DOCSLIB.ORG
Recommended publications
  • Hes5 Regulates the Transition Timing of Neurogenesis and Gliogenesis In
    © 2017. Published by The Company of Biologists Ltd | Development (2017) 144, 3156-3167 doi:10.1242/dev.147256 RESEARCH ARTICLE Hes5 regulates the transition timing of neurogenesis and gliogenesis in mammalian neocortical development Shama Bansod1,2, Ryoichiro Kageyama1,2,3,4 and Toshiyuki Ohtsuka1,2,3,* ABSTRACT has been reported that the high mobility group AT-hook (Hgma) During mammalian neocortical development, neural stem/progenitor genes regulate gene expression by modulating chromatin structure cells (NSCs) sequentially give rise to deep layer neurons and (Ozturk et al., 2014), maintain neurogenic NSCs, and inhibit superficial layer neurons through mid- to late-embryonic stages, gliogenesis during early- to mid-embryonic stages through global shifting to gliogenic phase at perinatal stages. Previously, we found opening of the chromatin state (Kishi et al., 2012). However, the that the Hes genes inhibit neuronal differentiation and maintain mechanism by which the expression of these epigenetic factors is NSCs. Here, we generated transgenic mice that overexpress Hes5 in controlled remains to be analyzed. NSCs of the central nervous system, and found that the transition Here, we found that Hes5, a transcriptional repressor acting timing from deep to superficial layer neurogenesis was shifted earlier, as an effector of Notch signaling, regulates the timing of while gliogenesis precociously occurred in the developing neocortex neurogenesis and gliogenesis via alteration in the expression of Hes5-overexpressing mice. By contrast, the transition from deep to levels of epigenetic factors. Notch signaling contributes to the superficial layer neurogenesis and the onset of gliogenesis were elaboration of cellular diversity during the development of various delayed in Hes5 knockout (KO) mice.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
    www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
    [Show full text]
  • Gene Standard Deviation MTOR 0.12553731 PRPF38A
    BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) Gut Gene Standard Deviation MTOR 0.12553731 PRPF38A 0.141472605 EIF2B4 0.154700091 DDX50 0.156333027 SMC3 0.161420017 NFAT5 0.166316903 MAP2K1 0.166585267 KDM1A 0.16904912 RPS6KB1 0.170330192 FCF1 0.170391706 MAP3K7 0.170660513 EIF4E2 0.171572093 TCEB1 0.175363093 CNOT10 0.178975095 SMAD1 0.179164705 NAA15 0.179904998 SETD2 0.180182498 HDAC3 0.183971158 AMMECR1L 0.184195031 CHD4 0.186678211 SF3A3 0.186697697 CNOT4 0.189434633 MTMR14 0.189734199 SMAD4 0.192451524 TLK2 0.192702667 DLG1 0.19336621 COG7 0.193422331 SP1 0.194364189 PPP3R1 0.196430217 ERBB2IP 0.201473001 RAF1 0.206887192 CUL1 0.207514271 VEZF1 0.207579584 SMAD3 0.208159809 TFDP1 0.208834504 VAV2 0.210269344 ADAM17 0.210687138 SMURF2 0.211437666 MRPS5 0.212428684 TMUB2 0.212560675 SRPK2 0.216217428 MAP2K4 0.216345366 VHL 0.219735582 SMURF1 0.221242495 PLCG1 0.221688351 EP300 0.221792349 Sundar R, et al. Gut 2020;0:1–10. doi: 10.1136/gutjnl-2020-320805 BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) Gut MGAT5 0.222050228 CDC42 0.2230598 DICER1 0.225358787 RBX1 0.228272533 ZFYVE16 0.22831803 PTEN 0.228595789 PDCD10 0.228799406 NF2 0.23091035 TP53 0.232683696 RB1 0.232729172 TCF20 0.2346075 PPP2CB 0.235117302 AGK 0.235416298
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • The Role of Hes1 in Pancreas Development Expression, Interdependancy and Notch Signalling
