HABITAT DISTRIBUTION, DIVERSITY AND SYSTEMATICS OF
MUS SPP. IN POTHWAR, PAKISTAN
SHAHNAZ BIBI 03-arid-783
Department of Zoology/Biology Faculty of Sciences Pir Mehr Ali
Shah
Arid AgricultureUniversity, Rawalpindi Pakistan 2017 2
HABITAT DISTRIBUTION, DIVERSITY AND SYSTEMATICS OF
MUS SPP. IN POTHWAR, PAKISTAN
by
SHAHNAZ BIBI (03-arid-783)
A thesis submitted in partial fulfillment of the requirements for the degree of
Doctor of Philosophy
in
Zoology
Department of Zoology/Biology Faculty of Sciences Pir Mehr Ali
Shah
Arid AgricultureUniversity, Rawalpindi Pakistan 2017
3
CERTIFICATION
I hereby undertake that this research is an original and no part of this thesis fall under plagiarism. If found otherwise, at any stage, I will be responsible for the consequences.
Name:Shahnaz Bibi Signature: ______
Registration No: 03-arid-783 Date: ______
Certified that the contents and form of thesis entitled “Habitat
Distribution, Diversity and Systematics of Mus spp. in Pothwar, Pakistan” submitted by Ms. Shahnaz Bibi have been found satisfactory for the requirement of degree.
Supervisor:______
(Dr. M. Sajid Nadeem)
Member: ______(Prof. Dr. Mirza Azhar Beg)
Member:______
(Dr. Ghazala Kaukab Raja)
Chairperson: ______
Dean:______4
Director, Advanced Studies: ______
To my parents, because I owe it all to them.
Many Thanks!
5
CONTENTS
LIST OF FIGURES 10
LIST OF PLATES 13
LIST OF ABBREVIATIONS 14
ACKNOWLEDGMENTS 14
ABSTRACT 16
1 INTRODUCTION 1
2 REVIEW OF LITERATURE 05
2.1 MOLECULAR STUDIES ON MUS 06
2.2 MORPHOMETRIC AND CRANIAL STUDIES 09
2.3 PELAGE COLOUR VARIATIONS IN MUS 12
2.4 HABITAT DISTRIBUTION OF MUS 13
3 MATERIALS AND METHODS 16
3.1 STUDY AREA 16
3.2 HABITAT STUDY AND SAMPLE COLLECTION 18
3.3 MOLECULAR ANALYSIS 19
3.3.1 Extraction of DNA 19
3.3.2 PCR Amplification of Cytochrome b 22
3.3.3 Gel Electrophoresis of PCR Products 23 6
3.3.4 Clean Up of PCR Products 23
3.3.5 Sequencing of Cytochrome b 23
3.3.6 Population Expansion, Mismatch Analysis and Divergence 24 Time Estimation
3.4 MORPHOMETRIC AND CRANIAL ANALYSIS 29
3.5 PELAGE COLOUR ANALYSIS 31
3.6 STATISTICAL ANALYSIS 31
4 RESULTS AND DISCUSSION 34
4.1 MOLECULAR ANALYSIS 34
4.1.1 Mismatch Distribution 35
4.1.2 Pak-India Centre of Diversity and Expansion Events 36
4.1.3 Population Expansion 44
4.2 MORPHOMETRIC AND CRANIAL ANALYSIS 46
4.2.1 Morphometric Variations at Species Level 51
4.2.1.1 Morphometric Variations Among M. musculus Sub-spp. 52
4.2.1.2 Morphometric Variations Among M. m. castaneus Sub- 54 lineages
4.2.2 Cranial Variations 56
4.3 PELAGE COLOUR VARIATIONS 68 7
4.4 HABITAT DISTRIBUTION 74
4.4.1 Relative Abundance of The Collected Taxa 74
4.4.2 Species Richness 75
4.4.3 Geographical Segregation 77 CONCLUSION AND
RECOMMENDATIONS 85
SUMMARY 87
LITERATURE CITED 89 LIST OF TABLES
Table No. Page
3.1. Sampling localities, habitat type, sample size (N) and 20 geographical coordinates of 145 mice specimens analyzed in this study
3.2. List of Mitochondrial DNA primers used in this study 25
3.3. List of cytochrome b and mtDNA control region sequences 28 along with accession numbers and localities used as reference in this study
4.4. Genetic diversity indices of four M. m. castaneus Cyt b 41 lineages. Sample size (N), number of haplotypes (H), number of polymorphic sites (S), haplotype diversity (Hd), nucleotide diversity (Pi), mean number of pairwise differences among sequences (K), Tajima’s D, and FU’s Fs values of neutrality tests from mismatch distribution analysis
8
4.5. Genetic diversity indices of M. m. castaneus mitochondrial 42 control region data. Sample size (N), number of haplotypes (H), number of polymorphic sites (S), haplotype diversity (Hd), nucleotide diversity (Pi), mean number of pairwise differences among sequences (K), Tajima’s D (with its P value), and FU’s FS values of neutrality tests from mismatch distribution analysis
4.6. Estimation of population expansion time (years before present) 43 for all M. m. castaneus sublineages based on Cyt b under two substitution rates
4.7. Comparison of body weight (BW), head and body length 53
(HBL), tail length (TV), hind foot length (HFL) and ear length (EL) between M. cookii, M. musculs and M. terricolor. Body weight is in g all other measurements are in mm
4.8. Comparison of body weight (BW), head and body length 55
(HBL), tail length (TV), hind foot length (HFL) and ear length (EL) between three sub-species of M. musculs. Body weight is in g, all other measurements are in mm
4.9. Morphometric measurements of four Cyto b lineages of mice 57 of M. musculus castaneus (CAS). Statistics given are no of specimens (N), mean (X), standard deviation (SD), and coefficient of variation (CV). Morphometric variants included are body wt (BW), head and body length (HBL), tail vertebrae length (TV), hind foot length (HF) and ear length (E). Body weight is in g and the linear measurements are in mm
9
4.10. Percentage count of the number of specimens correctly 58
classified to the respective sub-lineage on the basis of
Discriminant Function Analysis (DFA) of morphological
variables
4.11. Standardized Canonical Discriminant Function Coefficients of 58
morphological variables for M. m. castaneus sub-lineages
4.13. Summery statistics of cranial and dental variables of M. 60 Cookii, M. musculs and M. terricolor
4.14. Summary statistics of cranial and dental variables of three sub- 62
species of M. musculus
4.15. Summary statistics of cranial and dental variables of four sub- 63
lineages of M. m. castaneus
4.16. Percentage count of the number of specimens correctly 64 classified
to the respective sub-lineage on the basis of
Discriminant Function Analysis (DFA) of cranial variables
4.17. Standardized Canonical Discriminant Function Coefficients of 64
cranial variables for M. m. castaneus sub-lineages
4.18. Munsell colour chart values for four Cytb sub-lineages of mice 70 of M.
musculus castaneus (CAS).
10
4.19. Percentage count of the number of specimens correctly 71 classified
to the respective sub-lineage on the basis of
Discriminant Function Analysis (DFA) of coat colour variable
4.20 Standardized Canonical Discriminant Function Coefficients of 71
coat colour variables for M. m. castaneus sub-lineages
LIST OF FIGURES
Figure No. Page
3.1. Map of study area with sampling localities 17
4.1 NJ tree for all Cyt b sequences done during the study 40 depicting Mus species and sub-species recovered from the study area
4.2. ML tree for Cyt b sequences from M. m. castaneus 47 referred to as CAS1, CAS2, CAS3, and CAS4 along with M. m. domesticus used as outgroup
4.3. Median-Joining Network depicting four cyto b lineages 48
of M. m. castaneus
4.4. MJ Network for concatenated sequences (Cyt b and 49
control region) from individuals for which sequences from both genes were available. 11
4.5. Mismatch distribution for all M. m. castaneus sub 50 lineages (a) CAS1, (b) CAS2, (c) CAS3 a, (d) CAS3 b and (e) CAS4
4.6 Results of Discriminant Function Analysis (1st two 59
functions) of 5 morphological variables
4.7 Results of Discriminant Function Analysis (1st two 65
functions) of cranial variables
4.8 Results of Discriminant Function Analysis (1st two 72
functions) of coat colour variables
4.10 The proportion of mice specimens taken from different 76
habitat types in study area
4.11 The proportion of different Mus spp. collected from the 76 study area
4.12 The proportion of different sub-spp. of M. musculus 78
collected from the study area
4.13 The proportion of different lineages of M. m. castaneus 78
collected from the study area
4.14 The proportion of occurrence of three Mus spp. in each 79
habitat type 12
4.15 The proportion of occurrence of three subspp. of M. 79
musculus in each habitat type
4.16 The proportion of occurrence of different lineages of M. 80
m. castaneus in each habitat type
4.17 The proportion of occurrence of three Mus species in 82
different districts of Pothwar
4.18 The proportion of occurrence of three sub-spp. of M. 82 musculus in different districts of Pothwar
4.19 The proportion of occurrence of different CAS lineages 83
in each district in study area
13
LIST OF PLATES
Plate No. Page
3.1. Cytochrome b gene amplified from different Mus specimens. 26
M is ladder (easy ladder100-2000bp).
3.2 Mitochondrial DNA control region amplified from different 27
Mus specimens. M is ladder (easy ladder100-2000bp).
4.1 Coat colour variations in M. m. castaneus. (A) Golden brown, 69 (B)
Yellowish brown back and golden legs, (C) Pure dark grey with
white feet, (D) Dark brown.
14
LIST OF ABBREVIATIONS
PCR Polymerase Chain Reaction
Dbndd1 Dysbindin (dystrobrevin binding protein 1
Tcf Transcription factor 25 (basic helix-loop-helix)
Afg3l1 ATPase family gene 3 like-1 (yeast) mg Milligram
Cyt b Cytochrome b mm Millimeter
µl Microliter scnDNA Single-copy nuclear DNA mtDNA CR Mitochondrial DNA control region
CAS Mus musculus castaneus
MAFFT Multiple alignment using fast fourier transform
τ Tau
MEGA Molecular evolutionary genetics analysis
Myr Million years
DNAsp DNA sequence polymorphism
HBL Head and body length
TL Tail length
EL Ear length ACKNOWLEDGMENTS
15
All thanks to Allah Almighty, the source of knowledge and wisdom endowed to mankind, who gave me courage to complete this thesis. Countless salutations are upon the Holy Prophet Muhammad (PBUH), who is forever a symbol of direction and torch of guidance for humanity as whole.
I would like to extend thanks to the many people, in many countries, who so generously contributed to the work presented in this thesis. Special mention goes to my enthusiastic supervisor, Dr Sajid Nadeem for his kind support and honest supervision throughout the degree. I appreciate his excellent skills of supervision and continuous guidance that led to the completion of this work. My Ph.D has been an amazing experience and I thank him wholeheartedly,
I am cordially grateful to Prof. Dr. Mirza Azhar Beg and would like to express my deepest sense of gratitude and sense of obligation for his keen interest and dexterous assistance which enabled me to complete this task. I am also hugely appreciative to him, especially for sharing his taxonomic expertise so willingly, and for being so dedicated to his role as my secondary supervisor.
I am thankful to Prof. Dr. Stephen Donnelian University of Adelaide, Australia. It was fantastic to have the opportunity to work part of my research in your facilities. It was great experience to learn many new techniques.
Special mention also goes to Andrew Stephen Wiewel for encouraging me to embark on the molecular analysis path and for providing me with a fantastic lab training. Thanks to Dr. Terry Bertozzi, Dr. Steven Myers and Dr. Kanishka Ukuwela for helping and guiding me in lab work during my stay at University of Adelaide, Australia.
