DOCSLIB.ORG

Can the Introduction of Xenopus Laevis Affect Native Amphibian Populations? Reduction of Reproductive Occurrence in Presence of the Invasive Species

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Can the Introduction of Xenopus Laevis Affect Native Amphibian Populations? Reduction of Reproductive Occurrence in Presence of the Invasive Species Biol Invasions DOI 10.1007/s10530-010-9911-8 ORIGINAL PAPER Can the introduction of Xenopus laevis affect native amphibian populations? Reduction of reproductive occurrence in presence of the invasive species Francesco Lillo • Francesco Paolo Faraone • Mario Lo Valvo Received: 7 January 2010 / Accepted: 15 November 2010 Ó Springer Science+Business Media B.V. 2010 Abstract Biological invasions are regarded as a populations of Bufo bufo do not appear to be affected form of global change and potential cause of by the alien species. Since the Sicilian population of biodiversity loss. Xenopus laevis is an anuran X. laevis shows a strong dispersal capacity, propor- amphibian native to sub-Saharan Africa with strong tionate and quick interventions become necessary to invasive capacity, especially in geographic regions bound the detriment to the Sicilian amphibians with a Mediterranean climate. In spite of the world- populations. wide diffusion of X. laevis, the effective impact on local ecosystems and native amphibian populations is Keywords Xenopus laevis Á Alien invasive species Á poorly quantified. A large population of X. laevis Sicily Á Amphibians conservation Á occurs in Sicily and our main aim of this work was to Biological invasion assess the consequences of introduction of this alien species on local amphibian populations. In this study we compare the occurrence of reproduction of native amphibians in ponds with and without X. laevis, and Introduction before and after the alien colonization. The results of our study shows that, when X. laevis establishes a Biological invasions are regarded as a form of global conspicuous population in a pond system, the pop- change (Ricciardi 2007). Many human activities, ulations of Discoglossus pictus, Hyla intermedia and such as agriculture, aquaculture, recreation and Pelophylax synklepton esculentus show clear signs of transportation, are the cause of intentional or acci- distress and the occurrence of reproduction of these dental spread of species away from their natural native amphibians collapses. In contrast, the ranges of distribution (Gherardi et al. 2008). Although most new species fail to establish viable populations, those that persist can threaten native F. Lillo Á F. P. Faraone Á M. Lo Valvo (&) biodiversity and ecosystem functionality, and may Dipartimento di Biologia Animale ‘‘G. Reverberi’’, have detrimental effects on human health as well as Universita` di Palermo, Via Archirafi 18, 90123 Palermo, Italy economic impacts (Kolar and Lodge 2001). Com- e-mail: [email protected] pared to terrestrial ecosystems, aquatic ecosystems F. Lillo have proven particularly vulnerable to invasive alien e-mail: [email protected] species (Sala et al. 2000). F. P. Faraone The direct link between invasiveness and impact e-mail: [email protected] on the host ecosystems of an alien species is not 123 F. Lillo et al. easily demonstrable (Ricciardi and Cohen 2007). The African clawed frog is a proficient generalist Alien invasive species are among the main causes of predator, implicated in ingestion of endangered and global amphibian decline (Beebee and Griffiths 2005; rare species [e.g., Gasterosteus aculeatus williamsoni Kats and Ferrer 2003). The introduction of predatory (Tinsley and McCoid 1996); Eucyclogobius newber- fish, crustaceans and non-native amphibians can ryi (Lafferty and Page 1997)], as well as amphibians. strongly threaten the native amphibian populations For example, stomach contents of African clawed via competition, predation, diffusion of diseases or frogs have been found to have low numbers of Bufo other interactions (e.g., Garner et al. 2006; Hecnar boreas (one of 39 stomachs; Crayon 2005). Similarly, and M’Closkey 1997; Kats and Ferrer 2003). in a previous study on Sicilian populations of African After the American bullfrog (Lithobates catesbei- clawed frog, we recorded the presence of a Bufo bufo anus) and cane toad (Bufo (Chaunus) marinus), the tadpole among 306 stomachs examined (Faraone African clawed frog Xenopus laevis is probably the et al. 2008b). The African clawed frog is also invasive amphibian species with the greatest world- considered as the probable origin of the spread, and wide diffusion. It is native to sub-Saharan Africa and a vector of, the chytridiomycosis fungus Batracho- is a totally aquatic species that lives in most types of chytrium dendrobatidis (Weldon et al. 2004). Despite water bodies with preference for stagnant or still the aforementioned observations that lead to a waters in ponds or sluggish streams (Tinsley et al. legitimate concern for native species, few studies 1996). The African clawed frog has specific adapta- provide details of the impact of African clawed frogs tions to aquatic life, including retention of the lateral on host ecosystems, particularly