DOCSLIB.ORG

Regulatory Discrimination of Mrnas by FMRP Controls Mouse Adult

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Regulatory Discrimination of Mrnas by FMRP Controls Mouse Adult Regulatory discrimination of mRNAs by FMRP controls SEE COMMENTARY mouse adult neural stem cell differentiation Botao Liua,1, Yue Lib,c,d,1, Emily E. Stackpolea, Annie Novakb,c, Yu Gaob,c, Yinghua Zhaob,c, Xinyu Zhaob,c,2, and Joel D. Richtera,2 aProgram in Molecular Medicine, University of Massachusetts Medical School, Worcester, MA 01605; bWaisman Center, University of Wisconsin–Madison, Madison, WI 53705; cDepartment of Neuroscience, University of Wisconsin–Madison, Madison, WI 53705; and dInstitute of Traditional Chinese Medicine, Tianjin University of Traditional Chinese Medicine, Tianjin 301617, China Edited by Nahum Sonenberg, McGill University, Montreal, Canada, and approved October 4, 2018 (received for review June 5, 2018) Fragile X syndrome (FXS) is caused by the loss of fragile X mental learning deficits in FMRP-deficient mice (10). FMRP deficiency retardation protein (FMRP), an RNA binding protein whose de- in mouse aNSCs leads not only to aberrant activation and in- ficiency impacts many brain functions, including differentiation of creased proliferation of aNSCs, but also to reduced neural dif- adult neural stem cells (aNSCs). However, the mechanism by which ferentiation (11, 12). Although several FMRP-regulated genes FMRP influences these processes remains unclear. Here, we per- and pathways have been identified in aNSCs, genome-wide gene formed ribosome profiling and transcriptomic analysis of aNSCs in expression changes resulting from FMRP deficiency remain parallel from wild-type and Fmr1 knockout mice. Our data revealed unknown. Moreover, how gene expression programs are com- diverse gene expression changes at both mRNA and translation promised in FMRP-deficient aNSCs remains elusive. levels. Many mitosis and neurogenesis genes were dysregulated Several studies using high-throughput technologies, such as cross- primarily at the mRNA level, while numerous synaptic genes were linking immunoprecipitation (CLIP) coupled with sequencing (13– mostly dysregulated at the translation level. Translational “buffer- 15), have identified partially overlapping lists of FMRP target ing”, whereby changes in ribosome association with mRNA are com- mRNAs. However, those approaches suffer from the heterogeneity pensated by alterations in RNA abundance, was also evident. of brain tissue, the lack of sufficient sensitivity, and the inability of Knockdown of NECDIN, an FMRP-repressed transcriptional factor, capturing simultaneous changes in mRNA and translation. rescued neuronal differentiation. In addition, we discovered To obtain an in-depth understanding of gene regulation by NEUROSCIENCE that FMRP regulates mitochondrial mRNA expression and energy FMRP, we performed simultaneous ribosome profiling and homeostasis. Thus, FMRP controls diverse transcriptional and RNA sequencing (RNA-seq) on Fmr1 KO aNSCs. Our data posttranscriptional gene expression programs critical for neural revealed six distinct forms of FMRP regulation at mRNA and differentiation. translation levels that are involved in mitosis, neurogenesis, synaptic, and mitochondrial function. Interestingly, many mitosis fragile X syndrome | neural stem cells | translation | ribosome profiling | and neurogenesis genes were dysregulated primarily at the neural differentiation mRNA level, whereas numerous synaptic genes were mostly ragile X syndrome (FXS) is the most common form of Significance Finherited intellectual disability, which occurs in about 1 in 4,000 males and 1 in 6,000 females. FXS patients display a wide Fragile X syndrome (FXS) is the most common form of inherited spectrum of autistic features, including cognitive, behavioral, and intellectual disability and autism. FXS results from the loss of social deficits (1). Nearly all FXS cases are caused by a CGG functional fragile X mental retardation protein (FMRP), an RNA trinucleotide repeat expansion in the 5′ UTR of the fragile X binding protein involved in translational regulation. However, mental retardation 1 (FMR1) gene, which leads to hyper- the impact of FMRP on gene expression has not been evaluated methylation of the promoter region (2) and consequent tran- comprehensively. Here, we present simultaneous high-resolution scriptional silencing and loss of the encoded protein, fragile X ribosome profiling and RNA-sequencing data from the same wild- mental retardation protein (FMRP). FMRP is an RNA binding type and FMRP-deficient adult neural stem cells. We find re- protein that is highly expressed in the brain and largely functions markable and heretofore unknown forms of regulation by FMRP as a translational repressor (3). In addition to FMR1, other critical for neural differentiation. Importantly, our data also show mutations underlying autism spectrum disorders occur in genes that FMRP controls RNA expression in six distinct ways. Thus, we that signal to the translational apparatus, such as TSC complex have uncovered a molecular foundation for pathophysiologies subunit 2 (TSC2) and phosphatase and tensin homolog (PTEN) associated with FXS. (4, 5). It is therefore apparent that maintenance of translational homeostasis is essential for proper neural functions such as Author contributions: X.Z. and J.D.R. designed research; B.L., Y.L., and E.E.S. performed research; Y.G. contributed new reagents/analytic tools; B.L., Y.L., A.N., and Y.Z. analyzed synaptic efficacy (6). Indeed, a number of phenotypes of the data; and B.L., Y.L., X.Z., and J.D.R. wrote the paper. Fmr1 knockout (KO) mouse are rescued by depleting a variety of The authors declare no conflict of interest. translational activators, likely through rebalancing the trans- This article is a PNAS Direct Submission. lational homeostasis (7, 8). Published under the PNAS license. Neurogenesis persists throughout life in two germinal zones: Data deposition: The data reported in this paper have been deposited in the Gene Ex- the subgranular zone in the dentate gyrus (DG) of the hippo- pression Omnibus (GEO) database, https://www.ncbi.nlm.nih.gov/geo (accession no. campus and the subventricular zone of the lateral ventricles (9). GSE112502). The newborn neurons in the DG integrate into the existing cir- See Commentary on page 12086. cuitry of the hippocampus, which is crucial for cognitive function 1B.L. and Y.L. contributed equally to this work. and implicated in both neurodevelopmental and neuropsychiat- 2To whom correspondence may be addressed. Email: [email protected] or joel. ric disorders (9). We have shown that selective deletion of [email protected]. FMRP from adult neural stem cells (aNSCs) leads to impaired This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. performance on hippocampus-dependent learning tasks; con- 1073/pnas.1809588115/-/DCSupplemental. versely, restoration of FMRP specifically in aNSCs rescues these Published online October 29, 2018. www.pnas.org/cgi/doi/10.1073/pnas.1809588115 PNAS | vol. 115 | no. 48 | E11397–E11405 Downloaded by guest on October 1, 2021 A AAAA B Translation up Translation down AAAA AAAA AAAA AAAA AAAA RNase RNA extraction Buffering up Buffering down AAAA AAAA AAAA AAAA Purification Fragmentation AAAA AAAA AAAA mRNA up mRNA down Ribo-seq RNA-seq AAAA AAAA RPF AAAA AAAA mRNA AAAA AAAA Reference C E nuclear division 8 mitotic cell cycle 6 cell migration FDR 4 10 cell adhesion 2 neurogenesis -log 0 neuron projection development chemical synaptic transmission regulation of synapse activity wn wn o ring up fe mRNA up fering down mRNABuf d anslation up Tr Buf anslation do Tr 12 F chromosome extracellular region 8 cell junction FDR 10 synapse 4 neuron projection -log 0 mitochondrial ribosome wn wn wn o ing up ring do mRNA up e