. J Natl Cancer Inst 58, 209-214.

Fry, A. M. (2002). The Nek2 protein kinase: a novel regulator of centrosome structure. Oncogene 21, 6184- 6194.

Fujiki, H., and Suganuma, M. (2009). Carcinogenic aspects of protein phosphatase 1 and 2A inhibitors. Prog Mol Subcell Biol 46, 221-254.

Fulda, S., and Vucic, D. (2012). Targeting IAP proteins for therapeutic intervention in cancer. Nat Rev Drug Discov 11, 109-124.

Geisler, S., Holmstrom, K. M., Skujat, D., Fiesel, F. C., Rothfuss, O. C., Kahle, P. J., and Springer, W. (2010). PINK1/Parkin-mediated mitophagy is dependent on VDAC1 and p62/SQSTM1. Nat Cell Biol 12, 119-131.

Gey, G., Coffman, Wd, Kuicek, MT (1952). Tissue culture studies of proliferative capacity of cervical carcinoma and normal epithelium. Cancer Res 12, 264-265.

Goff, B. A., Mandel, L., Muntz, H. G., and Melancon, C. H. (2000). Ovarian carcinoma diagnosis. Cancer 89, 2068-2075.

Gomes, L. C., and Scorrano, L. (2013). Mitochondrial morphology in mitophagy and macroautophagy. Biochimica et Biophysica Acta (BBA) - Molecular Cell Research 1833, 205-212.

Grady, W. M., and Markowitz, S. D. (2002). Genetic and epigenetic alterations in colon cancer. Annu Rev Genomics Hum Genet 3, 101-128.

Greene, A. W., Grenier, K., Aguileta, M. A., Muise, S., Farazifard, R., Haque, M. E., McBride, H. M., Park, D. S., and Fon, E. A. (2012). Mitochondrial processing peptidase regulates PINK1 processing, import and Parkin recruitment. EMBO Rep 13, 378-385.

Grimm, D., Hofstadter, F., Bauer, J., Spruss, T., Steinbach, P., Bernhardt, G., and Menze, R. (1992). Establishment and characterization of a human papillary thyroid carcinoma cell line with oxyphilic differentiation (ONCO-DG 1). Virchows Arch B Cell Pathol Incl Mol Pathol 62, 97-104.

Gstaiger, M., and Krek, W. (unpublished). A protein interaction map of the human prefoldin chaperone family. unpublished.

Gstaiger, M., Luke, B., Hess, D., Oakeley, E. J., Wirbelauer, C., Blondel, M., Vigneron, M., Peter, M., and Krek, W. (2003). Control of nutrient-sensitive transcription programs by the unconventional prefoldin URI. Science 302, 1208-1212.

Hajek, P., Chomyn, A., and Attardi, G. (2007). Identification of a novel mitochondrial complex containing mitofusin 2 and stomatin-like protein 2. J Biol Chem 282, 5670-5681.

Hamilton, T. C., Young, R. C., McKoy, W. M., Grotzinger, K. R., Green, J. A., Chu, E. W., Whang-Peng, J., Rogan, A. M., Green, W. R., and Ozols, R. F. (1983). Characterization of a human ovarian carcinoma cell line (NIH:OVCAR-3) with androgen and estrogen receptors. Cancer Res 43, 5379-5389.

Hamilton, T. C., Young, R. C., and Ozols, R. F. (1984). Experimental model systems of ovarian cancer: applications to the design and evaluation of new treatment approaches. Semin Oncol 11, 285-298.

Hanahan, D., and Weinberg, R. A. (2000). The hallmarks of cancer. Cell 100, 57-70.

Hanahan, D., and Weinberg, R. A. (2011). Hallmarks of cancer: the next generation. Cell 144, 646-674.

Harada, H., Andersen, J. S., Mann, M., Terada, N., and Korsmeyer, S. J. (2001). p70S6 kinase signals cell survival as well as growth, inactivating the pro-apoptotic molecule BAD. Proc Natl Acad Sci U S A 98, 9666- 9670.

Hasson, S. A., Kane, L. A., Yamano, K., Huang, C. H., Sliter, D. A., Buehler, E., Wang, C., Heman-Ackah, S. M., Hessa, T., Guha, R., et al. (2013). High-content genome-wide RNAi screens identify regulators of parkin upstream of mitophagy. Nature 504, 291-295.

Hendrickx, A., Beullens, M., Ceulemans, H., Den Abt, T., Van Eynde, A., Nicolaescu, E., Lesage, B., and Bollen, M. (2009). Docking Motif-Guided Mapping of the Interactome of Protein Phosphatase-1. Chemistry & Biology 16, 365-371.

Heroes, E., Lesage, B., Gornemann, J., Beullens, M., Van Meervelt, L., and Bollen, M. (2013). The PP1 binding code: a molecular-lego strategy that governs specificity. FEBS J 280, 584-595.

Hippert, M. M., O'Toole, P. S., and Thorburn, A. (2006). Autophagy in cancer: good, bad, or both? Cancer Res 66, 9349-9351.

Hsu, L. C., Huang, X., Seasholtz, S., Potter, D. M., and Gollin, S. M. (2006). Gene amplification and overexpression of protein phosphatase 1alpha in oral squamous cell carcinoma cell lines. Oncogene 25, 5517- 5526.

Hunter, T. (2000). Signaling--2000 and beyond. Cell 100, 113-127.

Hurley, T. D., Yang, J., Zhang, L., Goodwin, K. D., Zou, Q., Cortese, M., Dunker, A. K., and DePaoli-Roach, A. A. (2007). Structural basis for regulation of protein phosphatase 1 by inhibitor-2. J Biol Chem 282, 28874- 28883.

Ichimura, Y., Kirisako, T., Takao, T., Satomi, Y., Shimonishi, Y., Ishihara, N., Mizushima, N., Tanida, I., Kominami, E., Ohsumi, M., et al. (2000). A ubiquitin-like system mediates protein lipidation. Nature 408, 488- 492.

Imai, Y., Kanao, T., Sawada, T., Kobayashi, Y., Moriwaki, Y., Ishida, Y., Takeda, K., Ichijo, H., Lu, B., and Takahashi, R. (2010). The loss of PGAM5 suppresses the mitochondrial degeneration caused by inactivation of PINK1 in Drosophila. PLoS Genet 6, e1001229.

Jedrzejas, M. J. (2000). Structure, function, and evolution of phosphoglycerate mutases: comparison with fructose-2,6-bisphosphatase, acid phosphatase, and alkaline phosphatase. Prog Biophys Mol Biol 73, 263-287.

Jemal, A., Siegel, R., Ward, E., Hao, Y., Xu, J., Murray, T., and Thun, M. J. (2008). Cancer statistics, 2008. CA Cancer J Clin 58, 71-96.

Jin, S. M., Lazarou, M., Wang, C., Kane, L. A., Narendra, D. P., and Youle, R. J. (2010). Mitochondrial membrane potential regulates PINK1 import and proteolytic destabilization by PARL. J Cell Biol 191, 933-942.

Jin, S. M., and Youle, R. J. (2012). PINK1- and Parkin-mediated mitophagy at a glance. J Cell Sci 125, 795-799.

Kanamaru, Y., Sekine, S., Ichijo, H., and Takeda, K. (2012). The phosphorylation-dependent regulation of mitochondrial proteins in stress responses. J Signal Transduct 2012, 931215.

Kane, L. A., Lazarou, M., Fogel, A. I., Li, Y., Yamano, K., Sarraf, S. A., Banerjee, S., and Youle, R. J. (2014). PINK1 phosphorylates ubiquitin to activate Parkin E3 ubiquitin ligase activity. J Cell Biol 205, 143-153.

Katayama, H., Kogure, T., Mizushima, N., Yoshimori, T., and Miyawaki, A. (2011). A sensitive and quantitative technique for detecting autophagic events based on lysosomal delivery. Chem Biol 18, 1042-1052.

Katsogiannou, M., Andrieu, C., and Rocchi, P. (2014). Heat shock protein 27 phosphorylation state is associated with cancer progression. Frontiers in Genetics 5, 346.

Kazlauskaite, A., Kondapalli, C., Gourlay, R., Campbell, D. G., Ritorto, M. S., Hofmann, K., Alessi, D. R., Knebel, A., Trost, M., and Muqit, M. M. (2014). Parkin is activated by PINK1-dependent phosphorylation of ubiquitin at Ser65. Biochem J 460, 127-139.

Kim, A., Ueda, Y., Naka, T., and Enomoto, T. (2012a). Therapeutic strategies in epithelial ovarian cancer. J Exp Clin Cancer Res 31, 14.

Kim, J., Coffey, D. M., Creighton, C. J., Yu, Z., Hawkins, S. M., and Matzuk, M. M. (2012b). High-grade serous ovarian cancer arises from fallopian tube in a mouse model. Proc Natl Acad Sci U S A 109, 3921-3926.

Knott, A. B., Perkins, G., Schwarzenbacher, R., and Bossy-Wetzel, E. (2008). Mitochondrial fragmentation in neurodegeneration. Nat Rev Neurosci 9, 505-518.

Koyano, F., Okatsu, K., Kosako, H., Tamura, Y., Go, E., Kimura, M., Kimura, Y., Tsuchiya, H., Yoshihara, H., Hirokawa, T., et al. (2014). Ubiquitin is phosphorylated by PINK1 to activate parkin. Nature 510, 162-166.

Kroemer, G., and Pouyssegur, J. (2008). Tumor cell metabolism: cancer's Achilles' heel. Cancer Cell 13, 472- 482.

Kurman, R. J., and Shih, I.-M. (2010). The Origin and Pathogenesis of Epithelial Ovarian Cancer- a Proposed Unifying Theory. The American journal of surgical pathology 34, 433-443.

Langer, T., Kaser, M., Klanner, C., and Leonhard, K. (2001). AAA proteases of mitochondria: quality control of membrane proteins and regulatory functions during mitochondrial biogenesis. Biochem Soc Trans 29, 431-436.

Lazarou, M., Jin, S. M., Kane, L. A., and Youle, R. J. (2012). Role of PINK1 binding to the TOM complex and alternate intracellular membranes in recruitment and activation of the E3 ligase Parkin. Dev Cell 22, 320-333.

Lazebnik, Y. A., Kaufmann, S. H., Desnoyers, S., Poirier, G. G., and Earnshaw, W. C. (1994). Cleavage of poly(ADP-ribose) polymerase by a proteinase with properties like ICE. Nature 371, 346-347.

Lin, L., Prescott, M. S., Zhu, Z., Singh, P., Chun, S. Y., Kuick, R. D., Hanash, S. M., Orringer, M. B., Glover, T. W., and Beer, D. G. (2000). Identification and characterization of a 19q12 amplicon in esophageal adenocarcinomas reveals cyclin E as the best candidate gene for this amplicon. Cancer Res 60, 7021-7027.

100

Lito, P., Pratilas, C. A., Joseph, E. W., Tadi, M., Halilovic, E., Zubrowski, M., Huang, A., Wong, W. L., Callahan, M. K., Merghoub, T., et al. (2012). Relief of profound feedback inhibition of mitogenic signaling by RAF inhibitors attenuates their activity in BRAFV600E melanomas. Cancer Cell 22, 668-682.

Liu, C. W., Wang, R. H., Dohadwala, M., Schonthal, A. H., Villa-Moruzzi, E., and Berndt, N. (1999). Inhibitory phosphorylation of PP1alpha catalytic subunit during the G(1)/S transition. J Biol Chem 274, 29470-29475.

