Qt0p78229s.Pdf

Total Page:16

File Type:pdf, Size:1020Kb

Load more

UC Irvine ICTS Publications Title Altered Expression of Diabetes-Related Genes in Alzheimer's Disease Brains: The Hisayama Study Permalink https://escholarship.org/uc/item/0p78229s Journal Cerebral Cortex, 24(9) ISSN 1460-2199 1047-3211 Authors Hokama, Masaaki Oka, Sugako Leon, Julio et al. Publication Date 2014-09-01 DOI 10.1093/cercor/bht101 License https://creativecommons.org/licenses/by/4.0/ 4.0 Peer reviewed eScholarship.org Powered by the California Digital Library University of California Cerebral Cortex September 2014;24:2476–2488 doi:10.1093/cercor/bht101 Advance Access publication April 17, 2013 Altered Expression of Diabetes-Related Genes in Alzheimer’s Disease Brains: The Hisayama Study Masaaki Hokama1,2, Sugako Oka1,3, Julio Leon1, Toshiharu Ninomiya4, Hiroyuki Honda5, Kensuke Sasaki5, Toru Iwaki5, Tomoyuki Ohara6, Tomio Sasaki2, Frank M. LaFerla8, Yutaka Kiyohara7 and Yusaku Nakabeppu1,3 1Division of Neurofunctional Genomics, Department of Immunobiology and Neuroscience, Medical Institute of Bioregulation, 2Department of Neurosurgery, Graduate School of Medical Sciences, 3Research Center for Nucleotide Pool, 4Department of Medicine and Clinical Science, Graduate School of Medical Sciences, 5Department of Neuropathology, Graduate School of Medical Sciences, 6Department of Neuropsychiatry, Graduate School of Medical Sciences, 7Department of Environmental Medicine, Graduate School of Medical Sciences, Kyushu University, Fukuoka 812-8582, Japan and 8Department of Neurobiology and Behavior, University of California, Irvine, CA 92697, USA Address correspondence to Prof. Yusaku Nakabeppu, Division of Neurofunctional Genomics, Department of Immunobiology and Neuroscience, Medical Institute of Bioregulation, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582, Japan. Email: [email protected] Diabetes mellitus (DM) is considered to be a risk factor for dementia To identify molecular pathological alterations in AD brains, including Alzheimer’s disease (AD). However, the molecular mechan- we performed interspecies comparative microarray analyses ism underlying this risk is not well understood. We examined gene using RNA prepared from postmortem human brain tissues expression profiles in postmortem human brains donated for the Hi- donated for the Hisayama study (Katsuki 1966; Matsuzaki sayama study. Three-way analysis of variance of microarray data et al. 2010; Sekita et al. 2010), and hippocampal RNAs from from frontal cortex, temporal cortex, and hippocampus was per- the triple-transgenic mouse model of AD (3xTg-AD) (Oddo formed with the presence/absence of AD and vascular dementia, et al. 2003). We found altered expression profiles of diabetes and sex, as factors. Comparative analyses of expression changes in mellitus (DM)-related genes in AD brains, which were inde- the brains of AD patients and a mouse model of AD were also per- pendent of peripheral DM-related abnormalities. formed. Relevant changes in gene expression identified by microarray analysis were validated by quantitative real-time reverse-transcription Materials and Methods polymerase chain reaction and western blotting. The hippocampi of AD brains showed the most significant alteration in gene expression Postmortem Brain Tissues profile. Genes involved in noninsulin-dependent DM and obesity were We examined 88 autopsy samples from Hisayama residents obtained significantly altered in both AD brains and the AD mouse model, as between 15 December 2008 and 24 February 2011. Clinical data related were genes related to psychiatric disorders and AD. The alterations to DM or prediabetes were collected as described (Ohara et al. 2011). in the expression profiles of DM-related genes in AD brains were The study was approved by the Ethics Committee of the Faculty of Medicine, Kyushu University. Written informed consent for all subjects independent of peripheral DM-related abnormalities. These results was obtained from their families. Neuropathologic changes were exam- indicate that altered expression of genes related to DM in AD brains ined as described previously (Matsuzaki et al. 2010). Sections were rou- is a result of AD pathology, which may thereby be exacerbated by tinely stained using hematoxylin–eosin, Klüver-Barrera stain, and a peripheral insulin resistance or DM. modified Bielschowsky method. Specimens from each subject were immunostained using antibodies against phosphorylated microtubule- Keywords: animal model, hippocampus, insulin, microarray, postmortem brains associated protein tau (MAPT) (AT8, mouse monoclonal, 1:500; Inno- genetics, Belgium) and the assessment of AD pathology was conducted ’ Introduction according to the Consortium to Establish a Registry for Alzheimer s Disease (CERAD) guidelines (Mirra et al. 1991) and the