local populations of line system in adults, aquatic chemoreceptors (Elepfandt amphibians. Since the discovery of African clawed 1996a, b; Elepfandt et al. 2000) and a body structure frogs in Italy in 2004 (Lillo et al. 2005), the need for particularly adapted for swimming (Videler and Jorna an in-depth investigation on the possible conse- 1985). However, it also has a remarkable ability to quences of its introduction on ecosystems is vital. migrate overland (Eggert and Foquet 2006; Faraone The aim of this study is to clarify if the establish- et al. 2008a; Measey and Tisley 1998). ment of an invasive population of African clawed The worldwide spread of the African clawed frog frogs influences native amphibian populations. Spe- is due to trade started in the 1930s. After the cifically, we aimed to evaluate: development of a pregnancy assay using African 1. The difference in the reproductive occurrence clawed frogs as a test animal, as well as its use as a and population structure of native amphibians in model in development biology (Gurdon 1996; Keller ponds with and without African clawed frogs and Lodge 2007; Weldon et al. 2007). The afore- 2. The change in reproductive occurrence of mentioned biological characteristics and strong amphibian assemblages during the colonization adaptability of the African clawed frog has resulted process of the African clawed frog in its success as an invasive species, particularly in 3. The trophic overlap between an aquatic native geographic regions with a Mediterranean climate amphibian and the African clawed frog. (Lobos and Measey 2002; Tinsley and McCoid 1996). Non-native and invasive populations of Afri- can clawed frog are present in the US states of Arizona and California (Crayon 2005), Ascension Materials and methods Island (Tinsley and McCoid 1996), Chile (Lobos and Measey 2002), France (Fouquet 2001), Wales Study area and amphibian species (Measey and Tisley 1998), Sicily (Lillo et al. 2005) and Portugal (Rebelo et al. 2010). Although many We conducted our study in the catchment basins of studies investigate the biology and the ecology of the rivers Belice Destro and Jato, Sicily, Italy. This African clawed frogs in their invasive environments area is 15 km wide (37°520–38°00N) and 27 km long (e.g., Fouquet and Measey 2006; Lobos and Jaksic (12°560–13°140E) and is mainly agricultural land, 2005; Measey and Tisley 1998), to our knowledge no cultivated with vineyards, olive groves and corn- studies examine the effects of this alien species on fields. It also includes a large reservoir (Lake Poma) populations of native amphibians. and hundreds of agricultural ponds with surface areas 123 Can the introduction of Xenopus laevis affect native amphibian populations? ranging between 100 and 2,000 m2. Faraone et al. sampling was repeated a few days later, otherwise the (2008a) showed that this region has a large invasive pond was discarded for the analysis. population of African clawed frog, with a distribution During 2007, to evaluate the consequences of the surface of *225 km2 in 2005. presence of African clawed frogs in the ponds, we The catchment basins include five native amphib- selected, between the 68 ponds sampled, 45 ponds ians: the common toad Bufo bufo, the endemic that appeared optimal for reproduction of native Sicilian green toad B. siculus, the painted frog amphibians. These ponds was divided in two groups: Discoglossus pictus, the Italian tree frog Hyla inter- one group of ponds included those impacted by the media and the Italian complex of green frog Pelo- presence of African clawed frogs (IMP; n = 26) and phylax synklepton esculentus. The agricultural ponds one group of control ponds without the alien species are important sites for reproduction of all these (CTR; n = 19). We compared the IMP and CTR amphibians except for the Sicilian green toad that is ponds (t test) about their environmental variables rare in agricultural ponds and prefers temporary (Table 1). ponds for reproduction (Sicilia et al. 2006), so our We used a v2 test to compare the different occur- study focuses on the other four native amphibians. rence of reproduction of native amphibians between IMP and CTR ponds. The number of ponds sampled Sampling and analysis for each species was the following: 26 IMP ponds and 18 CTR ponds for green frogs; 18 IMP ponds and On 34 occasions between 2005 and 2008, we 10 CTR ponds for common toads; 18 IMP ponds conducted sampling trips at 68 ponds within the and 11 CTR ponds for painted frogs; 17 IMP ponds study area. Each pond was sampled at least one time and 14 CTR ponds for Italian tree frogs. In the case of for season. During each sampling period we recorded no significant differences between IMP and CTR (1) the presence/absence of African clawed frogs in ponds we evaluated the difference of relative abun- the ponds, (2) the occurrence of reproduction of the dance of tadpoles collected by dipnets as described native amphibians in the same ponds, and (3) the by Scott and Woodward (1994). The method consists colonization of new ponds by African clawed frog of dragging the net (25 9 20 cm) for a note tract from year to year.