mRNABuffer d TranslationBuff anslation up do Tr D mRNA RPF TE ns **** ns **** **** **** **** *** **** **** **** **** **** **** **** **** **** **** Gene group 1 1 1 All FC 2 Translation up Buffering up 0 0 0 Translation down Buffering down KO/WT log KO/WT −1 −1 −1 mRNA up mRNA down Fig. 1. Ribosome profiling reveals diverse changes of gene expression in Fmr1 KO aNSCs. (A) Schematic diagram of the experimental procedures for ribosome profiling. (B) Schematic diagram of six regulatory groups captured by ribosome profiling. (C) Scatter plot of expression changes of mRNA levels and RPFs. Dysregulated mRNAs in the absence of FMRP are classified into six regulatory groups as shown in B; 12,502 genes past filtering are used for the scatter plot. Absolute fold change (FC) > 1.2, nominal P < 0.05, and false discovery rate (FDR) = 0.042 by permutation test. (D) Box plots of expression changes at different levels across six regulatory groups that visualize the medians. The lower and upper hinges correspond to the first and third quartiles. The whiskers extend from the hinges to the largest and smallest values no further than 1.5-fold of interquartile range. Outliers are not shown. Gene expression changes of each regulatory group were compared with those of all genes used for differentially expressed gene analysis (ns, not significant; ***P < 0.001; ****P < 0.0001; Wilcoxon rank sum test after multiple test correction with the Bonferroni method). (E) Top GO terms of biological process enriched in each regulatory group. The enrichment significance (−log10 FDR) is color coded. (F) Top GO terms of cellular component enriched in each regulatory group. See also SI Appendix, Figs. S1 and S2 and Datasets S1–S3. E11398 | www.pnas.org/cgi/doi/10.1073/pnas.1809588115 Liu et al. Downloaded by guest on October 1, 2021 dysregulated at the translation level. We discovered
Load more

Recommended publications
  • Different Genetic Mechanisms Mediate Spontaneous Versus UVR-Induced
    RESEARCH ARTICLE Different genetic mechanisms mediate spontaneous versus UVR-induced malignant melanoma Blake Ferguson1, Herlina Y Handoko1, Pamela Mukhopadhyay1, Arash Chitsazan1, Lois Balmer2,3, Grant Morahan2, Graeme J Walker1†* 1Drug Discovery Group, QIMR Berghofer Medical Research Institute, Herston, Australia; 2Centre for Diabetes Research, Harry Perkins Institute of Medical Research, Perth, Australia; 3School of Medical and Health Sciences, Edith Cowan University, Joondalup, Australia Abstract Genetic variation conferring resistance and susceptibility to carcinogen-induced tumorigenesis is frequently studied in mice. We have now turned this idea to melanoma using the collaborative cross (CC), a resource of mouse strains designed to discover genes for complex diseases. We studied melanoma-prone transgenic progeny across seventy CC genetic backgrounds. We mapped a strong quantitative trait locus for rapid onset spontaneous melanoma onset to Prkdc, a gene involved in detection and repair of DNA damage. In contrast, rapid onset UVR-induced melanoma was linked to the ribosomal subunit gene Rrp15. Ribosome biogenesis was upregulated in skin shortly after UVR exposure. Mechanistically, variation in the ‘usual suspects’ by which UVR may exacerbate melanoma, defective DNA repair, melanocyte proliferation, or inflammatory cell infiltration, did not explain melanoma susceptibility or resistance across the CC. *For correspondence: [email protected] Instead, events occurring soon after exposure, such as dysregulation of ribosome function, which alters many aspects of cellular metabolism, may be important. † Present address: Experimental DOI: https://doi.org/10.7554/eLife.42424.001 Dermatology Group, The University of Queensland Diamantina Institute, Woolloongabba, Australia Introduction Competing interests: The Cutaneous malignant melanoma (MM) is well known to be associated with high levels of sun expo- authors declare that no sure.
