DOCSLIB.ORG

The Role of Ionotropic Glutamate Receptors in Childhood Neurodevelopmental Disorders: Autism Spectrum Disorders and Fragile X Syndrome

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Role of Ionotropic Glutamate Receptors in Childhood Neurodevelopmental Disorders: Autism Spectrum Disorders and Fragile X Syndrome Send Orders for Reprints to [email protected] Current Neuropharmacology, 2014, 12, 71-98 71 The Role of Ionotropic Glutamate Receptors in Childhood Neurodevelopmental Disorders: Autism Spectrum Disorders and Fragile X Syndrome Genoveva Uzunova1,*, Eric Hollander1 and Jason Shepherd2 1Autism and Obsessive Compulsive Spectrum Program, Department of Psychiatry, Montefiore Medical Center, Albert Einstein College of Medicine, 111 East 210th St, Bronx, New York 10467-2490; 2Department of Neurobiology and Anatomy, University of Utah School of Medicine, 531A Wintrobe, 20N 1900 E, Salt Lake City, Utah 84132 Abstract: Autism spectrum disorder (ASD) and Fragile X syndrome (FXS) are relatively common childhood neurodevelopmental disorders with increasing incidence in recent years. They are currently accepted as disorders of the synapse with alterations in different forms of synaptic communication and neuronal network connectivity. The major excitatory neurotransmitter system in brain, the glutamatergic system, is implicated in learning and memory, synaptic plasticity, neuronal development. While much attention is attributed to the role of metabotropic glutamate receptors in ASD and FXS, studies indicate that the ionotropic glutamate receptors (iGluRs) and their regulatory proteins are also altered in several brain regions. Role of iGluRs in the neurobiology of ASD and FXS is supported by a weight of evidence that ranges from human genetics to in vitro cultured neurons. In this review we will discuss clinical, molecular, cellular and functional changes in NMDA, AMPA and kainate receptors and the synaptic proteins that regulate them in the context of ASD and FXS. We will also discuss the significance for the development of translational biomarkers and treatments for the core symptoms of ASD and FXS. Keywords: AMPA receptor, Arc, autism spectrum disorder, Fragile X syndrome, GRIP1/2, kainate receptor, MAP1B, memantine, metabotropic glutamate receptor, neuroligin, NMDA receptor. I. INTRODUCTION behavioral symptoms in a fraction of FXS subjects (7 from 30) who have methylation of the FMR1 gene promoter and no The mechanisms that underlie the learning and memory, detectable FMR1 messenger RNA, but not in individuals cognitive and social deficits associated with autism spectrum with partial promoter methylation. In addition to FXS, there disorders (ASD) and Fragile X syndrome (FXS) are complex are many other forms of ASD which have varied causes and and depend to a large extent on glutamate receptors. neurobiology. Interestingly, different forms of ASD are Glutamate receptors are comprised of ionotropic glutamate associated with either hypo- or hyperfunction of the receptors (iGluRs) and metabotropic glutamate receptors glutamatergic system despite presenting with similar (mGluRs). Findings from various experimental systems symptoms, providing further evidence for involvement of implicate iGluR dysfunction in ASDs and FXS. They include different mechanisms and receptors. Early studies indicated human genetic studies, clinical drug trials, human neuro- that direct targeting of NMDA receptors with pharmacologic imaging, and postmortem brain studies, animal models of antagonists was associated with undesired side effects on ASD and FXS, and in vitro cell cultures, which will be cognition and neurotoxicity. However, it may be possible to discussed in the present review. The metabotropic glutamate target the functions of iGluRs in synaptic plasticity and ASD receptors (mGluRs) are modulators of brain