Diverse Feather Shape Evolution Enabled by Coupling Anisotropic Signalling Modules with Self-Organizing Branching Programme

ARTICLE

Received 8 Jul 2016 | Accepted 1 Dec 2016 | Published 20 Jan 2017 DOI: 10.1038/ncomms14139 OPEN Diverse feather shape evolution enabled by coupling anisotropic signalling modules with self-organizing branching programme

Ang Li1, Seth Figueroa2, Ting-Xin Jiang1, Ping Wu1, Randall Widelitz1, Qing Nie2,3 & Cheng-Ming Chuong1,4,5,6

Adaptation of feathered dinosaurs and Mesozoic birds to new ecological niches was potentiated by rapid diversification of feather vane shapes. The molecular mechanism driving this spectacular process remains unclear. Here, through morphology analysis, transcriptome profiling, functional perturbations and mathematical simulations, we find that mesenchyme- derived GDF10 and GREM1 are major controllers for the topologies of rachidial and barb generative zones (setting vane boundaries), respectively, by tuning the periodic-branching programme of epithelial progenitors. Their interactions with the anterior–posterior WNT gradient establish the bilateral-symmetric vane configuration. Additionally, combinatory effects of CYP26B1, CRABP1 and RALDH3 establish dynamic retinoic acid (RA) landscapes in feather mesenchyme, which modulate GREM1 expression and epithelial cell shapes. Incre- mental changes of RA gradient slopes establish a continuum of asymmetric flight feathers along the wing, while switch-like modulation of RA signalling confers distinct vane shapes between feather tracts. Therefore, the co-option of anisotropic signalling modules introduced new dimensions of feather shape diversification.

1 Department of Pathology, University of Southern California, Los Angeles, California 90033, USA. 2 Department of Biomedical Engineering, University of California, Irvine, California 92627, USA. 3 Department of Mathematics, University of California, Irvine, California 92697, USA. 4 Integrative Stem Cell Center, China Medical University, Taichung 404, Taiwan. 5 Center for the Integrative and Evolutionary Galliformes Genomics, National Chung Hsing University, Taichung 402, Taiwan. 6 Research Center for Developmental Biology and Regenerative Medicine, National Taiwan University, Taipei 10617, Taiwan. Correspondence and requests for materials should be addressed to C.-M.C. (email: [email protected]).

NATURE COMMUNICATIONS | 8:14139 | DOI: 10.1038/ncomms14139 | www.nature.com/naturecommunications 1 ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms14139

ver the last two decades, spectacular palaeontological Through transcriptome profiling and functional perturbations, discoveries, mainly from China, have revolutionized our we identify mesenchyme (pulp) derived GDF10 and GREM1 Ounderstanding in the origin and evolution of feathers1–8. as key regulators for rachis and BGZ topology, respectively. Major novel functions of feathers that evolved include They function by modulating BMP signalling in adjacent endothermy, communication, aerodynamic flight and so on. epithelium. The interaction between WNT signalling, GDF10 These are achieved through stepwise retrofitting of the original and GREM1 establishes the symmetric vane configuration. feather forms1–3,7,8. Additionally, differentially localized CYP26B1, CRABP1 and The three major transformative events that occurred during RALDH3 in the pulp establish anisotropic RA signalling. This feather shape evolution are: (i) singular cylindrical filaments to modulates GREM1 expression and epithelial cell shapes which periodically branched feathers; (ii) radially symmetric feathers then adjusts BGZ topology and the barb-rachis angle, resulting in to bilaterally symmetric feathers by developing mirror-imaged alterations of vane width and symmetry. Thus the co-option vanes separated by a central shaft (rachis) and (iii) symmetric or of multi-scale mesenchymal signalling modules by feather asymmetric alterations of vane shapes, including the innovation epithelial progenitor cells likely drives vane shape diversification of feathers specialized for flight. Previous comparative analysis during feather evolution. of flight feather (remige) shapes in a variety of birds indicates a strong association between the level of vane asymmetry and 9 Results flying ability . These feathers serve as mini-airfoils that can Morphological traits affecting feather vane width/asymmetry. generate lift. The co-localization of the centre of gravity and the We started by analysing the morphology of rooster remiges centre of the lifting force in these feathers make the birds more with different asymmetry levels (primary and secondary remiges) stable in the air. These feathers also facilitate unidirectional pass- and body plumes with different vane widths (dorsal and breast through of air during flapping. Additionally, they can separate plumes) (Fig. 1). Before feather maturation, the pulp (considered from each other to minimize wind resistance9–15. Besides these to be the source of nutrition during growth) is enwrapped major transformative events, other morphologic features that by epithelium. This, in turn, is wrapped inside the feather sheath emerged during evolution include the deep follicles containing 7 which gives the feather primordium a cylinder conformation. stem cells for cyclic regeneration , the hooklets and curved Upon maturation the pulp retreats and the BGZ disintegrates, flanges in barbules and the solid cortex and air-filled pith 16 allowing the vanes to separate (Fig. 1a and Supplementary in rachis and ramus . Together, these features enhanced feather Movie 1). Before feather maturation, by cutting open the feather mechanical strength, reduced weight, improved air-trapping epithelial cylinder at the rachis side and removing the pulp, we efficiency and ensured renewability of feathers after damage. find that the width of the BGZ is inversely correlated with the In the past, efforts have been made to unveil the patterning width of the vanes (SHH has enriched expression between barbs22 rules and molecular circuitries generating different feather and hence was used as a vane marker). For asymmetric remiges, forms. For the previously mentioned transformative event higher asymmetry levels are associated with a larger BGZ that (i), BMP and its antagonist, NOGGIN, were shown to regulate expands toward the lateral side, restricting the epithelial area for branching periodicity17. An activator/inhibitor periodic-bran- lateral vane formation (Fig. 1b,c). For symmetric body plumes, ching (PB) model was further used to explain how branching narrower vanes are associated with a larger BGZ which expands morphogenesis occurs autonomously by interactions of diffusible in both lateral and medial directions. More interestingly, when we morphogens in the epithelium18. For event (ii), feather stem examine BGZ topology in remiges with emarginated vanes, cells were found to exhibit a ring configuration, horizontally we also find abrupt vane width changes associate with significant placed in downy feathers but tilted downward anteriorly 19 BGZ size alterations (Fig. 1d). In contrast, the feather cylinder (rachis side) in bilaterally symmetric feathers . An anterior– diameter barely changes during the emergence of the emarginated posterior WNT3A gradient was shown to convert radial to notch (Supplementary Fig. 1a,b). bilateral feather symmetry. Flattening of the gradient converted Another morphological parameter associated with vane shape bilaterally to radially symmetric feathers20. Yet for event variation is the barb-rachis angle. It is a combination of helical (iii), it remains unclear how feather vane shapes are altered in growth angle during feather branching morphogenesis and the different body regions (for example, symmetric body plumes vs expansion angle after feather maturation23 (Fig. 1a). The asymmetric remiges along the wing), at different growth phases expansion angle is likely determined by the physical properties (for example, primary remiges of large flying birds have naturally of barbs and barbules21. Our measurement shows narrower vanes occurring emarginated notches, meaning different vane widths at have smaller helical growth angles and smaller barb-rachis angles different phases of feather growth). Understanding of feather (Fig. 1b,c, Supplementary Fig. 1c–f). As to barb length, notable polymorphism at different physiological developmental stages differences are observed between the asymmetric vanes of (for example, natal down and adult plumes) and across different primary remiges (Fig. 1c). However, the differences between genders (for example, sail-shaped remiges occur in male but not dorsal and breast plumes are very minor (Fig. 1c), and the wider female mandarin ducks) is also lacking. We believe studying the vane region in emarginated remiges even have slightly shorter complex feather vane shapes in Aves provides great opportunities barbs (Fig. 1e). Thus vane width and barb length are not always to understand how systematic and environmental information are positively correlated with each other. sensed and interpreted by skin appendage stem cells. Here through anatomic and computational analysis we found two morphological parameters highly associated with feather Identifying crucial molecules for vane shape regulation.To vane shape diversity: the topology of the barb generative screen for crucial molecules that regulate vane shapes, we zone (BGZ) and the insertion angles of barbs into the rachis. performed RNA-seq to compare transcriptomes between the The BGZ is where the regularly spaced barbs initiate and hence it ‘narrow-vane’ group (lateral side of primary remiges, dorsal has also been called the new barb locus21. Morphologically it is plumes) and the ‘wide-vane’ group (medial side of primary thinner than the neighbouring epithelial regions, containing remiges, breast plumes) from roosters (Fig. 2a,b, Supplementary irregularly spaced small branches. Eventually it disintegrates to Fig. 2). Feather epithelium and pulp were separated during allow vanes to separate and the feather cylinder to open up upon preparation for tissue-to-tissue comparisons. We also performed feather maturation. Histone 3 Lysine 4 tri-methylation ChIP-seq to confirm the

2 NATURE COMMUNICATIONS | 8:14139 | DOI: 10.1038/ncomms14139 | www.nature.com/naturecommunications NATURE COMMUNICATIONS | DOI: 10.1038/ncomms14139 ARTICLE

ab Vane width Primary remige Secondary remige Breast plume Dorsal plume

θ + β

Barb length Lateral vane θ Medial vane Rachis BGZ SHH

c ** 60 ** ** 2 ** ** 50 ** 3 ** ** 2 30 1 (°) 25 1 Ratio to feather Vane width (cm) Barb length (cm)