Braak stage More than 20 million people worldwide suffer from dementia, (Braak and Braak 1991). During autopsy dissection, parts of the frontal and this number is expected to exceed 80 million by 2040 cortex, temporal cortex, and hippocampus were cut out from each because of the rapid increase in the numbers of elderly (Ferri brain and preserved at −80 °C until RNA preparation. et al. 2005). The prevalences of all-cause dementia and Alzheimer’s disease (AD) in the general population of Japa- Animals nese elderly have increased significantly over the past 3xTg-AD-H mice harboring a homozygous Psen1M146V mutation and 20 years, especially among subjects aged ≧75 years (Sekita homozygous mutant transgenes for APPSwe and MAPTP301L, 3xTg-AD-h mice harboring a homozygous Psen1 mutation and et al. 2010). Thus, it is important to establish effective preven- M146V hemizygous APPSwe and MAPTP301L transgenes, and nontransgenic tion strategies for dementia, and particularly for AD. To reach control mice (non-Tg) (Oddo et al. 2003) were used in this study. At this goal, it is essential to understand the risk factors for de- age 14 months, brains were removed (N = 3 male mice of each type) veloping dementia, including AD, in the elderly population. under pentobarbital anesthesia (i.p.), with perfusion of 40 mL of Several recent studies have indicated effects of insulin and saline via the left ventricle. Hippocampi were isolated and preserved glucose metabolism on the risk of developing dementia, at −80 °C until RNA preparation. The handling and killing of all especially AD (Kuusisto et al. 1997; de la Monte and Wands animals was performed in accordance with the national prescribed guidelines, and ethical approval for the study was granted by the 2008; Schrijvers et al. 2010). The results of the Hisayama study Animal Experiment Committee of Kyushu University. suggested that hyperinsulinemia and hyperglycemia caused by insulin resistance accelerate the formation of neuritic plaques Gene Expression Profiling with Microarray Analyses (NPs) in combination with the effect of the APOE ε4 allele, a Total RNA was isolated using a combination of Isogen (Nippon Gene, majorriskfactorforAD(Matsuzaki et al. 2010). Tokyo, Japan) and the RNeasy Mini Kit (Qiagen, Tokyo, Japan), © The Author 2013. Published by Oxford University Press. This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/), which permits non-commercial re-use, distribution, and reproduction in any medium, provided the original work is properly cited. For commercial re-use, please contact journals. [email protected] according to the manufacturers’ instructions. RNA concentration was room temperature. Sections were blocked with a solution containing determined by the measurement of UV absorbance spectra, and the 1 × Block Ace (Dainippon Pharmaceutical, Osaka, Japan) for 30 min total RNA profile was analyzed using an Agilent 2100 Bioanalyzer at room temperature, incubated with anti-PCSK1 (sc-100578, 1:50, (Agilent Technologies Japan, Tokyo, Japan) to determine RNA integ- Santa Cruz Biotechnology, Santa Cruz, CA, USA) and antineuron- rity number (RIN). Expression profiles of the RNA samples with an specific nuclear protein (NeuN) (ABN78, 1:1000, Merck Japan, Tokyo, RIN ≧6.9 were determined using Affymetrix Human or Mouse Gene Japan) antibodies in 10% Block Ace at 4 °C overnight, and then incu- 1.0ST arrays (Affymetrix Japan, Tokyo, Japan) according to the manu- bated with an Alexa Fluor-labeled second antibody (Invitrogen Japan, facturer’s instructions. The Ambion WT Expression Kit (Life Technol- Tokyo, Japan) for 45 min at room temperature. Confocal images were ogies Japan, Tokyo, Japan) and the GeneChip WT Terminal Labeling acquired using an LSM510 META Confocal Microscope System (Carl and Controls Kit (Affymetrix Japan) were used to generate amplified Zeiss MicroImaging, Tokyo, Japan). and biotinylated sense-strand DNA targets from expressed transcripts (100 ng of total RNA). Manufacturer’s instructions were followed for hybridization, washing, and scanning steps, and CEL files were gener- Western Blot Analysis ated. CEL files were imported into Partek Genomics Suite software Frozen hippocampus samples were homogenized in buffer containing (Partek, St Louis, MO, USA), and both exon-level and gene-level esti- 150 mM NaCl, 1.0% NP-40, 0.5% sodium deoxycholate, 0.1% sodium mates were obtained for all transcript clusters. The gene-level esti- dodecyl sulfate (SDS), 50 mM Tris-HCl, pH 8.0) with 2% protease mates were subjected to statistical analysis and hierarchical and inhibitor, and a 5% phosphatase inhibitor cocktail (Nacalai Tesque, partitioning clustering by the software.
Recommended publications
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
  • Expression Profiling of Ion Channel Genes Predicts Clinical Outcome in Breast Cancer