Load more

Recommended publications
  • Disease and Clinical Signs Poster
    African Clawed Frog Xenopus laevis Diseases and Clinical Signs in Photographs Therese Jones-Green University Biomedical Services Abstract Reported clinical signs associated with ill health and Clinical signs found between 2016 to 2018 Many diseases of Xenopus laevis frogs have been described in the • Opened in 2005, the biofacility can hold up to 900 female and 240 disease Clinical signs found between 2016 to 2018 male frogs in a Marine Biotech (now serviced by MBK Installations Ltd.) • 80 recirculating aquatic system. • Buoyancy problems 70 bridge this gap using photographs taken of frogs with clinical signs. The system monitors parameters such as: temperature, pH, • • Changes in activity e.g. lethargy or easily startled. My aims are: conductivity, and Total Gas Pressure. 60 • Unusual amount of skin shedding. 2018 • To share my experiences, via images, to help improve the welfare and • Frogs are maintained on mains fed water with a 20% water exchange. 50 ases • Weight loss, or failure to feed correctly. c husbandry of this species. • 2017 • Coelomic (body cavity) distention. 40 • To stimulate a dialogue which results in further sharing of ideas and 2016 Whole body bloat. 30 information. • Frogs are held under a 12 hour light/dark cycle. • Number of • Each tank has a PVC enrichment tube (30cm x 10cm), with smoothed • Fungal strands/tufts. 20 Introduction cut edges. • Sores or tremors at extremities (forearms and toes). 10 Between January 2016 and October 2018, cases of ill health and disease • Frogs are fed three times a week with a commercial trout pellet. • Redness or red spots. 0 Oedema Red leg Red leg (bad Red leg Gas bubble Sores on forearm Opaque cornea Skeletal Growth (cartilage Scar Cabletie Missing claws Eggbound in a colony of Xenopus laevis frogs housed by the University Biological hormone) (nematodes) disease deformity under skin) • The focus of the research undertaken in the biofacility is embryonic and • Excessive slime/mucous production or not enough (dry dull skin).
    [Show full text]
  • I T a L I a N Ecological N E T W O
    I T A L I A N E C O L O G I C A L N E T W O R K THE ROLE OF THE PROTECTED AREAS IN THE CONSERVATION OF VERTEBRATES Ministry of Environment Nature Conservation Directorate University of Rome “La Sapienza” Animal and Human Biology Department In collaboration with: IE A Institute o f A p p lie d Ecolo g y Via L. Spallanzani, 32 - 00161 Rome - Italy Tel./fax: +39 06 4403315 - e-mail: [email protected] ISBN 88- 87736- 03- 0 Luigi B oit a ni ● A less a n d r a F a lcucci ● Luigi M a io r a n o ● A less a n d ro M o nte m a g gio ri I T A L I A N E C O L O G I C A L N E T W O R K THE ROLE OF THE PROTECTED AREAS IN THE CONSERVATION OF VERTEBRATES Luigi Boitani Animal and Human Biology Department, University of Rome “La Sapienza” Alessandra Falcucci College of N atural Resources, Department of Fish and W ildlife Resources University of Idaho, Moscow (USA) Animal and Human Biology Department, University of Rome “La Sapienza” Luigi Maiorano College of N atural Resources, Department of Fish and W ildlife Resources University of Idaho, Moscow (USA) Animal and Human Biology Department, University of Rome “La Sapienza” Alessandro Montemaggiori Animal and Human Biology Department, University of Rome “La Sapienza” Institute of Applied Ecology, Rome September 2003 Recommended citation: Boitani L., A. Falcucci, L. Maiorano & A. Montemaggiori.