0 0 Barb-rachis angle 0 0 cylinder circuference plume plume plume plume plume plume plume plume Dorsal Dorsal Dorsal Dorsal Breast Breast Breast Breast remige remige remige remige remige remige remige remige Primary Primary Primary Primary Secondary Secondary Secondary Secondary de 1 2 ** 1 50 ** ** 1 2

0.5 25 2 (°) 1 Vane width (cm) Barb length (cm) SHH 0 Barb-rachis angle 0 0 1 2 1 2 1 2

Figure 1 | Feather vane shapes vary with differential BGZ topology and barb-rachis angles. (a) Schematic drawing of feather before and after maturation. The barb-rachis angle is a combination of the helical growth angle (y) during branching morphogenesis and the expansion angle (b) after maturation. (b) Comparing morphologies of two types of chicken remiges with different asymmetry levels and two types of body plumes with different vane widths before and after maturation. Feather epithelial cylinder (before maturation) was cut open at the rachis side and SHH in situ hybridization was used to highlight vanes. Boxes indicate the regions magnified on the right. Vane widths and barb-rachis angles are highlighted by bars and angle symbols, respectively. Scale bars, 500 mm. (c) Quantification of the ratio of different feather epithelial regions before maturation (n ¼ 4); vane widths, barb-rachis angles and barb lengths after maturation (n ¼ 30). Error bars denote s.d. ÃÃPo0.01. (d) Emarginated primary remiges demonstrate abrupt change of vane width. Feathers growing to a point B1 cm distal to the emarginated notch position were collected and compared with those B1 cm proximal to the notch. A significant shrinkage of the BGZ was observed in those proximal to the notch. Scale bars, 500 mm. (e) Comparisons of vane widths (n ¼ 10), barb-rachis angles (n ¼ 16) and barb lengths (n ¼ 16) at positions B1 cm distal and proximal to the notch in mature feathers. Error bars denote s.d. ÃÃPo0.01. differential expression revealed by RNA-seq, as H3K4me3 is Supplementary Table 1). In situ hybridization unveiled highly an epigenetic marker of actively transcribed genes24 localized GDF10 expression in the pulp adjacent to the rachis (Supplementary Fig. 3). Because transcriptome profiles showed (Fig. 2c). RNA-seq also indicated that the BMP antagonists, high similarity between samples of the same tissue type GREM1 and FST, are upregulated in the pulp of lateral (for example, linear correlation coefficient r ¼ 0.99 for lateral vs side primary remiges (7.30-fold, 1.93-fold) and dorsal plumes medial pulp samples, Fig. 2a) we applied the following conditions (2.12-fold, 4.68-fold) (Fig. 2a,b, Supplementary Table 2). In situ for candidate screening rather than the statistical test provided hybridization demonstrated localized GREM1 expression in the by analysis of variance: minimum fold change 41.8; minimum pulp adjacent to the BGZ (Fig. 2c). FST does not display such transcripts per kilobase million of the group with higher a localized pattern (Supplementary Fig. 4). Similar expression gene expression 425; the direction of change is identical for patterns of GDF10 and GREM1 were also seen in zebra finch both members of the same group (Supplementary Tables 1–4). and Japanese quail remiges (Supplementary Fig. 5). From this screening, we chose crucial morphogenetic signalling Furthermore, two genes along the RA pathway: CYP26B1, molecules for further characterization by in situ hybridization, which degrades RA (ref. 25), is upregulated in the pulp of lateral so we can observe the spatial distribution of these molecules. For side primary remiges (2.98-fold) and dorsal plumes (2.64-fold), example, RNA-seq analysis indicated that GDF10, a BMP family while CRABP1, which shuttles RA either to the nuclear receptors member, is downregulated in the pulp of lateral side primary (RARs) or degrading enzymes26, is downregulated in the pulp remiges (2.15-fold) and dorsal plumes (37.1-fold) (Fig. 2a,b, of lateral side primary remiges (10.22-fold) and dorsal plumes

NATURE COMMUNICATIONS | 8:14139 | DOI: 10.1038/ncomms14139 | www.nature.com/naturecommunications 3 ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms14139

ab L_Pulp M_Pulp D_Pulp B_Pulp r = 0.99 r = 0.96 14 14 CYP26B1 GREM1 GREM1 EYA2 FST 11 11 CYP26B1 LRIG1 FST EYA2 PKIA PKIA PKIA 8 FST CRABP1 8 EYA2 CYP26B1 LRIG1 LRIG1 (log2(TPM)) 5 5 CRABP1 CYP26B1 GDF10 GDF10 CRABP1 2 FGF10 2

D_Pulp FGF10 L_Pulp (log2(TPM)) FGF10 –1 –1 GDF10 –1 2 5 8 11 14 –1 2581114 –1.34 1.34 –1.34 1.34 (sqrtTPM) M_Pulp (log2(TPM)) B_Pulp (log2(TPM)) c KRT75 GDF10 GREM1 CYP26B1 CRABP1 Secondary remige Primary remige Breast plume Dosral plume

Lateral vane Medial vane Rachis BGZ d Lateral Medial

4 ** 15 ** ** 10 2 NS** ** 5 Relative ** ** **

quantification ** X IX VII V III Breast Dorsal ACTBCYP26B1 CRABP1 plume plume X IX VII V III Figure 2 | Identifying key molecular regulators of feather vane shapes. (a) Scatter plots depicting the transcriptomic comparisons between lateral and medial primary remige pulp, dorsal and breast plume pulp, respectively. Among the differentially expressed genes we picked out crucial signalling molecules (red) for further characterization. The linear correlation coefficient (r) is very close to 1, indicating highly similar transcriptome profile between samples. (b) The highlighted genes are clustered in two groups, one associated with narrower vanes and the other associated with wider vanes (L and M are the lateral side and medial side of primary remige; D, dorsal plume; B, breast plume, respectively. Two biological replicates are shown). (c) Candidate genes highlighted by RNA-seq analysis demonstrated differential localization in the pulp of growing feathers with different vane shapes (arrows). KRT75 is highly expressed in the rachis epithelium and hence was used as a marker for position alignment between samples. Scale bars, 500 mm. (d) qPCR for CYP26B1 and CRABP1 in the pulp of primary remiges along the wing (lateral-to-medial: X, IX, VII, V, III, n ¼ 3 for each position) demonstrates gradually decreased CYP26B1 expression and increased CRABP1 expression. While dorsal plumes have more strikingly elevated CYP26B1 and downregulated CRABP1 expression compared with the breast plumes (n ¼ 3). Error bars denote s.d. ÃÃPo0.01, NS, not significant.

(1.93-fold) (Fig. 2a,b, Supplementary Tables 1 and 2). In situ nuclear-enrichment of CRABP1 protein in pulp cells hybridization also demonstrated complementary expression (Supplementary Fig. 6). Nuclear CRABP1 implies its potential patterns of CYP26B1 and CRABP1 (Fig. 2c). CRABP1 role in trans-activating nuclear RA receptors27. Therefore, is colocalized with the RA synthetase, RALDH3, in breast CRABP1 protein likely promotes RA signalling in the pulp plumes but no differential expression of RA receptors was and this also implicates the presence of a lateral–medial detected (Supplementary Fig. 4). Immunostaining revealed RA signalling gradient in primary remiges.

4 NATURE COMMUNICATIONS | 8:14139 | DOI: 10.1038/ncomms14139 | www.nature.com/naturecommunications NATURE COMMUNICATIONS | DOI: 10.1038/ncomms14139 ARTICLE