Very special thanks goes to Prof. Dr. Hitoshi Suzuki Hokkaido University, Sapporo, Japan who helped me grow as a research scientist, incented me to strive towards my goal and introduced me to many valuable analysis techniques. I really appreciate his patience and how he supported me in overcoming numerous obstacles I have been facing during my result analysis. 16
I am thankful to Dr. Shamim Akhter (Chairperson, Zoology/Biology) and Prof. Dr. Mazhar Qayyum for their encouragement and support. I am also thankful to Dr. Ghazala Koukab Raja for her guidelines and suggestions during this study. Special gratitude goes out to the Higher Education Commission of Pakistan (HEC) for funding this research work and providing me the opportunity to visit University of Adelaide, South Australia under IRSIP.
I am also grateful to some special friends who have supported me along the way. I am cordially grateful to my fellows and teachers for their continuous support throughout the research.
Finally, but by no means least, thanks go to my dad, my mom and my siblings who have provided me thorough moral and emotional support in my life. They are the most important people in my world. Shahnaz
ABSTRACT
The mice of genus Mus are small-size mammals which belong to the family
Muridae of the mammalian order Rodentia. Considerable efforts have been devoted to establish the phylogeny of the Mus genus. But it has been difficult to establish clear taxonomy of the Mus genus by traditional morphometric tools due to the existence of subtle morphological differences among different forms. Thus, 17 different systematics studies of Mus genus are in great conflict. Despite the fact that Pakistan encompasses an important part of range of many Mus species, mice populations in Pakistan have not been the subject of any genetic and biogeographic studies. So, there exist some serious ambiguities with respect to the occurrence of Mus spp. in Pakistan. Thus, present study was conducted to find out which species are actually present in the study area Pothwar. True taxonomic status was examined by using molecular markers of Cytochrome b and
Mitochondrial control region. The genetic diversity depicted by Maximum likelihood phylogeny and Median joining network revealed three species i.e. Mus musculus, Mus terricolor and Mus cookii, three sub species of Mus musculus i.e.
M. m. musculus, M. m. domesticus and M. m. castaneus and four sub lineages of
M. m. castaneus. M. m. castaneus proved to be the most abundant and thus most important taxa identified from Pothwar region. M. m. castaneus population in
Pothwar proved to be highly diverse on the basis of haplotype and nucleotide diversity indices. Neutrality tests were implemented to study the recent demographic history of each sub lineage. Tajima’s D test suggested recent population expansion in all lineages. The taxa identified by genetic analysis were subjected to morphometric analysis involving body and cranial measurements, description of pelage and characteristics of the molar teeth.
Discriminant function analysis (DFA) of morphological, cranial and coat colour variables was executed to predict membership of each specimen to the respective species or lineage identified on the basis of molecular analysis. Results of molecular and morphometric analysis were well concordant in the case of three
Mus species as significant morphological segregation was evident at species level. While morphological segregation was not complete between sub-species of Mus musculus and among sub-lineages of M. m. castaneus as DFA showed 50-
70% morphological isolation between these sub-lineages identified by molocular 18 analyses. Chi-square test was applied to test the homogeneity of the distribution of Mus fauna. According to which no habitat wise segregation was evident for genetically identified Mus taxa.
This study tried to provide validated information about the genetic identity of Mus fauna of Pothwar. As members of genus Mus are major agricultural pests, this study provides basic information about the distribution and species composition of Mus in Pakistan for developing effective and environment friendly management programs for inhibiting different Mus populations.
19
Chapter 1
INTRODUCTION
The mice of the genus Mus belong to the family Muridae, order Rodentia of class Mammalia. This genus comprises thirty to forty species of small, terrestrial rodents, worldwide (Lundrigan, 2002; Marshall, 1977). Members of genus Mus are originally distributed in Europe, Africa and Asia and the species Mus musculus has also been introduced in other parts of the World as well. (Auffray et al., 1988). The molecular and palaeontological data describes the origin of the Mus genus from
Asia and the areas of Pakistan are known to having oldest Mus fossil of the Late
Miocene (Suzuki et al., 2004; Chevret et al., 2005).
The genus Mus is a highly speciose genus exhibiting extensive chromosomal evolution (Britton-Davidian et al., 2000; Veyrunes et al., 2004; Piàlek et al., 2005).
It is divided into four subgenera namely; Mus which includes nine species of house, field and commensal Eurasian mouse, Pyromys with five Asiatic species of spiny mouse, Nanomys with nineteen African species of pygmy mouse and Coelomys with five Asiatic shrew mice. All these taxa exhibit specific morphological as well as biochemical differences (Chevret, 2003; Musser and Carleton, 1993). Among all four Mus sub-genera, sub-genus Mus which has a Eurasian origin is the most well studied sub-genus and previously consists of 11 species to which a new species from the island of Cyprus has recently been added (Cucchi et al., 2006).
Thus, due to its wide ranging importance, considerable efforts have been
1 devoted to establish the phylogeny of the Mus genus. But, there have been difficulties in establishing the taxonomy of the Mus genus due to the existence of subtle 20 morphological differences among different forms which makes identification and phylogenetic placement of taxa much difficult. Though, the introduction of molecular studies to Mus systematics in 1960s proved quite helpful in addressing the problems of morphological variations and taxonomic divisions, (Selander et al.,
1969; Hunt and Selander, 1973; Bonhomme et al., 1978; Thaler et al., 1981;
Darviche and Orsini, 1982; Orsini et al., 1983; Auffray et al., 1990; Frisman et al.,
1990; Gerasimov et al., 1990), providing a single phylogeny to this genus is still difficult.
Different phylogenetic and systematic studies of Mus genus are in great conflict as the data of these studies differ substantially in terms of taxa studied and the methods used for generating phylogeny tree. Although data from these studies has not been compiled in an objective way, Boursot et al., (1993) presented summarized data from various studies in the form of a synthetic tree in which taxa are grouped according to these studies. But still results of Boursot et al., (1993) cannot be accepted as authentic as there is no objective distinction between the well supported and poorly supported clades.
In terms of damages and economic loses, several Mus species including Mus booduga and Mus musculus has been described as important pest of agriculture in
India (Parshad et al., 1987a; Parshad et al., 1987b; Parshad, 1987;
Parshad et al., 1994; Chakravarthy et al., 1992; Rangareddy, 1994). In Punjab
(Pakistan) M.musculus bactrianus inhabits the agriculture fields and plunder the crops. The mice of booduga-dunni complex of Marshall (1977) inhabit agricultural areas and depredate the field crops like Mus musculus but unlike the latter species they also affect the non-agricultural areas (Taber et al., 1967). In Pothwar, wheat and 21 groundnut crops are vulnerable to rodents attack (Brooks et al., 1988). Thus, all these mice are pests of agriculture.
There seems to exist some serious ambiguity with respect to the occurrence of the species of Mus in Pakistan. Five species of Mus viz., Mus saxicola, Mus terricolor, Mus musculus, Mus booduga and Mus dunni have been reported by
Marshall (1977) for Pakistan in his synopsis of taxonomy of Asian species. While,
Siddiqi (1969) has indicated the presence of Mus musculus, Mus booduga, Mus cervicolor and Mus platythrix, from Pakistan. Similarly, these four species of Mus have been documented in Pakistan by Roberts (1997). Moreover, Taber et al.,
(1967) has been reported to capture the specimens of Mus cervicolor from
Faisalabad, Pakistan. But, Marshall (1977) has described the distribution of Mus cervicolor from Nepal, Burma, and Thiland to Vietnam and Java and Sumatra in
Indonesia. Thus, if Mus platythrix and Mus cervicolor do not exist in Pakistan, then what is the taxonomic status of the mice described as Mus platythrix by Siddiqi
(1969) and Roberts (1997) and Mus cervicolor by Roberts (1997) and Taber et al.
(1967). Similarly, there are also uncertanities about occurrence of Mus species in
Pothwar as for example, Roberts (1997) has documented only Mus musculus and
Mus booduga from this region but according to Marshall (1977), Mus saxicola is
“common and widespread in Pakistan” and Mus terricolor, a small mouse with brown back and gray beneath has also been reported by him from Himalayan foothills to southern India. So, I expect to find these species in my study area,
Pothwar.
Therefore, in order to find out how many species of Mus are present in
Pothwar, morphometry of body and cranial measurements, description of pelage, characteristics of the molar teeth, molecular study and ecological and geographical 22 distribution in Pothwar was studied. Physiographically, the Pothwar region is bounded by Salt Range in the South, River Jhelum in the East, River Indus in the
West, and Murree hills and foothills of the Himalayas in the North. This geographical position makes the area important for the distribution and range expansion of many mice species. Thus, to investigate the specific status of these mice, present study has been designed to be conducted in this important region to redefine the Mus fauna of
Pothwar under the hypothesis that our knowledge about taxonomy and ecological distribution of Mus in Pakistan is incomplete and present study will attempt to solve this problem.
Therefore, objectives of the present study were:
• To perform molecular analysis of specimens of mice collected from
different localities of Pothwar.
• To make an attempt to identify the genetically characterized taxa of
Mus on the basis of their body measurements, pelage, skull and
dental characters.
• To collect information on Mus species present in different locations,
habitats and sub-habitats of the study area for defining their
geographical and ecological distribution.
Chapter 2
REVIEW OF LITERATURE
At least 12 species of Mus genus are raised in captivity to be used as model research organism in comparative studies of biological research in laboratory as well as in field studies to illustrate the behaviour and ecology of the wild mice 23
(Musser and Carleton, 1993; Chandrahas, 1974; Muntyanu, 1990; Chou et al., 1998).
The Asian Mus fauna which had been considered as consisting of 48 different species were reduced to 16 species by Marshall (1977) on the basis of cytological, morphological and ecological traits. He placed these 16 Asian species into three subgenera: Mus with six species, Pyromys with five, and Coelomys also with five species. According to Marshall (1977, 1981, 1998), globally, there are four subgenera of genus Mus namely; Mus, Coelomys, Pyromys and Nannomys. Various studies including those which involved scnDNA hybridization data (She et al.,
1990), allozymes (Bonhomme et al., 1984) and nuclear DNA sequences
(Jouvin-Marche et al., 1988) supported the monophyly of the genus Mus.
Of all the mice species within sub-genus Mus, M. musculus is the most important species which is not only an excellent experimental model but well known for its well debated evolution and radiation. It has been the subject of many researches for its wide range of genetic differentiation and admirable history of worldwide colonization and ecological adaptation. Attempts to classify house mouse sub species on morphological basis resulted in many ambiguities because of assigning a new taxonomical unit every time a new mice with different coat colour
5 was captured and same was the case with many spp. within the sub genus Mus characterized on the basis of skull and teeth. It was only after the advent of molecular techniques and their use in taxonomy that the differentiation was made between the different species and morphological variant populations of the same spp. Later on, three major sub-species of M. musculus namely M. m. musculs, M. m. domesticus and M. m. castaneus were identified on the basis of biosystematics
(Bonhomme, 1992). Of these M. musculus castaneus is widespread mainly in 24
Southeast Asia. (Awasthi et al., 1998).