function and by modulating regulating proteins and/or signaling synaptic plasticity and have recently been shown to play a pathways, with less potent or more specific NMDAR significant role in syndromic forms of ASD such as FXS antagonists, and with pharmacologic drugs targeting AMPA through enhanced protein synthesis-dependent synaptic or kainate receptors. The purpose of this review is to plasticity and perhaps peripheral mechanisms such as describe key studies that implicate iGluRs and their modulation of gastrointestinal functions. Therefore, mGluRs interacting proteins and signaling pathways in ASD and have been explored as therapeutic targets in FXS. However, FXS. Moreover, we will highlight mechanisms that may be clinical trials with group I mGluR (mGlu5) antagonists show important for development of new neuropharmacological that these drugs are not effective in all FXS subjects. For treatments. example, the Novartis mGlu5 antagonist AFQ056 improves II. ASD AND FXS: DEFINITION, PREVALENCE, CAUSES. NEUROPHARMACOLOGICAL TREATMENTS *Address correspondence to this author at the Autism and Obsessive ASDs are neurodevelopmental disorders appearing first Compulsive Spectrum Program, Department of Psychiatry, Montefiore Medical Center, Albert Einstein College of Medicine, 111 East 210th St, in early childhood usually before 3 years of age. Due to the Bronx, New York 10467-2490; Tel: 847-975-0364; great heterogeneity in the causes and presentation, the E-mail: [email protected] umbrella term ASD is accepted in the Diagnostic and 1875-6190/14 $58.00+.00 ©2014 Bentham Science Publishers 72 Current Neuropharmacology, 2014, Vol. 12, No. 1 Uzunova et al. Statistic Manual of Mental Disorders- Fifth Edition (DSM5) environmental factors may be stress and toxins. The precise [1]. ASDs are characterized with impairments in two core causal role of these factors, however, is heavily debated. symptoms domains: social/communication deficits and Here, we restrict our review to role of iGluRs in ASD. occurrence of repetitive behaviors, the symptoms being in a The treatments of ASD and FXS are complex and continuum from mild to severe in core and associated symptom domains. Within the social/communication domain depend on the presenting symptoms. They are a combination of applied behavioral analysis, medications, occupational there may be problems in social-emotional reciprocity, non- therapy, physical therapy and speech-language therapy verbal communication behaviors, and developing and (PubMed Health Information). Currently there are very few maintaining relationships. Within the area of restricted/ medications approved for treatment of ASD, none of which repetitive behaviors, interests or activities there may be target the core symptoms. Two of the atypical antipsychotic stereotyped, repetitive speech or motor movements, excessive adherence to routines or resistance to change, drugs risperidone and aripiprazole are approved by the US Food and Drug Administration for treatment of aggression highly restricted, fixated interests, hypo- or hyper-reactivity and irritability in children ages 5-16 with autism. These to sensory input. There may be varying degree of intellectual drugs are approved for treatment of schizophrenia which is disability, accompanying symptoms such as seizures, also a neurodevelopmental disorder and has common features anxiety, mood swings, aggression, sleep problems, attention with ASD such as social deficits and neurobiological problems, hyperactivity, common with other psychiatric disorders, and gastrointestinal complaints [4]. ASD is changes involving NMDA, GABA and dopamine receptors. Other medications used in clinical practice for treatment of relatively common occurring in 1 in 88 individuals, with a patients with ASD are serotonin reuptake inhibitors such as reported increase in incidence in