Liu, L., Feng, D., Chen, G., Chen, M., Zheng, Q., Song, P., Ma, Q., Zhu, C., Wang, R., Qi, W., et al. (2012). Mitochondrial outer-membrane protein FUNDC1 mediates hypoxia-induced mitophagy in mammalian cells. Nat Cell Biol 14, 177-185.

Liu, Y., Virshup, D. M., White, R. L., and Hsu, L. C. (2002). Regulation of BRCA1 phosphorylation by interaction with protein phosphatase 1alpha. Cancer Res 62, 6357-6361.

Lo, S. C., and Hannink, M. (2006). PGAM5, a Bcl-XL-interacting protein, is a novel substrate for the redox- regulated Keap1-dependent ubiquitin ligase complex. J Biol Chem 281, 37893-37903.

Lo, S. C., and Hannink, M. (2008). PGAM5 tethers a ternary complex containing Keap1 and Nrf2 to mitochondria. Exp Cell Res 314, 1789-1803.

Lu, H., Li, G., Liu, L., Feng, L., Wang, X., and Jin, H. (2013). Regulation and function of mitophagy in development and cancer. Autophagy 9, 1720-1736.

Lu, W., Karuppagounder, S. S., Springer, D. A., Allen, M. D., Zheng, L., Chao, B., Zhang, Y., Dawson, V. L., Dawson, T. M., and Lenardo, M. (2014). Genetic deficiency of the mitochondrial protein PGAM5 causes a Parkinson's-like movement disorder. Nat Commun 5, 4930.

Luo, J., Solimini, N. L., and Elledge, S. J. (2009). Principles of Cancer Therapy: Oncogene and Non-oncogene Addiction. Cell 136, 823-837.

MacFarlane, M., Merrison, W., Bratton, S. B., and Cohen, G. M. (2002). Proteasome-mediated degradation of Smac during apoptosis: XIAP promotes Smac ubiquitination in vitro. J Biol Chem 277, 36611-36616.

Manning, G., Whyte, D. B., Martinez, R., Hunter, T., and Sudarsanam, S. (2002). The protein kinase complement of the human genome. Science 298, 1912-1934.

Marshall, K. D., and Baines, C. P. (2014). Necroptosis: is there a role for mitochondria? Front Physiol 5, 323.

Mathew, R., Karantza-Wadsworth, V., and White, E. (2007). Role of autophagy in cancer. Nat Rev Cancer 7, 961-967.

Mita, P., Savas, J. N., Ha, S., Djouder, N., Yates, J. R., 3rd, and Logan, S. K. (2013). Analysis of URI nuclear interaction with RPB5 and components of the R2TP/prefoldin-like complex. PLoS One 8, e63879.

Mizushima, N. (2007). Autophagy: process and function. Genes Dev 21, 2861-2873.

Moorhead, G. B., Trinkle-Mulcahy, L., and Ulke-Lemee, A. (2007). Emerging roles of nuclear protein phosphatases. Nat Rev Mol Cell Biol 8, 234-244.

Narendra, D., Tanaka, A., Suen, D. F., and Youle, R. J. (2008). Parkin is recruited selectively to impaired mitochondria and promotes their autophagy. J Cell Biol 183, 795-803.

Narendra, D. P., Jin, S. M., Tanaka, A., Suen, D. F., Gautier, C. A., Shen, J., Cookson, M. R., and Youle, R. J. (2010). PINK1 is selectively stabilized on impaired mitochondria to activate Parkin. PLoS Biol 8, e1000298.

Narendra, D. P., and Youle, R. J. (2011). Targeting mitochondrial dysfunction: role for PINK1 and Parkin in mitochondrial quality control. Antioxid Redox Signal 14, 1929-1938.

Nowell, P. C. (1976). The clonal evolution of tumor cell populations. Science 194, 23-28.

101

Nunnari, J., and Suomalainen, A. (2012). Mitochondria: in sickness and in health. Cell 148, 1145-1159.

Okamoto, K. (2014). Organellophagy: eliminating cellular building blocks via selective autophagy. J Cell Biol 205, 435-445.

Okatsu, K., Oka, T., Iguchi, M., Imamura, K., Kosako, H., Tani, N., Kimura, M., Go, E., Koyano, F., Funayama, M., et al. (2012). PINK1 autophosphorylation upon membrane potential dissipation is essential for Parkin recruitment to damaged mitochondria. Nat Commun 3, 1016.

Okatsu, K., Saisho, K., Shimanuki, M., Nakada, K., Shitara, H., Sou, Y. S., Kimura, M., Sato, S., Hattori, N., Komatsu, M., et al. (2010). p62/SQSTM1 cooperates with Parkin for perinuclear clustering of depolarized mitochondria. Genes Cells 15, 887-900.

Olsen, J. V., Blagoev, B., Gnad, F., Macek, B., Kumar, C., Mortensen, P., and Mann, M. (2006). Global, in vivo, and site-specific phosphorylation dynamics in signaling networks. Cell 127, 635-648.

Otera, H., Wang, C., Cleland, M. M., Setoguchi, K., Yokota, S., Youle, R. J., and Mihara, K. (2010). Mff is an essential factor for mitochondrial recruitment of Drp1 during mitochondrial fission in mammalian cells. J Cell Biol 191, 1141-1158.

Pankiv, S., Clausen, T. H., Lamark, T., Brech, A., Bruun, J. A., Outzen, H., Overvatn, A., Bjorkoy, G., and Johansen, T. (2007). p62/SQSTM1 binds directly to Atg8/LC3 to facilitate degradation of ubiquitinated protein aggregates by autophagy. J Biol Chem 282, 24131-24145.

Pereira, S. R., Vasconcelos, V. M., and Antunes, A. (2011). The phosphoprotein phosphatase family of Ser/Thr phosphatases as principal targets of naturally occurring toxins. Critical Reviews in Toxicology 41, 83-110.

Perets, R., Wyant, G. A., Muto, K. W., Bijron, J. G., Poole, B. B., Chin, K. T., Chen, J. Y., Ohman, A. W., Stepule, C. D., Kwak, S., et al. (2013). Transformation of the fallopian tube secretory epithelium leads to high- grade serous ovarian cancer in Brca;Tp53;Pten models. Cancer Cell 24, 751-765.

Ponten, J., and Saksela, E. (1967). Two established in vitro cell lines from human mesenchymal tumours. Int J Cancer 2, 434-447.

Prat, J. (2012). New insights into ovarian cancer pathology. Ann Oncol 23 Suppl 10, x111-117.

Provencher, D. M., Lounis, H., Champoux, L., Tetrault, M., Manderson, E. N., Wang, J. C., Eydoux, P., Savoie, R., Tonin, P. N., and Mes-Masson, A. M. (2000). Characterization of four novel epithelial ovarian cancer cell lines. In Vitro Cell Dev Biol Anim 36, 357-361.

Rakovic, A., Shurkewitsch, K., Seibler, P., Grunewald, A., Zanon, A., Hagenah, J., Krainc, D., and Klein, C. (2013). Phosphatase and tensin homolog (PTEN)-induced putative kinase 1 (PINK1)-dependent ubiquitination of endogenous Parkin attenuates mitophagy: study in human primary fibroblasts and induced pluripotent stem cell- derived neurons. J Biol Chem 288, 2223-2237.

Sabatini, D. M. (2006). mTOR and cancer: insights into a complex relationship. Nat Rev Cancer 6, 729-734.

Sacco, F., Perfetto, L., Castagnoli, L., and Cesareni, G. (2012). The human phosphatase interactome: An intricate family portrait. FEBS Lett 586, 2732-2739.

Sadatomi, D., Tanimura, S., Ozaki, K., and Takeda, K. (2013). Atypical protein phosphatases: emerging players in cellular signaling. Int J Mol Sci 14, 4596-4612.

Sarraf, S. A., Raman, M., Guarani-Pereira, V., Sowa, M. E., Huttlin, E. L., Gygi, S. P., and Harper, J. W. (2013). Landscape of the PARKIN-dependent ubiquitylome in response to mitochondrial depolarization. Nature 496, 372-376.

Sayeed, A., Meng, Z., Luciani, G., Chen, L. C., Bennington, J. L., and Dairkee, S. H. (2010). Negative regulation of UCP2 by TGF[beta] signaling characterizes low and intermediate-grade primary breast cancer. Cell Death and Dis 1, e53.

102

Schraml, P., Bucher, C., Bissig, H., Nocito, A., Haas, P., Wilber, K., Seelig, S., Kononen, J., Mihatsch, M. J., Dirnhofer, S., and Sauter, G. (2003). Cyclin E overexpression and amplification in human tumours. J Pathol 200, 375-382.

Sekine, S., Kanamaru, Y., Koike, M., Nishihara, A., Okada, M., Kinoshita, H., Kamiyama, M., Maruyama, J., Uchiyama, Y., Ishihara, N., et al. (2012). Rhomboid protease PARL mediates the mitochondrial membrane potential loss-induced cleavage of PGAM5. J Biol Chem 287, 34635-34645.

Shiba-Fukushima, K., Imai, Y., Yoshida, S., Ishihama, Y., Kanao, T., Sato, S., and Hattori, N. (2012). PINK1- mediated phosphorylation of the Parkin ubiquitin-like domain primes mitochondrial translocation of Parkin and regulates mitophagy. Sci Rep 2, 1002.

Siegert, R., Leroux, M. R., Scheufler, C., Hartl, F. U., and Moarefi, I. (2000). Structure of the molecular chaperone prefoldin: unique interaction of multiple coiled coil tentacles with unfolded proteins. Cell 103, 621- 632.

Soubannier, V., McLelland, G. L., Zunino, R., Braschi, E., Rippstein, P., Fon, E. A., and McBride, H. M. (2012). A vesicular transport pathway shuttles cargo from mitochondria to lysosomes. Curr Biol 22, 135-141.

Stegmeier, F., Warmuth, M., Sellers, W. R., and Dorsch, M. (2010). Targeted cancer therapies in the twenty-first century: lessons from imatinib. Clin Pharmacol Ther 87, 543-552.

Stewart, B. W., and Kleihues, P. (2003). World Cancer Report. IARC Press.

Tait, S. W., and Green, D. R. (2010). Mitochondria and cell death: outer membrane permeabilization and beyond. Nat Rev Mol Cell Biol 11, 621-632.

Takeda, K., Komuro, Y., Hayakawa, T., Oguchi, H., Ishida, Y., Murakami, S., Noguchi, T., Kinoshita, H., Sekine, Y., Iemura, S., et al. (2009). Mitochondrial phosphoglycerate mutase 5 uses alternate catalytic activity as a protein serine/threonine phosphatase to activate ASK1. Proc Natl Acad Sci U S A 106, 12301-12305.

Taylor, R. C., Cullen, S. P., and Martin, S. J. (2008). Apoptosis: controlled demolition at the cellular level. Nat Rev Mol Cell Biol 9, 231-241.

TGCA research network, T. C. G. A. R. N. (2011). Integrated genomic analyses of ovarian carcinoma. Nature 474, 609-615.

Theurillat, J. P., Metzler, S. C., Henzi, N., Djouder, N., Helbling, M., Zimmermann, A. K., Jacob, F., Soltermann, A., Caduff, R., Heinzelmann-Schwarz, V., et al. (2011). URI is an oncogene amplified in ovarian cancer cells and is required for their survival. Cancer Cell 19, 317-332.