2.1 MOLECULAR STUDIES ON GENUS MUS
Several phylogenetic studies of the genus Mus have been conducted including
Bonhomme, 1986, 1992; Jouvin-Marche et al., 1988; She et al., 1990; Catzeflis and
Denys, 1992; Boursot et al., 1993; Sourrouille et al., 1995; Lundrigan et al., 2002;
Chevret et al,. 2003, 2005; and Veyrunes et al., 2005). But, though the monophyly
of its four sub-genera and of the genus Mus itself has been defined, clear
phylogenetic relationship among different subgenera and species has not been well
established. Despite the use of large number of molecular markers and sequencing
of many maternally, paternally and biparentally inherited genes, there has been
faliure to find out convincing relationships between different sub-genera
(Lundrigan et al., 2002).
Chevret et al. (2005) and Veyrunes et al. (2004) have view that the failures to establish the clear phylogeny of this genus might be the result of rapid radiation of the four subgenera occurred within 1 million years. Additionally, chromosomal rearrangements have been used as an alternative genetic marker by Veyrunes et al.
(2005). These chromosomal rearrangements are considered beneficial for having low levels of convergence, and being under-dominant mutations. Due to these facts, they disappear from the populations, unlike genes which may persist in populations as polymorphs.
Although no major resolution of phylogenetic controversy is achieved but a
hypothesis about the relationship among laboratory stock of Mus species is presented
by Lundrigan et al. (2002). They have generated a phylogeny of genus Mus by using 25
DNA sequences. In this study, DNA sequence data from previous studies was used as well as new sequence data was collected. Sequence data from six genes was used in this study and sequence data from five out of these six genes support monophyly of the sub-genus Mus.
Monophyly of the genus Mus is still not corroborated exclusively, as according to Thaler (1986), the morphological characters which have been described as uniting characters for this genus by Marshall, do not establish its monophyly.
Moreover these sub-genera are also quite divergent genetically but results of
Lundrigan et al. (2002) support the classification as described by Marshall and thus the monophyly of the genus Mus. Though the sampling was quite limited in the study of Lundrigan et al. (2002), their results are significantly important as in addition to the members of the genus Mus, DNA from three other murine genera,
Hylomyscus, Mastomys, and Rattus, were used as out groups for investigating phylogenies and his findings strongly supports the monophyly of the genus Mus and according to him there are not sufficient divergence among four subgenera of this genus to merit generic status. But broader sampling of this genus and other murine genera is still required to test its phylogeny.
The phylogenetic tree presented by Lundrigan et al. (2002) is claimed to be the best hypothesis about the Mus relationship as it is based on quite wide nucleotide sampling including multiple regions of genome and is in agreement with many previous studies involving allozymes and scnDNA hybridization but there are still differences about the relationship among Asian taxa in sub-genus Mus and about the relationship among different sub-genera of the Mus. According to Lundrigan et al.
(2002), these differences are not due to the presence of different genes instead these differences are the result of localized homoplasy the obscures the clear phylogenetic 26
relationship among different taxa in this genus. So, the problem of establishing a
clear relationship among different Asian species is still there to investigate.
The Asian clade of sub-genus Mus includes Mus cervicolor, Mus cookii, and
Mus caroli and of all the clades of this sub-genus, Asian clade is the least studied as
its geographic ranges are not well determined and geographic variations within the
species are also not well known. Most of the studies involving Asian species included
only laboratory stock which was prepared using few specimens collected in 1980s.
Findings of Lundrigan et al. (2002) strongly support the monopoly of this clade.
However, the phylogenetic relationships among these Asian species are not as clear
and branching pattern among these species has not been fully resolved by the
scnDNA hybridization data (She et al., 1990) hence they form a polytomy in Boursot
et al. (1993). According to the study of Barbara et al. (2002) combined nuclear data
strongly supports Mus cervicolor/Mus cookii clade, but combined mitochondrial data
provide weak support for a sister-group relationship between Mus cookii and Mus
caroli. So, in order to draw any conclusion, inclusion of more taxa and employment
of more molecular markers is required to study the clear phylogeny within genus
Mus.
2.2 MORPHOMETRIC AND CRANIAL STUDIES
Molar teeth are often used to set the different evolutionary arguments and issues like
systematic and phylogenetic relationships among different populations or taxonomic
units. In past, teeth were used as qualitative character of identification or simple teeth
measurements have been used as a taxonomic character but in more recent times
geometric morphometrics have been proven more useful as taxonomic and
systematic tool to set the evolutionary relationships between and within species 27
(Renaud et al., 1999, 2005; Polly, 2003; Renaud and Michaux, 2004; Renaud et al.,
2005). According to the study of Macholan (2008) about geometric morphometric analysis of the shape of molar teeth in Mus, there was 75 percent to 100 percent accuracy in classification of known taxa on the basis of molar teeth shape.
In past genetic study of morphological variations has been the focus of evolutionary biologists, in present times these types of studies are included in quantitative trait genetics (Mitteroecker and Gunz, 2009; Klingenberg, 2010). In
Mus musculus, mandible shape has been studied to correlate the morphological variation with genetic differences and to study the evolutionary relationships
(Atchley et al., 1985; Ehrich et al., 2003). Besides, these quantitative genetic studies, which were conducted on laboraty strains, there have been many comparative morphometric studies with wild Mus musculus (Renaud and Auffray, 2009;
Macholán et al., 2008) but almost all of them were limited in scope between and within population, concentrated on taxonomy. So, there were no studies about the extent and distribution of these shape differences between populations within and between related spp. So, there was no information about the evolutionary processes which incorporated these differences in mandible shape. Louis and Diethard (2011) analysed mandible shapes in 15 natural populations of the genus Mus focusing on
M. m. domesticus. They also assessed the effect of environmental, biological and technical factors. This study revealed that shape differences in mandible between individuals are more profound than the differences between populations, sub-species and species. Moreover, they found many variations in shape in the individuals from recently colonized northern areas as compared to the ancestral populations of summer-dry regions. They also found much variant populations in sympatric population of M. m. domesticus and M. spretus. Louis and Diethard (2011) concluded that although in natural populations mandible shape varies with 28 environmental factors, but the influence of environmental factors is less strong as compared to the extent of variation in mandible shape between populations. So, according to their findings, there must be some adaptive evolutionary process which accounts for these variations especially in newly colonized areas.
Michaux and Chevret (2007) used the mandible shape and size to trace the morphological diversification resulting due to adaptive radiation as this character has a direct link with feeding habit and has a relatively simple, two dimensional shape, due to which it can be easily quantified and can be compared easily in different related species. Besides Michaux and Chevret (2007) studies focusing on development (Klingenberg et al., 2001, 2003) and function (Satoh, 1997; Bresin et al., 1999) have been helpful in explaining shape changes in mandible.
Mandible shape in rodents is greatly influenced by phylogeny as well as by ecological adaptations (Renaud and Michaux, 2003; Cardini, 2003), thus, Michaux and Chevret (2007) analyzed the relative effect of ecological factors like food or diet type and phylogeny on mandible shape based on outline analysis of mandible. They used elliptical and radial Fourier transforms to quantify the size and shape differences between species. Their analysis showed that the mandible size is more affected by pylogeny then ecological adaptations or type of food and reverse is true for mandible shape. Their results described a clear separation of omnivorous, herbivorous and insectivorous rodents but showed some degree of overlapping. But, this separation of groups on the basis of diet was also influenced by phylogeny as shown by separation of Paromys, Arvicanthini, Rattus, and Apodemus. In this study, herbivorous Murinae members were characterized by massive mandible while the insectivorous forms were characterized by slender forms. Thus, their analysis of 29
mandible as morphological marker emphasizes the role of both phylogeny as well as
adaptive radiations of morphometrics of mandible in rodents.
2.3 PELAGE COLOUR VARIATIONS IN MUS
Pelage coloration is an important morphological character in mammals which
is necessary for interaction with environment and communication with other animals
(Lai et al., 2007). Adaptive significance of pelage coloration has been described by
different studies (Burtt, 1981; Cloudsley-Thompson, 1999) and the morphology of
mammalian hairs has long been used for species identification and examination of
hair variables like length, width and other variables determines what species hair
come from (Tumlison, 1983; Pocock and Jennings, 2006; Sahajpal et al., 2008).
Besides species identification, hair parameters have historically been used in
taxonomy (Hausman, 1920; Nason, 1948). Moreover, there are considerable
intraspecific variations in hair features which are useful for zoologists focusing on
single species (Davis, 2010). Though, coat colour variation in laboratory mice has
been studied (Silvers, 1979; Bennett and Lamoreux, 2003), little was known about
variations in coat colour and its adaptive significance in wild house mice before Lai
(2008) who studied coat colour variation in wild house mice in Asia. Several studies
have emphasized the role of pigmentation in terms of social communication,
camouflage and sexual displays (e.g. Hoekstra et al., 2004). Pigmentation
polymorphism does not only involve the colour change but also the variation in
spotting pattern and barring. Several studies involving mice as well as other
mammals have identified hundreds of genes related to pigmentation (Kijas et al.,
1998).
2.4 DISTRIBUTION AND HABITAT OF MUS TAXA IN 30
PAKISTAN
The Indian subcontinent is known to be inhabited by large number of species of the genus Mus (Awasthi et al., 1999). By using a combination of morphological, cytological and ecological evidences Marshall (1977) has described three sub genera of Mus in Asia; Mus with six species, Pyromys with five species and Coelomys also with five species (Shimada, 2007). Mus musculus has been widely distributed in
Indian sub-continent including islands whereas several other species of rodents and mice from genus Mus including Mus booduga and Mus platythrix are widely distributed throughout India from Kathiawar and Kutch south to Travancore
(Roberts, 1997). In Pakistan, four species of Mus namely, Mus musculus, Mus booduga, Mus cervicolor and Mus platythrix have been reported (Roberts, 1997).
Mus musculus is distributed throughout Pakistan including the hilly areas. Mus booduga, though has not penetrated the Balochistan hills and the Himalayas, but has been reported from Margalla hills. Mus cervicolor shares the habitat with Mus booduga and occurs throughout the Indus plain. Mus platythrix inhabits southern
Sind through Thatta and Tharparker districts but has not been reported from
Balochistan (Roberts, 1997). Three of these species have been reported from irrigated as well as dry farming systems in India where Mus musculus occurs commensally in houses, store houses and croplands, Mus booduga mostly occurs in cultivated lands where it prefers sandy soils and Mus platythrix occurs in cultivated lands and prefers sandy and gravel plains and rocky habitat
(Rao and Balasubramanyam, 1992).
In Pakistan, Mus musculus affects human settlements, cropland and sometimes lives in barren stony ravine. While, Mus booduga and Mus cervicolor are field mice which usually do not exist as commensal and have been reported from 31 cropland, from the edges of cultivated areas, from uncultivated sandy areas and from gardens. Similarly, Mus platythrix too never exists as commensal and inhabits uncultivated dry hilly areas (Roberts, 1997).
Murid family has been complicated according to biosystematical point of view
(Darvish et al., 2006). M. booduga and M. terricolor are indigenous sibling spp., widely distributed in Indian sub-continent which are very similar morphologically and are collectively called pygmy field mice. These two taxa were called conspecific for the long time until classified as sibling spp. by Matthey and Peter (1968) due to their divergent karyotype. They are widely distributed in wheat and rice fields and inflict major loss as pest. The breeding season of M. booduga and M. terricolor coincides with the harvesting of rice and wheat crops. In areas like southern India, climatic changes fluctuate less seriously and crops are fairly abundant throughout the year, but in northern parts of India, these sibling spp. are almost totally absent from the fields during harsh summers and were only available in abundance in harvesting months of Oct/Nov and March/April. Members of both co-existing spp. spend whole day in burrows and come outside during nights to search out the food and mate (Singh et al., 2009).