    FACULTY OF SCIENCE UNIVERSITY OF COPENHAGEN PhD thesis Cand.scient. Rasmus Klinck Department of Beta Cell Regeneration, Hagedorn Research Institute, and The PhD School of Science, Faculty of Science, University of Copenhagen, Denmark. The role of Hes1 in pancreas development Expression, Interdependancy and Notch signalling. Academic Advisors Dr. Olaf Nielsen, Department of Biology, Faculty of Science, University of Copenhagen – Denmark Dr. Mette C. Jørgensen, Department of Beta Cell Regeneration, Hagedorn Research Institute Denmark Submitted: 31/05/11 Cover picture: e10.5 mouse embryo expressing EGFP under the control of the Hes1 promoter manually stitched together from 15 complete image stacks. 2 Preface This Ph.D. thesis is based on experimental work performed in the Department of β Cell Regeneration at the Hagedorn Research Institute, Gentofte, Denmark from January 2008 to December 2010. The faculty supervisor on the project was Professor Olaf Nielsen, Department of Genetics, Faculty of Science, University of Copenhagen, and the project supervisor was Mette Christine Jørgensen, Ph.D., Chemist, Department of Beta Cell Regeneration at the Hagedorn Research Institute. This thesis is submitted in order to meet the requirements for obtaining a Ph.D. degree at the Faculty of Science, University of Copenhagen. The thesis is built around three scientific Manuscripts: Manuscript I: “A BAC transgenic Hes1-EGFP reporter reveals novel expression domains in mouse embryos” Submitted to Gene Expression Patterns Rasmus Klinck1, Ernst-Martin Füchtbauer2, Jonas Ahnfelt-Rønne1, Palle Serup1,Jan Nygaard Jensen1, Ole Dragsbæk Madsen1, Mette Christine Jørgensen1 1Department of Beta Cell Regeneration, Hagedorn Research Institute, Niels Steensens Vej 6, DK-2820 Gentofte, Denmark .2Department of Molecular Biology, Aarhus University, C.
    [Show full text]
  • Microrna Dysregulation Interplay with Childhood Abdominal Tumors
    Cancer and Metastasis Reviews (2019) 38:783–811 https://doi.org/10.1007/s10555-019-09829-x MicroRNA dysregulation interplay with childhood abdominal tumors Karina Bezerra Salomão1 & Julia Alejandra Pezuk2 & Graziella Ribeiro de Souza1 & Pablo Chagas1 & Tiago Campos Pereira3 & Elvis Terci Valera1 & María Sol Brassesco3 Published online: 17 December 2019 # Springer Science+Business Media, LLC, part of Springer Nature 2019 Abstract Abdominal tumors (AT) in children account for approximately 17% of all pediatric solid tumor cases, and frequently exhibit embryonal histological features that differentiate them from adult cancers. Current molecular approaches have greatly improved the understanding of the distinctive pathology of each tumor type and enabled the characterization of novel tumor biomarkers. As seen in abdominal adult tumors, microRNAs (miRNAs) have been increasingly implicated in either the initiation or progression of childhood cancer. Moreover, besides predicting patient prognosis, they represent valuable diagnostic tools that may also assist the surveillance of tumor behavior and treatment response, as well as the identification of the primary metastatic sites. Thus, the present study was undertaken to compile up- to-date information regarding the role of dysregulated miRNAs in the most common histological variants of AT, including neuroblas- toma, nephroblastoma, hepatoblastoma, hepatocarcinoma, and adrenal tumors. Additionally, the clinical implications of dysregulated miRNAs as potential diagnostic tools or indicators of prognosis were evaluated. Keywords miRNA . Neuroblastoma . Nephroblastoma . Hepatoblastoma . Hepatocarcinoma . Adrenal tumors 1 MicroRNA biogenesis and function retaining the hairpin (pre-miRNA, ~ 70 nucleotides long), which is translocated by Exportin-5 to the cytoplasm, and then Fundamentally, all cellular programs are controlled by genes: processed by another endoribonuclease (Dicer) into the growth, senescence, division, metabolism, stemness, mobility, miRNA duplex.