    Expression Profiling of Ion Channel Genes Predicts Clinical Outcome in Breast Cancer

    UCSF UC San Francisco Previously Published Works Title Expression profiling of ion channel genes predicts clinical outcome in breast cancer Permalink https://escholarship.org/uc/item/1zq9j4nw Journal Molecular Cancer, 12(1) ISSN 1476-4598 Authors Ko, Jae-Hong Ko, Eun A Gu, Wanjun et al. Publication Date 2013-09-22 DOI http://dx.doi.org/10.1186/1476-4598-12-106 Peer reviewed eScholarship.org Powered by the California Digital Library University of California Ko et al. Molecular Cancer 2013, 12:106 http://www.molecular-cancer.com/content/12/1/106 RESEARCH Open Access Expression profiling of ion channel genes predicts clinical outcome in breast cancer Jae-Hong Ko1, Eun A Ko2, Wanjun Gu3, Inja Lim1, Hyoweon Bang1* and Tong Zhou4,5* Abstract Background: Ion channels play a critical role in a wide variety of biological processes, including the development of human cancer. However, the overall impact of ion channels on tumorigenicity in breast cancer remains controversial. Methods: We conduct microarray meta-analysis on 280 ion channel genes. We identify candidate ion channels that are implicated in breast cancer based on gene expression profiling. We test the relationship between the expression of ion channel genes and p53 mutation status, ER status, and histological tumor grade in the discovery cohort. A molecular signature consisting of ion channel genes (IC30) is identified by Spearman’s rank correlation test conducted between tumor grade and gene expression. A risk scoring system is developed based on IC30. We test the prognostic power of IC30 in the discovery and seven validation cohorts by both Cox proportional hazard regression and log-rank test.
  • Supplementary Material