Interestingly, quantitative PCR (qPCR) for CYP26B1 a crucial role for BMP inhibition in the initiation of barb and CRABP1 in the pulp of primary remiges along the wing formation18. (lateral-to-medial: X, XI, VII, V, III) demonstrated gradually To evaluate the functional role of GREM1, we injected RCAS decreasing CYP26B1 expression (0.96-fold, 1.68-fold, 2.41-fold, viral vectors carrying GREM1 (ref. 28) or control (GFP) 2.59-fold compared with that of X) and increasing CRABP1 into follicles of plucked primary remiges. Ten out of fifteen expression (1.45-fold, 1.38-fold, 1.81-fold, 3.2-fold compared with regenerated feathers showed altered degrees of asymmetry that of X), implying position-dependent, gradual alteration of and mild decreases in the barb-rachis angle, while barb length RA gradient slope in primary remiges. Meanwhile dorsal plumes barely changed (Fig. 4a,b). Sectioning the proximal follicle of have more prominently elevated CYP26B1 (13.34-fold) and feathers with phenotypic changes before maturation revealed downregulated CRABP1 expression (215.77-fold) compared with expansion of the BGZ range compared with controls (Fig. 4a, the breast plumes (Fig. 2d), implicating switch-like regulation of Supplementary Fig. 9a). Furthermore, two out of three neonatal RA signalling regulation between these two feather tracts. chicken remiges infected with RCAS-GREM1 developed not only a notably expanded BGZ, but also branched rachises (Fig. 4c). Hence GREM1 promotes the feather epithelial GDF10 is a crucial modulator of rachis topology. Due to progenitors to adopt the BGZ fate and antagonizes the rachis fate. the high correlation between the GDF10 expression pattern and To confirm GREM1 functions through antagonizing epithelial the rachis topology in different feather types, we investigated BMP signalling, we inserted GREM1 protein coated beads whether there is a cause and effect relationship between the two. (1 mg ml À 1) into the pulp next to the vane region in growing Our attempts to clone full length chicken GDF10 were unsuc- body plumes. Three out of four samples demonstrated a BGZ-like cessful. This made us speculate that the transcripts might phenotype (Supplementary Fig. 9d) and decreased nuclear be spliced. Hence we did a 50-RACE experiment (Rapid ampli- pSMAD1/5/8 positive cells in the adjacent epithelium (Fig. 4d). fication of 50 cDNA ends) and found the majority of GDF10 We also examined the distribution of nuclear p-Smad1/5/8 transcripts are spliced at Exon 2, which matched the spliced positive cells in normal body plumes. These cells are present ESTs reported on the UCSC Genome Browser (Supplementary in the rachis and vane epithelium, but not in the BGZ epithelium, Fig. 7). We cloned the 30 part of the spliced transcript into which is adjacent to the GREM1 positive zone (Supplementary the replication competent avian sarcoma (RCAS) viral vector Fig. 10a). Thus GREM1 does antagonize BMP signalling in and infected embryonic chicken limbs. Three out of five of the feather epithelium. neonatal primary remiges developed more prominent rachises Because the BGZ region is usually thinner than other epithelial (Fig. 3a). We previously found that BMP2 mis-expression caused regions during feather growth, we speculate that GREM1’s impact an enhancement of rachis formation17. Therefore, we examined on feather epithelium includes changing the cell proliferation BMP signalling activity in the GDF10 mis-expressing follicles. rate. Through PCNA staining, we indeed observe decreased Indeed, we observed an increased number of nuclear epithelial cell proliferation in GREM1 mis-expressed feather phosphorylated (p)-Smad1/5/8 positive cells, indicating active follicles compared with controls (Supplementary Fig. 9b,c). BMP signalling (Fig. 3a). Consistent with this, we observe fewer proliferating cells in Previous studies also indicated that WNT signalling plays a BGZ epithelium compared with other epithelial regions in most crucial role for the formation of bilaterally symmetric feather of the feather forms we examined (Supplementary Fig. 10b). vanes20, so we also examined the potential crosstalk between Breast plumes are an exception, potentially because their GDF10 and WNT signalling. Neonatal primary remiges infected endogenous GREM1 expression is very low, or because the with virus mis-expressing constitutively active b-Catenin BGZ is so narrow that parts of the vane region were included developed expanded rachises without significant upregulation of in the region of interest used to count the number of proli- GDF10 expression (Fig. 3b). It is worth noting that unlike adult ferating cells. chicken primary remiges, neonatal primary remiges have very We also investigated the potential crosstalk between GREM1 thin rachises and barely detectable endogenous GDF10 and WNT signalling. Inserting WNT3A protein (100 mgmlÀ 1) expression. On the other hand, in normal feathers we observe soaked beads into the BGZ pulp of growing dorsal plumes abundant nuclear b-Catenin positive cells in the pulp adjacent to downregulated GREM1 expression (n ¼ 3, Supplementary the rachis and vanes, but not in the BGZ region. This regional Fig. 11a). Consistently, RCAS-b-Catenin infected neonatal difference potentially results from the anterior–posterior remiges also demonstrate decreasing GREM1 expression epithelial WNT gradient, because in body plumes with after- (Supplementary Fig. 11b). Thus WNT signalling plays an feathers (secondary rachis and vanes forming at the original inhibitory role on GREM1 expression. BGZ region) upregulated WNT3A expression and increased numbers of nuclear b-Catenin positive pulp cells are observed in the original BGZ region (Supplementary Fig. 8a). Interestingly, in Anisotropic RA signalling modulates vane width and symmetry. neonatal primary remiges infected with RCAS-GDF10, the The differential localization of RA related factors in asymmetric number of nuclear b-Catenin positive pulp cells also seems to remiges implies a potential link between the RA gradient increase (Fig. 3c). Therefore, beside BMP signalling, GDF10 may and vane asymmetry. When we mis-express a dominant negative potentially modulate the spatial activity of WNT signalling. form of chicken RARb (to block wild-type RAR function29) But WNT signalling itself can function without upregulation in primary remiges we observe decreases in feather vane widths of GDF10. and significantly sharper barb-rachis angles. Meanwhile the barb length barely changes (Fig. 5a,b) (12/12). Interestingly, GREM1 specifies BGZ topology. Due to the high correlation epithelial cells (especially those in BGZ regions) in growing between the GREM1 expression pattern and the BGZ topology remiges mis-expressing DNRARb have a more elongated in different feather types we investigated whether there is appearance (in the proximal–distal direction) than the controls a cause and effect relationship between the two. The antagonistic (Fig. 5c,d). A similar situation is also seen in feather epithelial property of GREM1 on BMP signalling also makes it a key cells exposed to different endogenous RA levels. For example, candidate molecule for BGZ specification because a previous dorsal plumes and lateral side primary remiges have upregulated mathematical model depicting feather shaping highlighted CYP26B1 in the pulp adjacent to epithelium. Their BGZ epithelial

NATURE COMMUNICATIONS | 8:14139 | DOI: 10.1038/ncomms14139 | www.nature.com/naturecommunications 5 ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms14139

a H&E KRT75 pSMAD1/5/8 DAPI RCAS-GFP RCAS-GDF10 RCAS-BMP2

bcH&E KRT75 GDF10 β-catenin DAPI RCAS-GFP RCAS-GFP -catenin β RCAS- RCAS-GDF10

Figure 3 | GDF10 is a crucial modulator of rachis topology. (a) Compared with the RCAS-GFP (control) infected neonatal primary remiges, GDF10 and BMP2 mis-expressing feathers developed enlarged rachises as shown by Hematoxylin & Eosin (H&E) staining and KRT75 in situ hybridization. Nuclear pSMAD1/5/8 positive cells also increased in the rachis region. Dotted red lines highlight the rachis. Scale bar, 100 mm. (b) RCAS-b-Catenin infected neonatal remiges developed expanded rachis without notable upregulation of GDF10 expression. Dotted red lines highlight the rachis. (c) RCAS-GDF10 infection increased nuclear b-Catenin positive cells in the pulp adjacent to the rachis. Scale bar, 100 mm. cells are more elongated than those in breast plumes and Consistent with this, in body plumes with after-feathers, the medial side of primary remiges, which have upregulated the decrease of GREM1 at the original BGZ coincides with CRABP1 (Fig. 5c,d). Through mathematical modelling, we increased RALDH3 and CRABP1 (promoting RA signalling, identify two potential mechanisms through which cell shapes Supplementary Fig. 8b). Meanwhile in primary remiges can affect the helical growth angle, which is a part of the with emarginated notches, the reduction of GREM1 expression barb-rachis angle. First, we found helical growth angle is an (after the abrupt expansion of vane width) coincides with arctangent function of the feather elongation rate divided by a decrease of CYP26B1 (degrading RA) expression on the lateral the travelling speed of the activator for feather branching side (Supplementary Fig. 13). Furthermore, the remiges infected (Supplementary Fig. 12a). Since cell shape elongation increases with RCAS-DNRARb have relatively wider GREM1 positive the feather elongation rate, it would reduce the helical growth zone while those infected with RCAS-GREM1 have not changed angle (Supplementary Fig. 12b). Second, elongated cell shape CYP26B1 expression patterns (Fig. 5a, Supplementary Fig. 9a). increases tissue tortuosity (Supplementary Fig. 12c,d), which Therefore, we hypothesize RA signalling works upstream can decrease the activator/inhibitor diffusivity if the diffusion to inhibit GREM1 expression. occurs mainly through the epithelial cellular plane. The slower To evaluate this possibility, we insert RA soaked beads travelling wave-speed of the branching activator produces (1 mg ml À 1) into the BGZ pulp of growing dorsal plumes a sharper helical growth angle (Supplementary Fig. 12d). that indeed decreases GREM1 expression compared with the But altering the travelling wave-speed of the inhibitor barely control (n ¼ 4, Fig. 6a). Next we isolated BGZ pulp cells from has any effects (Supplementary Fig. 12e). These modelling results different types of feathers and treated them with different indicate that activator diffusivity and feather elongation rate, concentrations of RA or a RAR antagonist. qPCR revealed both of which are inﬂuenced by cell shape, can control helical a RA dose-dependent decrease in GREM1 expression and growth angles. upregulation of GREM1 upon RAR antagonist treatment Previously the in situ hybridization of RA related factors (Fig. 6b, Supplementary Fig. 14). However, cells from breast in different types of feathers implies an association between plumes behave differently, potentially due to their low endogen- increased RA levels and decreased GREM1 expression (Fig. 2c). ous GREM1 expression (Fig. 2c). A similar trend of expression