recent years [2, 3]. ASD is fluoxetine approved for treatment of depression and obsessive- about 4 times more common in boys than in girls. It is compulsive disorder (OCD) in children 7 years and older, possible that the increased incidence is due to an divalproex sodium used to treat manic symptoms and ascertainment bias associated with greater awareness and more systematic screening of ASD, and perhaps also with epilepsy, and the psychostimulant drug methylphenidate used to treat attention-deficit hyperactivity disorder (ADHD). changes in the diagnostic criteria [4]. There are several reviews on the pharmacological treatments FXS is a common monogenic cause of autism which has of ASD and FXS for further reading [37-41]. been invaluable in understanding the neurobiology of ASD Due to research advances in understanding the and development of “targeted” drug treatments for the core neurobiology of FXS a new group of drugs which are symptoms [5-8]. FXS is caused by CGG repeats in the 5’ untranslated (UTR) region of the FMR1 gene which results antagonists of group I metabotropic glutamate receptors (gp I mGluR) are developed and have shown therapeutic efficacy in varying degree of loss of the Fragile X Mental Retardation in human FXS clinical trials [42, 43]. Importantly, studies in Protein (FMRP), an RNA binding protein that regulates the animal models show that drugs which reduce gp I mGluR- synthesis and trafficking of many brain RNAs involved in signaling in brain target the core symptoms of ASD [44-46]. synaptic plasticity and learning and memory [9]. Besides Pharmacological drug enhancement of GABAergic FXS, monogenic forms of ASD are tuberous sclerosis complex neurotransmission has also shown potential to improve (TSC) [10], Rett syndrome [11, 12], neurofibromatosis social function in FXS clinical trial [47]. In addition to mGlu (NF1)[13], Shank 2 and 3 deletion syndromes [14, 15]. and GABA receptors, there are pathological changes in FXS Interestingly, recent study finds that genes causing and ASD involving iGluRs. In some patients it may be more syndromic forms of ASD such as TSC1/2 and SHANK3 can beneficial to target iGluRs
Load more

Recommended publications
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Expression Profiling of Ion Channel Genes Predicts Clinical Outcome in Breast Cancer
    UCSF UC San Francisco Previously Published Works Title Expression profiling of ion channel genes predicts clinical outcome in breast cancer Permalink https://escholarship.org/uc/item/1zq9j4nw Journal Molecular Cancer, 12(1) ISSN 1476-4598 Authors Ko, Jae-Hong Ko, Eun A Gu, Wanjun et al. Publication Date 2013-09-22 DOI http://dx.doi.org/10.1186/1476-4598-12-106 Peer reviewed eScholarship.org Powered by the California Digital Library University of California Ko et al. Molecular Cancer 2013, 12:106 http://www.molecular-cancer.com/content/12/1/106 RESEARCH Open Access Expression profiling of ion channel genes predicts clinical outcome in breast cancer Jae-Hong Ko1, Eun A Ko2, Wanjun Gu3, Inja Lim1, Hyoweon Bang1* and Tong Zhou4,5* Abstract Background: Ion channels play a critical role in a wide variety of biological processes, including the development of human cancer. However, the overall impact of ion channels on tumorigenicity in breast cancer remains controversial. Methods: We conduct microarray meta-analysis on 280 ion channel genes. We identify candidate ion channels that are implicated in breast cancer based on gene expression profiling. We test the relationship between the expression of ion channel genes and p53 mutation status, ER status, and histological tumor grade in the discovery cohort. A molecular signature consisting of ion channel genes (IC30) is identified by Spearman’s rank correlation test conducted between tumor grade and gene expression. A risk scoring system is developed based on IC30. We test the prognostic power of IC30 in the discovery and seven validation cohorts by both Cox proportional hazard regression and log-rank test.
