DOCSLIB.ORG

Autocrine IFN Signaling Inducing Profibrotic Fibroblast Responses By

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Autocrine IFN Signaling Inducing Profibrotic Fibroblast Responses By Downloaded from http://www.jimmunol.org/ by guest on September 27, 2021 Inducing is online at: average * The Journal of Immunology , 11 of which you can access for free at: 2013; 191:2956-2966; Prepublished online 16 from submission to initial decision 4 weeks from acceptance to publication August 2013; doi: 10.4049/jimmunol.1300376 http://www.jimmunol.org/content/191/6/2956 A Synthetic TLR3 Ligand Mitigates Profibrotic Fibroblast Responses by Autocrine IFN Signaling Feng Fang, Kohtaro Ooka, Xiaoyong Sun, Ruchi Shah, Swati Bhattacharyya, Jun Wei and John Varga J Immunol cites 49 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html http://www.jimmunol.org/content/suppl/2013/08/20/jimmunol.130037 6.DC1 This article http://www.jimmunol.org/content/191/6/2956.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2013 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 27, 2021. The Journal of Immunology A Synthetic TLR3 Ligand Mitigates Profibrotic Fibroblast Responses by Inducing Autocrine IFN Signaling Feng Fang,* Kohtaro Ooka,* Xiaoyong Sun,† Ruchi Shah,* Swati Bhattacharyya,* Jun Wei,* and John Varga* Activation of TLR3 by exogenous microbial ligands or endogenous injury-associated ligands leads to production of type I IFN. Scleroderma patients with progressive skin fibrosis display an IFN-regulated gene signature, implicating TLR3 signaling in the disease. In this study, we show that TLR3 expression was detected on foreskin, adult skin, and lung fibroblasts, and TLR3 levels were significantly elevated in a subset of scleroderma skin biopsies. In explanted skin and lung fibroblasts, the synthetic TLR3 ligand polyinosinic-polycytidylic acid (poly(I:C)), a dsRNA analog, caused dose- and time-dependent stimulation of IFN-b production and generation of an IFN-response gene signature that was accompanied by substantial downregulation of collagen and a-smooth muscle actin gene expression. Furthermore, poly(I:C) abrogated TGF-b–induced fibrotic responses and blocked canonical Smad Downloaded from signaling via upregulation of inhibitory Smad7. Surprisingly, the inhibitory effects of poly(I:C) in fibroblasts were independent of TLR3 and were mediated by the cytosolic receptors retinoic acid–inducible gene 1 and melanoma differentiation-associated gene 5, and involved signaling via the IFN receptor. Taken together, these results demonstrate that induction of a fibroblast IFN response gene signature triggered by dsRNA is associated with potent TLR3-independent anti-fibrotic effects. The characteristic IFN response gene signature seen in scleroderma lesions might therefore signify a tissue-autonomous protective attempt to restrict fibroblast activation during injury. The Journal of Immunology, 2013, 191: 2956–2966. http://www.jimmunol.org/ rogressive fibrosis of the skin and internal organs accounts responses to both microbial pathogens and to tissue injury–as- for the intractable nature and the high mortality of sclero- sociated endogenous danger signals collectively referred to as P derma (1). As the principal effector cells responsible for damage-associated molecular patterns (DAMPs) (6). In contrast to fibrosis, stromal fibroblasts and myofibroblasts contribute to exces- TLR2 and TLR4, which reside at the cell surface and recognize sive deposition of collagens and other extracellular matrix proteins microbial ligands, TLR3 is normally endosomal in its location and (2). TGF-b, which stimulates collagen synthesis, myofibroblast dif- recognizes viral dsRNA, as well as the synthetic dsRNA analog ferentiation, and epithelial–mesenchymal transition, is implicated as polyinosinic-polycytidylic acid (poly(I:C)) (6, 7). Upon injury, by guest on September 27, 2021 a key initiating factor in both physiological and pathological tissue dsRNA generated at sites of tissue damage in situ serves as an remodeling (3). However, the mechanism responsible for the per- endogenous ligand for TLR3 (8). In most cell types, double-stranded sistence of the fibrotic process associated with pathological repair nucleic acids and their analogs are recognized as DAMPs not only remains poorly understood. by TLR3, but also by the cytosolic RNA helicases retinoic acid– Recent studies have detected an IFN-response gene signature, inducible gene 1 (RIG-1) and melanoma differentiation-associated characterized by upregulation of type I IFN–regulated genes, in