6 NATURE COMMUNICATIONS | 8:14139 | DOI: 10.1038/ncomms14139 | www.nature.com/naturecommunications NATURE COMMUNICATIONS | DOI: 10.1038/ncomms14139 ARTICLE

ab SHH GREM1 1.5 ** ** 1

0.5 1 Vane width (cm) RCAS-GFP 2 0 1 2 50 ** **

25 1212 (°)

Barb-rachis angle 0 NS 1.5 **

1 2 1

RCAS-GREM1 1 2 0.5

Barb length (cm) 0 RCAS RCAS 1212 -GFP -GREM1 Lateral vane Medial vaneBGZ Rachis

cdH&E pSmad1/5/8 1 12

2 BSA bead RCAS-GFP

1 1 2 GREM1 bead

RCAS-GREM1 2

Figure 4 | GREM1 is a key regulator of BGZ topology. (a) Compared with the controls, GREM1 mis-expressed adult chicken primary remiges have reduced vane width and increased BGZ width. Boxes indicate the vane boundaries between BGZ and vanes magnified below. Scale bars: 5 mm for the leftmost panel, 500 mm for the right two panels. (b) Comparing vane widths (n ¼ 4), barb-rachis angles and barb lengths (n ¼ 10) in control and GREM1 mis-expressed feathers. Error bars denote s.d. ÃÃPo0.01, ÃPo0.05, NS, not significant. (c) RCAS-GREM1 infected neonatal remiges not only had an expanded BGZ but also a branched rachis. Boxed regions are magnified on the right. Dotted red lines highlight the rachis. Scale bar, 100 mm. (d) GREM1 soaked beads reduced nuclear pSMAD1/5/8 staining in the neighbouring epithelial cells. Boxed regions are magnified on the top-left corner. Dashed lines highlight the beads. Scale bar, 100 mm. changes was also observed for GDF10 in cultured rachis pulp and established a multi-module regulatory feather (MRF) model cells, but the fold change is less significant (Supplementary (Fig. 7a) that provides a molecular basis for the diverse feather Fig. 14). forms. To further examine if RA acts on GREM1 directly, we searched In this model, RA signalling is the lateral–medial regulatory for RA response elements (RAREs) close to the GREM1 genomic module, which is mainly controlled by CYP26B1 and CRABP1. locus conserved in chicken, turkey and zebra finch (Suppleme- The lateral–medial module then acts on the anterior–posterior ntary Tables 5 and 6). Using a dual luciferase assay, we regulatory module, which consists of GDF10, GREM1 and show that a direct repeat 1 (DR1) type of RARE in the WNT signalling. These two layers of regulatory modules GREM1 promoter region repressed reporter transcription then act together on BMP signalling, an inhibitor of barb upon RA treatment (Fig. 6c,d), consistent with previous reports branching17,18, leading to changes of the activator’s spatial– of DR1 RARE’s inhibitory role on gene expression upon temporal dynamics and feather branching patterns. RA binding30. Meanwhile the positive control with trimeric Mathematically, the MRF model consists of the original DR5 RARE demonstrated significantly increased promoter PB model by Prum18, plus 4 new reaction–diffusion equations activity upon RA treatment. Hence RA signalling can directly for extracellular RA, WNT, GDF10 and GREM1. To model modulate GREM1 expression. extracellular RA we incorporated a previous model26 which includes Crabp1 and Cyp26 (see ‘Methods’: Model construction and simulations). We first simulate the MRF model with and A multi-module regulatory model for feather diversification. without the lateral–medial regulatory module. The simulation The strength of the PB model proposed by Prum is in its adoption indicates that the anterior–posterior module alone is able to of the activator–inhibitor concept18. Here we integrate the produce rachis and BGZ at opposite sides of the feather cylinder. new findings on GDF10, GREM1, RA and WNT signalling When a symmetric lateral–medial module is introduced, the

NATURE COMMUNICATIONS | 8:14139 | DOI: 10.1038/ncomms14139 | www.nature.com/naturecommunications 7 ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms14139

ab SHH GREM1 ** 1.5 ** 1

0.5

Vane width (cm) 0 RCAS-GFP 1 50 1 2 ** 2 **

25 1212 angle (°) Barb-rachis 0 β * NS 1.5

1 1 2 1 2 RCAS-DNRAR 0.5 Lateral vane Medial vane

Barb length (cm) 0 Rachis BGZ 1212 RCAS RCAS -GFP -DNRARb Lateral vane Medial vane cd Phalloidin-FITCPhalloidin-FITC Phalloidin-FITC ** ** 5 1 3 5 **

2.5 Medial BGZ Cell aspect ratio

RCAS-GFP BGZ 0 of primary remige Breast plume BGZ 1 2 3 4 5 6 2 4 6 300 NS ** ) 2 BGZ m β NS μ 200

100 Lateral BGZ

Cell area ( 0 of primary remige Dorsal plume BGZ 1 2 3 4 5 6 RCAS-DNRAR

Figure 5 | RA signalling modulates vane morphology and epithelial cell shapes. (a) Compared with the controls, RCAS-DNRARb infected adult chicken primary remiges have significantly reduced vane width and barb-rachis angles, while BGZ width is increased. Boxes highlight vane boundaries. Scale bars: leftmost panel: 5 mm, right three panels: 500 mm. (b) Quantification of feather vane widths (n ¼ 4), barb-rachis angles and barb lengths (n ¼ 10) in control and DNRARb infected remiges. Error bars denote s.d. ÃÃPo0.01, ÃPo0.05, NS, not significant. (c) BGZ epithelial cells have more elongated shape at epithelial regions exposed to lower RA levels. Phalloidin labels F-Actin that is mainly localized along epithelial cell boundaries. Scale bar, 50 mm. White lines highlight cell shape differences. (d) Quantification of cell aspect ratio and cell area in BGZ epithelial cells (n ¼ 30). Error bars denote s.d. ÃÃPo0.01, ÃPo0.05, NS, not significant. feather vanes can enlarge or shrink based on the level of Here we established a multi-module regulatory model revealing RA, which is modulated by CYP26B1 and CRABP1 (Fig. 7b). that the feather mesenchyme provides micro-environmental The MRF model can also simulate bilateral asymmetric feathers signals to tune the self-organized branching programme of by establishing opposing gradients of CYP26B1 and CRABP1 feather epithelial progenitors. First, branching of the feather in the lateral–medial direction. Through incrementally changing epithelial cylinder requires interactions between activators and their expression in the opposite direction, which changes inhibitors. BMP signalling appears to be the major inhibitor17,18. the slope of the RA gradient, a continuum of asymmetry SHH, NOGGIN and SPRY4 have been considered as the candidate levels could be produced (Fig. 7c). Such a continuum of activators17,18,31. However, there has not been any evidence asymmetry is commonly observed in a row of remiges along showing enforced expression of SHH can induce ectopic feather the alar tract on the bird wing (Fig. 2d, Supplementary Fig. 5) branching. NOGGIN and SPRY4 could enhance feather branching but their spatial distribution does not fit the prediction from the PB model. Therefore, the molecular identity of the activator Discussion may remain to be revealed. Second, GDF10 and GREM1 acted on Organ shaping is a fundamental issue in development and BMP signalling to tune the branching process, leading to the critical in tissue engineering. In many cases organ shapes establishment of Rachis and BGZ topology, respectively. Third, are influenced by signals arising both within and outside a WNT gradient coordinated the position of the rachis and the organ. We believe the diverse feather vane shapes in modern BGZ through interactions with GDF10 and GREM1, which birds provide a great opportunity to decipher the principles established the bilateral-symmetric vane configuration. Fourth, of morphogenesis and understand how stem cells can alter the anisotropic RA landscape, shaped by differential levels of their behaviours in response to different environmental CYP26B1, RALDH3 and CRABP1 over different body regions and information. time, introduced a new dimension of vane shape variations

8 NATURE COMMUNICATIONS | 8:14139 | DOI: 10.1038/ncomms14139 | www.nature.com/naturecommunications NATURE COMMUNICATIONS | DOI: 10.1038/ncomms14139 ARTICLE

ab Primary Secondary H&E GREM1 remige remige Breast plume Dorsal plume

1.2 DMSO bead

fold of 0.6 change GREM1 0 RA bead DMSO RA RA RA RA RA (μM) 0.1 0.5 2 8 40

c d H3K4me3 Lateral pulp Medial pulp RNA-seq ChIP-seq DMSO RA 8 μM Chr5 DR1-2 DR1-1 ** 29,830 kb 29,840 kb 0.6 ** GREM1 0.4 NS [7–17] ratio 0.2 [7–17]