    [Show full text]
  • Supplementary Material
    Supplementary Material Table S1: Significant downregulated KEGGs pathways identified by DAVID following exposure to five cinnamon- based phenylpropanoids (p < 0.05). p-value Term: Genes (Benjamini) Cytokine-cytokine receptor interaction: FASLG, TNFSF14, CXCL11, IL11, FLT3LG, CCL3L1, CCL3L3, CXCR6, XCR1, 2.43 × 105 RTEL1, CSF2RA, TNFRSF17, TNFRSF14, CCNL2, VEGFB, AMH, TNFRSF10B, INHBE, IFNB1, CCR3, VEGFA, CCR2, IL12A, CCL1, CCL3, CXCL5, TNFRSF25, CCR1, CSF1, CX3CL1, CCL7, CCL24, TNFRSF1B, IL12RB1, CCL21, FIGF, EPO, IL4, IL18R1, FLT1, TGFBR1, EDA2R, HGF, TNFSF8, KDR, LEP, GH2, CCL13, EPOR, XCL1, IFNA16, XCL2 Neuroactive ligand-receptor interaction: OPRM1, THRA, GRIK1, DRD2, GRIK2, TACR2, TACR1, GABRB1, LPAR4, 9.68 × 105 GRIK5, FPR1, PRSS1, GNRHR, FPR2, EDNRA, AGTR2, LTB4R, PRSS2, CNR1, S1PR4, CALCRL, TAAR5, GABRE, PTGER1, GABRG3, C5AR1, PTGER3, PTGER4, GABRA6, GABRA5, GRM1, PLG, LEP, CRHR1, GH2, GRM3, SSTR2, Chlorogenic acid Chlorogenic CHRM3, GRIA1, MC2R, P2RX2, TBXA2R, GHSR, HTR2C, TSHR, LHB, GLP1R, OPRD1 Hematopoietic cell lineage: IL4, CR1, CD8B, CSF1, FCER2, GYPA, ITGA2, IL11, GP9, FLT3LG, CD38, CD19, DNTT, 9.29 × 104 GP1BB, CD22, EPOR, CSF2RA, CD14, THPO, EPO, HLA-DRA, ITGA2B Cytokine-cytokine receptor interaction: IL6ST, IL21R, IL19, TNFSF15, CXCR3, IL15, CXCL11, TGFB1, IL11, FLT3LG, CXCL10, CCR10, XCR1, RTEL1, CSF2RA, IL21, CCNL2, VEGFB, CCR8, AMH, TNFRSF10C, IFNB1, PDGFRA, EDA, CXCL5, TNFRSF25, CSF1, IFNW1, CNTFR, CX3CL1, CCL5, TNFRSF4, CCL4, CCL27, CCL24, CCL25, CCL23, IFNA6, IFNA5, FIGF, EPO, AMHR2, IL2RA, FLT4, TGFBR2, EDA2R,
    [Show full text]
  • Ion Channels
    UC Davis UC Davis Previously Published Works Title THE CONCISE GUIDE TO PHARMACOLOGY 2019/20: Ion channels. Permalink https://escholarship.org/uc/item/1442g5hg Journal British journal of pharmacology, 176 Suppl 1(S1) ISSN 0007-1188 Authors Alexander, Stephen PH Mathie, Alistair Peters, John A et al. Publication Date 2019-12-01 DOI 10.1111/bph.14749 License https://creativecommons.org/licenses/by/4.0/ 4.0 Peer reviewed eScholarship.org Powered by the California Digital Library University of California S.P.H. Alexander et al. The Concise Guide to PHARMACOLOGY 2019/20: Ion channels. British Journal of Pharmacology (2019) 176, S142–S228 THE CONCISE GUIDE TO PHARMACOLOGY 2019/20: Ion channels Stephen PH Alexander1 , Alistair Mathie2 ,JohnAPeters3 , Emma L Veale2 , Jörg Striessnig4 , Eamonn Kelly5, Jane F Armstrong6 , Elena Faccenda6 ,SimonDHarding6 ,AdamJPawson6 , Joanna L Sharman6 , Christopher Southan6 , Jamie A Davies6 and CGTP Collaborators 1School of Life Sciences, University of Nottingham Medical School, Nottingham, NG7 2UH, UK 2Medway School of Pharmacy, The Universities of Greenwich and Kent at Medway, Anson Building, Central Avenue, Chatham Maritime, Chatham, Kent, ME4 4TB, UK 3Neuroscience Division, Medical Education Institute, Ninewells Hospital and Medical School, University of Dundee, Dundee, DD1 9SY, UK 4Pharmacology and Toxicology, Institute of Pharmacy, University of Innsbruck, A-6020 Innsbruck, Austria 5School of Physiology, Pharmacology and Neuroscience, University of Bristol, Bristol, BS8 1TD, UK 6Centre for Discovery Brain Science, University of Edinburgh, Edinburgh, EH8 9XD, UK Abstract The Concise Guide to PHARMACOLOGY 2019/20 is the fourth in this series of biennial publications. The Concise Guide provides concise overviews of the key properties of nearly 1800 human drug targets with an emphasis on selective pharmacology (where available), plus links to the open access knowledgebase source of drug targets and their ligands (www.guidetopharmacology.org), which provides more detailed views of target and ligand properties.