gene 5 (MDA5) (9). both circulating blood cells and in lesional skin from patients with The IFN signature detected in scleroderma lesional tissue scleroderma (4). The production of type I IFN in plasmacytoid suggests potential roles for TLR3 signaling, type I IFN, and innate dendritic cells as well as in stromal cells is controlled by TLRs immunity in pathogenesis. The recent demonstration that IFN (5). These conserved pattern recognition receptors trigger immune regulatory factor (IRF) 3 and IRF5, which are downstream of TLR3, are risk alleles for scleroderma provides further evidence *Division of Rheumatology, Northwestern University Feinberg School of Medicine, implicating type I IFN (10). However, the precise role of innate Chicago, IL 60611; and †McDermott Center for Human Growth and Development, immunity and of endogenous TLR ligands in the pathogenesis University of Texas Southwestern Medical Center, Dallas, TX 75390 of fibrosis remains poorly understood. We therefore sought to in- Received for publication February 6, 2013. Accepted for publication July 15, 2013. vestigate TLR expression in scleroderma and the modulation of This work was supported by National Institutes of Health Grant AR-42309. fibroblast function by the synthetic TLR3 ligand poly(I:C), which The sequences presented in this article have been submitted to the Gene Expression was shown previously to abrogate (11, 12) or induce (13) fibrosis. Omnibus (http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE47616) under ac- cession number GSE47616. The results showed that whereas poly(I:C) treatment served as Address correspondence and reprint requests to Dr. John Varga, Division of Rheuma- a potent stimulus for production of type I IFN and generation of an tology, Feinberg School of Medicine, Northwestern University, McGaw Pavillion M230, IFN-response gene signature in explanted skin fibroblasts, it po- 240 East Huron Street, Chicago, IL, 60611. E-mail address: [email protected] tently reduced fibrotic responses, blocked Smad-dependent TGF-b The online version of this article contains supplemental material. signaling, and prevented TGF-b stimulation of these cells through Abbreviations used in this article: ASMA, a-smooth muscle actin; DAMP, damage- endogenous IFN. The results therefore identify the TLR3 ligand associated molecular pattern; FDR, false discovery rate; IRF, IFN regulatory factor; MDA5, melanoma differentiation-associated gene 5; MEF, mouse embryonic fibro- poly(I:C) as a novel inhibitor of profibrotic TGF-b activity, and blast; poly(I:C), polyinosinic-polycytidylic acid; qPCR, quantitative PCR; RIG-1, they suggest the possibility that the IFN-response gene signature retinoic acid–inducible gene 1; RNAi, RNA interference; siRNA, small interfering seen in scleroderma lesional tissue may in fact represent a cell- RNA. autonomous attempt to restrain fibroblast activation and mitigate Copyright Ó 2013 by The American Association of Immunologists, Inc. 0022-1767/13/$16.00 aberrant fibrogenesis. www.jimmunol.org/cgi/doi/10.4049/jimmunol.1300376 The Journal of Immunology 2957 Materials and Methods was evaluated by determining levels of endogenous protein and mRNA Cell culture and reagents by Western analysis and real-time qPCR. Primary fibroblast cultures were established by explantation from adult Confocal immunofluorescence microscopy lungs, from biopsies from the distal forearm of patients with scleroderma Fibroblasts (10,000 cells/well) were seeded onto eight-well Lab-Tek II and healthy adults, and from neonatal foreskin (14). Biopsy protocols were chamber glass slides (Nalge Nunc International, Naperville, IL) and in- approved by the Institutional Review Board at Northwestern University. 2/2 cubated in serum-free Eagle’s MEM with poly(I:C) (10 mg/ml) or TGF-b2 Fibroblasts derived from type I IFN receptor-null (IFNAR1 ) mouse (10 ng/ml) for 1–24 h. At the end of the experiments, cells were fixed, embryos (A. Kroger, Helmholtz Center for Infection Research, Braunschweig, permeabilized, and incubated with primary Abs to phospho-Smad3 at Germany) (15) or from wild-type control mouse embryos were main- 1:200 dilution (Cell Signaling Technology, Beverly, MA), TLR3 (Santa tained in DMEM supplemented with 10% FBS (Lonza, Basel, Switzerland), Cruz Biotechnology, Santa Cruz, CA) at 1:100 dilution, or to type I col- 50 mg/ml penicillin, and 50 mg/ml streptomycin in a humidified atmo- lagen at 1:100 dilution (SouthernBiotech, Birmingham, AL). Cells were sphere of 5% CO2 at 37˚C, and studied between
Load more

Recommended publications