    [Show full text]
  • DUX4-Induced Constitutive DNA Damage and Oxidative Stress Contribute to Aberrant Differentiation of Myoblasts from FSHD Patients
    Free Radical Biology and Medicine 99 (2016) 244–258 Contents lists available at ScienceDirect Free Radical Biology and Medicine journal homepage: www.elsevier.com/locate/freeradbiomed Original article DUX4-induced constitutive DNA damage and oxidative stress contribute to aberrant differentiation of myoblasts from FSHD patients Petr Dmitriev a,b,1, Yara Bou Saada a,1, Carla Dib a, Eugénie Ansseau d, Ana Barat a, Aline Hamade e, Philippe Dessen c, Thomas Robert c, Vladimir Lazar c, Ruy A.N. Louzada g, Corinne Dupuy g, Vlada Zakharova f, Gilles Carnac b, Marc Lipinski a, Yegor S. Vassetzky a,f,n a UMR 8126, Univ. Paris-Sud, CNRS, Institut de Cancérologie Gustave-Roussy, F-94805 Villejuif, France b PhyMedExp, University of Montpellier, INSERM U1046, CNRS UMR 9214, F-34295 Montpellier cedex 5, France c Functional Genomics Unit, Institut de Cancérologie Gustave-Roussy, F-94805 Villejuif, France d Laboratory of Molecular Biology, University of Mons, 20 place du Parc, B700 Mons, Belgium e ER030-EDST, Department of Life and Earth Sciences, Faculty of Sciences II, Lebanese University, Lebanon f Lomonosov Moscow State University, Faculty of Bioengineering and Bioinformatics, 119991 Moscow, Russia g UMR 8200, Univ., Paris-Sud, CNRS, Institut de Cancérologie Gustave-Roussy, F-94805 Villejuif, France article info abstract Article history: Facioscapulohumeral dystrophy (FSHD) is one of the three most common muscular dystrophies in the Received 31 March 2016 Western world, however, its etiology remains only partially understood. Here, we provide evidence of Received in revised form constitutive DNA damage in in vitro cultured myoblasts isolated from FSHD patients and demonstrate 4 August 2016 oxidative DNA damage implication in the differentiation of these cells into phenotypically-aberrant Accepted 8 August 2016 myotubes.
    [Show full text]
  • Spatial and Temporal Specification of Neural Fates by Transcription Factor Codes François Guillemot
    REVIEW 3771 Development 134, 3771-3780 (2007) doi:10.1242/dev.006379 Spatial and temporal specification of neural fates by transcription factor codes François Guillemot The vertebrate central nervous system contains a great diversity Box 1. Neurons and glial cells of neurons and glial cells, which are generated in the embryonic neural tube at specific times and positions. Several classes of transcription factors have been shown to control various steps in the differentiation of progenitor cells in the neural tube and to determine the identity of the cells produced. Recent evidence indicates that combinations of transcription factors of the homeodomain and basic helix-loop-helix families establish molecular codes that determine both where and when the different kinds of neurons and glial cells are generated. Introduction Neuron Oligodendrocyte Astrocyte A multitude of neurons of different types, as well as oligodendrocytes and astrocytes (see Box 1), are generated as the vertebrate central The vertebrate central nervous system comprises three primary cell nervous system develops. These different neural cells are generated types, including neurons and two types of glial cells. Neurons are at defined times and positions by multipotent progenitors located in electrically excitable cells that process and transmit information via the walls of the embryonic neural tube. Progenitors located in the the release of neurotransmitters at synapses. Different subtypes of ventral neural tube at spinal cord level first produce motor neurons, neurons can be distinguished by the morphology of their cell body which innervate skeletal muscles and later produce oligodendrocytes and dendritic tree, the type of cells they connect with via their axon, the type of neurotransmitter used, etc.
    [Show full text]
  • Table SII. Significantly Differentially Expressed Mrnas of GSE23558 Data Series with the Criteria of Adjusted P<0.05 And