All the spp. of genus Mus are wild except Mus musculus which has evolved a commensal way of life. (Auffray et al., 1988; Sage et al., 1993; Prager et al., 1998).
So, the recent evolutionary history of M. musculus is related to its commensal way of life and the pattern of its colonization as commensal with humans covers many entangled evolutionary processes (Boursot et al., 1993). M. musculus is a polytypic spp. and represented by three distinctive lineages or subspecies namely M. m. musculus, M. m. domesticus and M. m. castaneus (Bonhomme et al., 1994; Boursot et al., 1993, 1996; Sage et al., 1993; Prager et al., 1996; 1998). 32
Chapter 3
MATERIALS AND METHODS
3.1 STUDY AREA
Pothwar region (32°22' N and 34° N, 71°30' E and 73°30' E) is the most
northern part of the province of Punjab, Pakistan. Pothwar region includes districts
of Rawalpindi, Chakwal, Attock, Jhelum and some areas of Islamabad Capital 33
Territory (Fig. 3.1). Physiographically, the region is bounded by Salt Range in the
South, River Jhelum in the East, River Indus in the West, and Murree hills and foothills of the Himalayas in the North.
The total area of the Pothwar is about 1.82 million ha of which about 0.61 million ha is under agriculture. The Pothwar region is a topographically and vegetationally heterogeneous landscape. Parts of it exist in near natural state, while other areas have been modified anthropogenetically to varying degrees. The rough high-lying Pothwar plateau (305-610m above sea level) is drained by numerous torrents, ravines and streams. From north Soan and Hano rivers, flowing southwest almost parallel to each other are joined by several of their tributaries before falling into the Indus. The Kanshi stream flow southward from the low hills till near the town of Gujar Khan it turns eastwards to meet the Jhelum river. The terrain of
Pothwar plateau is hilly, uneven and eroded. The range of temperature and rainfall variation tends to be wide. As one moves away from its subhumid northeastern part towards southern part temperature increases and rainfall decreases.
16
34
Fig 3.1: Map of the study area with sampling localities.
Thus, the southern part of Pothwar is mostly semi-arid. The vegetational change from north to south generally follows the temperature and humidity gradient.
The dry sub-tropical semi-evergreen scrub forest is the natural vegetation of the
Pothwar plateau and merges into the subtropical dry evergreen forest of the lower 35
hills in the north. The characteristics trees of the evergreen forest are Olea cuspidata
and Acacia modesta with some Pistacia. Acacia modesta predominates in southern
and hotter sites where the Olea cuspidata may be missing. Pistacia extends higher
into the hills vegetated with the coniferous species but does not ordinarily extend
down into the lower Acacia zone.
Wheat is the major winter crop, while groundnut, sorgum and millet are
summer crops of Pothwar. Groundnut is planted over an area of about 72,600 ha and
is an important cash crop. About 70 percent of the total groundnut production in
Pakistan occurs in the rain fed areas in the districts of Pothwar.
3.2 HABITAT STUDY AND SAMPLE COLLECTION
The habitats of captured specimens comprised households, in or near human
habitations, agricultural fields, and uncultivated fields. The uncultivated fields were
of varied types, for example, dry fields with pebbles and stones with little grass or
herbs, scrublands with shrubs and little ground floor vegetation, and lands with tree
of Accacia and Olea, and shrubs of Ziziphus.
A total of 180 mice were trapped from December 2010 through March, 2013.
The trapping sites were located in the districts of Rawalpindi, Jehlum, Chakwal,
Attock and Islamabad capital territory (Table 3.1). Locally made snap and live traps
were used for capturing the mice from the households and the fields. A total of 30
traps were set for a single night twice a month. Traps were set in the evening and
were collected next early morning. Pieces of Pakistani bread filmed with cooking oil
were used as bait. Each trapped specimen was assigned a field number along with
exact locality, habitat and date of capture was recorded. 36
3.3 MOLECULAR ANALYSIS
For molecular analysis DNA was extracted from all 180 collected specimens. Good
quality intact DNA was isolated from 149 specimens, so only these 149 specimens
were included in all subsequent analyses. First of all these 149 specimens were
characterized genetically by analysis of Cytochrome b gene and mitochondrial CR.
3.3.1 Extraction of Genomic DNA
Genomic DNA from ethanol preserved tail tissue was isolated by using the protocol
developed following the Puregene DNA isolation kit (Gentra Systems, Minnepolis,
MN, USA). Approximately 10-20 mg (0.01-0.02 g) tissue was taken in 1.5 ml
microfuge tube containing 300 µl cell lysis solution and 1.5 µl Protinase K solution. After mixing gently by inverting 25 times, lysate was incubated at 55 Co Table 3.1: Sampling localities, habitat type, sample size and geographical coordinates of 180 mice specimens analyzed in this study. Site Collection Habitat Type Number of Latitude Longitude locality samples Number (N) (E)
1 Attock Cropland, non 17 33º 29'37.9" 72º 06' 9.5" Rangli Jhand cropland
2 Attock Cropland, 19 33º 28' 14.8" 72º 15' 07.1" Kisran human
settlements 3 Chakwal 20 32º 55' 46.1" 72º 43' 45.8" Bari Cropland, fallow land
4 Chakwal 04 32º 48' 48.6" 72º 51' 36.7" Khokhar Cropland, non cropland 37
5 Chakwal 22 32º 52' 26.6" 72º 27' 24.2" Mumdot Cropland, non cropland, fallow land
6 Jehlum Lilah Fallow land 19 32º 31' 11.9" 72º 51' 42.0"
7 19 32º 39' 43.9" 72º39' 20.77" Chakwal Human Makhial settlements
8 Jehlum Cropland 11 33º 11' 27.3" 73º 10' 52.1" Usman Zada
9 Rwp Koont 11 33º 06' 58.0" 73º 00' 52.2" Cropland, non
cropland Field
10 RWP Gujar Cropland 05 33°15′31.15″ 73°18′19.18″ Khan
11 RWP Human 03 33°23′ 6.37″ 73°20′ 13.1″ Kalar Syedan settlements
12 RWP Chakra Human 04 33°35′22.53″ 72°58′42.73″
settlements
13 Rawalpindi Human 05 33°36′ 73° 2′ 37.49″ 20.88″ settlements
14 Islamabad Human 08 33°32′38.66″ 73°11′48.88″ Sihala settlements
15 Islamabad Cropland, non 05 33º 43' 7.2" 73º 15' 44.4" Pind Bhegwal cropland
16 Islamabad Human 04 33°38′39.13″ 73° 9′51.69″ Taramri settlements
17 Islamabad Human 04 33° 42' 0″ 73° 10′ 0″
settlements 38
for overnight. After the digestion of tissue, samples were removed from the incubator and allowed to cool to room temperature. 100 µl Protein Precipitation Solution was added to lysate. After vortexing vigorously at high speed for 20 seconds, microfuge tubes were placed on ice for 10 minutes. After that the mixture was centrifuged at
14000 xg for 5 minutes. Protein pellet was discarded and the supernatant containing
DNA was transferred to clean 1.5 µl screw top tube containing 300 µl of 100 percent
Isopropanol at room temperature. Tubes were inverted gently 30 times and stored at
-20 Co for overnight. The tubes were centrifuged at 14000 xg for 5 minutes. A white
DNA pellet was visible. The supernatant was poured off and tubes were drained on clean absorbent paper. 300 µl 70 percent Ethanol was added to each tube and inverted the tubes several times to wash the DNA pellet. Ethanol containing tubes were centrifuged at 14000 xg for 5 minutes. Ethanol was pippeted out carefully and tubes placed on heating block to evaporate out all the ethanol. DNA pellet was rehydrated by incubating in 30 µl
TLE buffer at 65 Cº for 1 hour and stored at 4 Cº.
39
3.3.2 PCR Amplification of Cytb and mtDNA CR
After genomic DNA isolation from tail tissue, PCR was carried out for both markers
using pair of primers given in Table 3.2. PCR was performed with a preamplification
denaturation at 95Co for 10 minutes followed by thirty four repeats each of 94Co for
45 seconds, 55Co for 45 seconds and 72Co for 1 minutes and final extension at 72Co
for 6 minutes. Master Mix was prepared by mixing 15.5µl water, 1.2µl of each
primer, 5 µl MRT buffer and 0.1 µl Immolase (DNA polymerase) per sample. 25 µl
PCR reaction contained 2 µl extracted DNA and 23 µl Master Mix.
3.3.3 Gel Electrophoresis of PCR Products
After PCR amplification, the PCR products obtained by both genetic markers (Cytb
and mtDNA CR) were separated on 1.5 percent agarose gel prepared in 0.5XTBE
(Plate 1 and 2). The electrophoresis was done at 105 V for 30 minutes. The gel was
stained in ethidium bromide for 30 min. A UV transilluminator was used to visualize
DNA bands while using Gel-Doc to take photographs. The band size was compared
in Gel-Doc by using Low ladder I (100-2000 bp) as marker to identify the position
of required band, After PCR, the PCR products were held at
4Cº until used.
3.3.4 Clean up of PCR Products
Amplified PCR products were cleaned by dry vacuum pump. For optimal recovery,
volume of PCR products was adjusted to 100 µl by adding TRIS buffer
(10mMTRIS). After that PCR products were transferred to 384 well multiscreen
PCR plate and plate was placed on the vacuum manifold. Vacuum of 20mmHg was 40
applied for 15 minutes until all the wells were dry. Dried PCR products were
resuspended in 10Mmtris.
3.3.5 Sequencing of Cytb and Phylogenetic Analysis
Entire Cytb (1140 bp) was sequenced using the same primer sets as used for
PCR. Cleaned PCR products were sent to AGRF (Australian Genome Research
Facility Ltd) for sequencing in both forward and reverse direction. Sequences were
verified by visual inspection of chromatograms. Sequence alignments were
performed using MAFFT 5 implemented in Geneious 6.1.5. For construction of
phylogeny 149 good quality sequences of 920-bp were included. Additional 15 Cytb
sequences of M.m.castaneus were added from Genbank to our original data set of 98
sequences. Accession numbers and source of these sequences are given in Table 3.3.
M.m.domesticus was used as outgroup in phylogenetic analyses. Maximum
likelihood tree (ML) and Median joining network (MJ) generated on the basis of
Cytb, identified four CAS sub-lineages (named hereafter CAS1, CAS2,
CAS3 and CAS4) following Suzuki et al., (2013).
Validity of these sub-lineages was verified by selecting a sub-set of 30 samples from
these sub-lineages and performing mtDNA CR analysis. Good quality mtDNA CR
was amplified from 27 sequences selected on the basis of Cytb phylogeny. The same
27 sequences were added to generate concatenated data. Phylogenetic reconstruction
was done by Maximum likelihood (ML) method using MEGA 6. Node support was
assessed by bootstrap method using MEGA 6.Median joining (MJ) network was
constructed in Network version 4.6.1.2.
41
3.3.6 Population Expansion, Mismatch Analysis and Divergence Time
Estimation
Demographic changes were estimated in four CAS sub-lineages recovered by
Maximum likelihood tree and MJ network. Genetic diversity was estimated in Table
3.2: List of Mitochondrial DNA primers used in this study.