    [Show full text]
  • Structural Analysis of Pathogenic Missense Mutations in GABRA2 and Identification of a Novel De Novo Variant in the Desensitization Gate
    Received: 22 October 2019 | Revised: 29 November 2019 | Accepted: 10 December 2019 DOI: 10.1002/mgg3.1106 ORIGINAL ARTICLE Structural analysis of pathogenic missense mutations in GABRA2 and identification of a novel de novo variant in the desensitization gate Alba Sanchis-Juan1,2 | Marcia A. Hasenahuer3,4 | James A. Baker3 | Amy McTague5 | Katy Barwick5 | Manju A. Kurian5 | Sofia T. Duarte6 | NIHR BioResource | Keren J. Carss1,2 | Janet Thornton3 | F. Lucy Raymond2,4 1Department of Haematology, University of Cambridge, NHS Blood and Transplant Abstract Centre, Cambridge, UK Background: Cys-loop receptors control neuronal excitability in the brain and their 2NIHR BioResource, Cambridge dysfunction results in numerous neurological disorders. Recently, six missense vari- University Hospitals NHS Foundation ants in GABRA2, a member of this family, have been associated with early infantile Trust, Cambridge Biomedical Campus, Cambridge, UK epileptic encephalopathy (EIEE). We identified a novel de novo missense variant 3European Molecular Biology Laboratory, in GABRA2 in a patient with EIEE and performed protein structural analysis of the European Bioinformatics Institute, seven variants. Wellcome Genome Campus, Hinxton, . Cambridge, UK Methods: The novel variant was identified by trio whole-genome sequencing We 4Department of Medical Genetics, performed protein structural analysis of the seven variants, and compared them to Cambridge Institute for Medical Research, previously reported pathogenic mutations at equivalent positions in other Cys-loop University of Cambridge, Cambridge, UK receptors. Additionally, we studied the distribution of disease-associated variants in 5Developmental Neurosciences, Great the transmembrane helices of these proteins. Ormond Street Institute of Child Health, University College London, London, UK Results: The seven variants are in the transmembrane domain, either close to the de- 6Hospital Dona Estefânia, Centro Hospitalar sensitization gate, the activation gate, or in inter-subunit interfaces.
    [Show full text]
  • Novel Missense Mutations in the Glycine Receptor Β Subunit Gene (GLRB) in Startle Disease
    *Manuscript Click here to view linked References Novel missense mutations in the glycine receptor β subunit gene (GLRB) in startle disease Victoria M. Jamesa,bº, Anna Bodecº, Seo-Kyung Chungd,e, Jennifer L. Gilla, Maartje Nielsenf, Frances M. Cowang, Mihailo Vujicg, Rhys H. Thomasd,e, Mark I. Reesd,e, Kirsten Harveya, Angelo Keramidasc, Maya Topfb, Ieke Ginjaarf, Joseph W. Lynchc,i and Robert J. Harveya* aDepartment of Pharmacology, UCL School of Pharmacy, 29-39 Brunswick Square, London WC1N 1AX, United Kingdom; bInstitute for Structural and Molecular Biology, Department of Biological Sciences, Birkbeck College, London WC1E 7HX, United Kingdom; cQueensland Brain Institute, The University of Queensland, Brisbane, QLD 4072 Australia; dInstitute of Life Science, College of Medicine, Swansea University, Swansea SA2 8PP, United Kingdom; eWales Epilepsy Research Network, College of Medicine, Swansea University, Swansea SA2 8PP, United Kingdom; fCenter for Human and Clinical Genetics, Leiden University Medical Center, Einthovenweg 20, 2333 ZC Leiden, The Netherlands; gDepartment of Paediatrics, Imperial College London, Hammersmith Hospital Campus, Du Cane Road, London W12 0HS, United Kingdom; hDepartment of Clinical Genetics, Sahlgrenska University Hospital, SE- 41345, Gothenburg, Sweden; iSchool of Biomedical Sciences, The University of Queensland, Brisbane, QLD 4072, Australia. Short title: GlyR β subunit mutations in startle disease ºThese authors contributed equally to this work *Corresponding author: Robert J Harvey, Department of Pharmacology, UCL School of Pharmacy, 29-39 Brunswick Square, London WC1N 1AX, UK. Telephone: +44 207 753 5930; E-mail: [email protected] 1 Abstract Startle disease is a rare, potentially fatal neuromotor disorder characterized by exaggerated startle reflexes and hypertonia in response to sudden unexpected auditory, visual or tactile stimuli.