    Table SII. Significantly differentially expressed mRNAs of GSE23558 data series with the criteria of adjusted P<0.05 and logFC>1.5. Probe ID Adjusted P-value logFC Gene symbol Gene title A_23_P157793 1.52x10-5 6.91 CA9 carbonic anhydrase 9 A_23_P161698 1.14x10-4 5.86 MMP3 matrix metallopeptidase 3 A_23_P25150 1.49x10-9 5.67 HOXC9 homeobox C9 A_23_P13094 3.26x10-4 5.56 MMP10 matrix metallopeptidase 10 A_23_P48570 2.36x10-5 5.48 DHRS2 dehydrogenase A_23_P125278 3.03x10-3 5.40 CXCL11 C-X-C motif chemokine ligand 11 A_23_P321501 1.63x10-5 5.38 DHRS2 dehydrogenase A_23_P431388 2.27x10-6 5.33 SPOCD1 SPOC domain containing 1 A_24_P20607 5.13x10-4 5.32 CXCL11 C-X-C motif chemokine ligand 11 A_24_P11061 3.70x10-3 5.30 CSAG1 chondrosarcoma associated gene 1 A_23_P87700 1.03x10-4 5.25 MFAP5 microfibrillar associated protein 5 A_23_P150979 1.81x10-2 5.25 MUCL1 mucin like 1 A_23_P1691 2.71x10-8 5.12 MMP1 matrix metallopeptidase 1 A_23_P350005 2.53x10-4 5.12 TRIML2 tripartite motif family like 2 A_24_P303091 1.23x10-3 4.99 CXCL10 C-X-C motif chemokine ligand 10 A_24_P923612 1.60x10-5 4.95 PTHLH parathyroid hormone like hormone A_23_P7313 6.03x10-5 4.94 SPP1 secreted phosphoprotein 1 A_23_P122924 2.45x10-8 4.93 INHBA inhibin A subunit A_32_P155460 6.56x10-3 4.91 PICSAR P38 inhibited cutaneous squamous cell carcinoma associated lincRNA A_24_P686965 8.75x10-7 4.82 SH2D5 SH2 domain containing 5 A_23_P105475 7.74x10-3 4.70 SLCO1B3 solute carrier organic anion transporter family member 1B3 A_24_P85099 4.82x10-5 4.67 HMGA2 high mobility group AT-hook 2 A_24_P101651
    [Show full text]
  • Supplementary Table 1
    Supplementary Table 1. 492 genes are unique to 0 h post-heat timepoint. The name, p-value, fold change, location and family of each gene are indicated. Genes were filtered for an absolute value log2 ration 1.5 and a significance value of p ≤ 0.05. Symbol p-value Log Gene Name Location Family Ratio ABCA13 1.87E-02 3.292 ATP-binding cassette, sub-family unknown transporter A (ABC1), member 13 ABCB1 1.93E-02 −1.819 ATP-binding cassette, sub-family Plasma transporter B (MDR/TAP), member 1 Membrane ABCC3 2.83E-02 2.016 ATP-binding cassette, sub-family Plasma transporter C (CFTR/MRP), member 3 Membrane ABHD6 7.79E-03 −2.717 abhydrolase domain containing 6 Cytoplasm enzyme ACAT1 4.10E-02 3.009 acetyl-CoA acetyltransferase 1 Cytoplasm enzyme ACBD4 2.66E-03 1.722 acyl-CoA binding domain unknown other containing 4 ACSL5 1.86E-02 −2.876 acyl-CoA synthetase long-chain Cytoplasm enzyme family member 5 ADAM23 3.33E-02 −3.008 ADAM metallopeptidase domain Plasma peptidase 23 Membrane ADAM29 5.58E-03 3.463 ADAM metallopeptidase domain Plasma peptidase 29 Membrane ADAMTS17 2.67E-04 3.051 ADAM metallopeptidase with Extracellular other thrombospondin type 1 motif, 17 Space ADCYAP1R1 1.20E-02 1.848 adenylate cyclase activating Plasma G-protein polypeptide 1 (pituitary) receptor Membrane coupled type I receptor ADH6 (includes 4.02E-02 −1.845 alcohol dehydrogenase 6 (class Cytoplasm enzyme EG:130) V) AHSA2 1.54E-04 −1.6 AHA1, activator of heat shock unknown other 90kDa protein ATPase homolog 2 (yeast) AK5 3.32E-02 1.658 adenylate kinase 5 Cytoplasm kinase AK7
    [Show full text]
  • ZNF346 Antibody (Pab)
    21.10.2014ZNF346 antibody (pAb) Rabbit Anti -Human/Mouse/Rat Zinc finger protein 346 (JAZ) Instruction Manual Catalog Number PK-AB718-6003 Synonyms ZNF346 Antibody: Zinc finger protein 346, Just another zinc finger protein, JAZ Description ZNF346, also known as JAZ (just another zinc-finger protein), is a nucleolar, zinc finger protein which preferentially binds to double-stranded (ds) RNA or RNA/DNA hybrids with high affinity via C2H2 zinc fingers. ZNF346 contains four CH-type zinc finger motifs that are connected by long (28-38) amino acid linker sequences. ZNF346 is expressed in all tissues tested and localizes to the nucleus, primarily the nucleolus. ZNF346 is exported by exportin-5 but translocates back into nuclei by a facilitated diffusion mechanism. ZNF346 interacts with ILF3 in an RNA-independent manner and may be involved in cell growth and survival. Quantity 100 µg Source / Host Rabbit Immunogen ZNF346 antibody was raised against a 20 amino acid synthetic peptide near the amino terminus of human ZNF346. Purification Method Affinity chromatography purified via peptide column. Clone / IgG Subtype Polyclonal antibody Species Reactivity Human, Mouse, Rat Specificity Formulation Antibody is supplied in PBS containing 0.02% sodium azide. Reconstitution During shipment, small volumes of antibody will occasionally become entrapped in the seal of the product vial. For products with volumes of 200 μl or less, we recommend gently tapping the vial on a hard surface or briefly centrifuging the vial in a tabletop centrifuge to dislodge any liquid in the container’s cap. Storage & Stability Antibody can be stored at 4ºC for three months and at -20°C for up to one year.
    [Show full text]