Primer Target Sequence (5’ – 3’) Source Name
LM444 Cytb CATGAAAAATCATCGTTGTAA A. Wiewel, University of Adelaide unpublished data
HM296 Cytb TCTTCATTTTTGGTTTACAAGACCA Torrance (1997), primer R8 15996L CR CTCCACCATCAGCACCCAAAGC Campbell et al. 1995
16502H CR TTTGATGGCCCTGAAGTAAGAACCA Moro et al. 1998
42
M
Plate 3.1: Cytochrome b gene amplified from different Mus specimens. M is ladder
(easy ladder100-2000bp).
43
M
Plate 3.2: Mitochondrial DNA control region amplified from different Mus
specimens. M is ladder (easy ladder100-2000bp).
Table 3.3: List of Cytochrome b and mtDNA CR sequences along with accession numbers and localities used as reference in this study. Species Accession no. Reference Country Locality
44
M. m. castaneus AB819909 Suzuki et al., 2013 India Maharashtra, Pune
Kolkata AB819910 Suzuki et al., 2013 India
AB819910 Suzuki et al., 2013 India Leh
AB649488 Suzuki et al., 2013 India Leh
AB649486 Suzuki et al., 2013 Pakistan Islamabad
AB649490 Suzuki et al., 2013 India Delhi
AB649491 Suzuki et al., 2013 India Bhubaneswar
AB649494 Suzuki et al., 2013 Sri Lanka Peradeniya
AB205284 Suzuki et al., 2013 Japan Hokkaido, Fukagawa AB125773 Suzuki et al., 2013 Taiwan Taitung
AB649499 Suzuki et al., 2013 Indonesia Maluku Province
AB64951 Suzuki et al., 2013 China Kunming
Suzuki et al., 2013 China Kunming
AB64952 AB64953 Suzuki et al., 2013 China Kunming AB649504 Suzuki et al., 2013 China Hainan I., Sanya
M. m. HQ157798 Bastos et al., 2011 South domesticus Africa
each sub-lineage separately by diversity indices; number of alleles (He), haplotype
diversity (hd), nucleotide diversity (휋) and minimum number of recombination
events (Rm) were inferred with DNASP 5.00. Neutrality tests Tajima’s D test and
Fu’s Fs test were calculated using Arlequin version 3.5.1.2 (Schneider et al., 2000).
The same software was used to perform mismatch distribution analyses for each sub- 45
lineage using goodness of-fit tests based on the sum of squared deviations and
raggedness index (Harpending, 1994). Tau (τ), the expansion time in mutational
units was estimated using mismatch distribution under demographic expansion
model in Arlequin version 3.5.1.2 (Harpendings (1994) raggedness index (R).
Population expansion time T (in years before present) was estimated from Cytb
sequences by using the equation
Where GT is the generation time (0.33 year (Aplin et al., 2011)), µ is the mutation
rate per site per million year (2.5% and 10% (Aplin et al., 2011)), and k is the
sequence length (920 bp).
3.4 MORHOMETRIC AND CRANIAL ANALYSIS
After the accurate genetic characterization, the collected specimens were subjected
to morphometric analysis. The body measurements included in the morphometric
analysis were head and body length (HBL), tail length (TV) from rump to the last
tail vertebra, ear length (EL) from basal notch to distal tip, and hind foot length
without claw (HFL) were recorded in mm. Only adult specimens were used. Round
skins of some samples were prepared for pelage colour analysis.
Apart from the external body measurements the skull and dental
measurements of the specimens were also analysed. Marshall (1977) and Musser and
Heaney (1992) were followed for the body and skull measurements. All these
measurements have been defined below.
Greatest skull length (GSL) Measured from the posterior most point on
skull and anterior most point on nasal bones. 46
Nasal length (NL) Measured from the anterior most to the posterior most
point of the nasal bone.
Rostral Length (RL) The distance between the antero-ventral edge of the zygomatic plate and the gnathion.
Rostral Breadth (RB) The least depth of the rostrum.
Inter Orbital Breadth (IOB) Least distance across skull between innermost margins or the orbits (eye sockets).
Zygomatic Breadth (ZB) The greatest distance across the skull between the outermost sides of the zygomatic arches.
Incisive Foramen Length (IFL) The distance between the anterior ends and the posterior ends of the incisive foramina.
Molar Tooth Row Length (MRL) Measured from the anterior margin of the crown of the first molar to the posterior margin of the crown of the last molar of the same row.
First Molar Length (M1L) Measured from the anterior margin of the crown to the posterior margin of the crown.
Mandibular Length Measured from the condyle (articulating surface with the glenoid cavity of the squamosal) to the anterior most point of the dentary excluding the incisors.
3.5 PELAGE COLOUR ANALYSIS
To determine the pelage colour and texture, round skins of the specimens were prepared. Pelage colour of the tail, dorsal and ventral side of the body and flanks was determined by using Munsell colour chart following Lai et al. 2008. Munsell colour chart uses tripartite colour scores i.e. hue, value and chroma to describe a colour. Hue depicts whether a colour looks yellow, green, red, blue or purple. Value 47
indicates lightness of the colour while chroma indicates its departure from a neutral
colour of the same lightness. In writing the Munsell notation, the order is hue, value
and chroma with a space between the hue letter and the succeeding value number
and a diagonal between the two numbers for value and chroma i.e. hue value/chroma.
Thus the notation for a colour hue 5YR, value 5 and chroma 6 is 5YR 5/6 (a
yellowish-red). The 1994 Revised Edition of the Munsell soil colour charts used in
present study (available at www.Munsell.com) can also be used for the evaluation of
skin, hair and eye colour in anthropology, criminology, pathology and other
biological sciences.
3.6 STATISTICAL ANALYSIS
Discriminant function analysis (DFA) of morphological, cranial and coat colour
variables was performed in SPSS16 to predict membership of each specimen to the
respective species or lineage identified on the basis of molecular analysis.
Discriminant score of two linear functions for each specimen was used to classify
each individual.
48
Chapter 4
RESULTS AND DISCUSSION
During this study period 180 mice specimens were collected from the
Pothwar region. The study involved genetic characterization as well as
morphological and pelage analysis of the collected samples. According to the present
study Mus fauna of Pothwar region comprises of three Mus species, namely Mus
musculus, Mus terricolor and Mus cookii. Out of these species Mus musculus was
reported to be the most abundant one and was represented by three sub-species viz.
M. m. musculus, M. m. domesticus and M. m. castaneus.
4.1 MOLECULAR ANALYSIS
49
Maximum likelihood tree generated for 149 long Cytb sequences along with reference sequences (Fig 4.1) depicts Mus cookii (Genbank Accession no.
KX790791), Mus terricolor (Genbank Accession no. KX790792), M.m.domesticus
(Genbank Accession no. KX790793) and M.m.castaneus (Genbank accessions:
KY661759-KY661856). All other Mus taxa except M.m.castaneus were not included in further genetic analysis due to limitation of small sample size. So, further genetic analysis concentrating on M.m.castaneus (CAS) proved this subspecies highly diverse and diverged into more than one sub-lineage. Maximum likelihood tree generated with Cytb data (Fig. 4.2) depicts these sub-lineages identified by reference sequences from Suzuki et al. (2013) and so named hereafter CAS-1, CAS-2, CAS-3 and CAS-4 following Suzuki et al. (2013). However,
33 according to our dataset out of these four sub-lineages described monophyletic in previous studies, only CAS-1 and CAS-2 are truly monophyletic, CAS-3 seems paraphyletic while CAS-4 is not clearly distinct. These results may point towards the possibility that divergence of CAS sub-lineages is a recent event such that there are not enough mutations have occurred in the Cytb since divergence to be able to differentiate between the lineages completely. Or it may be the case that CAS-3 and
CAS-4 which appears distinct with Suzuki et al. (2013) dataset with little or no representation from Pakistan are may not be monophyletic in fact and show further differentiation. This situation is also evident in Median Joining network (Fig 4.3) of
98 Cytb sequences of 919bp (Genbank accessions: KY661759-KY661856) from present study which has many more haplotypes than Suzuki et al. 2013 and shows differentiation of CAS-3 into subgroups CAS-3a and CAS-3b and presents CAS-4 as a bunch of haplotypes not clearly monophyletic. MJ network generated with concatenated data for 27 samples for which both Cytb and CR data (Genbank 50
Accession no. KX839164-KX839191) was available also features three of the four sub-lineages (CAS-2, CAS-3 and CAS-4) recovered from Cytb (Fig 4.4).
According to Cytb data haplotype diversity was high for all sub-lineages
(CAS-1, CAS-2, CAS-3a, CAS-3b and CAS-4) (Table 4.4), with highest diversity
(0.978) recorded for CAS-3b, followed by CAS-4 (0.975). Lowest haplotype diversity was found to be 0.786 for CAS-1. Nucleotide diversity was found to be low in all subgroups. As haplotype diversity is a measure of genetic diversity and nucleotide diversity is a measure of genetic variation, high haplotype diversity values and low nucleotide diversity values observed which point towards recent population expansion for all CAS populations (Mladineo et al., 2013). Number of haplotypes are correlated with sample size (if CAS-3a and CAS-3b taken together).
Tajima’s D values are negative for all CAS populations but are all non-significant except for CAS-2 where it was significantly negative. Whereas, Fu’s Fs test values are significantly negative except for CAS-1 where it is negative but nonsignificant.
As positive values of neutrality tests mean a neutral or random evolution of the gene or DNA under study while a negative value means evolution under non random process due to directional selection or population expansion so overall trend of significantly negative values for neutrality tests (Tajima’s D and Fu’s Fs test) in our results points towards a population expansion. Highest haplotype diversity in CR is found in CAS-2, followed by CAS-4 (Table 4.5) while nucleotide diversity was highest in CAS-4 and lowest in CAS-3 which is in agreement with the results of
Cytb. Numbers of haplotypes are also correlated with sample size as in Cytb.
Tajima’s D values are negative for all three CAS populations but significant only for
CAS-2. Whereas, Fu’s Fs test values are significantly negative both for CAS-3 and CAS-4 but positive for CAS-2.
51
4.1.1 Mismatch Distribution
The mismatch distribution for Cytb data produced unimodal peaks for
CAS-2, CAS-3b, and CAS-4 characteristic of a population with sudden expansion
(Fig. 4.5). For CAS-3b bimodal and for CAS-1 multimodal distribution is obtained
but even then the expansion model could not be rejected as the SSD values for
departure from expansion model are non-significant for all subgroups except for
CAS-2 where it is significant (Table 4.6). The fit of the data was estimated by
Harpending’s raggedness index (r). Raggedness index values are 0.20918, 0.02463,
0.02983, 0.05086 and 0.01207, for all sub-lineages respectively and all are found to
be non-significant. So small and non-significant raggedness index values for all
CAS sub-lineages are in consistence with other measures of population expansion.
The tau values calculated for Cytb data are 4.1, 1.0 3.0, 1.8 and 6.2, respectively
(Table 4.6).
4.1.2 Pakistan-India Centre of Diversity and Expansion Events
More genetic diversity of CAS populations represented by 62 haplotypes was
recovered by present study than any other previous study. All of the four CAS
sublineages reported by previous studies from different regions throughout its range
are recovered from our study area exhibiting no geographical segregation.
So, much more genetic diversity in terms of Cytb and CR is harbored by northern
Pakistan than any other neighboring region considered separately. Rajabi-Maham et
al. (2012) also recovered highest genetic diversity and all four CAS lineages or
haplogroups (HG1A, HG1B, HG2 and HG3) from the regions of Pakistan and
northern India and described this region as the place of secondary admixture between
all the haplogroups. Highest mtDNA diversity was reported by Suzuki et al. (2013) 52 from the areas of north-western India and Pakistan where all four sublineages are present. There was a decreasing trend in terms of diversity from north to south
(Suzuki et al., 2013, Boursot et al., 1996) and from west to east (Suzuki et al., 2013,
Prager et al. 1998). As far as genetic diversity is concerned, our results are corresponding to all of these studies.