    [Show full text]
  • Systematic Elucidation of Neuron-Astrocyte Interaction in Models of Amyotrophic Lateral Sclerosis Using Multi-Modal Integrated Bioinformatics Workflow
    ARTICLE https://doi.org/10.1038/s41467-020-19177-y OPEN Systematic elucidation of neuron-astrocyte interaction in models of amyotrophic lateral sclerosis using multi-modal integrated bioinformatics workflow Vartika Mishra et al.# 1234567890():,; Cell-to-cell communications are critical determinants of pathophysiological phenotypes, but methodologies for their systematic elucidation are lacking. Herein, we propose an approach for the Systematic Elucidation and Assessment of Regulatory Cell-to-cell Interaction Net- works (SEARCHIN) to identify ligand-mediated interactions between distinct cellular com- partments. To test this approach, we selected a model of amyotrophic lateral sclerosis (ALS), in which astrocytes expressing mutant superoxide dismutase-1 (mutSOD1) kill wild-type motor neurons (MNs) by an unknown mechanism. Our integrative analysis that combines proteomics and regulatory network analysis infers the interaction between astrocyte-released amyloid precursor protein (APP) and death receptor-6 (DR6) on MNs as the top predicted ligand-receptor pair. The inferred deleterious role of APP and DR6 is confirmed in vitro in models of ALS. Moreover, the DR6 knockdown in MNs of transgenic mutSOD1 mice attenuates the ALS-like phenotype. Our results support the usefulness of integrative, systems biology approach to gain insights into complex neurobiological disease processes as in ALS and posit that the proposed methodology is not restricted to this biological context and could be used in a variety of other non-cell-autonomous communication
    [Show full text]
  • A Glycine-Insulin Autocrine Feedback Loop Enhances Insulin Secretion
    Page 1 of 41 Diabetes Yan-Do et al. A glycine-insulin autocrine feedback loop enhances insulin secretion from human β-cells and is impaired in type 2 diabetes Richard Yan-Do, Eric Duong, Jocelyn E. Manning Fox, Xiaoqing Dai, Kunimasa Suzuki, Shara Khan, Austin Bautista, Mourad Ferdaoussi, James Lyon, Xichen Wu, Stephen Cheley#, Patrick E. MacDonald*, Matthias Braun# Department of Pharmacology and Alberta Diabetes Institute, University of Alberta, Edmonton, Canada, T6G 2E1 #Deceased Running title: Glycine enhances insulin secretion from β-cells Words: 3991 Figures: 6 *Address correspondence to Dr. Patrick MacDonald, Alberta Diabetes Institute, 6-126 Li Ka Shing Centre for Health Research Innovation, Edmonton, Alberta, T6G 2E1, Canada; e-mail: [email protected]; web: www.bcell.org; phone: 780 492 8063 1 Diabetes Publish Ahead of Print, published online May 3, 2016 Diabetes Page 2 of 41 Yan-Do et al. Abstract The secretion of insulin from pancreatic islet β-cells is critical for glucose homeostasis. Disrupted insulin secretion underlies almost all forms of diabetes including the most common form, type 2 diabetes (T2D). The control of insulin secretion is complex and impacted by circulating nutrients, neuronal inputs, and local signaling. In the present study we examined the contribution of glycine, an amino acid and neurotransmitter that activates ligand-gated Cl- currents, to insulin secretion from islets of both non-diabetic (ND) and T2D human donors. We find that human islet β-cells express glycine receptors (GlyR), notably the GlyRα1 subunit, and the glycine transporter (GlyT) isoforms GlyT1 and GlyT2. β-cells exhibit significant glycine- induced Cl- currents that promote membrane depolarization, Ca2+ entry, and insulin secretion from ND β-cells.