Tonks, N. K. (2006). Protein tyrosine phosphatases: from genes, to function, to disease. Nat Rev Mol Cell Biol 7, 833-846.

Tsao, S. W., Mok, S. C., Fey, E. G., Fletcher, J. A., Wan, T. S., Chew, E. C., Muto, M. G., Knapp, R. C., and Berkowitz, R. S. (1995). Characterization of human ovarian surface epithelial cells immortalized by human papilloma viral oncogenes (HPV-E6E7 ORFs). Exp Cell Res 218, 499-507.

Tummala, K. S., Gomes, A. L., Yilmaz, M., Grana, O., Bakiri, L., Ruppen, I., Ximenez-Embun, P., Sheshappanavar, V., Rodriguez-Justo, M., Pisano, D. G., et al. (2014). Inhibition of De Novo NAD(+) Synthesis by Oncogenic URI Causes Liver Tumorigenesis through DNA Damage. Cancer Cell 26, 826-839.

Twig, G., Elorza, A., Molina, A. J., Mohamed, H., Wikstrom, J. D., Walzer, G., Stiles, L., Haigh, S. E., Katz, S., Las, G., et al. (2008a). Fission and selective fusion govern mitochondrial segregation and elimination by autophagy. Embo j 27, 433-446.

Twig, G., Hyde, B., and Shirihai, O. S. (2008b). Mitochondrial fusion, fission and autophagy as a quality control axis: the bioenergetic view. Biochim Biophys Acta 1777, 1092-1097.

Vainberg, I. E., Lewis, S. A., Rommelaere, H., Ampe, C., Vandekerckhove, J., Klein, H. L., and Cowan, N. J. (1998). Prefoldin, a chaperone that delivers unfolded proteins to cytosolic chaperonin. Cell 93, 863-873. 103

van den Berg-Bakker, C. A., Hagemeijer, A., Franken-Postma, E. M., Smit, V. T., Kuppen, P. J., van Ravenswaay Claasen, H. H., Cornelisse, C. J., and Schrier, P. I. (1993). Establishment and characterization of 7 ovarian carcinoma cell lines and one granulosa tumor cell line: growth features and cytogenetics. Int J Cancer 53, 613-620.

Varfolomeev, E., Blankenship, J. W., Wayson, S. M., Fedorova, A. V., Kayagaki, N., Garg, P., Zobel, K., Dynek, J. N., Elliott, L. O., Wallweber, H. J. A., et al. (2007). IAP Antagonists Induce Autoubiquitination of c- IAPs, NF-κB Activation, and TNFα-Dependent Apoptosis. Cell 131, 669-681.

Virshup, D. M., and Shenolikar, S. (2009). From promiscuity to precision: protein phosphatases get a makeover. Mol Cell 33, 537-545.

Vives-Bauza, C., Zhou, C., Huang, Y., Cui, M., de Vries, R. L., Kim, J., May, J., Tocilescu, M. A., Liu, W., Ko, H. S., et al. (2010). PINK1-dependent recruitment of Parkin to mitochondria in mitophagy. Proc Natl Acad Sci U S A 107, 378-383.

Vogelstein, B., and Kinzler, K. W. (1993). The multistep nature of cancer. Trends Genet 9, 138-141.

Vucic, D., Dixit, V. M., and Wertz, I. E. (2011). Ubiquitylation in apoptosis: a post-translational modification at the edge of life and death. Nat Rev Mol Cell Biol 12, 439-452.

Wang, P., Bai, Y., Song, B., Wang, Y., Liu, D., Lai, Y., Bi, X., and Yuan, Z. (2011). PP1A-mediated dephosphorylation positively regulates YAP2 activity. PLoS One 6, e24288.

Wang, Z., Jiang, H., Chen, S., Du, F., and Wang, X. (2012). The mitochondrial phosphatase PGAM5 functions at the convergence point of multiple necrotic death pathways. Cell 148, 228-243.

Weinberg, R. A. (2014). Biology of Cancer, Second Edition. Biology of Cancer, Second Edition, 1-876.

Weinstein, I. B. (2000). Disorders in cell circuitry during multistage carcinogenesis: the role of homeostasis. Carcinogenesis 21, 857-864.

Weinstein, I. B. (2002). Cancer. Addiction to oncogenes--the Achilles heal of cancer. Science 297, 63-64.

Westermann, B. (2010). Mitochondrial fusion and fission in cell life and death. Nat Rev Mol Cell Biol 11, 872- 884.

Whitesell, L., and Lindquist, S. L. (2005). HSP90 and the chaperoning of cancer. Nat Rev Cancer 5, 761-772.

WHO, W. H. O. (2014). Fact Sheet N°297: Cancer.

Wong, T. W., Lee, F. Y., Yu, C., Luo, F. R., Oppenheimer, S., Zhang, H., Smykla, R. A., Mastalerz, H., Fink, B. E., Hunt, J. T., et al. (2006). Preclinical antitumor activity of BMS-599626, a pan-HER kinase inhibitor that inhibits HER1/HER2 homodimer and heterodimer signaling. Clin Cancer Res 12, 6186-6193.

Wu, H., Xue, D., Chen, G., Han, Z., Huang, L., Zhu, C., Wang, X., Jin, H., Wang, J., Zhu, Y., et al. (2014). The BCL2L1 and PGAM5 axis defines hypoxia-induced receptor-mediated mitophagy. Autophagy 10, 1712-1725.

Xiao, L., Gong, L. L., Yuan, D., Deng, M., Zeng, X. M., Chen, L. L., Zhang, L., Yan, Q., Liu, J. P., Hu, X. H., et al. (2010). Protein phosphatase-1 regulates Akt1 signal transduction pathway to control gene expression, cell survival and differentiation. Cell Death Differ 17, 1448-1462.

Yamamoto, H., Esaki, M., Kanamori, T., Tamura, Y., Nishikawa, S., and Endo, T. (2002). Tim50 is a subunit of the TIM23 complex that links protein translocation across the outer and inner mitochondrial membranes. Cell 111, 519-528.

Youle, R. J., and Narendra, D. P. (2011). Mechanisms of mitophagy. Nat Rev Mol Cell Biol 12, 9-14.

Youle, R. J., and Strasser, A. (2008). The BCL-2 protein family: opposing activities that mediate cell death. Nat Rev Mol Cell Biol 9, 47-59.

104

Youle, R. J., and van der Bliek, A. M. (2012). Mitochondrial fission, fusion, and stress. Science 337, 1062-1065.

Young, J. C., Agashe, V. R., Siegers, K., and Hartl, F. U. (2004). Pathways of chaperone-mediated protein folding in the cytosol. Nat Rev Mol Cell Biol 5, 781-791.

Yu, W., Sun, Y., Guo, S., and Lu, B. (2011). The PINK1/Parkin pathway regulates mitochondrial dynamics and function in mammalian hippocampal and dopaminergic neurons. Hum Mol Genet 20, 3227-3240.

Zhang, C., Lee, S., Peng, Y., Bunker, E., Giaime, E., Shen, J., Zhou, Z., and Liu, X. (2014). PINK1 triggers autocatalytic activation of Parkin to specify cell fate decisions. Curr Biol 24, 1854-1865.

Zhuang, M., Guan, S., Wang, H., Burlingame, A. L., and Wells, J. A. (2013). Substrates of IAP ubiquitin ligases identified with a designed orthogonal E3 ligase, the NEDDylator. Mol Cell 49, 273-282.

105

7 Supplementary data 7.1 Supplementary figures

Supplementary Figure 1 | Cancer Cell Line Encyclopedia (CCLE) analysis URI1 copy number variation (CNV) to URI1 mRNA expression of ovarian cancer cells lines based on Supplementary Table 1. Cell lines used for this study are indicated, TOV-21G and SKOV3 cells are additional labeled in green.

106

Supplementary Figure 2 | siRNA-based screen of Ser/Thr specific protein phosphatases, part 1

(A-E) HeLa cells were transfected with pooled siRNAs targeting the indicated genes or the control siRNA (GFP), treated with DMSO or 100 nM everolimus (Ever) O/N and their lysates analyzed by URI1 immunoblotting.

107

Supplementary Figure 3 | siRNA-based screen of Ser/Thr specific protein phosphatases, part 2 (A-D) HeLa cells were transfected with pooled siRNAs targeting the indicated genes or the control siRNA (GFP), treated with DMSO or 100 nM everolimus (Ever) O/N and their lysates analyzed by URI1 immunoblotting.

108

Supplementary Figure 4 | Analysis of knockdown efficiency achieved in the Ser/Thr protein phosphatase siRNA screen HeLa cells were transfected with pooled siRNAs targeting Lamin A/C (siLaminA/C), PGAM5 (siPGAM5), or PP1γ (siPP1γ) or with control siRNA (siGFP) and their lysates were immunoblotted for the indicated proteins.

Supplementary Figure 5 | Off-target effect of siPP1α(9) depleting both PP1α and PP1γ HeLa cells were tranfected with two different siRNAs targeting PP1α (siPP1α(9) and siPP1α(10)) or the control siRNA (siCtr) and their lysates immunoblotted for the indicated proteins.

Supplementary Figure 6 | Confirmation of knockdown efficiency corresponding to Figure 23 OVCAR-8 cells with doxycycline-inducible URI1 knockdown (shURI1(2)-teton) or the control construct (shCtr-teton) were treated with 20 µM CCCP for 6 and 10h and their lysates immunoblotted for the indicated proteins.

109

Supplementary Figure 7 | Interaction between URI1 and PGAM5/PGAM5(∆24) Control IgG and URI1 antibody were crosslinked to Sepharose beads and subsequently used for IP in HeLa cells followed by an immunoblotting analysis of PGAM5 and URI1. The whole cell extract (WCE) was directly processed for immunoblotting to serve as an input control.

Supplementary Figure 8 | Subcellular fractionation in URI1-depleted HOSE6-3 cells under CCCP treatment Immunoblotting analysis of the mitochondrial (left panel) and cytoplasmic (middle panel) fraction and comparison of both (right panel) in HOSE6-3 cells under URI1 knockdown by a lentiviral construct (shURI1(2)) or the control construct (shCtr) treated with 20 µM CCCP for 1h.

Supplementary Figure 9 | Subcellular fractionation in URI1-depleted OVCAR-8 cells under CCCP treatment Immunoblotting analysis of the mitochondrial (left panel) and cytoplasmic (middle panel) fraction and comparison of both (right panel) in OVCAR-8 cells with doxycycline-inducible URI1 knockdown (shURI1(2) or the control contruct (shCtr) treated with 20 µM CCCP for 30 min.

110

Supplementary Figure 10 | PGAM5 status in OVCAR-8 cells with doxycycline-inducible and stable URI1 knockdown under CCCP treatment (A) 20 µM CCCP timecourse (0-90 min) in OVCAR-8 cells with a doxycycline-inducible URI1 knockdown (shURI1(2)-teton) or the control construct (shCtr-teton) or (B) in OVCAR-8 pools with stable URI1 knockdown (shURI1(2)) or the control construct (shCtr).

Supplementary Figure 11 | STAP1 depletion causes decreased URI1 levels in OVCAR-8 cells OVCAR-8 cells with siRNA targeting STAP1 (siSTAP1) or the control siRNA (siCtr) and immunoblotted for the indicated proteins.