53
54
55
56
Figure 4.1: NJ tree for all Cytb sequences obtained during the study depicting Mus species and sub-species recovered from the study area.
Table 4.4: Genetic diversity indices of four M. m. castaneus Cyt b sub-lineages.
57
Sub- N H S Hd Pi K Tajima’s D Fu’s Fs lineage
CAS-1 8 4 8 0.786 0.00318 2.9285 -0.24580 0.94964
37 21 27 0.893 0.00307 2.8198 CAS-2 -2.02920* -16.83257**
CAS-3a 13 8 12 0.859 0.00283 2.60256 -126861 -3.75017**
-1.49805 -4.80808** CAS-3b 10 9 15 0.978 0.00389 3.57778
CAS-4 29 20 32 0.975 0.00626 5.76355 -106906 -8.75037**
Sample size (N), number of haplotypes (H), number of polymorphic sites (S), haplotype diversity (Hd), nucleotide diversity (Pi), mean number of pairwise differences among sequences (K), Tajima’s D, and Fu’s Fs values of neutrality tests from mismatch distribution analysis. P<0.05 (*), P<0.001 (**)
Table 4.5: Genetic diversity indices of M. m. castaneus mitochondrial control region
data.
58
Sub- N H S Hd Pi K Tajima’s D Fu’s Fs lineage
CAS-2 3 3 6 1.000 0.01316 4.00000 -2.02920* 0.13353
-126861 -3.27303** CAS-3 7 6 5 0.952 0.00656 2.00000
CAS-4 17 12 12 0.956 0.01534 4.63235 -106906 -4.06976*
Sample size (N), number of haplotypes (H), number of polymorphic sites (S), haplotype diversity (Hd), nucleotide diversity (Pi), mean number of pairwise differences among sequences (K), Tajima’s D, and Fu’s FS values of neutrality tests from mismatch distribution analysis. P<0.05 (*), P<0.001 (**)
Table 4.6: Estimation of population expansion time (years before present) for all M.
m. castaneus sub-lineages based on Cyt b under two substitution rates.
59
Sub- τ SSD Raggedness Expansion time lineage index estimate (ybp) Substitution rate (myr/site/lineage) 2.5% 10%
CAS-1 4.1 0.7034 0.20918 2941.0 7353
CAS-2 1.0 0.1154** 0.02463 7173.9 1793
CAS-3a 3.0 0.0044 0.02983 2152.7 5380
CAS-3b 1.8 0.01329 0.05086 12913 3228
CAS-4 6.2 0.0023 0.01207 44478 11119.5
τ, age of expansion in mutation unit, SSD, model fit (sum of squared deviation with its P value); R, raggedness. P<0.05 (*), P<0.001 (**)
Different researchers have proposed the region of Southwestern Asia
(encompassing Iraq, Iran, Afghanistan, Pakistan, and northwestern India) as the ancestral homeland of M. musculus on the basis of the observation that it encompasses the geographical range of all major as well as most restricted phylogroups (Suzuki et al., 2013) and it is the region with higher levels of nuclear 60
diversity (Bonhomme et al., 1984; Boursot et al., 1996; Boissinot and Boursot, 1997;
Prager et al., 1998; Darvish et al., 2006). Boursot et al., (1993, 1996) proposed
northern India as the place of origin for M. musculus on the basis of highest genetic
diversity recovered from this region. Prager et al. (1998) confirmed high mtDNA
diversity in the M. musculus populations inhabiting northern India and Pakistan.
According to them these populations were regarded as a monophyletic castaneus
lineage. But Pakistan has never been the point of emphasis for any of these studies
and small sample size from this important part of its range could not expose the true
diversity harbored by this area. Large sample size from northern Pakistan by present
study tried to provide a clearer picture about the likely place of origin of this sub-
species. So, our results strongly support the hypothesis that areas of northern
Pakistan are maybe one of the most likely centre of expansion and hub of diversity
for M. m. castaneus from where dispersal occurred towards all other areas of its
present range.
4.1.3 Population Expansion
Data set by present study suggested recent population expansion in all four sub-
lineages of M. m. castaneus. This observation is supported by bell-shaped mismatch
distributions (Fig. 4.5), the non significant raggedness index, SSD and statistical
tests to detect deviations from a neutral equilibrium model (Table 4.6). Time since
the onset of expansion event was estimated under the assumption of sudden
population expansion by using the τ value calculated from Cyt b data. Expansion
times were estimated as 7173-4447 and 1793-11119 years before present (ypb) with
substitution rates of 2.5% and 10%, respectively. According to our data M. m.
castaneus populations in Pakistan experienced multiple expansion events during
different historical times at least few of which predate the start of human settlements 61 in this region. As according to archaeological data, earliest human settlements in south Asia were established in Mehrgarh (present day
Balochistan, Pakistan) about 9000 years before present (ybp) (Allchin and Allchin,
1997) while the expansion time for most ancient M. m. castaneus sub-lineage (CAS-
4) according to our data (using mutation rate of 10%) is more than 11,000 ybp i.e. well before the start of human settlements in south Asia. Moreover, expansion times of 7353, 1793, 5380, 3228 ybp by CAS-1, CAS-2, CAS-3a and CAS-3b respectively, coincide with the start of agriculture and domestication of cattle in the region by
8000-6000 BC (Possehl, 1996). So it can be proposed that dispersal of M. m. castaneus sub-lineages appears to be benefitted by the ecological transformation of the habitat by agriculturists and emergence of human settlements and establishment of granaries in the area of Pakistan but it was not totally dependent on humans in ancient times. Estimated divergence time for major M. musculus phylogroups by
Suzuki et al. (2013) also hints towards the fact that initial diversification of M. musculus was not mediated by humans as it predates the dispersal of humans out of
Africa. But at the same time, clear abundance of M. musculus sub species over other collected species i.e. M. terricolor and M. cookii in the area points towards the fact that M. musculus and its sub species may get benefitted by their commensal association with humans and it can be assumed that such co-existence provided ecological advantage for the species and accelerated its expansion in human modified landscapes. Analysis of genetic diversity by present study provided valuable knowledge about the genetic constitution of mice of northern Pakistan.
Especially providing important knowledge about occurrence of more than one sub- lineage of M. m. castaneus in an important area of its range, present study is a further step in understanding the natural history of this Southeast Asian subspecies.
Principal findings of molecular analysis are 1) Mice populations in Pothwar,
Pakistan include M. cookii, M. terricolor, M. m. musculus, M. m. domesticus and M. 62
m. castaneus. 2) M. m. castaneus populations of this region have substantial genetic
variation depicted by more than one Cytb sub-lineages which are also depicted by
Cytb and mtDNA CR concatenated dataset. 3) Our results suggest that these CAS
sub-lineages may coexist and are distributed throughout Pothwar region and may not
show geographical segregation. 3) These sub-lineages may show signs of population
expansion at different historical times.
4.2 MORPHOMETRIC AND CRANIAL ANALYSIS
Biosystematics is the study of setting the taxonomical status and evolution
of an organism or taxa based upon statistical data and one of the basic aims of the
biosystematics is to determine how a species differentiates into subspecies through
time and space under the effect of genetic information (Darvish, 2008). As the basic
structure and transformation of the morphological character has the genetic basis,
there has been a growing trend of analyzing the morphological 63
Figure 4.2: ML tree for Cytb sequences from M. m. castaneus sub-lineages along with M. m. domesticus used as outgroup. (Green CAS1, yellow CAS2, blue CAS3,
pink CAS4).
64
Fig 4.3: Median-Joining Network depicting four Cytb sub-lineages of
M. m. castaneus. (Green CAS-1, Yellow CAS-2, Blue CAS-3a, Purple CAS-3 b,
Pink CAS-4. Red circles in each sub-lineage shows reference samples from Suzuki et al. 2013).
65
Figure 4.4. MJ Network for concatenated sequences (Cytb and CR) from individuals
for which sequences from both genes were available. (Yellow CAS-2,
Blue CAS-3a, Purple CAS-3b, Pink CAS-4).
(a) (b)
66
(c) (d)
(e)
Fig 4.5: Mismatch distributions for all M. m. castaneus sub-lineages (a) CAS1, (b) CAS2,
(c) CAS3 a, (d) CAS3 b and (e) CAS4 based on the number of nucleotide differences between pairs of individuals. Solid lines represent the observed distribution and dashed lines represent the expected distribution according to the sudden expansion.
species by genetics and molecular markers (Darviche 1978; Darviche and Orsini,
1982; Darvish 1988; Darvish 1997; Darvish 2004; Boursot et al., 1993; Sage et al.
1993; Prager et al. 1998; Darvish et al. 2006).
So, after the accurate genetic characterization of all the collected samples,
morphological, skull and dental measurements were analysed from all these mice
specimens with the aim to identify the most accurate diagnostic morphometric
characters and to clarify the biosystematic and phylogeography of these genetically
determined populations. Efforts were made to analyze the inter and intra species
variations in the skull and dental characters of mice fauna of Pothwar specially 67
subspecies M. m. castaneus and its sub-lineages which have been determined by
genetic analysis.
4.2.1 Morphometric Variations at Species Level
Three mice species namely M. musculus, M. terricolor and M. cookii were recorded
from the study area with M. musculus being the most abundant one was represented
by 146 specimens, M. terricolor by two specimens while just one specimen of M.
cookii was recorded. A comparison of mean values of all the five body characters
between M. cookii, M. musculus and M. terricolor is given in Table 4.7. As far as
the mean values for external body measurements are concerned, highest body weight
(BW) was recorded in M. cookii (22g) followed by M. musculus 15.0+3.58 while
smallest BW was shown by M. terricolor 7.33+1.04.
Same trend was observed in head and body length (HBL) as it was measured 96mm
in M. cookii, 77.68+ 9.52 in M. musculus and 58.2+0.80 in M. terricolor. Tail
vertebra length (TV) was measured as 85.2 mm in M. cookii, 68.46+7.54 in M.
musculus and 44.1+ 1.10 in M. terricolor. Pattern of variation observed for hind foot
(HFL) and ear length (EL) was more or less similar as observed for above mentioned
characters the only difference was that the extent of variation was not that much
prominent as it was observed for other characters. HFL ranged from18mm in M.
cookii to 16.38+1.90 in M. musculus and 13.3+0.30 in M. terricolor. While EL was
recorded as 15 mm for M. cookii, and 13.29+1.66 and 10.2+0.12 mm for M.
musculus and M. terricolor, respectively. So, M. cookii was the largest mice species
captured with highest values for all body characters which were prominently greater
than those of other two species. But the significance of this difference couldn’t be 68
tested statistically due to the fact the M. cookii was represented by just a single
specimen.
4.2.1.1 Morphometric variations among M. musculus sub-species
Variations in all the external body characters were also compared among the three
subspecies of M. musculus namely M. m. castaneus, M. m. domesticus and
M. m. musculus (Table 4.8). BW was recorded 13.5+1.31 for M. m. castaneus,
15.5+1.50 for M. m. domescticus and 16.2+0.84 for M. m. musculus. HBL was 76.6
in M. m. castaneus, 78.9+1.34 in M. m. domesticus and 79.0+0.98) in M. m.
musculus. Mean TV was shorter than HBL in M. m. castaneus 74.8+0.77 and M. m.
musculus (70 + 0.98) while it was larger than HBL in M. m. domesticus 82+2.0. 69
Table 4. 7: Summery statistics of body weight (BW), head and body length (HBL), tail length (TV), hind foot length (HFL) and ear length (EL) of M. cookii, M. musculs, and M. terricolor.