  • Regulation of Cdc42 and Its Effectors in Epithelial Morphogenesis Franck Pichaud1,2,*, Rhian F
    © 2019. Published by The Company of Biologists Ltd | Journal of Cell Science (2019) 132, jcs217869. doi:10.1242/jcs.217869 REVIEW SUBJECT COLLECTION: ADHESION Regulation of Cdc42 and its effectors in epithelial morphogenesis Franck Pichaud1,2,*, Rhian F. Walther1 and Francisca Nunes de Almeida1 ABSTRACT An overview of Cdc42 Cdc42 – a member of the small Rho GTPase family – regulates cell Cdc42 was discovered in yeast and belongs to a large family of small – polarity across organisms from yeast to humans. It is an essential (20 30 kDa) GTP-binding proteins (Adams et al., 1990; Johnson regulator of polarized morphogenesis in epithelial cells, through and Pringle, 1990). It is part of the Ras-homologous Rho subfamily coordination of apical membrane morphogenesis, lumen formation and of GTPases, of which there are 20 members in humans, including junction maturation. In parallel, work in yeast and Caenorhabditis elegans the RhoA and Rac GTPases, (Hall, 2012). Rho, Rac and Cdc42 has provided important clues as to how this molecular switch can homologues are found in all eukaryotes, except for plants, which do generate and regulate polarity through localized activation or inhibition, not have a clear homologue for Cdc42. Together, the function of and cytoskeleton regulation. Recent studies have revealed how Rho GTPases influences most, if not all, cellular processes. important and complex these regulations can be during epithelial In the early 1990s, seminal work from Alan Hall and his morphogenesis. This complexity is mirrored by the fact that Cdc42 can collaborators identified Rho, Rac and Cdc42 as main regulators of exert its function through many effector proteins.
    [Show full text]
  • Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model
    Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021 T + is online at: average * The Journal of Immunology , 34 of which you can access for free at: 2016; 197:1477-1488; Prepublished online 1 July from submission to initial decision 4 weeks from acceptance to publication 2016; doi: 10.4049/jimmunol.1600589 http://www.jimmunol.org/content/197/4/1477 Molecular Profile of Tumor-Specific CD8 Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A. Waugh, Sonia M. Leach, Brandon L. Moore, Tullia C. Bruno, Jonathan D. Buhrman and Jill E. Slansky J Immunol cites 95 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html http://www.jimmunol.org/content/suppl/2016/07/01/jimmunol.160058 9.DCSupplemental This article http://www.jimmunol.org/content/197/4/1477.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2016 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 25, 2021. The Journal of Immunology Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Expression Profiling of Ion Channel Genes Predicts Clinical Outcome in Breast Cancer
    UCSF UC San Francisco Previously Published Works Title Expression profiling of ion channel genes predicts clinical outcome in breast cancer Permalink https://escholarship.org/uc/item/1zq9j4nw Journal Molecular Cancer, 12(1) ISSN 1476-4598 Authors Ko, Jae-Hong Ko, Eun A Gu, Wanjun et al. Publication Date 2013-09-22 DOI http://dx.doi.org/10.1186/1476-4598-12-106 Peer reviewed eScholarship.org Powered by the California Digital Library University of California Ko et al. Molecular Cancer 2013, 12:106 http://www.molecular-cancer.com/content/12/1/106 RESEARCH Open Access Expression profiling of ion channel genes predicts clinical outcome in breast cancer Jae-Hong Ko1, Eun A Ko2, Wanjun Gu3, Inja Lim1, Hyoweon Bang1* and Tong Zhou4,5* Abstract Background: Ion channels play a critical role in a wide variety of biological processes, including the development of human cancer. However, the overall impact of ion channels on tumorigenicity in breast cancer remains controversial. Methods: We conduct microarray meta-analysis on 280 ion channel genes. We identify candidate ion channels that are implicated in breast cancer based on gene expression profiling. We test the relationship between the expression of ion channel genes and p53 mutation status, ER status, and histological tumor grade in the discovery cohort. A molecular signature consisting of ion channel genes (IC30) is identified by Spearman’s rank correlation test conducted between tumor grade and gene expression. A risk scoring system is developed based on IC30. We test the prognostic power of IC30 in the discovery and seven validation cohorts by both Cox proportional hazard regression and log-rank test.