[0–1,259] Dual luciferase 0 DR1-1 DR1-2 DR5 [0–1,259] trimer

Figure 6 | RA signalling can directly inhibit GREM1 expression. (a) Insertion of AG1x8 beads soaked in 1 mg ml À 1 RA into dorsal plumes’ BGZ pulp significantly decreased GREM1 expression compared with the DMSO treated controls. Dashed lines highlight the bead. Scale bar, 100 mm. (b) qPCR for GREM1 in pulp cells from four types of feathers treated with different doses of RA (n ¼ 3). Error bars denote s.d. (c) Two conserved (chicken, turkey, zebra finch) DR1 type RAREs were identified close to the GREM1 genomic locus. DR1-1 (highlighted in red) is in the active promoter region (H3K4me3 peak). The peak regions called by MACS are highlighted by blue bars. (d) DR1-1 downregulated its downstream gene expression upon RA treatment while a DR5 trimer had the opposite effect in dual luciferase assays (n ¼ 4). Error bars denote s.d. ÃÃPo0.01, NS, not significant. through crosstalk with GREM1 to adjust the BGZ topology primary remiges have shorter barbs but comparable barb-rachis (and potentially GDF10 to adjust rachis topology) and barb-rachis angle to the wider medial vanes. In our work, we found the angles. feather vane width and barb length are not always correlated in Differential RA signalling activities have been implicated as chicken feathers (Fig. 1c,e). Therefore, it is possible that the a key regulator of region-specific phenotypes. For example, differential barb-rachis angles were evolved after the Mesozoic RALDH2 À / À mouse embryos have been reported to show period. bilaterally asymmetric somitogenesis due to left–right desynchro- Then how could RA signalling modulate barb-rachis angles nization of segmentation clock oscillations32. Previous analyses of at the molecular level? We observe different feather epithelial naked neck chickens revealed elevated RA in the neck potentiates cell shapes in feather vanes having different RA levels. Lower BMP signalling, which inhibits feather formation33. Our findings RA is associated with a more elongated cell shape in the here indicate GREM1 as a potential candidate to explain the proximal–distal direction (Fig. 5c). Through mathematical potentiation effect of RA on BMP signalling. During limb modelling we demonstrate two potential mechanisms through development, RA forms a gradient for proximal–distal limb which cell shapes could affect helical growth angles (Supple- patterning25, which is in the same direction as those in primary mentary Fig. 12), and the helical growth angle is part of the barb- remiges. Therefore, it is possible that the limb RA gradient is rachis angle. Interestingly, in RCAS-GREM1 infected feathers we somehow imprinted within the remige pulp cells and the observed narrower vanes with negligible changes of barb length steepness of the limb RA gradient is used to establish a (Fig. 4b), which could be explained by a compensation effect from continuum of asymmetry levels in remiges along the wing. sharper helical growth angles (Fig. 7d). Since RA inhibits GREM1 Beside the gradual changes of RA gradient, we also observed expression, the sharper helical growth angle and elongated cell switch-like regulation of RA signalling in breast vs dorsal plumes. shapes in RCAS-DNRARb infected feathers may also due to This may result in the differential expression of Homeobox genes elevated GREM1 level. Consistent with this, when we compare or T-box genes, which are body axis organizers that chicken dorsal and breast plumes, the dorsal plumes have higher can potentially regulate GREM1 expression34–36. Additionally, GREM1 expression accompanied by sharper barb-rachis angles RA signalling can be swiftly modulated during feather growth to and helical growth angles (Fig. 1c, Supplementary Fig. 1e,f), as give rise to abrupt vane shape changes like emarginated notches. well as more elongated epithelial cell shapes (Fig. 5c). It is also Besides its effect on BGZ topology, RA signalling also worth noticing that the barb length is only slightly different modulates barb-rachis angles, which may further contribute to between dorsal and breast plumes (Fig. 1c). These results are also the diversification of vane shapes. A recent publication indicates consistent with a previous report that the barb length is affected the emergence of asymmetric remige vanes and the differential by both the relative position of the BGZ to the rachis and the barb-rachis angles between vanes occurred at different times helical growth angles23. In other systems, RA signalling also has during evolution, and it is the differential barb length that been shown to influence cell shape/polarity38,39. Cell shape determines vane asymmetry37. In Mesozoic birds such as polarization is usually related to planar cell polarity (PCP) Archaeopteryx and Confuciusornis, the narrower lateral vanes of signalling40,41. Meanwhile the non-canonical WNT/PCP pathway

NATURE COMMUNICATIONS | 8:14139 | DOI: 10.1038/ncomms14139 | www.nature.com/naturecommunications 9 ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms14139

ab No RA module High RA Low RA Periodical branching module Activator Inhibitor

(BMP2) Time (a.u.) Epithelial progenitors 1 Pulp (microenvironment) Anterior– posterior 0 regulatory Activator BMP2 RA module 1 GDF10 WNT signaling GREM1

Normalized concentration 0 GREM1 GDF10 WNT RA Lateral– Modulation of epithelial cell shapes medial Postulated order of emergence in evolution regulatory c Steeper Intermediate Shallower module CYP26B1 RA signaling CRABP1 RA gradient RA gradient RA gradient

d BGZ expansion +

Control BGZ expansion cell shape elongation Time (a.u.)

17.1° 16.7° 10.2° 1

Time (a.u.) 0 Activator BMP2 RA Barb length 550 337 505 1 (a.u.)

Vane width 149 89 88

(a.u.) Normalized concentration 0 GREM1 GDF10 WNT RA

Figure 7 | A multi-module regulatory model of feather diversification. (a) Schematic representation of the infrastructure of the multi-module regulatory feather (MRF) model and the corresponding transformative events of feather shapes in evolution. Dashed lines denote crosstalk relationships not fully confirmed. The differential equations for quantifying the crosstalk relationships are listed in the Methods. (b) Representative simulations of vane shape variations using the MRF model either without RA module, with high RA (CRABP1 level set at 1.1, CYP26B1 at 0.02, artificial unit), or with low RA (CRABP1 at 0.005, CYP26B1 at 0.2). (c) Representative simulations of feathers with different levels of vane asymmetry by changing the slope of RA gradient (CRABP1 at 0.006, CYP26B1 at 5 for the steeper RA gradient, CRABP1 at 0.03, CYP26B1 at 0.5 for the intermediate RA gradient, CRABP1 at 0.06, CYP26B1 at 0.3 for the shallower RA gradient), (d) Simulations of RCAS-GREM1 and RCAS-DNRARb infected feathers in which the BGZ expands without significantly shortening of barbs. has also been implicated in establishing body bilateral asymmetry hormone levels in different genders, seasons and physiological by regulating the distribution and movement of cilia42. Key developmental stages. PCP pathway members were not highlighted by our RNA-seq analysis. However, PCP proteins endow cell polarity through Methods their asymmetric localization within cells, which would not be Animals. Animal care and experiments were conducted according to the detected by transcriptome analysis. guidelines established by the USC Institutional Animal Care and Use Committee. Besides the barb-rachis angle and the topology of the Pathogen free Charles River (Connecticut, USA) white leghorn chickens were used for virus injection and feather follicle collection. BGZ, there are other parameters that can modulate feather vane width such as the epithelial cylinder circumference during feather Measurements of feather anatomic parameters. For normal remiges and body growth. We believe that the gradual change of the circumference plumes, the measurements of barb-rachis angle, barb length and vane width were does contribute to the production of the smoothly arced contour done in the vane area 3 cm and 2 cm below the distal tip, respectively. For of feathers. However, the keratinized follicle and feather sheath RCAS virus injected adult chicken remiges, the measurements were done and the tension from extra-follicular musculature may limit its 1–2 cm below the tip. To collect growing feathers proximal and distal to the contribution to abrupt vane width changes such as the formation emargination notch, we carefully measured the distance of the notch to the feather tip for primary remige VI–VIII for each chicken and collect the regenerating of emarginated notch. feather at least 1 cm shorter than that distance. The sample proximal to the notch is In summary, our study here reveals a multi-module regulatory the regenerating feather Z1 cm longer than the distance. network in feather mesenchyme that facilitates the diversification of feather vane shapes through regulating the branching RNA-seq and ChIP-seq sample preparation and analysis. For RNA-seq we morphogenesis of feather epithelial progenitors. Such interactions cut the proximal follicles of three primary remiges from Spafas white leghorn between organ stem cells and their microenvironment are also chickens into the lateral and medial halves and separated the epithelium from 43 the mesenchyme in 2xCMF solution. For dorsal plumes and breast plumes, observed in the development and regeneration of other organs . 25 proximal follicles were used, respectively. Total RNA was extracted using It would be intriguing to investigate how these microenvironment Trizol reagent. A total of 4 mg RNA was used for library construction by TruSeq signals crosstalk with systematic signals, such as differential RNA Sample Prep Kit Version2 (Illumina). Two biological replicates were sent for