Supplementary Figure 12 | Potential role of URI1 in the PGAM5-Keap1-Nrf2 axis

(A) HeLa cells were treated with 500 µM H2O2 for 30 min and immunoblotted for the indicated proteins. (B) HeLa cells were treated with 500 µM H2O2 for 7 min, subjected to IgG or URI1-IP and immunoblotted for PGAM5. The whole cell extract (WCE) was directly processed for immunoblotting to serve as an input control. (C) OVCAR-3 cells were subjected to IgG or URI1-IP and immunoblotted for Keap1. 111

7.2 Supplementary tables

Supplementary Table 1 | Cancer Cell Line Encyclopedia (CCLE) analysis of ovarian cancer cells lines performed by Dr. Christian Britschgi5 (http://www.broadinstitute.org/ccle/home)

blue: cell lines used in this study URI1 copy number variation URI1 mRNA expression Cell line name [log2 ratio] [log2] FUOV1_OVARY 2.864 12.81943 NIHOVCAR3_OVARY 2.298 11.58599 ONCODG1_OVARY 1.838 11.39299 COV318_OVARY 1.724 11.05058 OVCAR8_OVARY 1.059 10.67793 OVCAR4_OVARY 0.9816 10.19502 OVSAHO_OVARY 0.7547 10.17583 RMGI_OVARY 0.7528 8.995699 OVISE_OVARY 0.7392 9.957952 CAOV4_OVARY 0.6809 9.672573 JHOS4_OVARY 0.6502 9.854025 RMUGS_OVARY 0.6401 10.07333 OV90_OVARY 0.619 9.197927 KURAMOCHI_OVARY 0.5398 10.52772 JHOC5_OVARY 0.4837 9.30167 OVMANA_OVARY 0.4513 8.259357 COLO704_OVARY 0.4364 9.986478 EFO21_OVARY 0.422 10.07094 SNU8_OVARY 0.3613 9.389814 OAW28_OVARY 0.2716 9.334731 SNU840_OVARY 0.2648 9.464385 COV644_OVARY 0.2361 9.354131 59M_OVARY 0.2249 9.607974 JHOS2_OVARY 0.1915 9.45458 JHOM1_OVARY 0.1745 8.46471 OAW42_OVARY 0.1359 9.148464 HEYA8_OVARY 0.1117 9.591993 COV362_OVARY 0.0523 8.912128 COV434_OVARY 0.0447 9.396835 SNU119_OVARY 0.0414 9.757335 CAOV3_OVARY 0.0404 8.948936 OC316_OVARY 0.0393 9.507851 OV7_OVARY 0.0327 9.502639 IGROV1_OVARY 0.0253 9.060776

5 Group of Prof. W. Krek, Institute of Molecular Health Sciences, ETH Zurich 112

OVKATE_OVARY -0.0002 9.130867 A2780_OVARY -0.0029 9.788116 OC314_OVARY -0.0034 9.608218 OV56_OVARY -0.0347 9.40905 TOV21G_OVARY -0.0459 8.855364 SKOV3_OVARY -0.046 9.153491 OVK18_OVARY -0.0583 9.540733 JHOM2B_OVARY -0.0751 9.427077 EFO27_OVARY -0.0839 9.01982 OVTOKO_OVARY -0.0985 8.666412 TOV112D_OVARY -0.1599 9.251864 HS571T_OVARY -0.1876 8.525908 MCAS_OVARY -0.237 8.716812 TYKNU_OVARY -0.2675 9.09445 ES2_OVARY -0.4157 9.401393 COV504_OVARY -0.7621 7.687143

113

Supplementary Table 2 | List of siRNAs included into the screen of protein phosphatases

Entrez Gene Name gene Product name Product ID siRNA target sequence description ID Hs_ACP5_1 SI00291095 CTCGGGCAAGTCCCTCTTTAA acid phosphatase Hs_ACP5_3 SI00291109 ACGGCGCTGCTCATCCTGCAA ACP5 54 5, tartrate resistant Hs_ACP5_4 SI00291116 CACTGGTGTGCAAGACATCAA Hs_ACP5_5 SI03062115 CACTATGGGACTGAAGACTCA Hs_ACPP_2 SI00021889 ACAGATGGCGCTAGATGTTTA acid Hs_ACPP_3 SI00021896 CCGGACTTTGATGAGTGCTAT ACPP 55 phosphatase, prostate Hs_ACPP_5 SI04894659 CACTGAGGACACCATGACTAA Hs_ACPP_6 SI04947992 CACGGAGTGTATGACCACAAA Hs_ACPT_1 SI00145278 CCCGCCAAAGATGGAGGGAAT acid Hs_ACPT_3 SI02647134 CTGCTGAATGCTATCCTTGCA ACPT 93650 phosphatase, testicular Hs_ACPT_5 SI03052014 ATGGTCATGTACTCAGCTCAT Hs_ACPT_6 SI03111829 TAGGCCGCTTCTACCAGCTGA alkaline ALPI 248 phosphatase, Hs_ALPI_5 SI02665579 CACGTCCATCCTGTACGGCAA intestinal alkaline Hs_ALPL_5 SI02658600 CCGGGACTGGTACTCAGACAA phosphatase, ALPL 249 liver/bone/kidne Hs_ALPL_6 SI02658607 CAGGATTGGAACATCAGTTAA y alkaline ALPPL2 251 phosphatase, Hs_ALPPL2_5 SI02759414 CACGGTCCTCCTATACGGAAA placental-like 2 Hs_DUSP10_5 SI03038791 ACCATGACTGATGCTTATAAA dual specificity Hs_DUSP10_6 SI03058223 CACCGAGAATCCTTACACCAA DUSP10 11221 phosphatase 10 Hs_DUSP10_7 SI03118178 TGCCATAAACCTTGTTACATA Hs_DUSP10_8 SI03119998 TGGCAGCTGAATGATAGACAA dual specificity Hs_DUSP11_5 SI02658845 CCCTTATGTATTCAAGCTTAA DUSP11 8446 phosphatase 11 Hs_DUSP11_6 SI02658852 CAGAAACTGTTCCTTACTTAA dual specificity Hs_DUSP12_5 SI02659083 TACCGTTTCACAAGGATTGAA DUSP12 11266 phosphatase 12 Hs_DUSP12_6 SI02659090 ATGCTTTACATGGCAATCAAA Hs_DUSP13_1 SI00115717 TCAGTCCATCTCTATAATAAA dual specificity Hs_DUSP13_2 SI00115724 ACCCTGAGATGTAAACAGCAA DUSP13 51207 phosphatase 13 Hs_DUSP13_3 SI00115731 CAGGTGGACACAGGTGCCAAA Hs_DUSP13_5 SI03061870 CACGTTGTGAATGCCGCTGCA dual specificity Hs_DUSP14_7 SI02659055 ACCCTTATTATTTAGCTGTTA DUSP14 11072 phosphatase 14 Hs_DUSP14_8 SI02659062 AAGGGAATGCATACATTGCTA Hs_DUSP15_1 SI00160461 CACCACGATTGTGACAGCGTA 12885 dual specificity Hs_DUSP15_2 SI00160468 ACGGGCCTGGAGGGTATTAAA DUSP15 3 phosphatase 15 Hs_DUSP15_5 SI03094392 CTGCAGGATATCACCTACCTT Hs_DUSP15_6 SI03098928 CTGGGCCGAAATAAGATCACA dual specificity DUSP16 80824 Hs_DUSP16_5 SI02759421 AACCCAGTTGTTACTCTCTTA phosphatase 16 Hs_DUSP18_1 SI00154784 CAAGCTCATGCTGTCTAGCAA 15029 dual specificity Hs_DUSP18_2 SI00154791 CAGGAATGAATCTGCTACAAT DUSP18 0 phosphatase 18 Hs_DUSP18_3 SI00154798 ACGGGTCTCTCTCCCGAAGAA Hs_DUSP18_4 SI00154805 CCAGATCACCATGGTCATCAA 14267 dual specificity DUSP19 Hs_DUSP19_6 SI02659356 CAGAGTTAACCTAATGAGTCA 9 phosphatase 19

114

Hs_DUSP2_11 SI04892692 AACATTCAGGATATGTCAATA dual specificity Hs_DUSP2_5 SI03024469 TTGGAAACTTAGCACTTTATA DUSP2 1844 phosphatase 2 Hs_DUSP2_6 SI03025848 TTGTGCTCAGCTGACATTTAA Hs_DUSP2_8 SI03083829 CGAGGCCTTTGACTTCGTTAA Hs_DUSP21_2 SI00132412 AACGTAGTAAGCCTTACCTTA dual specificity Hs_DUSP21_3 SI00132419 ACCGGATGGTGCCTTGTTAAA DUSP21 63904 phosphatase 21 Hs_DUSP21_4 SI00132426 TCGGTGGAAGTGGTCAACGTA Hs_DUSP21_7 SI04902149 CGCGGCTGCTATCCTGAACTA Hs_DUSP22_1 SI00125272 AAGCAACATAGAGTTTAAGTA dual specificity Hs_DUSP22_2 SI00125279 GGGCAACTTAGCCAAGTTTAA DUSP22 56940 phosphatase 22 Hs_DUSP22_3 SI00125286 CATGTTTATGTTGAGAACTAA Hs_DUSP22_4 SI00125293 AAGCATGAGGTCCATCAGTAT Hs_DUSP23_1 SI00374885 CAGTTCTACCAGCGAACGAAA dual specificity Hs_DUSP23_2 SI00374892 GAAGTGGACTAAAGTATTAAA DUSP23 54935 phosphatase 23 Hs_DUSP23_5 SI03025750 TTGTACTGCTTTGTTGAATAA Hs_DUSP23_6 SI03039309 ACCCGGCTCCATCGAGACCTA dual specificity Hs_DUSP3_5 SI02665600 CCGTATTTACTTAACAAGATT DUSP3 1845 phosphatase 3 Hs_DUSP3_6 SI02665607 CCCGCGGATCTACGTGGGCAA Hs_DUSP6_1 SI00030324 TGCGGAATTGGTTAATACTAA dual specificity Hs_DUSP6_3 SI00030338 TCAGCTGTGCTAAACAGTATA DUSP6 1848 phosphatase 6 Hs_DUSP6_5 SI02627338 TACGGACACTATTATCACTAA Hs_DUSP6_6 SI03106404 GTCGGAAATGGCGATCAGCAA dual specificity Hs_DUSP7_6 SI02658656 TACGACTTTGTCAAGAGGAAA DUSP7 1849 phosphatase 7 Hs_DUSP7_7 SI02658663 CAAGGTGGTTTCAACAAGTTT dual specificity DUSP8 1850 Hs_DUSP8_5 SI02658887 TCCATCGAGTTCATCGATAAA phosphatase 8

green fluorescent GFP - GFP siRNA SI04380467 - protein

green fluorescent GFP - SI04380467 - protein integrin-linked Hs_ILKAP_5 SI00287994 TTCGGTGATCTTTGGTCTGAA kinase-associated ILKAP 80895 serine/threonine Hs_ILKAP_8 SI02659902 ATGGAGGAATTCGAGCCTCAA phosphatase Hs_PGAM5_2 SI03204677 CTCGGCCGTGGCGGTAGGGAA CAGGCAGGAGGAGGACAGTT Hs_PGAM5_9 SI05349575 phosphoglycerat A 19211 PGAM5 e mutase family Hs_MGC5352_ 1 SI00643825 CCCGCCCGTGTCTCATTGGAA member 5 3 Hs_PGAM5_1 SI05349582 TCCAAGCTGGACCACTACAAA 0 Hs_Lamin A/C LMNA 4000 lamin A/C SI03650332 - siRNA protein Hs_PPEF1_1 SI00086100 CCCAATCGGTACAATCGTTGA phosphatase, EF- Hs_PPEF1_2 SI00086107 ATCGAATATGCTGATGAACAA PPEF1 5475 hand calcium Hs_PPEF1_5 SI03073448 CAGTTCGAATCTGGTAAACAT binding domain 1 Hs_PPEF1_6 SI03121125 TGGGATTATGTGGACTCGATA protein Hs_PPEF2_1 SI00086072 CTGCAGGAGCATTGCGCTTAA phosphatase, EF- Hs_PPEF2_2 SI00086079 CACATGAATATCGACATTACA PPEF2 5470 hand calcium Hs_PPEF2_3 SI00086086 CGGAGCATTGATTTCAACAAA binding domain 2 Hs_PPEF2_4 SI00086093 CCCACAAGCTACAAATGCTAA