    [Show full text]
  • The Identification of Genetic Determinants of Methanol
    Journal of Fungi Article The Identification of Genetic Determinants of Methanol Tolerance in Yeast Suggests Differences in Methanol and Ethanol Toxicity Mechanisms and Candidates for Improved Methanol Tolerance Engineering Marta N. Mota 1,2, Luís C. Martins 1,2 and Isabel Sá-Correia 1,2,* 1 iBB—Institute for Bioengineering and Biosciences, Instituto Superior Técnico, Universidade de Lisboa, 1049-001 Lisbon, Portugal; [email protected] (M.N.M.); [email protected] (L.C.M.) 2 Department of Bioengineering, Instituto Superior Técnico, Universidade de Lisboa, 1049-001 Lisbon, Portugal * Correspondence: [email protected] Abstract: Methanol is a promising feedstock for metabolically competent yeast strains-based biore- fineries. However, methanol toxicity can limit the productivity of these bioprocesses. Therefore, the identification of genes whose expression is required for maximum methanol tolerance is important for mechanistic insights and rational genomic manipulation to obtain more robust methylotrophic yeast strains. The present chemogenomic analysis was performed with this objective based on the screening of the Euroscarf Saccharomyces cerevisiae haploid deletion mutant collection to search for susceptibility ◦ phenotypes in YPD medium supplemented with 8% (v/v) methanol, at 35 C, compared with an equivalent ethanol concentration (5.5% (v/v)). Around 400 methanol tolerance determinants were Citation: Mota, M.N.; Martins, L.C.; identified, 81 showing a marked phenotype. The clustering of the identified tolerance genes indicates Sá-Correia, I. The Identification of an enrichment of functional categories in the methanol dataset not enriched in the ethanol dataset, Genetic Determinants of Methanol Tolerance in Yeast Suggests such as chromatin remodeling, DNA repair and fatty acid biosynthesis.
    [Show full text]
  • Supplementary Materials: Evaluation of Cytotoxicity and Α-Glucosidase Inhibitory Activity of Amide and Polyamino-Derivatives of Lupane Triterpenoids
    Supplementary Materials: Evaluation of cytotoxicity and α-glucosidase inhibitory activity of amide and polyamino-derivatives of lupane triterpenoids Oxana B. Kazakova1*, Gul'nara V. Giniyatullina1, Akhat G. Mustafin1, Denis A. Babkov2, Elena V. Sokolova2, Alexander A. Spasov2* 1Ufa Institute of Chemistry of the Ufa Federal Research Centre of the Russian Academy of Sciences, 71, pr. Oktyabrya, 450054 Ufa, Russian Federation 2Scientific Center for Innovative Drugs, Volgograd State Medical University, Novorossiyskaya st. 39, Volgograd 400087, Russian Federation Correspondence Prof. Dr. Oxana B. Kazakova Ufa Institute of Chemistry of the Ufa Federal Research Centre of the Russian Academy of Sciences 71 Prospeсt Oktyabrya Ufa, 450054 Russian Federation E-mail: [email protected] Prof. Dr. Alexander A. Spasov Scientific Center for Innovative Drugs of the Volgograd State Medical University 39 Novorossiyskaya st. Volgograd, 400087 Russian Federation E-mail: [email protected] Figure S1. 1H and 13C of compound 2. H NH N H O H O H 2 2 Figure S2. 1H and 13C of compound 4. NH2 O H O H CH3 O O H H3C O H 4 3 Figure S3. Anticancer screening data of compound 2 at single dose assay 4 Figure S4. Anticancer screening data of compound 7 at single dose assay 5 Figure S5. Anticancer screening data of compound 8 at single dose assay 6 Figure S6. Anticancer screening data of compound 9 at single dose assay 7 Figure S7. Anticancer screening data of compound 12 at single dose assay 8 Figure S8. Anticancer screening data of compound 13 at single dose assay 9 Figure S9. Anticancer screening data of compound 14 at single dose assay 10 Figure S10.