10 NATURE COMMUNICATIONS | 8:14139 | DOI: 10.1038/ncomms14139 | www.nature.com/naturecommunications NATURE COMMUNICATIONS | DOI: 10.1038/ncomms14139 ARTICLE sequencing (50 bp, single end) with Illumina HiSeq 2000 in the USC Epigenome intensity was read by Perkin Elmer EnVision Multilabel Plate Reader at the Center. FastQ files were trimmed and mapped to the chicken genome (galGal4) USC Translational Research Laboratory. using Partek Flow. Further analysis was done in Partek Genomic Suite. For ChIP-seq, 15 primary remige follicles were collected and processed similar to those Immunohistochemistry and immunofluorescence Antibodies. pSMAD1/5/8 used for RNA-seq. The mesenchymal cells were dissociated by 0.35% Collagenase . (Millipore, AB3848); b-Catenin (Sigma, C-2206); Phalloidin-FITC (Sigma,P-5282); digestion before formaldehyde cross-linking. The ChIP experiments were CRABP1 (Abcam, ab2816); PCNA (DAKO, clone PC10); CldU (Abcam, ab6326). performed as described previously44, including the formaldehyde cross-linking Immunostaining follows our published method45. All samples are fixed in of cells for 14 min at room temperature followed by sonication for 20 min ° (30 s on/off cycle). Immunoprecipitation with H3K4me3 antibodies were paraformaldehyde for 2 days at 4 C and washed. For phalloidin staining, samples were pre-blocked and incubated with Phalloidin-FITC for 1 h at room temperature. performed at 4 °C overnight. After cross-link reversal, DNA from two biological For Whole-Mount immunostaining, samples were dehydrated, rehydrated, replicates were sent for library preparation and sequencing by the USC Epigenome pre-blocked and incubated with the primary antibody at 4 °C overnight. They were Center. Reads were trimmed and aligned to galGal4 in Partek Flow. Peak calling then incubated with a secondary antibody conjugated to Alexa Fluor 488 (green) or was done with MACS. Results were viewed in the Integrative Genomics Viewer. Alexa Fluor 594 (red) labelled for 6 h. For section immunostaining, antigen retrieval was carried out through citrate buffer in a 95 °C water bath. Primary Whole-Mount and section RNA in situ hybridization. Whole-Mount in situ antibody incubation is at 4 °C overnight and secondary antibody incubation is at hybridization was performed as in Jiang et al.45. Briefly, samples were fixed room temperature for 3 h. in 4% paraformaldehyde for 2 days, followed by PBS washing, dehydration, and rehydration. Hybridization with digoxigenin labelled probes took place CldU labelling and quantification To show transient amplifying cells, chickens in a 65 °C water bath overnight. The samples were washed and incubated with . were injected with the BrdU homologue, CldU (Sigma) at 5 mg kg À 1. Feathers anti-digoxigenen-AP antibodies at 4 °C overnight. Colour development was were collected 2 h later. To quantify the CldU positive cell ratio, six circles (100 mm implemented with Promega NBT/BCIP substrate. Proximal feather follicles were diameter) were drawn on the confocal image in different regions. CldU positive cut open at the rachis side and the mesenchyme was removed in 2xCMF solution and DAPI stained nuclei within the circles were quantified using ImageJ. to expose the inner side of the epithelial cylinder. Samples were kept flat during probe hybridization in chambers with narrow gaps. Section in situ hybridization was done as described46. Samples were fixed and washed following Whole-Mount Virus injection and bead implantation. RCAS-GREM1 is a gift of J.-C. Belmonte, protocols. After dehydration, the tissue was then embedded in paraffin and Salk Institute. The primers for cloning GDF10 isoforms are: ggggacaagtttgtaca sectioned at 8 mm. Sections were rehydrated, acetylated before hybridization with aaaaagcaggcttccatatcataaaagaatcaaaacgatct and ggggaccactttgtacaagaaagc digoxigenen labelled probes overnight at 65 °C. Antibody incubation and colour tgggtcttatcggcaggcacaagttt. The primers for cloning RCAS-DNRARb are: ggggac development followed Whole-Mount protocols. The SHH and KRT75 probe have aagtttgtacaaaaaagcaggcttcattaacatgacaaccagca and ggggaccactttgtacaagaaa already been described22,47. Primers for probe cloning are listed as follows: gctgggtctcaaggaatttccattttcaacgta. The PCR products were cloned into RCAS c-RALDH3: gcccatcaaggtgtgttctt and tgccaaagcatattcaccaa; c-CRABP1 sense: using BP-LR reaction (Life Technologies). RCAS virus was produced by acctggaagatgaggagcag and ggtcacatacaacaccgcatt; c-CYP26B1: cctgatagagagcggcaaag transfecting DF-1 cells with the corresponding plasmids. Supernatant was collected, and gttggaatccagtccgaaga; c-EYA2: cattcccggcctaactgtgt and agcatgtaactgcagggtcc; ultra-centrifuged and injected as described17. For bead implantation, heparin bead c-FGF10: aatggtgcctcagcctttt and ccattggaagaaagtgagctg; c-FST: aggagga soaked in PBS or recombinant human Gremlin protein (R&D Systems 5190-GR) cgtcaacgacaac and atcgacctctgccaacctta; c-GDF10: tcccatactgaggctcaacc and for 1 h at room temperature were inserted into the peripheral pulp of growing tgttttcgccttgctttctt; c-GREM1: cgacagcagaagggagaaag and gcacttctcggcttagtcca; phase contour feathers around the ramogenic zone level. The feathers were c-KRT75: atgtctcgccagtccaccg and ttagctcctgtaacttctcc; c-RARa: acggagtgct collected 24–48 h later. To achieve localized WNT signalling activation, Affi-Gel cggagagtta and tgcagtttgtccaccttgtc; c-RARb: acttgttccaagccctcctt and tgcatct Blue beads soaked Mouse WNT3A (100 mgmlÀ 1, PeproTech 315-20) were used. gagttcggttcag; c-SHH: ggaattcccag(ca)gitg(ct)aa(ag)ga(ag)(ca)(ag)i(gct)tia and For delivery RA, Bio-Rad AG1X8 beads were soaked in 1 mg ml À 1 retinoic acid tcattiatggaccca(ga)tc(ga)aaiccigc(tc)tc; zebra finch-GDF10: cgagctggagagctcattct (RA) for 20 min in dark. and gacaatcttgggcattggaaa; zebra finch-GREM1: catcggtgccttgtttcttc and gacaccggcactccttaactc; zebra finch-SHH: tctcctctgggctgacttgt and cgccact gagttttctgctt; In situ hybridization in quail samples used chicken probes. Confocal microscopy and image processing. A Zeiss LS510 confocal microscope was used to image the fluorescently labelled specimens. Background correction, z-stack compaction, image stitching and cell counting were done in Fiji ImageJ48,49. RT-qPCR of cultured pulp cell RNAs. The pulp from the most proximal part (5 mm) of growing feathers was separated from epithelium by brief 2xCMF treatment, then either directly processed for RNA extraction or dissociated in Statistical analysis. Two independent sample T-tests were done with Matlab. 0.35% Type I Collagenase for culture. The cultured (48 h) pulp cells were with different drug treatments: RA (Sigma R2625), RAR antagonist (ER 50891 Tocris Model construction and simulations. All the simulation codes for solving the 3823). RNA was isolated with the Qiagen RNeasy Mini Kit and the concentration Partial Differential Equations along with analysis of tortuosity and estimation of was measured with the NanoDrop 2000 spectrophotometer. Reverse transcription the barb-rachis angle are developed using Matlab. was done with Superscript III (Life Technologies). qPCR primers: ACTB: gctatg aactccctgatggtc and ggactccatacccaagaaaga; CRABP1: ccacggaaatcaacttcaaaa and ttgttttcattctcccaggtg; CYP26B1: tgcccctgtctttaaggatg and aggggaggtagtggaacctg; Periodic-branching model. The PB model is based on a previous activator– 18 GREM1: tcttctgacgggatttctgc and aatcattgggctgatccttg. GDF10: tgtgctgagcttgattctgg inhibitor model , where a diffusible self-regulating activator A, activates and ttgcaaggtcattggcataa; Maxima SYBR Green/ROX qPCR Mix was from Thermo a diffusible inhibitor B and a non-diffusible inhibitor C. Both inhibitors B and C Scientific. The Ct values were measured by Agilent Mx3000P qPCR system. The downregulate activator A. The GREM1 and GDF10 steady state profiles formed in relative quantification was done by pyQPCR v0.9 software. Each condition has at the MRF model are incorporated in the PB model through inhibiting B least two biological replicates and three technical replicates. downregulation of A, and upregulating basal production of B, respectively. ÀÁ 2 2 0 @½A @ ½A 0 s ½A þ bA 1 Rapid amplification of 5 cDNA ends and cloning. Rapid amplification of ¼ DA 2 þ À rA½Að1Þ 0 @t @x ÀÁ 5 cDNA ends was done using the GeneRacer core kit and Superscript III 2 @ sB ½B A þ ½ n þ ½ RT module following the manual (Invitrogen). Overall, 2 mg primary remige 1 sA A G sC C 1 þ s = pulp RNA was used as the starting material. The gene specific primer for GDF10 is G [GREM] cggcaggcacaagtttcaactgacat. The PCR product was amplified using the GeneRacer 50 Nested Primer and the gene specific primer was ligated with pDrive vector. 2 We transformed DH5a cells with the ligation mixture and used blue/white @½B @ ½B 2 ¼ D þ r ½A þ b ½GDFÀr ½Bð2Þ screening for colonies with insert for sequencing. @t B @x2 A B B

Identifying candidate RARE and Dual luciferase assay. Search of RARE close to @½C 2 the GREM1 genomic locus was done in the Genomatix Software Suite. The two ¼ bC½A À rC½Cð3Þ @t candidate DR1 type RA-response elements were cloned into pGL3-SV40 Promoter Vector (no enhancer). pRL-SV40 Vector (with enhancer) serves as the internal The concentration of activator A is represented by [A], inhibitors B and C by control. Both vectors are from P. C. Tang at National Chung Hsing University. [B]and[C], Grem1 by [GREM] and GDF10 by [GDF]. Here, DA and DB are the pGL3-RARE-luciferase (Addgene #13458) was used as the positive control. diffusion coefficients of A and B, rA, rB and rC are decay rates of A, B and C. Primary remige BGZ pulp cells were co-transfected with the pGL and pRL vectors Parameter s modulates the maximum autocatalytic reaction of A, sA, sB, sC and for 6 h using Lipofectamine 2000 (Life Technologies) and then switched to media sG are saturation coefficients, bA and bB are the basal production of A and B, while containing DMSO or RA for another 1.5 days. The cells were then processed bC modulates the maximum production of C. nG is a Hill coefficient. Simulation with the Promega Dual-Luciferase Reporter Assay System and the luciferase parameters are listed in Supplementary Table 7.