115

protein Hs_PPM1A_5 SI02659258 AAGCGTGATTTCAAACCATAA phosphatase, PPM1A 5494 Mg2+/Mn2+ Hs_PPM1A_6 SI02659265 TTCCATGAGTATTGCAGGTAA dependent, 1A protein Hs_PPM1B_6 SI02658677 CGAGATAACATGAGTATTGTA phosphatase, PPM1B 5495 Hs_PPM1B_7 SI02759190 CAACCAAGTGTTTAGAATGAA Mg2+/Mn2+ dependent, 1B Hs_PPM1B_8 SI02759197 TAGCCTAACTACACACATCAA protein Hs_PPM1D_5 SI02658859 ACGGGTCTTCCTAGCACATCA phosphatase, PPM1D 8493 Mg2+/Mn2+ Hs_PPM1D_6 SI02759302 ATGGCCAAGGGTGAATTCTAA dependent, 1D protein Hs_PPM1E_7 SI02659139 CCCATTTAGGTCTGTACTAAA phosphatase, PPM1E 22843 Mg2+/Mn2+ Hs_PPM1E_8 SI02659146 GAGGCGGTTTATAGTCAGAAA dependent, 1E protein Hs_PPM1F_5 SI03042585 AGCACCGTATATGGAATACAA phosphatase, Hs_PPM1F_6 SI03064460 CAGAGTTTCTTTAACCGCCTT PPM1F 9647 Mg2+/Mn2+ Hs_PPM1F_7 SI03092026 CTCGTCCCAAGCTAAATGTAA dependent, 1F Hs_PPM1F_8 SI03093552 CTGAGGGCGTGCAAAGTTGAA protein Hs_PPM1G_6 SI02658684 CAGGACCTGAGGACTCAACTA phosphatase, PPM1G 5496 Mg2+/Mn2+ Hs_PPM1G_7 SI02658691 CCAGAGGATGAAGTAGAACTA dependent, 1G protein Hs_PPM1L_3 SI00152047 CTGTAGAGTCACATATATGAA 15174 phosphatase, Hs_PPM1L_6 SI03044146 AGCGTGAACCCATATTGATAA PPM1L 2 Mg2+/Mn2+ Hs_PPM1L_7 SI03046274 AGGTCTATAATCAGTGACGAA dependent, 1L Hs_PPM1L_8 SI03087623 CTAATCATGCATGACCGTTAA protein Hs_PPP1CA_1 SI02225755 AAGAGACGCTACAACATCAAA phosphatase 1, 0 PPP1CA 5499 catalytic subunit, Hs_PPP1CA_9 SI02225748 CCGCAATTCCGCCAAAGCCAA alpha isozyme protein Hs_PPP1CB_5 SI02225762 TACGAGGATGTCGTCCAGGAA phosphatase 1, PPP1CB 5500 catalytic subunit, Hs_PPP1CB_6 SI02759204 CACTATTGGATGTGATTCTAA beta isozyme protein Hs_PPP1CC_5 SI02225769 CTGGTTATAACAGCAAATGAA phosphatase 1, PPP1CC 5501 Hs_PPP1CC_6 SI02225776 AACATCGACAGCATTATCCAA catalytic subunit, gamma isozyme Hs_PPP1CC_8 SI02759211 GAGGAGTAAGTGTACAATTGA protein Hs_PPP2CA_5 SI02225783 ATGGAACTTGACGATACTCTA phosphatase 2, PPP2CA 5515 catalytic subunit, Hs_PPP2CA_6 SI02225790 CAAACAATCATTGGAGCTTAA alpha isozyme Hs_PPP2CB_1 SI02225797 CCGACAAATTACCCAAGTATA protein 2 phosphatase 2, Hs_PPP2CB_1 PPP2CB 5516 SI02225804 TGGGATCTGTCTTGGCATTAA catalytic subunit, 3 beta isozyme Hs_PPP2CB_1 SI02777397 ATGGAATTAGATGACACTTTA 4 protein Hs_PPP3CA_6 SI02658614 TCGGCCTGTATGGGACTGTAA phosphatase 3, PPP3CA 5530 catalytic subunit, Hs_PPP3CA_7 SI02759155 CTGACATATACTGGAAATGTA alpha isozyme protein Hs_PPP3CB_1 SI00129458 CAGGGTTCCCTTCATTAATAA phosphatase 3, Hs_PPP3CB_5 SI02644572 AAGGGTTTGGATAGGATCAAT PPP3CB 5532 catalytic subunit, Hs_PPP3CB_6 SI03048290 ATCGATTATTAGAGCTCATGA beta isozyme Hs_PPP3CB_7 SI03111661 TAGGAGGATCACCTGCTAATA

116

protein Hs_PPP3CC_5 SI03037230 AAGTTGGAGGATCACCTAGTA phosphatase 3, Hs_PPP3CC_6 SI03044384 AGGAAGCACTACAGTTCGTAA PPP3CC 5533 catalytic subunit, Hs_PPP3CC_7 SI03076052 CCCAAGATGCTGGGTATCGAA gamma isozyme Hs_PPP3CC_8 SI03084928 CGCGAGGTCTGGACCGAATTA CGGACAATCGACCGAAAGCA protein Hs_PPP4C_8 SI02658698 PPP4C 5531 phosphatase 4, A catalytic subunit Hs_PPP4C_9 SI02658705 TCGCCAGATCACGCAGGTCTA protein PPP5C 5536 phosphatase 5, Hs_PPP5C_5 SI02225853 CTCGTGGAAACCACACTCAAA catalytic subunit protein Hs_PPP6C_5 SI02225860 CACAAATGAGTTTGTTCATAT PPP6C 5537 phosphatase 6, catalytic subunit Hs_PPP6C_6 SI02225867 CAGCAGCAAAGTTGTTATTCA

117

Supplementary Table 3 | Mitochondrial URI1 interactome detected by URI1-Co-IP and MS analysis in OVCAR-3 cells

(blue: established URI1 interactors; red: novel URI1 interactors investigated in this study) Spectral Spectral Uniprot Uniprot entry Gene names Protein description Ratio1 counts counts accession name IgG URI1 ATP-binding cassette sub-family D member 3 (70 kDa P28288 ABCD3_HUMAN ABCD3 PMP70 PXMP1 100 0 3 peroxisomal membrane protein) (PMP70) 3-ketoacyl-CoA thiolase, peroxisomal (EC 2.3.1.16) (Acetyl- P09110 THIK_HUMAN ACAA1 ACAA PTHIO CoA acyltransferase) (Beta-ketothiolase) (Peroxisomal 3- 100 0 2 oxoacyl-CoA thiolase) ACACA ACAC ACC1 Acetyl-CoA carboxylase 1 (ACC1) (EC 6.4.1.2) (ACC-alpha) Q13085 ACACA_HUMAN 100 0 8 ACCA [Includes: Biotin carboxylase (EC 6.3.4.14)] Acetyl-CoA acetyltransferase, mitochondrial (EC 2.3.1.9) P24752 THIL_HUMAN ACAT1 ACAT MAT 100 0 4 (Acetoacetyl-CoA thiolase) (T2) Q5T8D3 ACBD5_HUMAN ACBD5 KIAA1996 Acyl-CoA-binding domain-containing protein 5 100 0 18 P68032 ACTC_HUMAN ACTC1 ACTC Actin, alpha cardiac muscle 1 (Alpha-cardiac actin) 100 0 12 P35611 ADDA_HUMAN ADD1 ADDA Alpha-adducin (Erythrocyte adducin subunit alpha) 100 0 8 Q9UEY8 ADDG_HUMAN ADD3 ADDL Gamma-adducin (Adducin-like protein 70) 100 0 4 Aminoacyl tRNA synthase complex-interacting multifunctional protein 1 (Multisynthase complex auxiliary component p43) [Cleaved into: Endothelial monocyte- Q12904 AIMP1_HUMAN AIMP1 EMAP2 SCYE1 100 0 2 activating polypeptide 2 (EMAP-2) (Endothelial monocyte- activating polypeptide II) (EMAP-II) (Small inducible cytokine subfamily E member 1)] Aminoacyl tRNA synthase complex-interacting Q13155 AIMP2_HUMAN AIMP2 JTV1 PRO0992 multifunctional protein 2 (Multisynthase complex auxiliary 100 0 3 component p38) (Protein JTV-1) Aldehyde dehydrogenase family 1 member A3 (EC 1.2.1.5) P47895 AL1A3_HUMAN ALDH1A3 ALDH6 (Aldehyde dehydrogenase 6) (Retinaldehyde dehydrogenase 100 0 3 3) (RALDH-3) (RalDH3) ANKFY1 ANKHZN Ankyrin repeat and FYVE domain-containing protein 1 Q9P2R3 ANFY1_HUMAN 100 0 1 KIAA1255 (Ankyrin repeats hooked to a zinc finger motif) Adenomatous polyposis coli protein (Protein APC) (Deleted P25054 APC_HUMAN APC DP2.5 100 0 1 in polyposis 2.5)

118

ADP-ribosylation factor GTPase-activating protein 2 (ARF ARFGAP2 ZNF289 Q8N6H7 ARFG2_HUMAN GAP 2) (GTPase-activating protein ZNF289) (Zinc finger 100 0 13 Nbla10535 protein 289) Q5T2N8 ATD3C_HUMAN ATAD3C ATPase family AAA domain-containing protein 3C 100 0 1 ATP synthase subunit gamma, mitochondrial (F-ATPase P36542 ATPG_HUMAN ATP5C1 ATP5C ATP5CL1 100 0 2 gamma subunit) ATXN2L A2D A2LG A2LP Ataxin-2-like protein (Ataxin-2 domain protein) (Ataxin-2- Q8WWM7 ATX2L_HUMAN 6.1 7 43 A2RP related protein) Transcription regulator protein BACH1 (BTB and CNC O14867 BACH1_HUMAN BACH1 100 0 8 homolog 1) (HA2303) BAG family molecular chaperone regulator 2 (BAG-2) (Bcl- O95816 BAG2_HUMAN BAG2 100 0 2 2-associated athanogene 2) Q9NYF8 BCLF1_HUMAN BCLAF1 BTF KIAA0164 Bcl-2-associated transcription factor 1 (Btf) 100 0 15 Complement component 1 Q subcomponent-binding protein, C1QBP GC1QBP HABP1 mitochondrial (GC1q-R protein) (Glycoprotein gC1qBP) Q07021 C1QBP_HUMAN 100 0 2 SF2P32 (C1qBP) (Hyaluronan-binding protein 1) (Mitochondrial matrix protein p32) (p33) Q49A88 CCD14_HUMAN CCDC14 Coiled-coil domain-containing protein 14 100 0 11 T-complex protein 1 subunit epsilon (TCP-1-epsilon) (CCT- P48643 TCPE_HUMAN CCT5 CCTE KIAA0098 100 0 2 epsilon) Parafibromin (Cell division cycle protein 73 homolog) Q6P1J9 CDC73_HUMAN CDC73 C1orf28 HRPT2 100 0 46 (Hyperparathyroidism 2 protein) Cerebellar degeneration-related protein 2 (Major Yo Q01850 CDR2_HUMAN CDR2 PCD17 paraneoplastic antigen) (Paraneoplastic cerebellar 100 0 3 degeneration-associated antigen) Cerebellar degeneration-related protein 2-like (Paraneoplastic Q86X02 CDR2L_HUMAN CDR2L HUMPPA 100 0 7 62 kDa antigen) Centromere protein F (CENP-F) (AH antigen) (Kinetochore P49454 CENPF_HUMAN CENPF 100 0 10 protein CENPF) (Mitosin) Centrosomal protein of 97 kDa (Cep97) (Leucine-rich repeat Q8IW35 CEP97_HUMAN CEP97 LRRIQ2 100 0 2 and IQ domain-containing protein 2) CLTC CLH17 CLTCL2 Clathrin heavy chain 1 (Clathrin heavy chain on chromosome Q00610 CLH1_HUMAN 100 0 4 KIAA0034 17) (CLH-17)