    [Show full text]
  • The Borg Family of Cdc42 Effector Proteins Cdc42ep1–5
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Institute of Cancer Research Repository Biochemical Society Transactions (2016) 0 1–8 DOI: 10.1042/BST20160219 1 2 The Borg family of Cdc42 effector proteins 3 4 Cdc42EP1–5 5 6 Aaron J. Farrugia and Fernando Calvo 7 8 Tumour Microenvironment Team, Division of Cancer Biology, Institute of Cancer Research, 237 Fulham Road, London SW2 6JB, U.K. 9 Correspondence: Fernando Calvo ([email protected]) 10 11 12 13 Despite being discovered more than 15 years ago, the Borg (binder of Rho GTPases) 14 – family of Cdc42 effector proteins (Cdc42EP1 5) remains largely uncharacterised and rela- 15 tively little is known about their structure, regulation and role in development and disease. 16 Recent studies are starting to unravel some of the key functional and mechanistic 17 aspects of the Borg proteins, including their role in cytoskeletal remodelling and signal- 18 ling. In addition, the participation of Borg proteins in important cellular processes such as 19 cell shape, directed migration and differentiation is slowly emerging, directly linking Borgs 20 with important physiological and pathological processes such as angiogenesis, neuro- 21 fi transmission and cancer-associated desmoplasia. Here, we review some of these nd- 22 ings and discuss future prospects. 23 24 25 26 27 28 29 Introduction 30 The Rho GTPase family member Cdc42 regulates a diverse range of cellular functions including cyto- 31 kinesis, cytoskeletal remodelling and cell polarity [1,2]. Like other Rho family members, Cdc42 cycles 32 between two tightly regulated conformational states, a GTP-bound active state and a GDP-bound 33 inactive state [3].
    [Show full text]
  • Transcriptome Sequencing and Genome-Wide Association Analyses Reveal Lysosomal Function and Actin Cytoskeleton Remodeling in Schizophrenia and Bipolar Disorder
    Molecular Psychiatry (2015) 20, 563–572 © 2015 Macmillan Publishers Limited All rights reserved 1359-4184/15 www.nature.com/mp ORIGINAL ARTICLE Transcriptome sequencing and genome-wide association analyses reveal lysosomal function and actin cytoskeleton remodeling in schizophrenia and bipolar disorder Z Zhao1,6,JXu2,6, J Chen3,6, S Kim4, M Reimers3, S-A Bacanu3,HYu1, C Liu5, J Sun1, Q Wang1, P Jia1,FXu2, Y Zhang2, KS Kendler3, Z Peng2 and X Chen3 Schizophrenia (SCZ) and bipolar disorder (BPD) are severe mental disorders with high heritability. Clinicians have long noticed the similarities of clinic symptoms between these disorders. In recent years, accumulating evidence indicates some shared genetic liabilities. However, what is shared remains elusive. In this study, we conducted whole transcriptome analysis of post-mortem brain tissues (cingulate cortex) from SCZ, BPD and control subjects, and identified differentially expressed genes in these disorders. We found 105 and 153 genes differentially expressed in SCZ and BPD, respectively. By comparing the t-test scores, we found that many of the genes differentially expressed in SCZ and BPD are concordant in their expression level (q ⩽ 0.01, 53 genes; q ⩽ 0.05, 213 genes; q ⩽ 0.1, 885 genes). Using genome-wide association data from the Psychiatric Genomics Consortium, we found that these differentially and concordantly expressed genes were enriched in association signals for both SCZ (Po10 − 7) and BPD (P = 0.029). To our knowledge, this is the first time that a substantially large number of genes show concordant expression and association for both SCZ and BPD. Pathway analyses of these genes indicated that they are involved in the lysosome, Fc gamma receptor-mediated phagocytosis, regulation of actin cytoskeleton pathways, along with several cancer pathways.