Variable M. cookii M. musculus M. terricolor
(N=01) (N=146) (N=02)
X SD CV X SD CV
BW 22.0 15.0 3.58 0.25 07.3 1.04 0.14
HBL 96.0 77.6 9.52 0.12 58.2 0.80 0.01
TV 85.2 68.4 7.54 0.11 44.1 1.1 0.02
HF 18.6 16.3 1.90 0.11 13.3 0.3 0.02 E 15.0 13.2 1.66 0.12 10.2 0.8 0.07
Body weight is in g all other measurements are in mm.
70
HFL length was also markedly greater in M. m. domesticus (17.3 + 0.70) than other
two subspecies 16.3+0.16 for M. m. castaneus and 16.9+1.55 for M. m. musculus.
While EL was almost equal in M. m. domesticus and M. m. musculus 14.9+0.40 and
14.2+0.42 respectively) but markedly shorter 13.2+1.76 in M. m. castaneus.
4.2.1.2 Morphometric variations among M. m. castaneus sub-lineages
According to genetic characterization M. m. castaneus turned out to be the most
abundant subspecies recorded from Pothwar region which was further differentiated
into four sub-lineages, so variations in external body characters were also compared
among these sub-lineages (Table 4.9). Highest BW was recorded for CAS 2 (14.9 +
2.65g), followed by CAS 4 (14.0 + 3.28), and CAS 3 (13.4 + 3.6) while lowest BW
was observed in CAS1 (11.8+ 4.57). In the case of HBL, trend of highest and lowest
was similar as for BW with CAS 1 being smallest with 73.5+8.90 and CAS 2 largest
with 77.8+8.17. But for CAS 3 and CAS 4 trend was somewhat different with CAS
3 (76.3+11.35) larger than CAS 4 (75.5+9.02). TV was measured 65.4+7.71 in
CAS1, 70.4+8.43 in CAS2, 68.7+6.01 in CAS3 and
66.9+6.32 in CAS4.
Variation in EL was not much prominent among four sub-lineages of M. m.
castaneus. It was measured as 13.2+1.76, 12.9+1.43, 13.3+1.42 and 13.7+2.04 from
CAS 1 to CAS 4, respectively. Unlike other characters mentioned above, HFL was
smallest in CAS 2 (15.8 + 2.32) and largest in CAS3 (17.0+1.03). In CAS 1 71
Table 4. HFL was measured 16.7 + 0.16 and in CAS4 it was 16.5 + 1.74. 8: Summery statitics of body weight (BW), head and body length (HBL), tail vertebra length (TVL), hind foot length (HFL) and ear length (EL) of three subspecies of M. musculus.
Variable M. m. castaneus M. m. domesticus M. m. musculus
(N= 140) (N=03) (N=03) X SD CV X SD CV X SD CV
BW 13.5 1.31 0.97 15.5 1.50 0.09 16.2 0.84 0.05
HBL 76.6 1.35 0.14 78.9 1.34 0.01 79.0 1.41 0.01 TV 72.8 2.39 0.10 82.0 2.1 1.04 70.0 1.0 0.01
HF 16.3 1.60 0.09 17.3 0.70 0.04 16.9 1.55 0.09 EL 13.2 1.76 0.13 14.9 0.40 0.02 14.4 0.42 0.02
Body weight is in g, all other measurements are in mm.
72
Discriminant function analysis (DFA) based on five morphological measurements
was 46.7% accurate in assigning the individual specimens to the correct sub-lineage
identified on the basis of molecular analysis (Table 4.11). From the values of
standardized canonical discriminant coefficients in Table 4.12 it can be concluded
that HFL, BW and HBL are the variables which are playing important role in
discrimination between CAS sub-lineages as larger the
standardized coefficient, greater is the contribution of the respective variable to the
discrimination between groups. Position of group centroids in canonical discriminant
functions graph (Fig. 4.6) also shows that morphological differentiation between the
sub-lineages is not complete as clusters for all sublineages overlap to varying degree.
4.2.2 Cranial Variations
Cranial analysis revealed that there was mark difference in the skull size among
three species of genus Mus recovered from study area. M. musculus skull was with
broad zygomatic plate. Zygomatic plate was considerably narrow in M. terricolor.
While Skull of M. cookii was elongated, markedly longer than that of M. musculus.
As far as qualitative differences at sub-species level are concerned, M. m. musculus
skull appeared wider and broader while skull of M. m. domesticus was narrow and
elongated. So, these three species can be differentiated on the basis of cranial
characteristics. Table 4.13 provides basic statistical data about cranial and 9: 73
Table 4. Morphometric measurements of four Cytb lineages of M. musculus castaneus
(CAS). Morphometric variants included are body weight (BW), head and body length (HBL), tail vertebrae length (TV), hind foot length (HFL) and ear length (EL).
Variable CAS1 CAS2 CAS3 CAS4 (N=22) (N=56) (N=31) (N=31)
X SD CV X SD CV X SD CV X SD CV
BW 11.8 4.57 0.38 14.9 2.65 0.17 13.4 3.6 0.26 14.0 3.28 0.23
HBL 73.5 8.90 0.12 75.5 9.02 0.11 77.8 8.17 0.10 76.3 11.35 0.14
TV 72.4 7.71 0.11 74.4 8.43 0.11 76.7 6.01 0.08 75.9 6.32 0.09
HFL 16.7 1.60 0.09 15.8 2.32 0.14 17.0 1.03 0.06 16.5 1.74 0.10 EL 13.2 1.76 0.13 12.9 1.43 0.11 13.3 1.42 0.10 13.7 2.04 0.14
Statistics given are no of specimens (N), mean (X), standard deviation (SD), and coefficient of variation (CV). Body weight is in g and the linear measurements are in mm. N is the number of samples.
74
Table 4.10: Percentage count of the number of specimens correctly classified to the respective sub-lineage on the basis of Discriminant Function Analysis (DFA) of morphological variables.
Sub- Predicted Group Membership Total lineage C1 C2 C3 C4
C1 41.7 0.0 20.8 25.0 12.5 100.0 C2 74.1 12.1 13.8 100.0 % Count C3 15.6 12.5 56.3 15.6 100.0 C4 8.3 33.3 8.3 50.0 100.0
46.7% of original grouped cases correctly classified.
Table 4.11: Standardized Canonical Discriminant Function Coefficients of morphological variables for M. m. castaneus sub-lineages. CAS-1 (n= 22), CAS-2
(n=56), CAS- (n=31) and CAS- (n=31).
Variable Function 1 BW .485 HBL .301 TV .296 EL -.165 HFL -.664
75
Table 4.
76
Sub- l ineage
Fig 4.6: Results of Discriminant Function Analysis (1st two functions) of 5 morphological variables. Overlapping of the clusters for different sub-lineages indicate that sub-lineages are not completely distinguishable on the basis of morphological characters.
Table 4.13. Summary statistics of cranial and dental variables of M. Cookii, M. musculs and M. terricolor. All measurements are in mm. 77
Variable M. cookii M. musculus (N= M. terricolor (N=01) 146 ) (N= 02)
X SD X SD
GSL 22.5 21.0 3.69 18.2 0.14 0.14 10.30 9.3 0.51 8.2 CB 07.0 6.5 0.86 5.9 0.07 CD
02.0 10.6 0.52 9.2 0.20 ZB 80.9 7.7 1.11 6.6 0.14 NL 04.9 4.9 0.89 3.9 0.11 IFL 03.8 4.2 0.47 3.0 0.05 IOB 10.7 10.5 0.73 9.1 0.20 ML
03.9 3.5 0.06 3.1 0.15 UMRL 03.8 3.4 0.26 2.8 0.11 LMRL 02.0 1.9 0.21 1.6 0.05 M1L
dental variables of M. cookii, M. musculus and M. terricolor. According to this data
M. cookii was the largest mice species collected from Pothwar region followed by
M. musculus while M. terricolor was the smallest one true to its name “pygmy mice”.
78
Craniometric data also revealed considerable differences among skulls of three sub- species of M. musculus (Table 4.14). M. m. domesticus was characterized by largest skull (GSL 23.2+0.36) followed by M. m. musculus (GSL 22.36+0.07) while smallest skull was measured in M. m. castaneus (GSL 18.43+3.78). M. m. castaneus had smallest magnitude for all cranial variables related to length i.e. GSL and NL but on the other hand it was the sub-species with zygomatic plate broader than both of the other two sub-species of M. musculus. Table 4.15 provides basic statistical data about cranial and dental variables of four CAS sub-lineages. Results of DFA show that classification of specimens into respective sub-lineage on the basis of cranial characters was 69.6% correct (Table 4.16) and according to standardized canonical discriminant function coefficients IFL and GSL were the most important skull characters for classification into respective group (Table
4.17). Position of group centroids in canonical discriminant functions graph (Fig. 4.7) for dental and skull variables shows that there was considerable differentiation between the sub-lineages as there was less overlap between clusters for each sublineage and group centroids were also separated considerably.
Although in recent years there has been tremendous increase in the use of molecular techniques in the field of phylogenetics however study of morphological Table 4.14.
Summary statistics of cranial and dental variables of three sub-species of M. musculs.
All measurements are in mm.
Skull M. m. castaneus M. m. domesticus M. m. musculus character (N= 140 ) (N= 03 ) (N=03 )
X SD X SD X SD
GSL 18.43 3.78 23.20 0.36 22.36 0.07
9.32 0.51 9.50 0.20 9.70 0.05 CB 79
CD 6.54 0.86 6.36 0.41 6.13 0.15
ZB 10.61 0.62 10.33 0.15 10.56 0.60
NL 6.73 0.78 7.40 0.40 7.83 0.05
4.97 IFL 0.89 5.23 0.49 5.30 0.56
IOB 4.04 0.05 4.26 0.14 4.33 0.06
ML 10.54 0.73 10.73 0.75 11.23 0.25
UMRL 3.63 0.30 3.93 0.23 3.86 0.15
LMRL 3.46 0.26 3.66 0.15 3.73 0.20
M1L 1.96 0.21 1.96 0.05 2.03 0.05
Table 4.15: Summary statistics of cranial and dental variables of four sub-lineages of
M. m. castaneus. All measurements are in mm.
Skull CAS1 CAS2 CAS3 CAS4
Character (N=22) (N=56) (N=31) (N=31)
X SD X SD X SD X SD
GSL 20.78 0.93 23.17 0.20 21.88 0.55 20.84 0.57
CB 9.1 0.21 9.7 0.29 9.0 0.14 9.17 0.34 80
CD 6.5 0.11 6.5 0.22 6.2 0.07 6.4 0.07
ZB 10.4 0.14 10.8 0.28 10.9 0.41 10.3 0.53
NL 7.93 0.05 7.64 0.50 7.70 0.25 7.04 0.15
IFL 4.26 0.19 4.71 0.34 4.76 0.37 4.7 0.78
IOB 4.1 0.08 4.4 0.09 4.1 0.16 4.6 0.09
ML 10.6 0.15 10.4 0.54 10.8 0.28 10.5 1.10
UMRL 3.6 0.5 3.5 0.03 3.6 0.70 3.4 0.02
LMRL 3.5 0.11 3.5 0.12 3.3 0.09 3.4 0.02 M1L 1.9 0.07 2.0 0.09 2.0 0.03 1.9 0.02
Table 4.16: Percentage count of the number of specimens correctly classified to the respective sub-lineage on the basis of Discriminant Function Analysis (DFA) of cranial variables. Sub- Predicted Group Total lineage C1 Membership C3 C4 C2 C1 75.0 .0 25.0 7.7 0.0 100.0 C2 7.7 61.5 75.0 23.1 100.0 % Count C3 0.0 0.0 25.0 100.0 C4 7.7 15.4 7.7 69.2 100.0
69.6% of original grouped cases correctly classified.