119

Cellular nucleic acid-binding protein (CNBP) (Zinc finger P62633 CNBP_HUMAN CNBP RNF163 ZNF9 100 0 2 protein 9) COBRA1 KIAA1182 Negative elongation factor B (NELF-B) (Cofactor of Q8WX92 NELFB_HUMAN 100 0 1 NELFB BRCA1) CTNNB1 CTNNB OK/SW- P35222 CTNB1_HUMAN Catenin beta-1 (Beta-catenin) 100 0 6 cl.35 PRO2286 RNA polymerase-associated protein CTR9 homolog (SH2 Q6PD62 CTR9_HUMAN CTR9 KIAA0155 SH2BP1 100 0 55 domain-binding protein 1) Q13948 CASP_HUMAN CUX1 CUTL1 Protein CASP 100 0 18 Homeobox protein cut-like 1 (CCAAT displacement protein) P39880 CUX1_HUMAN CUX1 CUTL1 100 0 37 (CDP) (Homeobox protein cux-1) 28S ribosomal protein S29, mitochondrial (MRP-S29) P51398 RT29_HUMAN DAP3 MRPS29 (S29mt) (Death-associated protein 3) (DAP-3) (Ionizing 100 0 1 radiation resistance conferring protein) Aspartyl-tRNA synthetase, cytoplasmic (EC 6.1.1.12) P14868 SYDC_HUMAN DARS PIG40 (Aspartate--tRNA ligase) (AspRS) (Cell proliferation- 100 0 5 inducing gene 40 protein) ATP-dependent RNA helicase DDX1 (EC 3.6.4.13) (DEAD Q92499 DDX1_HUMAN DDX1 box protein 1) (DEAD box protein retinoblastoma) (DBP- 6.3 3 19 RB) ATP-dependent RNA helicase A (EC 3.6.4.13) (DEAH box Q08211 DHX9_HUMAN DHX9 DDX9 LKP NDH2 100 0 2 protein 9) (Nuclear DNA helicase II) (NDH II) Protein diaphanous homolog 1 (Diaphanous-related formin-1) O60610 DIAP1_HUMAN DIAPH1 DIAP1 100 0 6 (DRF1) Disks large homolog 5 (Discs large protein P-dlg) (Placenta Q8TDM6 DLG5_HUMAN DLG5 KIAA0583 PDLG 100 0 89 and prostate DLG) DnaJ homolog subfamily A member 1 (DnaJ protein DNAJA1 DNAJ2 HDJ2 P31689 DNJA1_HUMAN homolog 2) (HSDJ) (Heat shock 40 kDa protein 4) (Heat 100 0 2 HSJ2 HSPF4 shock protein J2) (HSJ-2) (Human DnaJ protein 2) (hDj-2) DnaJ homolog subfamily A member 3, mitochondrial (DnaJ protein Tid-1) (hTid-1) (Hepatocellular carcinoma-associated Q96EY1 DNJA3_HUMAN DNAJA3 HCA57 TID1 100 0 4 antigen 57) (Tumorous imaginal discs protein Tid56 homolog) Developmentally-regulated GTP-binding protein 1 (DRG-1) Q9Y295 DRG1_HUMAN DRG1 NEDD3 (Neural precursor cell expressed developmentally down- 100 0 1 regulated protein 3) (NEDD-3)

120

Eukaryotic translation elongation factor 1 epsilon-1 (Aminoacyl tRNA synthetase complex-interacting O43324 MCA3_HUMAN EEF1E1 AIMP3 P18 100 0 2 multifunctional protein 3) (Elongation factor p18) (Multisynthase complex auxiliary component p18) P13639 EF2_HUMAN EEF2 EF2 Elongation factor 2 (EF-2) 100 0 4 Eukaryotic translation initiation factor 3 subunit I (eIF3i) (Eukaryotic translation initiation factor 3 subunit 2) (TGF- Q13347 EIF3I_HUMAN EIF3I EIF3S2 TRIP1 100 0 4 beta receptor-interacting protein 1) (TRIP-1) (eIF-3-beta) (eIF3 p36) Eukaryotic translation initiation factor 3 subunit K (eIF3k) EIF3K EIF3S12 ARG134 (Eukaryotic translation initiation factor 3 subunit 12) Q9UBQ5 EIF3K_HUMAN HSPC029 MSTP001 100 0 2 (Muscle-specific gene M9 protein) (PLAC-24) (eIF-3 p25) PTD001 (eIF-3 p28) Eukaryotic translation initiation factor 4 gamma 2 (eIF-4- EIF4G2 DAP5 OK/SW- P78344 IF4G2_HUMAN gamma 2) (eIF-4G 2) (eIF4G 2) (Death-associated protein 5) 100 0 17 cl.75 (DAP-5) (p97) P50402 EMD_HUMAN EMD EDMD STA Emerin 100 0 2 Alpha-enolase (EC 4.2.1.11) (2-phospho-D-glycerate hydro- ENO1 ENO1L1 MBPB1 lyase) (C-myc promoter-binding protein) (Enolase 1) (MBP- P06733 ENOA_HUMAN 100 0 1 MPB1 1) (MPB-1) (Non-neural enolase) (NNE) (Phosphopyruvate hydratase) (Plasminogen-binding protein) Bifunctional aminoacyl-tRNA synthetase (Cell proliferation- inducing gene 32 protein) [Includes: Glutamyl-tRNA EPRS GLNS PARS QARS P07814 SYEP_HUMAN synthetase (EC 6.1.1.17) (Glutamate--tRNA ligase) (GluRS); 100 0 10 QPRS PIG32 Prolyl-tRNA synthetase (EC 6.1.1.15) (Proline--tRNA ligase)] P84090 ERH_HUMAN ERH Enhancer of rudimentary homolog 100 0 11 P15311 EZRI_HUMAN EZR VIL2 Ezrin (Cytovillin) (Villin-2) (p81) 100 0 2 Fatty acid synthase (EC 2.3.1.85) [Includes: [Acyl-carrier- protein] S-acetyltransferase (EC 2.3.1.38); [Acyl-carrier- protein] S-malonyltransferase (EC 2.3.1.39); 3-oxoacyl-[acyl- carrier-protein] synthase (EC 2.3.1.41); 3-oxoacyl-[acyl- P49327 FAS_HUMAN FASN FAS carrier-protein] reductase (EC 1.1.1.100); 3- 100 0 10 hydroxypalmitoyl-[acyl-carrier-protein] dehydratase (EC 4.2.1.61); Enoyl-[acyl-carrier-protein] reductase (EC 1.3.1.10); Oleoyl-[acyl-carrier-protein] hydrolase (EC 3.1.2.14)]

121

O95684 FR1OP_HUMAN FGFR1OP FOP FGFR1 oncogene partner 100 0 3 Formin-like protein 3 (Formin homology 2 domain- FMNL3 FHOD3 KIAA2014 Q8IVF7 FMNL3_HUMAN containing protein 3) (WW domain-binding protein 3) (WBP- 100 0 5 WBP3 3) Forkhead box protein O3 (AF6q21 protein) (Forkhead in O43524 FOXO3_HUMAN FOXO3 FKHRL1 FOXO3A 100 0 1 rhabdomyosarcoma-like 1) Ras GTPase-activating protein-binding protein 2 (G3BP-2) Q9UN86 G3BP2_HUMAN G3BP2 KIAA0660 100 0 6 (GAP SH3 domain-binding protein 2) Golgi-specific brefeldin A-resistance guanine nucleotide Q92538 GBF1_HUMAN GBF1 KIAA0248 100 0 20 exchange factor 1 (BFA-resistant GEF 1) Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] 1 (EC 2.6.1.16) (D-fructose-6-phosphate Q06210 GFPT1_HUMAN GFPT1 GFAT GFPT amidotransferase 1) (Glutamine:fructose 6 phosphate 100 0 6 amidotransferase 1) (GFAT 1) (GFAT1) (Hexosephosphate aminotransferase 1) Heterogeneous nuclear ribonucleoproteins C1/C2 (hnRNP P07910 HNRPC_HUMAN HNRNPC HNRPC 100 0 17 C1/C2) HSP90AA1 HSP90A Heat shock protein HSP 90-alpha (Heat shock 86 kDa) (HSP P07900 HS90A_HUMAN 100 0 3 HSPC1 HSPCA 86) (HSP86) (Renal carcinoma antigen NY-REN-38) HSP90AB1 HSP90B Heat shock protein HSP 90-beta (HSP 90) (Heat shock 84 P08238 HS90B_HUMAN 100 0 5 HSPC2 HSPCB kDa) (HSP 84) (HSP84) Endoplasmin (94 kDa glucose-regulated protein) (GRP-94) P14625 ENPL_HUMAN HSP90B1 GRP94 TRA1 (Heat shock protein 90 kDa beta member 1) (Tumor rejection 100 0 11 antigen 1) (gp96 homolog) Isoleucyl-tRNA synthetase, cytoplasmic (EC 6.1.1.5) P41252 SYIC_HUMAN IARS 100 0 5 (Isoleucine--tRNA ligase) (Virshup and Shenolikar) (IleRS) Insulin-like growth factor 2 mRNA-binding protein 1 (IGF2 mRNA-binding protein 1) (IMP-1) (Coding region IGF2BP1 CRDBP VICKZ1 Q9NZI8 IF2B1_HUMAN determinant-binding protein) (CRD-BP) (IGF-II mRNA- 100 0 1 ZBP1 binding protein 1) (VICKZ family member 1) (Zip code- binding protein 1) (ZBP-1) (Zipcode-binding protein 1) Inosine-5'-monophosphate dehydrogenase 2 (IMP P12268 IMDH2_HUMAN IMPDH2 IMPD2 dehydrogenase 2) (IMPD 2) (IMPDH 2) (EC 1.1.1.205) 100 0 1 (IMPDH-II)