    [Show full text]
  • Table S1. Nakharuthai and Srisapoome (2020)
    Primer name Nucleotide sequence (5’→3’) Purpose CXC-1F New TGAACCCTGAGCTGAAGGCCGTGA Real-time PCR CXC-1R New TGAAGGTCTGATGAGTTTGTCGTC Real-time PCR CXC-1R CCTTCAGCTCAGGGTTCAAGC Genomic PCR CXC-2F New GCTTGAACCCCGAGCTGAAAAACG Real-time PCR CXC-2R New GTTCAGAGGTCGTATGAGGTGCTT Real-time PCR CXC-2F CAAGCAGGACAACAGTGTCTGTGT 3’RACE CXC-2AR GTTGCATGATTTGGATGCTGGGTAG 5’RACE CXC-1FSB AACATATGTCTCCCAGGCCCAACTCAAAC Southern blot CXC-1RSB CTCGAGTTATTTTGCACTGATGTGCAA Southern blot CXC1Exon1F CAAAGTGTTTCTGCTCCTGG Genomic PCR On-CXC1FOverEx CATATGCAACTCAAACAAGCAGGACAACAGT Overexpression On-CXC1ROverEx CTCGAGTTTTGCACTGATGTGCAATTTCAA Overexpression On-CXC2FOverEx CATATGCAACTCAAACAAGCAGGACAACAGT Overexpression On-CXC2ROverEx CTCGAGCATGGCAGCTGTGGAGGGTTCCAC Overexpression β-actinrealtimeF ACAGGATGCAGAAGGAGATCACAG Real-time PCR β-actinrealtimeR GTACTCCTGCTTGCTGATCCACAT Real-time PCR M13F AAAACGACGGCCAG Nucleotide sequencing M13R AACAGCTATGACCATG Nucleotide sequencing UPM-long (0.4 µM) CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT RACE PCR UPM-short (2 µM) CTAATAC GACTCACTATA GGGC RACE PCR Table S1. Nakharuthai and Srisapoome (2020) On-CXC1 Nucleotide (%) Amino acid (%) On-CXC2 Nucleotide (%) Amino acid (%) Versus identity identity similarity Versus identity identity Similarity Teleost fish 1. Rock bream, Oplegnathus fasciatus (AB703273) 64.5 49.1 68.1 O. fasciatus 70.7 57.7 75.4 2. Mandarin fish, Siniperca chuatsi (AAY79282) 63.2 48.1 68.9 S. chuatsi 70.5 54.0 78.8 3. Atlantic halibut, Hippoglossus hippoglossus (ACY54778) 52.0 39.3 51.1 H. hippoglossus 64.5 46.3 63.9 4. Common carp IL-8, Cyprinus carpio (ABE47600) 44.9 19.1 34.1 C. carpio 49.4 21.9 42.6 5. Rainbow trout IL-8, Oncorhynchus mykiss (CAC33585) 44.0 21.3 36.3 O. mykiss 47.3 23.7 44.4 6. Japanese flounder IL-8, Paralichthys olivaceus (AAL05442) 48.4 25.4 45.9 P.