    Supplementary Material

    Supplementary Material Table S1: Significant downregulated KEGGs pathways identified by DAVID following exposure to five cinnamon- based phenylpropanoids (p < 0.05). p-value Term: Genes (Benjamini) Cytokine-cytokine receptor interaction: FASLG, TNFSF14, CXCL11, IL11, FLT3LG, CCL3L1, CCL3L3, CXCR6, XCR1, 2.43 × 105 RTEL1, CSF2RA, TNFRSF17, TNFRSF14, CCNL2, VEGFB, AMH, TNFRSF10B, INHBE, IFNB1, CCR3, VEGFA, CCR2, IL12A, CCL1, CCL3, CXCL5, TNFRSF25, CCR1, CSF1, CX3CL1, CCL7, CCL24, TNFRSF1B, IL12RB1, CCL21, FIGF, EPO, IL4, IL18R1, FLT1, TGFBR1, EDA2R, HGF, TNFSF8, KDR, LEP, GH2, CCL13, EPOR, XCL1, IFNA16, XCL2 Neuroactive ligand-receptor interaction: OPRM1, THRA, GRIK1, DRD2, GRIK2, TACR2, TACR1, GABRB1, LPAR4, 9.68 × 105 GRIK5, FPR1, PRSS1, GNRHR, FPR2, EDNRA, AGTR2, LTB4R, PRSS2, CNR1, S1PR4, CALCRL, TAAR5, GABRE, PTGER1, GABRG3, C5AR1, PTGER3, PTGER4, GABRA6, GABRA5, GRM1, PLG, LEP, CRHR1, GH2, GRM3, SSTR2, Chlorogenic acid Chlorogenic CHRM3, GRIA1, MC2R, P2RX2, TBXA2R, GHSR, HTR2C, TSHR, LHB, GLP1R, OPRD1 Hematopoietic cell lineage: IL4, CR1, CD8B, CSF1, FCER2, GYPA, ITGA2, IL11, GP9, FLT3LG, CD38, CD19, DNTT, 9.29 × 104 GP1BB, CD22, EPOR, CSF2RA, CD14, THPO, EPO, HLA-DRA, ITGA2B Cytokine-cytokine receptor interaction: IL6ST, IL21R, IL19, TNFSF15, CXCR3, IL15, CXCL11, TGFB1, IL11, FLT3LG, CXCL10, CCR10, XCR1, RTEL1, CSF2RA, IL21, CCNL2, VEGFB, CCR8, AMH, TNFRSF10C, IFNB1, PDGFRA, EDA, CXCL5, TNFRSF25, CSF1, IFNW1, CNTFR, CX3CL1, CCL5, TNFRSF4, CCL4, CCL27, CCL24, CCL25, CCL23, IFNA6, IFNA5, FIGF, EPO, AMHR2, IL2RA, FLT4, TGFBR2, EDA2R,
  • Ion Channels

    Ion Channels

    UC Davis UC Davis Previously Published Works Title THE CONCISE GUIDE TO PHARMACOLOGY 2019/20: Ion channels. Permalink https://escholarship.org/uc/item/1442g5hg Journal British journal of pharmacology, 176 Suppl 1(S1) ISSN 0007-1188 Authors Alexander, Stephen PH Mathie, Alistair Peters, John A et al. Publication Date 2019-12-01 DOI 10.1111/bph.14749 License https://creativecommons.org/licenses/by/4.0/ 4.0 Peer reviewed eScholarship.org Powered by the California Digital Library University of California S.P.H. Alexander et al. The Concise Guide to PHARMACOLOGY 2019/20: Ion channels. British Journal of Pharmacology (2019) 176, S142–S228 THE CONCISE GUIDE TO PHARMACOLOGY 2019/20: Ion channels Stephen PH Alexander1 , Alistair Mathie2 ,JohnAPeters3 , Emma L Veale2 , Jörg Striessnig4 , Eamonn Kelly5, Jane F Armstrong6 , Elena Faccenda6 ,SimonDHarding6 ,AdamJPawson6 , Joanna L Sharman6 , Christopher Southan6 , Jamie A Davies6 and CGTP Collaborators 1School of Life Sciences, University of Nottingham Medical School, Nottingham, NG7 2UH, UK 2Medway School of Pharmacy, The Universities of Greenwich and Kent at Medway, Anson Building, Central Avenue, Chatham Maritime, Chatham, Kent, ME4 4TB, UK 3Neuroscience Division, Medical Education Institute, Ninewells Hospital and Medical School, University of Dundee, Dundee, DD1 9SY, UK 4Pharmacology and Toxicology, Institute of Pharmacy, University of Innsbruck, A-6020 Innsbruck, Austria 5School of Physiology, Pharmacology and Neuroscience, University of Bristol, Bristol, BS8 1TD, UK 6Centre for Discovery Brain Science, University of Edinburgh, Edinburgh, EH8 9XD, UK Abstract The Concise Guide to PHARMACOLOGY 2019/20 is the fourth in this series of biennial publications. The Concise Guide provides concise overviews of the key properties of nearly 1800 human drug targets with an emphasis on selective pharmacology (where available), plus links to the open access knowledgebase source of drug targets and their ligands (www.guidetopharmacology.org), which provides more detailed views of target and ligand properties.
  • Structural Analysis of Pathogenic Missense Mutations in GABRA2 and Identification of a Novel De Novo Variant in the Desensitization Gate

    Structural Analysis of Pathogenic Missense Mutations in GABRA2 and Identification of a Novel De Novo Variant in the Desensitization Gate