    [Show full text]
  • Cellular and Molecular Signatures in the Disease Tissue of Early
    Cellular and Molecular Signatures in the Disease Tissue of Early Rheumatoid Arthritis Stratify Clinical Response to csDMARD-Therapy and Predict Radiographic Progression Frances Humby1,* Myles Lewis1,* Nandhini Ramamoorthi2, Jason Hackney3, Michael Barnes1, Michele Bombardieri1, Francesca Setiadi2, Stephen Kelly1, Fabiola Bene1, Maria di Cicco1, Sudeh Riahi1, Vidalba Rocher-Ros1, Nora Ng1, Ilias Lazorou1, Rebecca E. Hands1, Desiree van der Heijde4, Robert Landewé5, Annette van der Helm-van Mil4, Alberto Cauli6, Iain B. McInnes7, Christopher D. Buckley8, Ernest Choy9, Peter Taylor10, Michael J. Townsend2 & Costantino Pitzalis1 1Centre for Experimental Medicine and Rheumatology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, Charterhouse Square, London EC1M 6BQ, UK. Departments of 2Biomarker Discovery OMNI, 3Bioinformatics and Computational Biology, Genentech Research and Early Development, South San Francisco, California 94080 USA 4Department of Rheumatology, Leiden University Medical Center, The Netherlands 5Department of Clinical Immunology & Rheumatology, Amsterdam Rheumatology & Immunology Center, Amsterdam, The Netherlands 6Rheumatology Unit, Department of Medical Sciences, Policlinico of the University of Cagliari, Cagliari, Italy 7Institute of Infection, Immunity and Inflammation, University of Glasgow, Glasgow G12 8TA, UK 8Rheumatology Research Group, Institute of Inflammation and Ageing (IIA), University of Birmingham, Birmingham B15 2WB, UK 9Institute of
    [Show full text]
  • Goblet Cell LRRC26 Regulates BK Channel Activation and Protects Against Colitis in Mice
    Goblet cell LRRC26 regulates BK channel activation and protects against colitis in mice Vivian Gonzalez-Pereza,1, Pedro L. Martinez-Espinosaa, Monica Sala-Rabanala, Nikhil Bharadwaja, Xiao-Ming Xiaa, Albert C. Chena,b, David Alvaradoc, Jenny K. Gustafssonc,d,e, Hongzhen Hua, Matthew A. Ciorbab, and Christopher J. Linglea aDepartment of Anesthesiology, Washington University School of Medicine in St. Louis, St. Louis, MO 63110; bMcKelvey School of Engineering, Washington University in St. Louis, St. Louis, MO 63130; cDepartment of Internal Medicine, Division of Gastroenterology, Washington University School of Medicine in St. Louis, St. Louis, MO 63110; dDepartment of Medical Chemistry and Cell Biology, University of Gothenburg, 405 30 Gothenburg, Sweden; and eDepartment of Physiology, University of Gothenburg, 405 30 Gothenburg, Sweden Edited by Richard W. Aldrich, The University of Texas at Austin, Austin, TX, and approved December 21, 2020 (received for review September 16, 2020) Goblet cells (GCs) are specialized cells of the intestinal epithelium Despite this progress, ionic transport in GCs and its implications contributing critically to mucosal homeostasis. One of the func- in GC physiology is a topic that remains poorly understood. tions of GCs is to produce and secrete MUC2, the mucin that forms Here, we address the role of the Ca2+- and voltage-activated K+ the scaffold of the intestinal mucus layer coating the epithelium channel (BK channel) in GCs. and separates the luminal pathogens and commensal microbiota GCs play two primary roles: One related to the maintenance from the host tissues. Although a variety of ion channels and of the mucosal barrier (reviewed in refs.