    [Show full text]
  • Xenopus for Dummies.Docx
    Xenopus for DUMMIES 1 Xenopus for DUMMIES OUTLINE Introduction ........................................................................................................................... 2 1. Why is Xenopus interesting for iGEM? ........................................................................... 4 2. Requirements before planning to work on Xenopus......................................................... 5 3. Guidelines to define an iGEM project with Xenopus ........................................................ 5 4. The micro-injection procedure ........................................................................................ 7 a. Step 1: Fertilized eggs ........................................................................................ 7 b. Step 2: DNA injection .......................................................................................... 7 c. Place the injected embryos in incubator 21°C ..................................................... 8 d. The following days .............................................................................................. 8 e. Embryos injection: efficiency ............................................................................... 8 5. The biobrick plasmids for Xenopus ................................................................................. 9 6. Xenopus debugging tool ............................................................................................... 10 a. How? ................................................................................................................
    [Show full text]
  • Association of DNA with Nuclear Matrix in in Vitro Assembled Nuclei
    Cell Research (1997), 7, 107-117 Association of DNA with nuclear matrix in in vitro as- sembled nuclei induced by rDNA from Tetrahymena shang- haiensis in Xenopus egg extracts CHEN YING, BO ZHANG, XIU FEN LI, ZHONG HE ZHAI Department of Cell Biology and Genetics, College of Life Sciences, Peking University, Beijing 100871 ABSTRACT The nuclei assembled from exogenous DNA or chro- matin in egg extracts resemble their in vivo counterparts in many aspects. However, the distribution pattern of DNA in these nuclei remains unknown. We introduced rDNA from the macronuclei of Tetrahymena into Xenopus cell- free extracts to examine the association of specific DNA sequences with nuclear matrix (NM) in the nuclei assem- bled in vitro. Our previous works showed the 5'NTS (non- transcription sequences) of the rDNA specifically bind to the NM system in the macronuclei. We show now the rDNA could induce chromatin assembly and nuclear for- mation in Xenopus cell-free system. When we extracted the NM system and compared the binding affinity of differ- ent regions of rDNA with the NM system, we found that the 5'NTS still hold their binding affinity with insoluble structure of the assembled nuclei in the extracts of Xeno- pus eggs. Key words: Nuclear assembly, nuclear matrix, Xeno- pus egg extracts, Tetrahymena rDNA. On the occasion of Professor Lu Ji SHI's (L. C. Sze), eightieth birthday, we present this paper and extend our sincere greetings to Professor SHI. As we mentioned in our paper, in early 1950's, it is Professor SHI who first studied the behavior of exogenous homologous desoxyribose nucleoprotein (chromatin) in amphibian eggs.
    [Show full text]
  • Parasitic Nematodes of Pool Frog (Pelophylax Lessonae) in the Volga Basin
    Journal MVZ Cordoba 2019; 24(3):7314-7321. https://doi.org/10.21897/rmvz.1501 Research article Parasitic nematodes of Pool Frog (Pelophylax lessonae) in the Volga Basin Igor V. Chikhlyaev1 ; Alexander B. Ruchin2* ; Alexander I. Fayzulin1 1Institute of Ecology of the Volga River Basin, Russian Academy of Sciences, Togliatti, Russia 2Mordovia State Nature Reserve and National Park «Smolny», Saransk, Russia. *Correspondence: [email protected] Received: Febrary 2019; Accepted: July 2019; Published: August 2019. ABSTRACT Objetive. Present a modern review of the nematodes fauna of the pool frog Pelophylax lessonae (Camerano, 1882) from Volga basin populations on the basis of our own research and literature sources analysis. Materials and methods. Present work consolidates data from different helminthological works over the past 80 years, supported by our own research results. During the period from 1936 to 2016 different authors examined 1460 specimens of pool frog, using the method of full helminthological autopsy, from 13 regions of the Volga basin. Results. In total 9 nematodes species were recorded. Nematode Icosiella neglecta found for the first time in the studied host from the territory of Russia and Volga basin. Three species appeared to be more widespread: Oswaldocruzia filiformis, Cosmocerca ornata and Icosiella neglecta. For each helminth species the following information included: systematic position, areas of detection, localization, biology, list of definitive hosts, the level of host-specificity. Conclusions. Nematodes of pool frog, excluding I. neglecta, belong to the group of soil-transmitted helminthes (geohelminth) and parasitize in adult stages. Some species (O. filiformis, C. ornata, I. neglecta) are widespread in the host range.