    Received: 22 October 2019 | Revised: 29 November 2019 | Accepted: 10 December 2019 DOI: 10.1002/mgg3.1106 ORIGINAL ARTICLE Structural analysis of pathogenic missense mutations in GABRA2 and identification of a novel de novo variant in the desensitization gate Alba Sanchis-Juan1,2 | Marcia A. Hasenahuer3,4 | James A. Baker3 | Amy McTague5 | Katy Barwick5 | Manju A. Kurian5 | Sofia T. Duarte6 | NIHR BioResource | Keren J. Carss1,2 | Janet Thornton3 | F. Lucy Raymond2,4 1Department of Haematology, University of Cambridge, NHS Blood and Transplant Abstract Centre, Cambridge, UK Background: Cys-loop receptors control neuronal excitability in the brain and their 2NIHR BioResource, Cambridge dysfunction results in numerous neurological disorders. Recently, six missense vari- University Hospitals NHS Foundation ants in GABRA2, a member of this family, have been associated with early infantile Trust, Cambridge Biomedical Campus, Cambridge, UK epileptic encephalopathy (EIEE). We identified a novel de novo missense variant 3European Molecular Biology Laboratory, in GABRA2 in a patient with EIEE and performed protein structural analysis of the European Bioinformatics Institute, seven variants. Wellcome Genome Campus, Hinxton, . Cambridge, UK Methods: The novel variant was identified by trio whole-genome sequencing We 4Department of Medical Genetics, performed protein structural analysis of the seven variants, and compared them to Cambridge Institute for Medical Research, previously reported pathogenic mutations at equivalent positions in other Cys-loop University of Cambridge, Cambridge, UK receptors. Additionally, we studied the distribution of disease-associated variants in 5Developmental Neurosciences, Great the transmembrane helices of these proteins. Ormond Street Institute of Child Health, University College London, London, UK Results: The seven variants are in the transmembrane domain, either close to the de- 6Hospital Dona Estefânia, Centro Hospitalar sensitization gate, the activation gate, or in inter-subunit interfaces.
  • Novel Missense Mutations in the Glycine Receptor Β Subunit Gene (GLRB) in Startle Disease

    Novel Missense Mutations in the Glycine Receptor Β Subunit Gene (GLRB) in Startle Disease

    *Manuscript Click here to view linked References Novel missense mutations in the glycine receptor β subunit gene (GLRB) in startle disease Victoria M. Jamesa,bº, Anna Bodecº, Seo-Kyung Chungd,e, Jennifer L. Gilla, Maartje Nielsenf, Frances M. Cowang, Mihailo Vujicg, Rhys H. Thomasd,e, Mark I. Reesd,e, Kirsten Harveya, Angelo Keramidasc, Maya Topfb, Ieke Ginjaarf, Joseph W. Lynchc,i and Robert J. Harveya* aDepartment of Pharmacology, UCL School of Pharmacy, 29-39 Brunswick Square, London WC1N 1AX, United Kingdom; bInstitute for Structural and Molecular Biology, Department of Biological Sciences, Birkbeck College, London WC1E 7HX, United Kingdom; cQueensland Brain Institute, The University of Queensland, Brisbane, QLD 4072 Australia; dInstitute of Life Science, College of Medicine, Swansea University, Swansea SA2 8PP, United Kingdom; eWales Epilepsy Research Network, College of Medicine, Swansea University, Swansea SA2 8PP, United Kingdom; fCenter for Human and Clinical Genetics, Leiden University Medical Center, Einthovenweg 20, 2333 ZC Leiden, The Netherlands; gDepartment of Paediatrics, Imperial College London, Hammersmith Hospital Campus, Du Cane Road, London W12 0HS, United Kingdom; hDepartment of Clinical Genetics, Sahlgrenska University Hospital, SE- 41345, Gothenburg, Sweden; iSchool of Biomedical Sciences, The University of Queensland, Brisbane, QLD 4072, Australia. Short title: GlyR β subunit mutations in startle disease ºThese authors contributed equally to this work *Corresponding author: Robert J Harvey, Department of Pharmacology, UCL School of Pharmacy, 29-39 Brunswick Square, London WC1N 1AX, UK. Telephone: +44 207 753 5930; E-mail: [email protected] 1 Abstract Startle disease is a rare, potentially fatal neuromotor disorder characterized by exaggerated startle reflexes and hypertonia in response to sudden unexpected auditory, visual or tactile stimuli.
  • Systematic Elucidation of Neuron-Astrocyte Interaction in Models of Amyotrophic Lateral Sclerosis Using Multi-Modal Integrated Bioinformatics Workflow