    [Show full text]
  • Gene Expression Changes in Glutamate and GABA-A Receptors
    HHS Public Access Author manuscript Author ManuscriptAuthor Manuscript Author Alcohol Manuscript Author Clin Exp Res. Author Manuscript Author manuscript; available in PMC 2017 May 01. Published in final edited form as: Alcohol Clin Exp Res. 2016 May ; 40(5): 955–968. doi:10.1111/acer.13056. Gene expression changes in glutamate and GABA-A receptors, neuropeptides, ion channels and cholesterol synthesis in the periaqueductal gray following binge-like alcohol drinking by adolescent alcohol-preferring (P) rats Jeanette N. McClinticka,b, William J. McBridec, Richard L. Bellc, Zheng-Ming Dingc, Yunlong Liud, Xiaoling Xueia,b, and Howard J. Edenberga,b,d,* aDepartment of Biochemistry & Molecular Biology, Indiana University School of Medicine, Indianapolis, IN 46202, United States bCenter for Medical Genomics, Indiana University School of Medicine, Indianapolis, IN 46202, United States cInstitute of Psychiatric Research, Department of Psychiatry, Indiana University School of Medicine, Indianapolis, IN 46202, United States dDepartment of Medical & Molecular Genetics, Indiana University School of Medicine, Indianapolis, IN 46202, United States Abstract Background—Binge-drinking of alcohol during adolescence is a serious public health concern with long-term consequences, including increased pain, fear and anxiety. The periaqueductal gray (PAG) is involved in processing pain, fear and anxiety. The effects of adolescent binge drinking on gene expression in this region have yet to be studied. Methods—Male adolescent P (alcohol preferring) rats were exposed to repeated binge-drinking (three 1-h sessions/day during the dark-cycle, 5 days/week for 3 weeks starting at 28 days of age; ethanol intakes of 2.5 – 3 g/kg/session). We used RNA sequencing to assess the effects of ethanol intake on gene expression.
    [Show full text]
  • GSE50161, (C) GSE66354, (D) GSE74195 and (E) GSE86574
    Figure S1. Boxplots of normalized samples in five datasets. (A) GSE25604, (B) GSE50161, (C) GSE66354, (D) GSE74195 and (E) GSE86574. The x‑axes indicate samples, and the y‑axes represent the expression of genes. Figure S2. Volanco plots of DEGs in five datasets. (A) GSE25604, (B) GSE50161, (C) GSE66354, (D) GSE74195 and (E) GSE86574. Red nodes represent upregulated DEGs and green nodes indicate downregulated DEGs. Cut‑off criteria were P<0.05 and |log2 FC|>1. DEGs, differentially expressed genes; FC, fold change; adj.P.Val, adjusted P‑value. Figure S3. Transcription factor‑gene regulatory network constructed using the Cytoscape iRegulion plug‑in. Table SI. Primer sequences for reverse transcription‑quantitative polymerase chain reaction. Genes Sequences hsa‑miR‑124 F: 5'‑ACACTCCAGCTGGGCAGCAGCAATTCATGTTT‑3' R: 5'‑CTCAACTGGTGTCGTGGA‑3' hsa‑miR‑330‑3p F: 5'‑CATGAATTCACTCTCCCCGTTTCTCCCTCTGC‑3' R: 5'‑CCTGCGGCCGCGAGCCGCCCTGTTTGTCTGAG‑3' hsa‑miR‑34a‑5p F: 5'‑TGGCAGTGTCTTAGCTGGTTGT‑3' R: 5'‑GCGAGCACAGAATTAATACGAC‑3' hsa‑miR‑449a F: 5'‑TGCGGTGGCAGTGTATTGTTAGC‑3' R: 5'‑CCAGTGCAGGGTCCGAGGT‑3' CD44 F: 5'‑CGGACACCATGGACAAGTTT‑3' R: 5'‑TGTCAATCCAGTTTCAGCATCA‑3' PCNA F: 5'‑GAACTGGTTCATTCATCTCTATGG‑3' F: 5'‑TGTCACAGACAAGTAATGTCGATAAA‑3' SYT1 F: 5'‑CAATAGCCATAGTCGCAGTCCT‑3' R: 5'‑TGTCAATCCAGTTTCAGCATCA‑3' U6 F: 5'‑GCTTCGGCAGCACATATACTAAAAT‑3' R: 5'‑CGCTTCACGAATTTGCGTGTCAT‑3' GAPDH F: 5'‑GGAAAGCTGTGGCGTGAT‑3' R: 5'‑AAGGTGGAAGAATGGGAGTT‑3' hsa, homo sapiens; miR, microRNA; CD44, CD44 molecule (Indian blood group); PCNA, proliferating cell nuclear antigen;
    [Show full text]
  • Gene Expression Predictors of Breast Cancer Outcomes