    [Show full text]
  • Maritime Southeast Asia and Oceania Regional Focus
    November 2011 Vol. 99 www.amphibians.orgFrogLogNews from the herpetological community Regional Focus Maritime Southeast Asia and Oceania INSIDE News from the ASG Regional Updates Global Focus Recent Publications General Announcements And More..... Spotted Treefrog Nyctixalus pictus. Photo: Leong Tzi Ming New The 2012 Sabin Members’ Award for Amphibian Conservation is now Bulletin open for nomination Board FrogLog Vol. 99 | November 2011 | 1 Follow the ASG on facebook www.facebook.com/amphibiansdotor2 | FrogLog Vol. 99| November 2011 g $PSKLELDQ$UN FDOHQGDUVDUHQRZDYDLODEOH 7KHWZHOYHVSHFWDFXODUZLQQLQJSKRWRVIURP $PSKLELDQ$UN¶VLQWHUQDWLRQDODPSKLELDQ SKRWRJUDSK\FRPSHWLWLRQKDYHEHHQLQFOXGHGLQ $PSKLELDQ$UN¶VEHDXWLIXOZDOOFDOHQGDU7KH FDOHQGDUVDUHQRZDYDLODEOHIRUVDOHDQGSURFHHGV DPSKLELDQDUN IURPVDOHVZLOOJRWRZDUGVVDYLQJWKUHDWHQHG :DOOFDOHQGDU DPSKLELDQVSHFLHV 3ULFLQJIRUFDOHQGDUVYDULHVGHSHQGLQJRQ WKHQXPEHURIFDOHQGDUVRUGHUHG±WKHPRUH \RXRUGHUWKHPRUH\RXVDYH2UGHUVRI FDOHQGDUVDUHSULFHGDW86HDFKRUGHUV RIEHWZHHQFDOHQGDUVGURSWKHSULFHWR 86HDFKDQGRUGHUVRIDUHSULFHGDW MXVW86HDFK 7KHVHSULFHVGRQRWLQFOXGH VKLSSLQJ $VZHOODVRUGHULQJFDOHQGDUVIRU\RXUVHOIIULHQGV DQGIDPLO\ZK\QRWSXUFKDVHVRPHFDOHQGDUV IRUUHVDOHWKURXJK\RXU UHWDLORXWOHWVRUIRUJLIWV IRUVWDIIVSRQVRUVRUIRU IXQGUDLVLQJHYHQWV" 2UGHU\RXUFDOHQGDUVIURPRXUZHEVLWH ZZZDPSKLELDQDUNRUJFDOHQGDURUGHUIRUP 5HPHPEHU±DVZHOODVKDYLQJDVSHFWDFXODUFDOHQGDU WRNHHSWUDFNRIDOO\RXULPSRUWDQWGDWHV\RX¶OODOVREH GLUHFWO\KHOSLQJWRVDYHDPSKLELDQVDVDOOSUR¿WVZLOOEH XVHGWRVXSSRUWDPSKLELDQFRQVHUYDWLRQSURMHFWV ZZZDPSKLELDQDUNRUJ FrogLog Vol. 99 | November
    [Show full text]
  • Enhanced XAO: the Ontology of Xenopus Anatomy And
    Segerdell et al. Journal of Biomedical Semantics 2013, 4:31 http://www.jbiomedsem.com/content/4/1/31 JOURNAL OF BIOMEDICAL SEMANTICS RESEARCH Open Access Enhanced XAO: the ontology of Xenopus anatomy and development underpins more accurate annotation of gene expression and queries on Xenbase Erik Segerdell1*, Virgilio G Ponferrada2, Christina James-Zorn2, Kevin A Burns2, Joshua D Fortriede2, Wasila M Dahdul3,4, Peter D Vize5 and Aaron M Zorn2 Abstract Background: The African clawed frogs Xenopus laevis and Xenopus tropicalis are prominent animal model organisms. Xenopus research contributes to the understanding of genetic, developmental and molecular mechanisms underlying human disease. The Xenopus Anatomy Ontology (XAO) reflects the anatomy and embryological development of Xenopus. The XAO provides consistent terminology that can be applied to anatomical feature descriptions along with a set of relationships that indicate how each anatomical entity is related to others in the embryo, tadpole, or adult frog. The XAO is integral to the functionality of Xenbase (http://www. xenbase.org), the Xenopus model organism database. Results: We significantly expanded the XAO in the last five years by adding 612 anatomical terms, 2934 relationships between them, 640 synonyms, and 547 ontology cross-references. Each term now has a definition, so database users and curators can be certain they are selecting the correct term when specifying an anatomical entity. With developmental timing information now asserted for every anatomical term, the ontology provides internal checks that ensure high-quality gene expression and phenotype data annotation. The XAO, now with 1313 defined anatomical and developmental stage terms, has been integrated with Xenbase expression and anatomy term searches and it enables links between various data types including images, clones, and publications.