    Systematic Elucidation of Neuron-Astrocyte Interaction in Models of Amyotrophic Lateral Sclerosis Using Multi-Modal Integrated Bioinformatics Workflow

    ARTICLE https://doi.org/10.1038/s41467-020-19177-y OPEN Systematic elucidation of neuron-astrocyte interaction in models of amyotrophic lateral sclerosis using multi-modal integrated bioinformatics workflow Vartika Mishra et al.# 1234567890():,; Cell-to-cell communications are critical determinants of pathophysiological phenotypes, but methodologies for their systematic elucidation are lacking. Herein, we propose an approach for the Systematic Elucidation and Assessment of Regulatory Cell-to-cell Interaction Net- works (SEARCHIN) to identify ligand-mediated interactions between distinct cellular com- partments. To test this approach, we selected a model of amyotrophic lateral sclerosis (ALS), in which astrocytes expressing mutant superoxide dismutase-1 (mutSOD1) kill wild-type motor neurons (MNs) by an unknown mechanism. Our integrative analysis that combines proteomics and regulatory network analysis infers the interaction between astrocyte-released amyloid precursor protein (APP) and death receptor-6 (DR6) on MNs as the top predicted ligand-receptor pair. The inferred deleterious role of APP and DR6 is confirmed in vitro in models of ALS. Moreover, the DR6 knockdown in MNs of transgenic mutSOD1 mice attenuates the ALS-like phenotype. Our results support the usefulness of integrative, systems biology approach to gain insights into complex neurobiological disease processes as in ALS and posit that the proposed methodology is not restricted to this biological context and could be used in a variety of other non-cell-autonomous communication
  • A Glycine-Insulin Autocrine Feedback Loop Enhances Insulin Secretion

    A Glycine-Insulin Autocrine Feedback Loop Enhances Insulin Secretion

    Page 1 of 41 Diabetes Yan-Do et al. A glycine-insulin autocrine feedback loop enhances insulin secretion from human β-cells and is impaired in type 2 diabetes Richard Yan-Do, Eric Duong, Jocelyn E. Manning Fox, Xiaoqing Dai, Kunimasa Suzuki, Shara Khan, Austin Bautista, Mourad Ferdaoussi, James Lyon, Xichen Wu, Stephen Cheley#, Patrick E. MacDonald*, Matthias Braun# Department of Pharmacology and Alberta Diabetes Institute, University of Alberta, Edmonton, Canada, T6G 2E1 #Deceased Running title: Glycine enhances insulin secretion from β-cells Words: 3991 Figures: 6 *Address correspondence to Dr. Patrick MacDonald, Alberta Diabetes Institute, 6-126 Li Ka Shing Centre for Health Research Innovation, Edmonton, Alberta, T6G 2E1, Canada; e-mail: [email protected]; web: www.bcell.org; phone: 780 492 8063 1 Diabetes Publish Ahead of Print, published online May 3, 2016 Diabetes Page 2 of 41 Yan-Do et al. Abstract The secretion of insulin from pancreatic islet β-cells is critical for glucose homeostasis. Disrupted insulin secretion underlies almost all forms of diabetes including the most common form, type 2 diabetes (T2D). The control of insulin secretion is complex and impacted by circulating nutrients, neuronal inputs, and local signaling. In the present study we examined the contribution of glycine, an amino acid and neurotransmitter that activates ligand-gated Cl- currents, to insulin secretion from islets of both non-diabetic (ND) and T2D human donors. We find that human islet β-cells express glycine receptors (GlyR), notably the GlyRα1 subunit, and the glycine transporter (GlyT) isoforms GlyT1 and GlyT2. β-cells exhibit significant glycine- induced Cl- currents that promote membrane depolarization, Ca2+ entry, and insulin secretion from ND β-cells.
  • Gene Expression Changes in Glutamate and GABA-A Receptors