NATURE COMMUNICATIONS | 8:14139 | DOI: 10.1038/ncomms14139 | www.nature.com/naturecommunications 11 ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms14139

Prediction of helical growth angles and estimation of feather tortuosity. RAR, BP, RABP, WNT, GDF, GREM), respectively. In some cases, a molecule can decay when it is both unbound and bound in a complex. Therefore, two decay rates À 1 W y ¼ tan ð4Þ are given: rBP1 and rBP2 for CRABP1 unbound and bound to RA, rR1 and rR2 for the V RA receptor unbound and bound to RA, and rRAi1 and rRAi2 for RAi unbound and Predicted helical growth angle, y, is equal to the inverse tangent of the bound to CRABP1. kon, koff, mon and moff, are on and off rates for complexes propagating wave speed of the activator, W, divided by the feather elongation rate, RAR and RABP. The rate at which RA in complex [RAR] unbinds and binds with V. Wave speed was estimated by calculating the product of the mean wavelength CRABP1 to form [RABP]isja, while the rate at which RA in complex [RABP] and frequency of the travelling activator waves. Wave speed can be thought of as unbinds and binds to RA receptors to form [RAR]isjb. Diffusible extracellular the horizontal component of barb growth as shown in Supplementary Fig. 12a. RA is modelled as entering the cell at rate kp, and b is the proportion of RA lost L from the system in this transition. Regulation of activation and inhibition between l ¼ ð5Þ molecular species are regulated by Hill functions, where k , k , k , k and k are C 1 2 3 4 5 dissociation constants and n , n , n , n and n are Hill coefficients. Some The tortuosity of the tissue, l, is calculated as the length of the shortest path 1 2 3 4 5 maximum production rates, as well as the concentration of CYP26B1 are spatially between two points, L, divided by the length of the chord connecting those two dependent and are defined as follows: points, C. Supplementary Fig. 12c shows examples of calculating the path length between two points in a tissue. Mean tortuosity calculated for different feathers are Where x2[0, 1) shown in Supplementary Table 8. ÂÃ ½CYP ¼ a ÃExp v ðÞsinð2pxÞÀ1 þ B ð16Þ D j cyp cyp CYP DÃ ¼ ð6Þ ÂÃ l2 V ðÞ¼x a ÃExp v ðÞsinðÞÀ 2pðx þ 0:5Þ 1 þ B ð17Þ The apparent diffusivity coefficient, DÃ, of a molecule in a medium is equal to BP bp bp BP its free diffusivity, D, divided by the square of the tortuosity of the medium. V ðÞ¼x a ÃExp½ð v ðÞcosðÞÀ 2pðx þ 0:5Þ 1 18Þ Supplementary Table 8 shows the effect of tortuosity on diffusion coefficients WNT wnt wnt in different feather tissues. A more tortuous medium leads to a lower apparent ÂÃ p : diffusion of a molecule. VGDF ðÞ¼x agdf ÃExp vgdf ðÞcosðÞÀ 2 ðx þ 0 5Þ 1 ð19Þ Here, ai is a scaling coefficient and vi defines the slope of the gradient formed. We solved the system of partial differential equations using a second order finite Multi-module regulatory feather model. In the MRF model the concentration difference scheme in space. For the temporal discretization, the MRF model uses a of extracellular diffusible RA is represented by [RAo], diffusible WNT by [WNT], fourth order Runge–Kutta time integration method while the PB model uses a first diffusible GDF10 by [GDF] and diffusible GREM1 by [GREM]. The concentrations order Euler method. The MRF model is run to steady state. Different spatial of non-diffusible molecules are similarly represented, intracellular RA by [RAi], resolutions have been used to test the code for the order of accuracy of the CRABP1 by [BP], CYP26B1 by [CYP] and RA receptors by [R]. [RAi] bound with numerical method, including N ¼ 200, 400 and 800, where N is the number of [R] forms the complex [RAR], which we use as a RA signal, and [RAi] bound with points for spatial discretization. Similarly, the temporal order of accuracy of the [BP] forms the complex [RABP]. The interactions between RAo, RAi, BP, CYP and approximation has also been tested and studied. R are based on a previous model26, with the WNT, GDF and GREM interactions added based on our experimental result (parameters are listed in Supplementary Table 9). Data availability. The RNA-seq and ChIP-seq data that support the findings of 0 1 this study have been deposited in NCBI GEO database with the accession number @½RA @2½RA 1 GSE86415. o o @ A b ¼ DRAo 2 þ VRAo BRAo þ n1 À ðÞ1 þ kp½RAoþkp½RAi @t @x 1 þ k1=[WNT] ð7Þ References 1. Prum, R. O. & Brush, A. H. The evolutionary origin and diversification of @½RA feathers. Q. Rev. Biol. 77, 261–295 (2002). i ¼k ½RA þr ½þRAR r ½ÀRABP r ½CYP½RA @t p i R2 BP2 RAi 1 i ð8Þ 2. Xu, X. et al. An integrative approach to understanding bird origins. Science 346, À k ½RA Àk ½RA ½þR k ½ÀRAR m ½RA ½þBP m ½RABP 1253293 (2014). p i on i off on i off 3. Chuong, C. M. et al. Adaptation to the sky: defining the feather with @½R integument fossils from mesozoic China and experimental evidence from ¼ V À r ½ÀR k ½RA ½þR k ½ÀRAR ja½RABP ½þR jb½BP ½ðRAR 9Þ molecular laboratories. J. Exp. Zool. B Mol. Dev. Evol. 298, 42–56 (2003). @t R R1 on i off 4. Xu, X., Zheng, X. & You, H. Exceptional dinosaur fossils show ontogenetic @½RAR development of early feathers. Nature 464, 1338–1341 (2010). ¼ kon½RAi½ÀR koff ½þRAR ja½RABP ½ÀR jb½BP ½ÀRAR rR2½ðRAR 10Þ 5. Chiappe, L. M. in Glorified Dinosaurs: The Origin and Early Evolution of Birds @t 263 (John Wiley, 2007). @½BP 6. Xu, X., Zhou, Z. & Prum, R. O. Branched integumental structures in ¼V ðÞÀx r ½þBP r ½CYP ½RABP @t BP BP1 RAi2 ð11Þ Sinornithosaurus and the origin of feathers. Nature 410, 200–204 (2001). 7. Chen, C. F. et al. Development, regeneration, and evolution of feathers. Annu. À m ½RA ½þBP m ½þRABP ja½RABP ½ÀR jb½BP ½RAR on i off Rev. Anim. Biosci. 3, 169–195 (2015). @½RABP 8. Chuong, C. M., Chodankar, R., Widelitz, R. B. & Jiang, T. X. Evo-devo of ¼Àr ½CYP½þRABP m ½RA ½BP feathers and scales: building complex epithelial appendages. Curr. Opin. Genet. @ RAi 2 on i t ð12Þ Dev. 10, 449–456 (2000). À moff ½ÀRABP ja½RABP ½þR jb½BP ½ÀRAR rBP2½RABP 9. Feduccia, A. & Tordoff, H. B. Feathers of archaeopteryx: asymmetric vanes 0 1 indicate aerodynamic function. Science 203, 1021–1022 (1979). 2 @½WNT @ ½WNT @ 1 A 10. Norberg, R. A. in The Beginnings of Birds (eds Hecht, M. K., Ostrom, J. H., ¼ DWNT 2 þ VWNT ðÞx BWNT þ n2 À rWNT ½WNT @t @x 1 þ k2=[GDF] Viohl, G. & Wellnhofer, P.) 303–313 (Freunde des Jura-Museums, 1985). 11. Norberg, U. M. in The Beginnings of Birds (eds Hecht, M. K., Ostrom, J. H., ð13Þ Viohl, G. & Wellnhofer, P.) 293–302 (Freunde des Jura-Museums, 1985). 0 1 12. Paul, G. S. in Dinosaurs of the Air: the Evolution and Loss of Flight in Dinosaurs 2 and Birds 460 (Johns Hopkins University Press, 2002). @½GDF @ ½GDF @ 1 A ¼ DGDF þ VGDF ðÞx BGDF þ n À rGDF ½GDF 13. Pennycuick, C. J. in Modelling the Flying Bird 480 (Academic Press, 2008). @t @x2 k = 3 1 þ 3 [RAR] 14. Dyke, G. et al. Aerodynamic performance of the feathered dinosaur ð14Þ Microraptor and the evolution of feathered flight. Nat. Commun. 4, 2489 (2013). 15. Scott, S. D. & McFarland, C. in Bird Feathers: A Guide to North American @½GREM @2½GREM Species (Stackpole Books, 2010). ¼ DGREM 16. Lucas, P. & Stettenheim, A. in Avian Anatomy Integument. USDA Agriculture @t 0 @x2 1 Handbook Vol. 362 (1972). @ 1 A 17. Yu, M., Wu, P., Widelitz, R. B. & Chuong, C. M. The morphogenesis of þ VGREM BGREM þ n4 n5 À rGREM ½GREM 1 þ k4=[RAR] þ k5=[WNT] feathers. Nature 420, 308–312 (2002). 18. Harris, M. P., Williamson, S., Fallon, J. F., Meinhardt, H. & Prum, R. O. ð15Þ Molecular evidence for an activator-inhibitor mechanism in development of Here, Vi, Bi, Di and ri are the maximum production rates, basal production embryonic feather branching. Proc. Natl Acad. Sci. USA 102, 11734–11739 rates, diffusion coefficients and the decay rates of molecule type i(¼ RAo, RAi, R, (2005).