    [Show full text]
  • Stages of Embryonic Development of the Zebrafish
    DEVELOPMENTAL DYNAMICS 2032553’10 (1995) Stages of Embryonic Development of the Zebrafish CHARLES B. KIMMEL, WILLIAM W. BALLARD, SETH R. KIMMEL, BONNIE ULLMANN, AND THOMAS F. SCHILLING Institute of Neuroscience, University of Oregon, Eugene, Oregon 97403-1254 (C.B.K., S.R.K., B.U., T.F.S.); Department of Biology, Dartmouth College, Hanover, NH 03755 (W.W.B.) ABSTRACT We describe a series of stages for Segmentation Period (10-24 h) 274 development of the embryo of the zebrafish, Danio (Brachydanio) rerio. We define seven broad peri- Pharyngula Period (24-48 h) 285 ods of embryogenesis-the zygote, cleavage, blas- Hatching Period (48-72 h) 298 tula, gastrula, segmentation, pharyngula, and hatching periods. These divisions highlight the Early Larval Period 303 changing spectrum of major developmental pro- Acknowledgments 303 cesses that occur during the first 3 days after fer- tilization, and we review some of what is known Glossary 303 about morphogenesis and other significant events that occur during each of the periods. Stages sub- References 309 divide the periods. Stages are named, not num- INTRODUCTION bered as in most other series, providing for flexi- A staging series is a tool that provides accuracy in bility and continued evolution of the staging series developmental studies. This is because different em- as we learn more about development in this spe- bryos, even together within a single clutch, develop at cies. The stages, and their names, are based on slightly different rates. We have seen asynchrony ap- morphological features, generally readily identi- pearing in the development of zebrafish, Danio fied by examination of the live embryo with the (Brachydanio) rerio, embryos fertilized simultaneously dissecting stereomicroscope.
    [Show full text]
  • Diet Composition of the Karpathos Marsh Frog (Pelophylax Cerigensis): What Does the Most Endangered Frog in Europe Eat?
    Animal Biodiversity and Conservation 42.1 (2019) 1 Diet composition of the Karpathos marsh frog (Pelophylax cerigensis): what does the most endangered frog in Europe eat? P. Pafilis, G. Kapsalas, P. Lymberakis, D. Protopappas, K. Sotiropoulos Pafilis, P., Kapsalas, G., Lymberakis, P., Protopappas, D., Sotiropoulos, K., 2019. Diet composition of the Karpathos marsh frog (Pelophylax cerigensis): what does the most endangered frog in Europe eat? Animal Biodiversity and Conservation, 42.1: 1–8, https://doi.org/10.32800/abc.2019.42.0001 Abstract Diet composition of the Karpathos marsh frog (Pelophylax cerigensis): what does the most endangered frog in Europe eat? The Karpathos marsh frog (Pelophylax cerigensis) is considered the most endangered frog in Europe. Here we assess its feeding ecology and examine 76 individuals from the two known populations using the stomach flushing method. We also measured body weight, snout–vent length, mouth width and prey width and length. Pelophylax cerigensis follows the feeding pattern of green frogs of the adjacent areas, with Coleoptera, Araneae, Isopoda and Hymenoptera being the main prey groups. The two populations differed in body size but had similar values of prey abundance and frequency. It seems that P. cerigensis follows a strict feeding strategy. Further research on prey availability in its habitats will provide valuable insight. Key words: Diet, Endangered species, Islands, Frogs, Mediterranean Resumen Composición de la dieta de la rana de Kárpatos (Pelophylax cerigensis): ¿qué come la rana más amenazada de Europa? La rana de Kárpatos (Pelophylax cerigensis) es considerada la rana más amenazada de Europa. Aquí evaluamos su ecología alimentaria y examinamos 76 individuos de las dos poblaciones conocidas usando el método del lavado de estómago.