    Gene Expression Changes in Glutamate and GABA-A Receptors

    HHS Public Access Author manuscript Author ManuscriptAuthor Manuscript Author Alcohol Manuscript Author Clin Exp Res. Author Manuscript Author manuscript; available in PMC 2017 May 01. Published in final edited form as: Alcohol Clin Exp Res. 2016 May ; 40(5): 955–968. doi:10.1111/acer.13056. Gene expression changes in glutamate and GABA-A receptors, neuropeptides, ion channels and cholesterol synthesis in the periaqueductal gray following binge-like alcohol drinking by adolescent alcohol-preferring (P) rats Jeanette N. McClinticka,b, William J. McBridec, Richard L. Bellc, Zheng-Ming Dingc, Yunlong Liud, Xiaoling Xueia,b, and Howard J. Edenberga,b,d,* aDepartment of Biochemistry & Molecular Biology, Indiana University School of Medicine, Indianapolis, IN 46202, United States bCenter for Medical Genomics, Indiana University School of Medicine, Indianapolis, IN 46202, United States cInstitute of Psychiatric Research, Department of Psychiatry, Indiana University School of Medicine, Indianapolis, IN 46202, United States dDepartment of Medical & Molecular Genetics, Indiana University School of Medicine, Indianapolis, IN 46202, United States Abstract Background—Binge-drinking of alcohol during adolescence is a serious public health concern with long-term consequences, including increased pain, fear and anxiety. The periaqueductal gray (PAG) is involved in processing pain, fear and anxiety. The effects of adolescent binge drinking on gene expression in this region have yet to be studied. Methods—Male adolescent P (alcohol preferring) rats were exposed to repeated binge-drinking (three 1-h sessions/day during the dark-cycle, 5 days/week for 3 weeks starting at 28 days of age; ethanol intakes of 2.5 – 3 g/kg/session). We used RNA sequencing to assess the effects of ethanol intake on gene expression.
  • GSE50161, (C) GSE66354, (D) GSE74195 and (E) GSE86574

    GSE50161, (C) GSE66354, (D) GSE74195 and (E) GSE86574

    Figure S1. Boxplots of normalized samples in five datasets. (A) GSE25604, (B) GSE50161, (C) GSE66354, (D) GSE74195 and (E) GSE86574. The x‑axes indicate samples, and the y‑axes represent the expression of genes. Figure S2. Volanco plots of DEGs in five datasets. (A) GSE25604, (B) GSE50161, (C) GSE66354, (D) GSE74195 and (E) GSE86574. Red nodes represent upregulated DEGs and green nodes indicate downregulated DEGs. Cut‑off criteria were P<0.05 and |log2 FC|>1. DEGs, differentially expressed genes; FC, fold change; adj.P.Val, adjusted P‑value. Figure S3. Transcription factor‑gene regulatory network constructed using the Cytoscape iRegulion plug‑in. Table SI. Primer sequences for reverse transcription‑quantitative polymerase chain reaction. Genes Sequences hsa‑miR‑124 F: 5'‑ACACTCCAGCTGGGCAGCAGCAATTCATGTTT‑3' R: 5'‑CTCAACTGGTGTCGTGGA‑3' hsa‑miR‑330‑3p F: 5'‑CATGAATTCACTCTCCCCGTTTCTCCCTCTGC‑3' R: 5'‑CCTGCGGCCGCGAGCCGCCCTGTTTGTCTGAG‑3' hsa‑miR‑34a‑5p F: 5'‑TGGCAGTGTCTTAGCTGGTTGT‑3' R: 5'‑GCGAGCACAGAATTAATACGAC‑3' hsa‑miR‑449a F: 5'‑TGCGGTGGCAGTGTATTGTTAGC‑3' R: 5'‑CCAGTGCAGGGTCCGAGGT‑3' CD44 F: 5'‑CGGACACCATGGACAAGTTT‑3' R: 5'‑TGTCAATCCAGTTTCAGCATCA‑3' PCNA F: 5'‑GAACTGGTTCATTCATCTCTATGG‑3' F: 5'‑TGTCACAGACAAGTAATGTCGATAAA‑3' SYT1 F: 5'‑CAATAGCCATAGTCGCAGTCCT‑3' R: 5'‑TGTCAATCCAGTTTCAGCATCA‑3' U6 F: 5'‑GCTTCGGCAGCACATATACTAAAAT‑3' R: 5'‑CGCTTCACGAATTTGCGTGTCAT‑3' GAPDH F: 5'‑GGAAAGCTGTGGCGTGAT‑3' R: 5'‑AAGGTGGAAGAATGGGAGTT‑3' hsa, homo sapiens; miR, microRNA; CD44, CD44 molecule (Indian blood group); PCNA, proliferating cell nuclear antigen;
  • Gene Expression Predictors of Breast Cancer Outcomes