12 NATURE COMMUNICATIONS | 8:14139 | DOI: 10.1038/ncomms14139 | www.nature.com/naturecommunications NATURE COMMUNICATIONS | DOI: 10.1038/ncomms14139 ARTICLE

19. Yue, Z., Jiang, T. X., Widelitz, R. B. & Chuong, C. M. Mapping stem cell 42. Nakamura, M. et al. Control of pelage hair follicle development and cycling activities in the feather follicle. Nature 438, 1026–1029 (2005). by complex interactions between follistatin and activin. FASEB J. 17, 497–499 20. Yue, Z., Jiang, T. X., Widelitz, R. B. & Chuong, C. M. Wnt3a gradient converts (2003). radial to bilateral feather symmetry via topological arrangement of epithelia. 43. Li, A. et al. Deciphering principles of morphogenesis from temporal and spatial Proc. Natl Acad. Sci. USA 103, 951–955 (2006). patterns on the integument. Dev. Dyn. 244, 905–920 (2015). 21. Prum, R. O. & Williamson, S. Theory of the growth and evolution of feather 44. Rada-Iglesias, A. et al. A unique chromatin signature uncovers early shape. J. Exp. Zool. 291, 30–57 (2001). developmental enhancers in humans. Nature 470, 279–283 (2011). 22. Ting-Berreth, S. A. & Chuong, C. M. Sonic Hedgehog in feather morpho- 45. Jiang, T. X., Stott, S., Widelitz, R. B. & Chuong, C. M. in Molecular Basis genesis: induction of mesenchymal condensation and association with cell of Epithelial Appendage Morphogenesis (ed. Chuong, C. M.) 359–408 death. Dev. Dyn. 207, 157–170 (1996). (Landes Bioscience, 1998). 23. Feo, T. J. & Prum, R. O. Theoretical morphology and development of flight 46. Zhang, Z., Lan, Y., Chai, Y. & Jiang, R. Antagonistic actions of Msx1 and Osr2 feather vane asymmetry with experimental tests in parrots. J. Exp. Zool. Part B: pattern mammalian teeth into a single row. Science 323, 1232–1234 (2009). Mol. Dev. Evol. 322, 240–255 (2014). 47. Ng, C. S. et al. The chicken frizzle feather is due to an alpha-keratin (KRT75) 24. Guenther, M. G., Levine, S. S., Boyer, L. A., Jaenisch, R. & Young, R. A. mutation that causes a defective rachis. PLoS Genet. 8, e1002748 (2012). A chromatin landmark and transcription initiation at most promoters in 48. Preibisch, S., Saalfeld, S. & Tomancak, P. Globally optimal stitching of tiled 3D human cells. Cell 130, 77–88 (2007). microscopic image acquisitions. Bioinformatics 25, 1463–1465 (2009). 25. Rhinn, M. & Dolle, P. Retinoic acid signalling during development. 49. Thevenaz, P. & Unser, M. User-friendly semiautomated assembly of accurate Development 139, 843–858 (2012). image mosaics in microscopy. Microsc. Res. Tech. 70, 135–146 (2007). 26. Cai, A. Q. et al. Cellular retinoic acid-binding proteins are essential for hindbrain patterning and signal robustness in zebrafish. Development 139, Acknowledgements 2150–2155 (2012). 27. Donovan, M., Olofsson, B., Gustafson, A. L., Dencker, L. & Eriksson, U. The This research was supported by the US NIH Grants AR47364 and AR60306. A.L. was cellular retinoic acid binding proteins. J. Steroid Biochem. Mol. Biol. 53, supported by CIRM predoctoral and postdoctoral fellowship. Q.N. is supported by 459–465 (1995). P50GM76516, R01GM107264, R01NS095355 and NSF DMS1562176. S.F. is supported 28. Capdevila, J., Tsukui, T., Rodriquez Esteban, C., Zappavigna, V. & by NSF Graduate Research Fellowship DGE-1321846 and NRSA EB009418. We thank Izpisua Belmonte, J. C. Control of vertebrate limb outgrowth by the proximal NL Nerurkar from C Tabin’s lab for providing the pSMAD staining protocol. We thank factor Meis2 and distal antagonism of BMPs by Gremlin. Mol. Cell 4, 839–849 the Cell and Tissue Imaging Core, USC Research Center for Liver Disease for assistance (1999). in imaging (NIH P30DK048522); USC Epigenome Center for sequencing; and Y. Chen 29. Damm, K., Heyman, R. A., Umesono, K. & Evans, R. M. Functional inhibition and M. Li of the USC Norris Medical Library Bioinformatics Service for assistance in of retinoic acid response by dominant negative retinoic acid receptor mutants. sequencing data analysis. Proc. Natl Acad. Sci. USA 90, 2989–2993 (1993). 30. Kurokawa, R. et al. Polarity-specific activities of retinoic acid receptors Author contributions determined by a co-repressor. Nature 377, 451–454 (1995). C.-M.C and A.L. designed the research. A.L., T.-X.J. and P.W. performed the biological 31. Yue, Z., Jiang, T. X., Wu, P., Widelitz, R. B. & Chuong, C. M. Sprouty/FGF experiments. C.-M.C., A.L., R.W. and S.F. analysed the biological data. S.F. and Q.N. signalling regulates the proximal-distal feather morphology and the size of prepared the mathematical models and conducted simulations. All authors contributed dermal papillae. Dev. Biol. 372, 45–54 (2012). to the writing and editing of the manuscript. 32. Vermot, J. et al. Retinoic acid controls the bilateral symmetry of somite formation in the mouse embryo. Science 308, 563–566 (2005). 33. Mou, C. et al. Cryptic patterning of avian skin confers a developmental facility Additional information for loss of neck feathering. PLoS Biol. 9, e1001028 (2011). Supplementary Information accompanies this paper at http://www.nature.com/ 34. Sheth, R. et al. Decoupling the function of Hox and Shh in developing limb naturecommunications reveals multiple inputs of Hox genes on limb growth. Development 140, 2130–2138 (2013). Competing financial interests: The authors declare no competing financial interests. 35. Nie, X., Xu, J., El-Hashash, A. & Xu, P. X. Six1 regulates Grem1 expression in the metanephric mesenchyme to initiate branching morphogenesis. Dev. Biol. Reprints and permission information is available online at http://npg.nature.com/ 352, 141–151 (2011). reprintsandpermissions/ 36. Farin, H. F. et al. Tbx2 terminates shh/fgf signalling in the developing How to cite this article: Li, A. et al. Diverse feather shape evolution enabled by mouse limb bud by direct repression of gremlin1. PLoS Genet. 9, e1003467 coupling anisotropic signalling modules with self-organizing branching programme. (2013). Nat. Commun. 8, 14139 doi: 10.1038/ncomms14139 (2017). 37. Feo, T. J., Field, D. J. & Prum, R. O. Barb geometry of asymmetrical feathers reveals a transitional morphology in the evolution of avian flight. Proc. R. Soc. Publisher’s note: Springer Nature remains neutral with regard to jurisdictional claims in Lond. B: Biol. Sci. 282, 20142864 (2015). published maps and institutional affiliations. 38. Horton, W. & Hassell, J. R. Independence of cell shape and loss of cartilage matrix production during retinoic acid treatment of cultured chondrocytes. Dev. Biol. 115, 392–397 (1986). This work is licensed under a Creative Commons Attribution 4.0 39. Brown, P. D. & Benya, P. D. Alterations in chondrocyte cytoskeletal International License. The images or other third party material in this architecture during phenotypic modulation by retinoic acid and article are included in the article’s Creative Commons license, unless indicated otherwise dihydrocytochalasin B-induced reexpression. J. Cell Biol. 106, 171–179 (1988). in the credit line; if the material is not included under the Creative Commons license, 40. Li, Y. & Dudley, A. T. Noncanonical frizzled signalling regulates cell polarity of users will need to obtain permission from the license holder to reproduce the material. growth plate chondrocytes. Development 136, 1083–1092 (2009). To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/ 41. Seifert, J. R. & Mlodzik, M. Frizzled/PCP signalling: a conserved mechanism regulating cell polarity and directed motility. Nat. Rev. Genet. 8, 126–138 (2007). r The Author(s) 2017

NATURE COMMUNICATIONS | 8:14139 | DOI: 10.1038/ncomms14139 | www.nature.com/naturecommunications 13