    GENE EXPRESSION PREDICTORS OF BREAST CANCER OUTCOMES Erich Huang2, Skye H Cheng1, Holly Dressman2, Jennifer Pittman5, Mei-Hua Tsou1, Cheng-Fang Horng1, Andrea Bild2, Edwin S Iversen4,5, Ming Liao5, Chii-Ming Chen1, Mike West5, Joseph R Nevins2,6 and Andrew T Huang1,3 1Koo Foundation Sun Yat-Sen Cancer Center, Taipei, Taiwan 2Department of Molecular Genetics and Microbiology, Duke University Medical Center 3Department of Medicine, Duke University Medical Center 4Department of Biostatistics and Bioinformatics, Duke University Medical Center 5Institute of Statistics and Decision Sciences, Duke University 6Howard Hughes Medical Institute SUMMARY Background The integration of currently accepted risk factors with genomic data carries the promise of focusing the practice of medicine on the individual patient. Such integration requires interpreting the complex, multivariate patterns in gene expression data, and evaluating their capacity to improve clinical predictions. We do this here, in a study of predicting nodal metastatic states and relapse for breast cancer patients. Methods DNA microarray data from samples of primary breast tumors were analyzed using non-linear statistical analyses to evaluate multiple patterns of interactions of groups of genes that have predictive value, at the individual patient level, with respect to lymph node metastasis and cancer recurrence. Findings We identify aggregate patterns of gene expression (metagenes) that associate with lymph node status and recurrence, and that are capable of honestly predicting outcomes in individual patients with about 90% accuracy. The identified metagenes define distinct groups of genes, suggesting different biological processes underlying these two characteristics of breast cancer. Initial external validation comes from similarly accurate predictions of nodal status of a small sample in a quite distinct population group.
    [Show full text]
  • Structural Analysis of Pathogenic Missense Mutations in GABRA2 and Identification of a Novel De Novo Variant in the Desensitization Gate
    bioRxiv preprint doi: https://doi.org/10.1101/678219; this version posted June 21, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Structural analysis of pathogenic missense mutations in GABRA2 and identification of a novel de novo variant in the desensitization gate Alba Sanchis-Juan1,2,*, Marcia A Hasenahuer3,4,*, James A Baker3, Amy McTague5, Katy Barwick5, Manju A Kurian5, Sofia T Duarte6, NIHR BioResource, Janet Thornton3, F Lucy Raymond2,4 1. Department of Haematology, University of Cambridge, NHS Blood and Transplant Centre, Cambridge CB2 0PT, United Kingdom 2. NIHR BioResource, Cambridge University Hospitals NHS Foundation Trust, Cambridge Biomedical Campus, Cambridge CB2 0QQ, UK 3. European Molecular Biology Laboratory, European Bioinformatics Institute, Wellcome Genome Campus, Hinxton, Cambridge, CB10 1SD, United Kingdom 4. Department of Medical Genetics, Cambridge Institute for Medical Research, University of Cambridge, Cambridge CB2 0XY, UK 5. Developmental Neurosciences, Great Ormond Street Institute of Child Health, University College London, London WC1N 1EH, UK 6. Hospital Dona Estefânia, Centro Hospitalar de Lisboa Central, 1169-045 Lisbon, Portugal * These authors contributed equally to this work Corresponding author Professor F Lucy Raymond, email: [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/678219; this version posted June 21, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract Cys-loop receptors are vital for controlling neuronal excitability in the brain and their dysfunction results in numerous neurological disorders.
    [Show full text]