    [Show full text]
  • Helical Insertion of Peptidoglycan Produces Chiral Ordering of the Bacterial Cell Wall
    Helical insertion of peptidoglycan produces PNAS PLUS chiral ordering of the bacterial cell wall Siyuan Wanga,b, Leon Furchtgottc,d, Kerwyn Casey Huangd,1, and Joshua W. Shaevitza,e,1 aLewis-Sigler Institute for Integrative Genomics, Princeton University, Princeton, NJ 08544; bDepartment of Molecular Biology, Princeton University, Princeton, NJ 08544; cBiophysics Program, Harvard University, Cambridge, MA 02138; dDepartment of Bioengineering, Stanford University, Stanford, CA 94305; and eDepartment of Physics, Princeton University, Princeton, NJ 08854 AUTHOR SUMMARY Cells from all kingdoms of wall growth to demonstrate life face the task of that patterning of cell-wall constructing a specific, synthesis by left-handed mechanically robust three- MreB polymers leads to a dimensional (3D) cell shape right-handed chiral from molecular-scale organization of the glycan components. For many strands. This organization bacteria, maintaining a rigid, produces a left-handed rod-like shape facilitates a twisting of the cell body diverse range of behaviors during elongational growth. including swimming motility, We then confirm the detection of chemical existence of right-handed gradients, and nutrient access Fig. P1. Helical insertion of material into the bacterial cell wall (green) glycan organization in E. coli during elongational growth, guided by the protein MreB (yellow), leads and waste evacuation in by osmotically shocking biofilms. The static shape of to an emergent chiral order in the cell-wall network and twisting of the cell that can be visualized using surface-bound beads (red). surface-labeled cells and a bacterial cell is usually directly measuring the defined by the cell wall, a difference in stiffness macromolecular polymer network composed of glycan strands between the longitudinal and transverse directions.
    [Show full text]
  • Waterfrog (Pelophylax Sp.) Found Near Domusnovas in Southwestern
    Beitrag_10_(Seiten89-103_ShortNotes)_SHORT_NOTE.qxd 01.08.2011 11:51 Seite 13 SHOrT nOTe HerPeTOZOa 24 (1/2) Wien, 30. Juli 2011 SHOrT nOTe 101 sides several Hyla sarda (De BeTTa, 1853), we found unexpectedly two waterfrogs, an adult and a sub-adult, the latter of which we managed to capture with the help of a net. The specimen (Fig. 1) was kept at the Zoo - logy Department of the University of Paler - mo (Laboratorio di Zoologia applicata, Di - partimento di Biologia animale, Università degli Studi di Palermo) until it died and then stored in the collection of the annexed mu - seo di Zoologia “Pietro Doderlein” (Via archirafi 16, Palermo 90123, Italy) under the museum number mZPa a-129. The finding place was the bank of a little stream flowing next to the cave. It was quite full of water and covered with vegetation, but it also contained some waste. The stream is located be tween a car park, just in front of the entrance to the cave, and a restaurant on the other side. The GPS co ordinates are: 39°20’10.74’’n, 8°37’39’’e, and the alti- tude is 181 m above sea level. We do not know for sure what species/ subspecies we found. Genetic verification Waterfrog (Pelophylax sp.) will be made by Daniele CaneSTreLLI (Vi - found near Domusnovas in terbo) on the specimen collected in order to see which group it belongs to. In fact, the southwestern Sardinia, Italy systematics of the waterfrogs of Italy is under debate. Until recently, the generally In Sardinia, and its satellite islands accepted concept claimed the presence of (i) there are 10 species of amphibians, six of the group Pelophylax lessonae and Pelo - which are caudates and four anurans, and 18 phylax kl.
    [Show full text]