    [Show full text]
  • MRPL11 Antibody A
    Revision 1 C 0 2 - t MRPL11 Antibody a e r o t S Orders: 877-616-CELL (2355) [email protected] Support: 877-678-TECH (8324) 9 9 Web: [email protected] 1 www.cellsignal.com 2 # 3 Trask Lane Danvers Massachusetts 01923 USA For Research Use Only. Not For Use In Diagnostic Procedures. Applications: Reactivity: Sensitivity: MW (kDa): Source: UniProt ID: Entrez-Gene Id: WB, IP H Mk Endogenous 21 Rabbit Q9Y3B7 65003 Product Usage Information Application Dilution Western Blotting 1:1000 Immunoprecipitation 1:50 Storage Supplied in 10 mM sodium HEPES (pH 7.5), 150 mM NaCl, 100 µg/ml BSA and 50% glycerol. Store at –20°C. Do not aliquot the antibody. Specificity / Sensitivity MRPL11 Antibody detects endogenous levels of total MRPL11 protein. Species Reactivity: Human, Monkey Source / Purification Polyclonal antibodies are produced by immunizing animals with a synthetic peptide corresponding to the sequence of human MRPL11. Antibodies are purified by peptide affinity chromatography. Background A subset of mitochondrial proteins are synthesized on the ribosomes within mitochondria (1). The 55S mammalian mitochondrial ribosomes are composed of a 28S small subunit and a 39S large subunit (1). Over 40 protein components have been identified from the large subunit of the human mitochondrial ribosome (1). The mitochondrial ribosomal protein L11 (MRPL11) is one such component (1). In animals, plants and fungi, this protein is translated from a gene in the nuclear genome (2). 1. Koc, E.C. et al. (2001) J Biol Chem 276, 43958-69. 2. Handa, H. et al. (2001) Mol Genet Genomics 265, 569-75.
    [Show full text]
  • Analysis of Gene Expression Data for Gene Ontology
    ANALYSIS OF GENE EXPRESSION DATA FOR GENE ONTOLOGY BASED PROTEIN FUNCTION PREDICTION A Thesis Presented to The Graduate Faculty of The University of Akron In Partial Fulfillment of the Requirements for the Degree Master of Science Robert Daniel Macholan May 2011 ANALYSIS OF GENE EXPRESSION DATA FOR GENE ONTOLOGY BASED PROTEIN FUNCTION PREDICTION Robert Daniel Macholan Thesis Approved: Accepted: _______________________________ _______________________________ Advisor Department Chair Dr. Zhong-Hui Duan Dr. Chien-Chung Chan _______________________________ _______________________________ Committee Member Dean of the College Dr. Chien-Chung Chan Dr. Chand K. Midha _______________________________ _______________________________ Committee Member Dean of the Graduate School Dr. Yingcai Xiao Dr. George R. Newkome _______________________________ Date ii ABSTRACT A tremendous increase in genomic data has encouraged biologists to turn to bioinformatics in order to assist in its interpretation and processing. One of the present challenges that need to be overcome in order to understand this data more completely is the development of a reliable method to accurately predict the function of a protein from its genomic information. This study focuses on developing an effective algorithm for protein function prediction. The algorithm is based on proteins that have similar expression patterns. The similarity of the expression data is determined using a novel measure, the slope matrix. The slope matrix introduces a normalized method for the comparison of expression levels throughout a proteome. The algorithm is tested using real microarray gene expression data. Their functions are characterized using gene ontology annotations. The results of the case study indicate the protein function prediction algorithm developed is comparable to the prediction algorithms that are based on the annotations of homologous proteins.