    Gene Expression Predictors of Breast Cancer Outcomes

    GENE EXPRESSION PREDICTORS OF BREAST CANCER OUTCOMES Erich Huang2, Skye H Cheng1, Holly Dressman2, Jennifer Pittman5, Mei-Hua Tsou1, Cheng-Fang Horng1, Andrea Bild2, Edwin S Iversen4,5, Ming Liao5, Chii-Ming Chen1, Mike West5, Joseph R Nevins2,6 and Andrew T Huang1,3 1Koo Foundation Sun Yat-Sen Cancer Center, Taipei, Taiwan 2Department of Molecular Genetics and Microbiology, Duke University Medical Center 3Department of Medicine, Duke University Medical Center 4Department of Biostatistics and Bioinformatics, Duke University Medical Center 5Institute of Statistics and Decision Sciences, Duke University 6Howard Hughes Medical Institute SUMMARY Background The integration of currently accepted risk factors with genomic data carries the promise of focusing the practice of medicine on the individual patient. Such integration requires interpreting the complex, multivariate patterns in gene expression data, and evaluating their capacity to improve clinical predictions. We do this here, in a study of predicting nodal metastatic states and relapse for breast cancer patients. Methods DNA microarray data from samples of primary breast tumors were analyzed using non-linear statistical analyses to evaluate multiple patterns of interactions of groups of genes that have predictive value, at the individual patient level, with respect to lymph node metastasis and cancer recurrence. Findings We identify aggregate patterns of gene expression (metagenes) that associate with lymph node status and recurrence, and that are capable of honestly predicting outcomes in individual patients with about 90% accuracy. The identified metagenes define distinct groups of genes, suggesting different biological processes underlying these two characteristics of breast cancer. Initial external validation comes from similarly accurate predictions of nodal status of a small sample in a quite distinct population group.
  • Structural Analysis of Pathogenic Missense Mutations in GABRA2 and Identification of a Novel De Novo Variant in the Desensitization Gate

    Structural Analysis of Pathogenic Missense Mutations in GABRA2 and Identification of a Novel De Novo Variant in the Desensitization Gate

    bioRxiv preprint doi: https://doi.org/10.1101/678219; this version posted June 21, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Structural analysis of pathogenic missense mutations in GABRA2 and identification of a novel de novo variant in the desensitization gate Alba Sanchis-Juan1,2,*, Marcia A Hasenahuer3,4,*, James A Baker3, Amy McTague5, Katy Barwick5, Manju A Kurian5, Sofia T Duarte6, NIHR BioResource, Janet Thornton3, F Lucy Raymond2,4 1. Department of Haematology, University of Cambridge, NHS Blood and Transplant Centre, Cambridge CB2 0PT, United Kingdom 2. NIHR BioResource, Cambridge University Hospitals NHS Foundation Trust, Cambridge Biomedical Campus, Cambridge CB2 0QQ, UK 3. European Molecular Biology Laboratory, European Bioinformatics Institute, Wellcome Genome Campus, Hinxton, Cambridge, CB10 1SD, United Kingdom 4. Department of Medical Genetics, Cambridge Institute for Medical Research, University of Cambridge, Cambridge CB2 0XY, UK 5. Developmental Neurosciences, Great Ormond Street Institute of Child Health, University College London, London WC1N 1EH, UK 6. Hospital Dona Estefânia, Centro Hospitalar de Lisboa Central, 1169-045 Lisbon, Portugal * These authors contributed equally to this work Corresponding author Professor F Lucy Raymond, email: [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/678219; this version posted June 21, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract Cys-loop receptors are vital for controlling neuronal excitability in the brain and their dysfunction results in numerous neurological disorders.