    [Show full text]
  • Table SI. Primer List of Genes Used for Reverse Transcription‑Quantitative PCR Validation
    Table SI. Primer list of genes used for reverse transcription‑quantitative PCR validation. Genes Forward (5'‑3') Reverse (5'‑3') Length COL1A1 AGTGGTTTGGATGGTGCCAA GCACCATCATTTCCACGAGC 170 COL6A1 CCCCTCCCCACTCATCACTA CGAATCAGGTTGGTCGGGAA 65 COL2A1 GGTCCTGCAGGTGAACCC CTCTGTCTCCTTGCTTGCCA 181 DCT CTACGAAACCAGGATGACCGT ACCATCATTGGTTTGCCTTTCA 192 PDE4D ATTGCCCACGATAGCTGCTC GCAGATGTGCCATTGTCCAC 181 RP11‑428C19.4 ACGCTAGAAACAGTGGTGCG AATCCCCGGAAAGATCCAGC 179 GPC‑AS2 TCTCAACTCCCCTCCTTCGAG TTACATTTCCCGGCCCATCTC 151 XLOC_110310 AGTGGTAGGGCAAGTCCTCT CGTGGTGGGATTCAAAGGGA 187 COL1A1, collagen type I alpha 1; COL6A1, collagen type VI, alpha 1; COL2A1, collagen type II alpha 1; DCT, dopachrome tautomerase; PDE4D, phosphodiesterase 4D cAMP‑specific. Table SII. The differentially expressed mRNAs in the ParoAF_Control group. Gene ID logFC P‑Value Symbol Description ENSG00000165480 ‑6.4838 8.32E‑12 SKA3 Spindle and kinetochore associated complex subunit 3 ENSG00000165424 ‑6.43924 0.002056 ZCCHC24 Zinc finger, CCHC domain containing 24 ENSG00000182836 ‑6.20215 0.000817 PLCXD3 Phosphatidylinositol‑specific phospholipase C, X domain containing 3 ENSG00000174358 ‑5.79775 0.029093 SLC6A19 Solute carrier family 6 (neutral amino acid transporter), member 19 ENSG00000168916 ‑5.761 0.004046 ZNF608 Zinc finger protein 608 ENSG00000134343 ‑5.56371 0.01356 ANO3 Anoctamin 3 ENSG00000110400 ‑5.48194 0.004123 PVRL1 Poliovirus receptor‑related 1 (herpesvirus entry mediator C) ENSG00000124882 ‑5.45849 0.022164 EREG Epiregulin ENSG00000113448 ‑5.41752 0.000577 PDE4D Phosphodiesterase
    [Show full text]
  • Anoctamin 1 (Tmem16a) Ca -Activated Chloride Channel Stoichiometrically Interacts with an Ezrin–Radixin–Moesin Network
    Anoctamin 1 (Tmem16A) Ca2+-activated chloride channel stoichiometrically interacts with an ezrin–radixin–moesin network Patricia Perez-Cornejoa,1, Avanti Gokhaleb,1, Charity Duranb,1, Yuanyuan Cuib, Qinghuan Xiaob, H. Criss Hartzellb,2, and Victor Faundezb,2 aPhysiology Department, School of Medicine, Universidad Autónoma de San Luis Potosí, San Luis Potosí, SLP 78210, Mexico; and bDepartment of Cell Biology, Emory University School of Medicine, Atlanta, GA 30322 Edited by David E. Clapham, Howard Hughes Medical Institute, Children’s Hospital Boston, Boston, MA, and approved May 9, 2012 (received for review January 4, 2012) The newly discovered Ca2+-activated Cl− channel (CaCC), Anocta- approach to identify Ano1-interacting proteins. We find that min 1 (Ano1 or TMEM16A), has been implicated in vital physiolog- Ano1 forms a complex with two high stochiometry interactomes. ical functions including epithelial fluid secretion, gut motility, and One protein network is centered on the signaling/scaffolding smooth muscle tone. Overexpression of Ano1 in HEK cells or Xen- actin-binding regulatory proteins ezrin, radixin, moesin, and opus oocytes is sufficient to generate Ca2+-activated Cl− currents, RhoA. The ezrin–radixin–moesin (ERM) proteins organize the but the details of channel composition and the regulatory factors cortical cytoskeleton by linking actin to the plasma membrane that control channel biology are incompletely understood. We and coordinate cell signaling events by scaffolding signaling used a highly sensitive quantitative SILAC proteomics approach molecules (19). The other major interactome is centered on the to obtain insights into stoichiometric protein networks associated SNARE and SM proteins VAMP3, syntaxins 2 and -4, and the with the Ano1 channel.