    [Show full text]
  • Multifactorial Erβ and NOTCH1 Control of Squamous Differentiation and Cancer
    Multifactorial ERβ and NOTCH1 control of squamous differentiation and cancer Yang Sui Brooks, … , Karine Lefort, G. Paolo Dotto J Clin Invest. 2014;124(5):2260-2276. https://doi.org/10.1172/JCI72718. Research Article Oncology Downmodulation or loss-of-function mutations of the gene encoding NOTCH1 are associated with dysfunctional squamous cell differentiation and development of squamous cell carcinoma (SCC) in skin and internal organs. While NOTCH1 receptor activation has been well characterized, little is known about how NOTCH1 gene transcription is regulated. Using bioinformatics and functional screening approaches, we identified several regulators of the NOTCH1 gene in keratinocytes, with the transcription factors DLX5 and EGR3 and estrogen receptor β (ERβ) directly controlling its expression in differentiation. DLX5 and ERG3 are required for RNA polymerase II (PolII) recruitment to the NOTCH1 locus, while ERβ controls NOTCH1 transcription through RNA PolII pause release. Expression of several identified NOTCH1 regulators, including ERβ, is frequently compromised in skin, head and neck, and lung SCCs and SCC-derived cell lines. Furthermore, a keratinocyte ERβ–dependent program of gene expression is subverted in SCCs from various body sites, and there are consistent differences in mutation and gene-expression signatures of head and neck and lung SCCs in female versus male patients. Experimentally increased ERβ expression or treatment with ERβ agonists inhibited proliferation of SCC cells and promoted NOTCH1 expression and squamous differentiation both in vitro and in mouse xenotransplants. Our data identify a link between transcriptional control of NOTCH1 expression and the estrogen response in keratinocytes, with implications for differentiation therapy of squamous cancer. Find the latest version: https://jci.me/72718/pdf Research article Multifactorial ERβ and NOTCH1 control of squamous differentiation and cancer Yang Sui Brooks,1,2 Paola Ostano,3 Seung-Hee Jo,1,2 Jun Dai,1,2 Spiro Getsios,4 Piotr Dziunycz,5 Günther F.L.
    [Show full text]
  • Allele-Specific Expression of Ribosomal Protein Genes in Interspecific Hybrid Catfish
    Allele-specific Expression of Ribosomal Protein Genes in Interspecific Hybrid Catfish by Ailu Chen A dissertation submitted to the Graduate Faculty of Auburn University in partial fulfillment of the requirements for the Degree of Doctor of Philosophy Auburn, Alabama August 1, 2015 Keywords: catfish, interspecific hybrids, allele-specific expression, ribosomal protein Copyright 2015 by Ailu Chen Approved by Zhanjiang Liu, Chair, Professor, School of Fisheries, Aquaculture and Aquatic Sciences Nannan Liu, Professor, Entomology and Plant Pathology Eric Peatman, Associate Professor, School of Fisheries, Aquaculture and Aquatic Sciences Aaron M. Rashotte, Associate Professor, Biological Sciences Abstract Interspecific hybridization results in a vast reservoir of allelic variations, which may potentially contribute to phenotypical enhancement in the hybrids. Whether the allelic variations are related to the downstream phenotypic differences of interspecific hybrid is still an open question. The recently developed genome-wide allele-specific approaches that harness high- throughput sequencing technology allow direct quantification of allelic variations and gene expression patterns. In this work, I investigated allele-specific expression (ASE) pattern using RNA-Seq datasets generated from interspecific catfish hybrids. The objective of the study is to determine the ASE genes and pathways in which they are involved. Specifically, my study investigated ASE-SNPs, ASE-genes, parent-of-origins of ASE allele and how ASE would possibly contribute to heterosis. My data showed that ASE was operating in the interspecific catfish system. Of the 66,251 and 177,841 SNPs identified from the datasets of the liver and gill, 5,420 (8.2%) and 13,390 (7.5%) SNPs were identified as significant ASE-SNPs, respectively.