122

P16144 ITB4_HUMAN ITGB4 Integrin beta-4 (GP150) (CD antigen CD104) 100 0 17 Junction plakoglobin (Catenin gamma) (Desmoplakin III) P14923 PLAK_HUMAN JUP CTNNG DP3 100 0 2 (Desmoplakin-3) Kinesin-like protein KIF11 (Kinesin-like protein 1) (Kinesin- like spindle protein HKSP) (Kinesin-related motor protein P52732 KIF11_HUMAN KIF11 EG5 KNSL1 TRIP5 100 0 17 Eg5) (Thyroid receptor-interacting protein 5) (TR-interacting protein 5) (TRIP-5) O60684 IMA7_HUMAN KPNA6 IPOA7 Importin subunit alpha-7 (Karyopherin subunit alpha-6) 100 0 1 Laminin subunit beta-3 (Epiligrin subunit bata) (Kalinin B1 Q13751 LAMB3_HUMAN LAMB3 LAMNB1 chain) (Kalinin subunit beta) (Laminin B1k chain) (Laminin- 100 0 23 5 subunit beta) (Nicein subunit beta) La-related protein 1 (La ribonucleoprotein domain family Q6PKG0 LARP1_HUMAN LARP1 KIAA0731 LARP 100 0 1 member 1) L-lactate dehydrogenase B chain (LDH-B) (EC 1.1.1.27) P07195 LDHB_HUMAN LDHB (LDH heart subunit) (LDH-H) (Renal carcinoma antigen NY- 100 0 12 REN-46) RNA polymerase-associated protein LEO1 (Replicative Q8WVC0 LEO1_HUMAN LEO1 RDL 100 0 10 senescence down-regulated leo1-like protein) LIMA1 EPLIN SREBP3 LIM domain and actin-binding protein 1 (Epithelial protein Q9UHB6 LIMA1_HUMAN 100 0 7 PP624 lost in neoplasm) LMO7 FBX20 FBXO20 LIM domain only protein 7 (LMO-7) (F-box only protein 20) Q8WWI1 LMO7_HUMAN 100 0 1 KIAA0858 (LOMP) Serine/threonine-protein kinase MARK1 (EC 2.7.11.1) Q9P0L2 MARK1_HUMAN MARK1 KIAA1477 MARK 100 0 8 (MAP/microtubule affinity-regulating kinase 1) MAP/microtubule affinity-regulating kinase 3 (EC 2.7.11.1) (C-TAK1) (cTAK1) (Cdc25C-associated protein kinase 1) P27448 MARK3_HUMAN MARK3 CTAK1 EMK2 (ELKL motif kinase 2) (EMK-2) (Protein kinase STK10) 100 0 20 (Ser/Thr protein kinase PAR-1) (Serine/threonine-protein kinase p78) Methionyl-tRNA synthetase, cytoplasmic (EC 6.1.1.10) P56192 SYMC_HUMAN MARS 100 0 6 (Methionine--tRNA ligase) (MetRS) P43243 MATR3_HUMAN MATR3 KIAA0723 Matrin-3 100 0 2 O95140 MFN2_HUMAN MFN2 CPRP1 KIAA0214 Mitofusin-2 (EC 3.6.5.-) (Transmembrane GTPase MFN2) 100 0 25 Q8N3R9 MPP5_HUMAN MPP5 MAGUK p55 subfamily member 5 100 0 1

123

Myosin-10 (Cellular myosin heavy chain, type B) (Myosin heavy chain 10) (Myosin heavy chain, non-muscle IIb) (Non- P35580 MYH10_HUMAN MYH10 100 0 2 muscle myosin heavy chain B) (NMMHC-B) (Non-muscle myosin heavy chain IIb) (NMMHC II-b) (NMMHC-IIB) Inactive N-acetylated-alpha-linked acidic dipeptidase-like Q58DX5 NADL2_HUMAN NAALADL2 100 0 20 protein 2 (NAALADase L2) NCAPD3 CAPD3 Condensin-2 complex subunit D3 (Non-SMC condensin II P42695 CNDD3_HUMAN 100 0 2 KIAA0056 complex subunit D3) (hCAP-D3) Serine/threonine-protein kinase Nek2 (EC 2.7.11.1) (HSPK P51955 NEK2_HUMAN NEK2 NEK2A NLK1 21) (Never in mitosis A-related kinase 2) (NimA-related 100 0 3 protein kinase 2) (NimA-like protein kinase 1) Glucocorticoid receptor (GR) (Nuclear receptor subfamily 3 P04150 GCR_HUMAN NR3C1 GRL 100 0 5 group C member 1) Cleavage and polyadenylation specificity factor subunit 5 (Cleavage and polyadenylation specificity factor 25 kDa NUDT21 CFIM25 CPSF25 O43809 CPSF5_HUMAN subunit) (CFIm25) (CPSF 25 kDa subunit) (Nucleoside 100 0 3 CPSF5 diphosphate-linked moiety X motif 21) (Nudix motif 21) (Pre-mRNA cleavage factor Im 25 kDa subunit) Nuclear fragile X mental retardation-interacting protein 2 (82 Q7Z417 NUFP2_HUMAN NUFIP2 KIAA1321 PIG1 kDa FMRP-interacting protein) (82-FIP) (Cell proliferation- 100 0 20 inducing gene 1 protein) (FMRP-interacting protein 2) Nuclear pore complex protein Nup93 (93 kDa nucleoporin) Q8N1F7 NUP93_HUMAN NUP93 KIAA0095 100 0 8 (Nucleoporin Nup93) Nuclear pore complex protein Nup98-Nup96 [Cleaved into: Nuclear pore complex protein Nup98 (98 kDa nucleoporin) P52948 NUP98_HUMAN NUP98 ADAR2 100 0 4 (Nucleoporin Nup98); Nuclear pore complex protein Nup96 (96 kDa nucleoporin) (Nucleoporin Nup96)] PABPC1 PAB1 PABP1 Polyadenylate-binding protein 1 (PABP-1) (Poly(A)-binding P11940 PABP1_HUMAN 6.3 4 25 PABPC2 protein 1) Polyadenylate-binding protein 4 (PABP-4) (Poly(A)-binding Q13310 PABP4_HUMAN PABPC4 APP1 PABP4 protein 4) (Activated-platelet protein 1) (APP-1) (Inducible 100 0 16 poly(A)-binding protein) (iPABP) RNA polymerase II-associated factor 1 homolog (hPAF1) Q8N7H5 PAF1_HUMAN PAF1 PD2 100 0 26 (Pancreatic differentiation protein 2) P57721 PCBP3_HUMAN PCBP3 Poly(rC)-binding protein 3 (Alpha-CP3) 100 0 1

124

Protein disulfide-isomerase A6 (EC 5.3.4.1) (Endoplasmic Q15084 PDIA6_HUMAN PDIA6 ERP5 P5 TXNDC7 reticulum protein 5) (ER protein 5) (ERp5) (Protein disulfide 100 0 7 isomerase P5) (Thioredoxin domain-containing protein 7) Q9NUG6 PDRG1_HUMAN PDRG1 C20orf126 PDRG p53 and DNA damage-regulated protein 1 100 0 17 Q9UHV9 PFD2_HUMAN PFDN2 PFD2 HSPC231 Prefoldin subunit 2 100 0 23 O15212 PFD6_HUMAN PFDN6 HKE2 PFD6 Prefoldin subunit 6 (Protein Ke2) 100 0 16 Serine/threonine-protein phosphatase PGAM5, mitochondrial Q96HS1 PGAM5_HUMAN PGAM5 (EC 3.1.3.16) (Bcl-XL-binding protein v68) 5.0 3 15 (Phosphoglycerate mutase family member 5) PIH1 domain-containing protein 1 (Nucleolar protein 17 Q9NWS0 PIHD1_HUMAN PIH1D1 NOP17 100 0 27 homolog) DNA-directed RNA polymerase I subunit RPA1 (RNA polymerase I subunit A1) (EC 2.7.7.6) (A190) (DNA-directed O95602 RPA1_HUMAN POLR1A RNA polymerase I largest subunit) (DNA-directed RNA 100 0 4 polymerase I subunit A) (RNA polymerase I 194 kDa subunit) (RPA194) DNA-directed RNA polymerases I and III subunit RPAC1 (DNA-directed RNA polymerase I subunit C) (RNA O15160 RPAC1_HUMAN POLR1C POLR1E polymerases I and III subunit AC1) (AC40) (DNA-directed 100 0 7 RNA polymerases I and III 40 kDa polypeptide) (RPA40) (RPA39) (RPC40) DNA-directed RNA polymerases I and III subunit RPAC2 (RNA polymerases I and III subunit AC2) (AC19) (DNA- Q9Y2S0 RPAC2_HUMAN POLR1D 100 0 2 directed RNA polymerase I subunit D) (RNA polymerase I 16 kDa subunit) (RPA16) (RPC16) (hRPA19) DNA-directed RNA polymerase II subunit RPB1 (RNA polymerase II subunit B1) (EC 2.7.7.6) (DNA-directed RNA P24928 RPB1_HUMAN POLR2A POLR2 polymerase II subunit A) (DNA-directed RNA polymerase III 100 0 96 largest subunit) (RNA-directed RNA polymerase II subunit RPB1) (EC 2.7.7.48) DNA-directed RNA polymerases I, II, and III subunit RPABC1 (RNA polymerases I, II, and III subunit ABC1) P19388 RPAB1_HUMAN POLR2E (DNA-directed RNA polymerase II 23 kDa polypeptide) 100 0 22 (DNA-directed RNA polymerase II subunit E) (RPB5 homolog) (XAP4)

125

DNA-directed RNA polymerases I, II, and III subunit RPABC3 (RNA polymerases I, II, and III subunit ABC3) P52434 RPAB3_HUMAN POLR2H (DNA-directed RNA polymerase II subunit H) (DNA- 100 0 10 directed RNA polymerases I, II, and III 17.1 kDa polypeptide) (RPB17) (RPB8 homolog) (hRPB8) DNA-directed RNA polymerase III subunit RPC1 (RNA polymerase III subunit C1) (EC 2.7.7.6) (DNA-directed RNA O14802 RPC1_HUMAN POLR3A polymerase III largest subunit) (DNA-directed RNA 100 0 73 polymerase III subunit A) (RNA polymerase III 155 kDa subunit) (RPC155) (RNA polymerase III subunit C160) DNA-directed RNA polymerase III subunit RPC2 (RNA polymerase III subunit C2) (EC 2.7.7.6) (C128) (DNA- Q9NW08 RPC2_HUMAN POLR3B 100 0 13 directed RNA polymerase III 127.6 kDa polypeptide) (DNA- directed RNA polymerase III subunit B) DNA-directed RNA polymerase III subunit RPC4 (RNA polymerase III subunit C4) (DNA-directed RNA polymerase P05423 RPC4_HUMAN POLR3D BN51 BN51T 100 0 1 III subunit D) (Protein BN51) (RNA polymerase III 47 kDa subunit) (RPC53 homolog) DNA-directed RNA polymerase III subunit RPC5 (RNA Q9NVU0 RPC5_HUMAN POLR3E KIAA1452 polymerase III subunit C5) (DNA-directed RNA polymerase 100 0 9 III 80 kDa polypeptide) DNA-directed RNA polymerase III subunit RPC10 (RNA polymerase III subunit C10) (DNA-directed RNA polymerase Q9Y2Y1 RPC10_HUMAN POLR3K RPC11 My010 III subunit K) (RNA polymerase III 12.5 kDa subunit) 100 0 2 (RPC12.5) (RNA polymerase III subunit C11) (HsC11p) (RPC11) (hRPC11) Serine/threonine-protein phosphatase PP1-alpha catalytic P62136 PP1A_HUMAN PPP1CA PPP1A 100 0 20 subunit (PP-1A) (EC 3.1.3.16) Serine/threonine-protein phosphatase PP1-gamma catalytic P36873 PP1G_HUMAN PPP1CC subunit (PP-1G) (EC 3.1.3.16) (Protein phosphatase 1C 5.7 3 17 catalytic subunit) Peroxiredoxin-2 (EC 1.11.1.15) (Natural killer cell-enhancing factor B) (NKEF-B) (PRP) (Thiol-specific antioxidant P32119 PRDX2_HUMAN PRDX2 NKEFB TDPX1 100 0 2 protein) (Tsao et al.) (Thioredoxin peroxidase 1) (Thioredoxin-dependent peroxide reductase 1)