    [Show full text]
  • NUAK2 Amplification Coupled with PTEN Deficiency Promotes Melanoma Development Via CDK Activation
    Published OnlineFirst April 1, 2015; DOI: 10.1158/0008-5472.CAN-13-3209 Cancer Therapeutics, Targets, and Chemical Biology Research NUAK2 Amplification Coupled with PTEN Deficiency Promotes Melanoma Development via CDK Activation Takeshi Namiki1,2,3, Tomonori Yaguchi2, Kenta Nakamura2,4, Julio C. Valencia1, Sergio G. Coelho1, Lanlan Yin1, Masakazu Kawaguchi1, Wilfred D. Vieira1, Yasuhiko Kaneko5, Atsushi Tanemura6, Ichiro Katayama6, Hiroo Yokozeki3, Yutaka Kawakami2, and Vincent J. Hearing1 Abstract The AMPK-related kinase NUAK2 has been implicated in number of cells in S phase. NUAK2 silencing and inactivation of melanoma growth and survival outcomes, but its therapeutic the PI3K pathway efficiently controlled CDK2 expression, where- utility has yet to be confirmed. In this study, we show how as CDK2 inactivation specifically abrogated the growth of its genetic amplification in PTEN-deficient melanomas may NUAK2-amplified and PTEN-deficient melanoma cells. Immu- rationalize the use of CDK2 inhibitors as a therapeutic strategy. nohistochemical analyses confirmed an association of CDK2 Analysis of array-CGH data revealed that PTEN deficiency is expression with NUAK2 amplification and p-Akt expression in coupled tightly with genomic amplification encompassing the melanomas. Finally, pharmacologic inhibition of CDK2 was NUAK2 locus, a finding strengthened by immunohistochemical sufficient to suppress the growth of NUAK2-amplified and evidence that phospho-Akt overexpression was correlated with PTEN-deficient melanoma cells in vitro and in vivo. Overall, our NUAK2 expression in clinical specimens of acral melanoma. results show how CDK2 blockade may offer a promising therapy Functional studies in melanoma cells showed that inactivation for genetically defined melanomas, where NUAK2 is amplified of the PI3K pathway upregulated p21 expression and reduced the and PTEN is deleted.
    [Show full text]
  • Ion Channels of Nociception
    International Journal of Molecular Sciences Editorial Ion Channels of Nociception Rashid Giniatullin A.I. Virtanen Institute, University of Eastern Finland, 70211 Kuopio, Finland; Rashid.Giniatullin@uef.fi; Tel.: +358-403553665 Received: 13 May 2020; Accepted: 15 May 2020; Published: 18 May 2020 Abstract: The special issue “Ion Channels of Nociception” contains 13 articles published by 73 authors from different countries united by the main focusing on the peripheral mechanisms of pain. The content covers the mechanisms of neuropathic, inflammatory, and dental pain as well as pain in migraine and diabetes, nociceptive roles of P2X3, ASIC, Piezo and TRP channels, pain control through GPCRs and pharmacological agents and non-pharmacological treatment with electroacupuncture. Keywords: pain; nociception; sensory neurons; ion channels; P2X3; TRPV1; TRPA1; ASIC; Piezo channels; migraine; tooth pain Sensation of pain is one of the fundamental attributes of most species, including humans. Physiological (acute) pain protects our physical and mental health from harmful stimuli, whereas chronic and pathological pain are debilitating and contribute to the disease state. Despite active studies for decades, molecular mechanisms of pain—especially of pathological pain—remain largely unaddressed, as evidenced by the growing number of patients with chronic forms of pain. There are, however, some very promising advances emerging. A new field of pain treatment via neuromodulation is quickly growing, as well as novel mechanistic explanations unleashing the efficiency of traditional techniques of Chinese medicine. New molecular actors with important roles in pain mechanisms are being characterized, such as the mechanosensitive Piezo ion channels [1]. Pain signals are detected by specialized sensory neurons, emitting nerve impulses encoding pain in response to noxious stimuli.
    [Show full text]