    [Show full text]
  • Supplementary Materials
    Supplementary Materials: Supplemental Table 1 Abbreviations FMDV Foot and Mouth Disease Virus FMD Foot and Mouth Disease NC Non-treated Control DEGs Differentially Expressed Genes RNA-seq High-throughput Sequencing of Mrna RT-qPCR Quantitative Real-time Reverse Transcriptase PCR TCID50 50% Tissue Culture Infective Doses CPE Cytopathic Effect MOI Multiplicity of Infection DMEM Dulbecco's Modified Eagle Medium FBS Fetal Bovine Serum PBS Phosphate Buffer Saline QC Quality Control FPKM Fragments per Kilo bases per Million fragments method GO Gene Ontology KEGG Kyoto Encyclopedia of Genes and Genomes R Pearson Correlation Coefficient NFKBIA NF-kappa-B Inhibitor alpha IL6 Interleukin 6 CCL4 C-C motif Chemokine 4 CXCL2 C-X-C motif Chemokine 2 TNF Tumor Necrosis Factor VEGFA Vascular Endothelial Growth Gactor A CCL20 C-C motif Chemokine 20 CSF2 Macrophage Colony-Stimulating Factor 2 GADD45B Growth Arrest and DNA Damage Inducible 45 beta MYC Myc proto-oncogene protein FOS Proto-oncogene c-Fos MCL1 Induced myeloid leukemia cell differentiation protein Mcl-1 MAP3K14 Mitogen-activated protein kinase kinase kinase 14 IRF1 Interferon regulatory factor 1 CCL5 C-C motif chemokine 5 ZBTB3 Zinc finger and BTB domain containing 3 OTX1 Orthodenticle homeobox 1 TXNIP Thioredoxin-interacting protein ZNF180 Znc Finger Protein 180 ZNF36 Znc Finger Protein 36 ZNF182 Zinc finger protein 182 GINS3 GINS complex subunit 3 KLF15 Kruppel-like factor 15 Supplemental Table 2 Primers for Verification of RNA-seq-detected DEGs with RT-qPCR TNF F: CGACTCAGTGCCGAGATCAA R:
    [Show full text]
  • Role of Mitochondrial Ribosomal Protein S18-2 in Cancerogenesis and in Regulation of Stemness and Differentiation
    From THE DEPARTMENT OF MICROBIOLOGY TUMOR AND CELL BIOLOGY (MTC) Karolinska Institutet, Stockholm, Sweden ROLE OF MITOCHONDRIAL RIBOSOMAL PROTEIN S18-2 IN CANCEROGENESIS AND IN REGULATION OF STEMNESS AND DIFFERENTIATION Muhammad Mushtaq Stockholm 2017 All previously published papers were reproduced with permission from the publisher. Published by Karolinska Institutet. Printed by E-Print AB 2017 © Muhammad Mushtaq, 2017 ISBN 978-91-7676-697-2 Role of Mitochondrial Ribosomal Protein S18-2 in Cancerogenesis and in Regulation of Stemness and Differentiation THESIS FOR DOCTORAL DEGREE (Ph.D.) By Muhammad Mushtaq Principal Supervisor: Faculty Opponent: Associate Professor Elena Kashuba Professor Pramod Kumar Srivastava Karolinska Institutet University of Connecticut Department of Microbiology Tumor and Cell Center for Immunotherapy of Cancer and Biology (MTC) Infectious Diseases Co-supervisor(s): Examination Board: Professor Sonia Lain Professor Ola Söderberg Karolinska Institutet Uppsala University Department of Microbiology Tumor and Cell Department of Immunology, Genetics and Biology (MTC) Pathology (IGP) Professor George Klein Professor Boris Zhivotovsky Karolinska Institutet Karolinska Institutet Department of Microbiology Tumor and Cell Institute of Environmental Medicine (IMM) Biology (MTC) Professor Lars-Gunnar Larsson Karolinska Institutet Department of Microbiology Tumor and Cell Biology (MTC) Dedicated to my parents ABSTRACT Mitochondria carry their own ribosomes (mitoribosomes) for the translation of mRNA encoded by mitochondrial DNA. The architecture of mitoribosomes is mainly composed of mitochondrial ribosomal proteins (MRPs), which are encoded by nuclear genomic DNA. Emerging experimental evidences reveal that several MRPs are multifunctional and they exhibit important extra-mitochondrial functions, such as involvement in apoptosis, protein biosynthesis and signal transduction. Dysregulations of the MRPs are associated with severe pathological conditions, including cancer.