126

Thioredoxin-dependent peroxide reductase, mitochondrial (EC 1.11.1.15) (Antioxidant protein 1) (AOP-1) (HBC189) P30048 PRDX3_HUMAN PRDX3 AOP1 100 0 2 (Peroxiredoxin III) (Prx-III) (Peroxiredoxin-3) (Protein MER5 homolog) Q14671 PUM1_HUMAN PUM1 KIAA0099 PUMH1 Pumilio homolog 1 (HsPUM) (Pumilio-1) 100 0 8 Glutaminyl-tRNA synthetase (EC 6.1.1.18) (Glutamine-- P47897 SYQ_HUMAN QARS 100 0 4 tRNA ligase) (GlnRS) Arginyl-tRNA synthetase, cytoplasmic (EC 6.1.1.19) P54136 SYRC_HUMAN RARS 100 0 8 (Arginine--tRNA ligase) (ArgRS) Q96D15 RCN3_HUMAN RCN3 UNQ239/PRO272 Reticulocalbin-3 (EF-hand calcium-binding protein RLP49) 100 0 9 Mitochondrial ribonuclease P protein 1 (Mitochondrial RNase P protein 1) (HBV pre-S2 trans-regulated protein 2) Q7L0Y3 MRRP1_HUMAN RG9MTD1 MRPP1 (RNA (guanine-9-)-methyltransferase domain-containing 100 0 2 protein 1) (EC 2.1.1.-) (Renal carcinoma antigen NY-REN- 49) Unconventional prefoldin RPB5 interactor (Protein NNX3) O94763 RMP_HUMAN RMP C19orf2 NNX3 URI1 (RNA polymerase II subunit 5-mediating protein) (RPB5- 100 0 78 mediating protein) Putative RNA polymerase II subunit B1 CTD phosphatase Q8IXW5 RPAP2_HUMAN RPAP2 C1orf82 RPAP2 (EC 3.1.3.-) (RNA polymerase II-associated protein 100 0 31 2) Q9H6T3 RPAP3_HUMAN RPAP3 RNA polymerase II-associated protein 3 100 0 72 60S ribosomal protein L17 (60S ribosomal protein L23) (PD- P18621 RL17_HUMAN RPL17 100 0 2 1) P62899 RL31_HUMAN RPL31 60S ribosomal protein L31 100 0 2 P62277 RS13_HUMAN RPS13 40S ribosomal protein S13 100 0 2 P62854 RS26_HUMAN RPS26 40S ribosomal protein S26 100 0 2 40S ribosomal protein S3a (v-fos transformation effector P61247 RS3A_HUMAN RPS3A FTE1 MFTL 100 0 5 protein) (Fte-1) 40S ribosomal protein S5 [Cleaved into: 40S ribosomal P46782 RS5_HUMAN RPS5 100 0 3 protein S5, N-terminally processed] P46781 RS9_HUMAN RPS9 40S ribosomal protein S9 100 0 3

127

RuvB-like 1 (EC 3.6.4.12) (49 kDa TATA box-binding protein-interacting protein) (49 kDa TBP-interacting protein) RUVBL1 RVB1 INO80H (54 kDa erythrocyte cytosolic protein) (ECP-54) (INO80 Q9Y265 RUVB1_HUMAN 100 0 42 NMP238 TIP49 TIP49A complex subunit H) (Nuclear matrix protein 238) (NMP 238) (Pontin 52) (TIP49a) (TIP60-associated protein 54-alpha) (TAP54-alpha) RuvB-like 2 (EC 3.6.4.12) (48 kDa TATA box-binding protein-interacting protein) (48 kDa TBP-interacting protein) RUVBL2 RVB2 INO80J Q9Y230 RUVB2_HUMAN (51 kDa erythrocyte cytosolic protein) (ECP-51) (INO80 47.0 1 47 TIP48 TIP49B CGI-46 complex subunit J) (Repressing pontin 52) (Reptin 52) (TIP49b) (TIP60-associated protein 54-beta) (TAP54-beta) Serpin H1 (47 kDa heat shock protein) (Arsenic- SERPINH1 CBP1 CBP2 transactivated protein 3) (AsTP3) (Cell proliferation-inducing P50454 SERPH_HUMAN 100 0 2 HSP47 SERPINH2 PIG14 gene 14 protein) (Collagen-binding protein) (Colligin) (Rheumatoid arthritis-related antigen RA-A47) SLC25A3 PHC OK/SW- Phosphate carrier protein, mitochondrial (Phosphate transport Q00325 MPCP_HUMAN 100 0 2 cl.48 protein) (PTP) (Solute carrier family 25 member 3) 4F2 cell-surface antigen heavy chain (4F2hc) (4F2 heavy P08195 4F2_HUMAN SLC3A2 MDU1 chain antigen) (Lymphocyte activation antigen 4F2 large 100 0 2 subunit) (CD antigen CD98) Small nuclear ribonucleoprotein Sm D1 (Sm-D1) (Sm-D P62314 SMD1_HUMAN SNRPD1 100 0 1 autoantigen) (snRNP core protein D1) Q9UJZ1 STML2_HUMAN STOML2 SLP2 HSPC108 Stomatin-like protein 2 (SLP-2) (EPB72-like protein 2) 28.0 4 112 STX2 EPIM STX2A P32856 STX2_HUMAN Syntaxin-2 (Epimorphin) 100 0 12 STX2B STX2C Syntaxin-binding protein 1 (N-Sec1) (Protein unc-18 P61764 STXB1_HUMAN STXBP1 UNC18A homolog 1) (Unc18-1) (Protein unc-18 homolog A) (Unc- 100 0 2 18A) (p67) SYNE1 C6orf98 KIAA0796 Nesprin-1 (Enaptin) (Myocyte nuclear envelope protein 1) Q8NF91 SYNE1_HUMAN KIAA1262 KIAA1756 (Myne-1) (Nuclear envelope spectrin repeat protein 1) 100 0 4 MYNE1 (Synaptic nuclear envelope protein 1) (Syne-1) Transcription factor AP-4 (Activating enhancer-binding Q01664 TFAP4_HUMAN TFAP4 BHLHC41 protein 4) (Class C basic helix-loop-helix protein 41) 100 0 30 (bHLHc41) Thyroid hormone receptor-associated protein 3 (Thyroid Q9Y2W1 TR150_HUMAN THRAP3 TRAP150 hormone receptor-associated protein complex 150 kDa 100 0 29 component) (Trap150)

128

Mitochondrial import inner membrane translocase subunit Q3ZCQ8 TIM50_HUMAN TIMM50 TIM50 PRO1512 100 0 2 TIM50 Tight junction protein ZO-1 (Tight junction protein 1) (Zona Q07157 ZO1_HUMAN TJP1 ZO1 100 0 2 occludens protein 1) (Zonula occludens protein 1) Tight junction protein ZO-2 (Tight junction protein 2) (Zona Q9UDY2 ZO2_HUMAN TJP2 X104 ZO2 100 0 6 occludens protein 2) (Zonula occludens protein 2) O43897 TLL1_HUMAN TLL1 TLL Tolloid-like protein 1 (EC 3.4.24.-) 100 0 19 TPR and ankyrin repeat-containing protein 1 (Lupus brain O15050 TRNK1_HUMAN TRANK1 KIAA0342 LBA1 100 0 2 antigen 1 homolog) Tubulin alpha-1C chain (Alpha-tubulin 6) (Tubulin alpha-6 Q9BQE3 TBA1C_HUMAN TUBA1C TUBA6 100 0 20 chain) Tubulin alpha-4A chain (Alpha-tubulin 1) (Testis-specific P68366 TBA4A_HUMAN TUBA4A TUBA1 100 0 19 alpha-tubulin) (Tubulin H2-alpha) (Tubulin alpha-1 chain) TUBB TUBB5 OK/SW- P07437 TBB5_HUMAN Tubulin beta chain (Tubulin beta-5 chain) 12.3 3 37 cl.56 P68371 TBB2C_HUMAN TUBB2C Tubulin beta-2C chain (Tubulin beta-2 chain) 100 0 32 P04350 TBB4_HUMAN TUBB4 TUBB5 Tubulin beta-4 chain (Tubulin 5 beta) 100 0 24 Thioredoxin reductase 2, mitochondrial (EC 1.8.1.9) TXNRD2 KIAA1652 Q9NNW7 TRXR2_HUMAN (Selenoprotein Z) (SelZ) (TR-beta) (Thioredoxin reductase 100 0 2 TRXR2 TR3) UDP-glucose:glycoprotein glucosyltransferase 1 (UGT1) UGGT1 GT UGCGL1 (hUGT1) (EC 2.4.1.-) (UDP--Glc:glycoprotein Q9NYU2 UGGG1_HUMAN 100 0 1 UGGT UGT1 UGTR glucosyltransferase) (UDP-glucose ceramide glucosyltransferase-like 1) Protein UXT (Androgen receptor trapped clone 27 protein) Q9UBK9 _HUMAN UXT HSPC024 STAP1 (ART-27) (Ubiquitously expressed transcript protein), 100 0 17 STAP1 WD repeat-containing protein 61 (Meiotic recombination Q9GZS3 WDR61_HUMAN WDR61 100 0 26 REC14 protein homolog) WD repeat-containing protein 92 (WD repeat-containing Q96MX6 WDR92_HUMAN WDR92 100 0 40 protein Monad) Nuclease-sensitive element-binding protein 1 (CCAAT- binding transcription factor I subunit A) (CBF-A) (DNA- P67809 YBOX1_HUMAN YBX1 NSEP1 YB1 binding protein B) (DBPB) (Enhancer factor I subunit A) 7.0 1 7 (EFI-A) (Y-box transcription factor) (Y-box-binding protein 1) (YB-1)

129

YLP motif-containing protein 1 (Nuclear protein ZAP3) P49750 YLPM1_HUMAN YLPM1 C14orf170 ZAP3 100 0 8 (ZAP113) ATP-dependent zinc metalloprotease YME1L1 (EC 3.4.24.-) YME1L1 FTSH1 YME1L Q96TA2 YMEL1_HUMAN (ATP-dependent metalloprotease FtsH1) (Meg-4) (Presenilin- 100 0 15 UNQ1868/PRO4304 associated metalloprotease) (PAMP) (YME1-like protein 1) 14-3-3 protein theta (14-3-3 protein T-cell) (14-3-3 protein P27348 1433T_HUMAN YWHAQ 100 0 2 tau) (Protein HS1) 14-3-3 protein zeta/delta (Protein kinase C inhibitor protein P63104 1433Z_HUMAN YWHAZ 100 0 2 1) (KCIP-1) 1Ratio of spectral counts detected in the URI1 pulldown to spectral counts detected in the IgG pulldown

130