    [Show full text]
  • Supplementary Table 1: Adhesion Genes Data Set
    Supplementary Table 1: Adhesion genes data set PROBE Entrez Gene ID Celera Gene ID Gene_Symbol Gene_Name 160832 1 hCG201364.3 A1BG alpha-1-B glycoprotein 223658 1 hCG201364.3 A1BG alpha-1-B glycoprotein 212988 102 hCG40040.3 ADAM10 ADAM metallopeptidase domain 10 133411 4185 hCG28232.2 ADAM11 ADAM metallopeptidase domain 11 110695 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 195222 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 165344 8751 hCG20021.3 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 189065 6868 null ADAM17 ADAM metallopeptidase domain 17 (tumor necrosis factor, alpha, converting enzyme) 108119 8728 hCG15398.4 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 117763 8748 hCG20675.3 ADAM20 ADAM metallopeptidase domain 20 126448 8747 hCG1785634.2 ADAM21 ADAM metallopeptidase domain 21 208981 8747 hCG1785634.2|hCG2042897 ADAM21 ADAM metallopeptidase domain 21 180903 53616 hCG17212.4 ADAM22 ADAM metallopeptidase domain 22 177272 8745 hCG1811623.1 ADAM23 ADAM metallopeptidase domain 23 102384 10863 hCG1818505.1 ADAM28 ADAM metallopeptidase domain 28 119968 11086 hCG1786734.2 ADAM29 ADAM metallopeptidase domain 29 205542 11085 hCG1997196.1 ADAM30 ADAM metallopeptidase domain 30 148417 80332 hCG39255.4 ADAM33 ADAM metallopeptidase domain 33 140492 8756 hCG1789002.2 ADAM7 ADAM metallopeptidase domain 7 122603 101 hCG1816947.1 ADAM8 ADAM metallopeptidase domain 8 183965 8754 hCG1996391 ADAM9 ADAM metallopeptidase domain 9 (meltrin gamma) 129974 27299 hCG15447.3 ADAMDEC1 ADAM-like,
    [Show full text]
  • Supplementary Figures 1-14 and Supplementary References
    SUPPORTING INFORMATION Spatial Cross-Talk Between Oxidative Stress and DNA Replication in Human Fibroblasts Marko Radulovic,1,2 Noor O Baqader,1 Kai Stoeber,3† and Jasminka Godovac-Zimmermann1* 1Division of Medicine, University College London, Center for Nephrology, Royal Free Campus, Rowland Hill Street, London, NW3 2PF, UK. 2Insitute of Oncology and Radiology, Pasterova 14, 11000 Belgrade, Serbia 3Research Department of Pathology and UCL Cancer Institute, Rockefeller Building, University College London, University Street, London WC1E 6JJ, UK †Present Address: Shionogi Europe, 33 Kingsway, Holborn, London WC2B 6UF, UK TABLE OF CONTENTS 1. Supplementary Figures 1-14 and Supplementary References. Figure S-1. Network and joint spatial razor plot for 18 enzymes of glycolysis and the pentose phosphate shunt. Figure S-2. Correlation of SILAC ratios between OXS and OAC for proteins assigned to the SAME class. Figure S-3. Overlap matrix (r = 1) for groups of CORUM complexes containing 19 proteins of the 49-set. Figure S-4. Joint spatial razor plots for the Nop56p complex and FIB-associated complex involved in ribosome biogenesis. Figure S-5. Analysis of the response of emerin nuclear envelope complexes to OXS and OAC. Figure S-6. Joint spatial razor plots for the CCT protein folding complex, ATP synthase and V-Type ATPase. Figure S-7. Joint spatial razor plots showing changes in subcellular abundance and compartmental distribution for proteins annotated by GO to nucleocytoplasmic transport (GO:0006913). Figure S-8. Joint spatial razor plots showing changes in subcellular abundance and compartmental distribution for proteins annotated to endocytosis (GO:0006897). Figure S-9. Joint spatial razor plots for 401-set proteins annotated by GO to small GTPase mediated signal transduction (GO:0007264) and/or GTPase activity (GO:0003924).
    [Show full text]
  • Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
    www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
    [Show full text]