81
Table 4.17: Standardized Canonical Discriminant Function Coefficients of cranial variables for M. m. castaneus sub-lineages. CAS-1 (n= 22), CAS-2 (n=56), CAS-
(n=31) and CAS- (n=31).
Variable Function 1
GSL -.652 NL -.249 CB .181 CD .420 ZB -.279 BFM .349 IFL .774
82
Sub - lineage
Fig 4.7: Results of Discriminant Function Analysis (1st two functions) of cranial variables. Less overlapping of the clusters for different sub-lineages indicates that sub-lineages are considerably distinguishable on the basis of cranial characters. characters still remains an important tool in inferring phylogenies (David and
Laurin, 1996; Corti et al., 1998; Steppan, 1998; Velzen et al., 1998; Mauk et al.,
1999; Simmons and Conway, 2001) as morphological data can be collected more easily from large no of preserved museum specimens and also from fossil record
(Hillis, 1987). Moreover, morphometric data can also be used to study the selection pressures and trends for adaptations within a taxa or lineage (Long and Singh,
1995; Corti and Fadda, 1996; Corti et al,. 1996; Hansen, 1997).
83
Three Mus species identified from Pothwar were completely distinguishable on the basis of all the morphological variables included in this study. M. terricolor was the smallest species collected from study area and single specimen of M. cookii collected was largest in all morphological aspects, while there was also considerable difference between M. terricolor and M. musculus in terms of all mean skull and external body measurements except upper molar tooth row length and ear length. Almost all of the morphological measurements for M. musculus and M. cookii are in good agreement with previous studies (Marshall 1977), but M. terricolor recovered from Pothwar differed from M. terricolor reported by Marshall (1997) by having slightly larger mean values of body length (HBL) and skull length (GSL) and smaller values for all other cranial and external body measurements especially tail length (TVL).
There was greater degree of overlap between three sub species of M. musculus which makes the identification difficult on the basis of morphological characters.
Gerasimov et al. (1990) made 16 keys by using 60 skull and mandible variables to discriminate among five genetically determined taxa of the genus Mus including two sub-species of M. musculus (M. m. musculus and M. m. domesticus) on the basis of multivariate craniometric analysis. They found highest similarity in mean values of skull and dental variables among M. m. musculus and M. m. domesticus (i.e. five variables significantly different at p < 0.05 and just one variable (width of zygomatic arch) significantly different at p < 0.001) and suggested that these two sub-species are so identical morphologically that even multivariate analysis of skull and dental characters cannot discriminate them completely as they are not completely reproductively isolated (Gerasimov et al.,
1990) and have diverged comparatively recently (She et al., 1990).
84
All measurements calculated by present study for three subspecies including external body characters and skull variables were in good agreement with previous reports (Marshall 1977) except very clear disagreement in the case of tail length for M. m. castaneus. According to previous reports M. m. castaneus has been characterized by tail length longer than body length (Marshall 1977) but according to present study tail length was never longer than body length rather specimens from
Pothwar populations of M. m. castaneus always have tail length equal or shorter than body length. This disagreement about the M. m. castaneus populations of Pothwar can be attributed to the absence of data specific to M. m. castaneus populations of
Pakistan as M. m. castaneus populations in Pakistan have never been the subject of any comprehensive study characterizing this population genetically and morphologically.
Visibly shorter tail and comparatively larger skull in M. m. castaneus from
Pothwar can also be attributed to the life history and adaptations according to the habitat as study of morphometric variations among commensal and non commensal mice populations belonging to same species (M. musculus) by Sla´bova´and Frynta
(2007) explained the effect of life history and ecology on the morphological characters and according to them populations exhibiting commensal mode of life had smaller skulls and much longer tails than non commensal populations of the same sub-species. Shorter tail length is an ancestral character in M. musculus as it is proved by the fact that other close relatives of M. musculus (M. spicilegus, M. macedonicus and M. spretus) have shorter tail length. So, the longer tail length is an adaptation to commensal mode of life as tail movements contributes to the better survival in three dimensional commensal habitats (Sla´bova´and Frynta, 2007). Another note able finding about the castaneus populations in Pothwar is the considerable genetic 85 diversity represented in the form of four well differentiated clades designated here as sub-lineages. Earlier reports by Rajabi-Maham et al. (2012) have also described the polytypic character of castaneus as it exhibits reasonable genetic diversity in the form of three or four clades. These authors debated about the taxonomic status of these clades and emphasized the need to further investigate if these clades could be raised to the status of separate subspecies.
4.3 PELAGE COLOUR VARIATIONS
Single specimen of M. cookii captured had dark grey dorsal fur and light
A B
86
C D
Plate 4.1: Coat colour variations in M. m. castaneus. (A) Golden brown, (B)
Yellowish brown back and golden legs, (C) Pure dark grey with white feet, (D)
Dark brown.
Table 4.18: Munsell colour chart values for four Cytb sub-lineages of mice of M. musculus castaneus (CAS). Munsell colour variables include value, chroma and hue for dorsal as well as for ventral coat colourof mice specimens.
Munsell CAS1 CAS2 CAS3 CAS4 variable N=22 N=56 N=31 N=31
X SD CV X SD CV X SD CV X SD CV
Dorsal Value 4.5 1.17 0.25 4.2 0.84 0.16 4.7 1.08 0.22 4.7 1.43 0.24 Chroma 4.7 1.48 0.31 4.1 1.88 0.30 4.5 2.04 0.36 4.6 1.72 0.25 Hue 8.9 2.42 0.29 7.8 1.92 0.24 8.1 1.61 1.19 7.6 2.03 0.26
Ventral
Value 7.8 0.00 0.00 7.9 0.27 0.03 7.8 0.36 0.04 7.6 0.47 0.06 Chroma 2.7 1.44 0.53 2.3 1.46 0.63 2.0 0.74 0.36 1.6 0.87 0.54 Hue 8.3 1.96 0.23 7.3 2.38 0.32 7.5 2.58 0.34 6.6 2.36 0.35
No of specimens (N), mean (X), standard deviation (SD), coefficient of variation (CV) and range (R) are given.
87
Table 4.19: Percentage count of the number of specimens correctly classified to the respective sub-lineage on the basis of Discriminant Function Analysis (DFA) of coat colour variables. Sub- Predicted Group Total lineage C1 Membership C3 C4 C2 C1 44.7 29.4 25.9 .0 0.0 100.0 C2 4.2 85.4 71.4 10.4 100.0 % Count C3 7.1 3.6 17.9 100.0 C4 0.0 64.3 0.0 35.7 100.0
47.1% of original grouped cases correctly classified.
Table 4.20: Standardized Canonical Discriminant Function Coefficients of coat colour variables for M. m. castaneus sub-lineages. CAS-1 (n= 22), CAS-2 (n=56),
CAS- (n=31) and CAS- (n=31).
Variable Function 1
(D)V -.152 (D)C -.327 D(Hue) .110 (V)V .429 (V)C .537 (V)HUE .304
88
Sub - lineage
Fig 4.8: Results of Discriminant Function Analysis (1st two functions) of coat colour variables. Overlapping of the clusters for different sub-lineages indicate that sub- lineages are not completely distinguishable on the basis of coat colour characters.
89
grey ventral fur while same pattern was recorded true for the tail colour. M. terricolor had grayish brown fur on dorsal body surface and white belly fur with black bases while feet were pure white. All three M. m. domesticus specimens had yellowish brown fur dorsally (5/4, 7.5 YR) and light grayish white ventrally (8/4, 7.5YR). M. m. musculus was reported to have dark brown back with white or off white belly.
However, tremendous variation was observed in the dorsal and ventral coat colour of castaneus which varied from light orange brown and dark golden brown (Plate 3) to dark grey dorsally and light orange/peach and fawn colour to pure white ventrally.
There was also variation in foot colour from light pinkish brown to pure white and to black. A discriminant function analysis based on dorsal and ventral coat colour variables (taken together) was 47.1% accurate in assigning the individual specimens to the correct sub-lineage identified on the basis of molecular analysis (Table 4.19).
Values of standardized canonical discriminant coefficients for these variables are given in Table 4.20 which shows that ventral coat colour plays important role in discrimination between CAS sub-lineages. Position of group centroids in canonical discriminant functions graph (Fig. 4.8) also shows that differentiation between the sub-lineages is not complete as clusters for all sub-lineages overlap to varying degree.
These differences in coat colour are suggestive of either strong selection in the different habitats or partially segregated gene pools. Traditionally, M. m. castaneus has been reported as dark coloured mice while M. m. bactrianus is identified as having golden brown or bright yellow dorsal fur but in present study tremendous coat colour variation in Castaneus was observed which approaches the description of bactrianus. So, this study supports the view discussed by some previous authors (e.g.
Rajabi-Maham et al., 2012) that what had been called bactrianus now seems to be 90 part of high mtDNA diversity that exists among castaneus populations from Pakistan and northwest India. So, coat colour variation within castaneus can be an interesting topic for future research in Pakistan.
4.4 HABITAT DISTRIBUTION
All the sampled habitats were segregated into croplands, non crop areas, fallow lands and human settlements. Figure 4.10 presents information about the proportion of the samples collected from each type of the habitats. Trapping success was highest in cropland as 45 percent of the total collected samples were obtained from this type of habitat. Specimens collected from human settlements comprised 30 percent of the total samples while 16 percent and 8 percent mice were trapped from fallow lands and non crop areas, respectively.
4.4.1 Relative Abundance of the Collected Taxa
Genetic analysis revealed that Mus fauna of Pothwar was clearly dominated by Mus musculs as random trapping in all potential habitats resulted in capture of 177 specimens of Mus musculus, two specimens of Mus terricolor and one specimen of
Mus cookii out of the total 180 captured mice. Figure 4.11 presents pie chart of the data about the relative abundance (proportion) of the three species in the total collected samples. Figure 4.12 presents the percentage of each sub-species out of the total M. musculus samples which shows that most of the collected M. musculus samples were of South Asian sub-species M. m. castaneus which comprised 97 percent of the collected M. musculus samples while M. m. domesticus comprised 2 percent and 1 percent, respectively. Relative abundance was also studied among Cytb 91 sub-lineages of M. m. castaneus and it was revealed that Out of total M. m. castaneus samples, 43 percent belong to CAS2, 25 percent to CAS3 and CAS4 each and 7 percent to CAS1 (Fig. 4.13).
4.4.2 Species Richness
Fig. 4.14, 4.15 and 4.16 presents information about the diversity and species richness of each type of habitat (croplands, non crop areas, fallow lands and human settlements) at the level of species, sub-species and sub-lineages, respectively. Data in these figures show that as far as species and sub-species are concerned, cropland was the most diverse and rich habitat harboring all the three collected species of sub-genus Mus recovered from the study area while only one species i.e. Mus musculus was captured from the samples collected from the remaining habitats (non crop areas, fallow lands and human settlements). Same trend was observed at the sub-species level as samples from cropland exhibited highest diversity representing all the three sub-species of M. musculus while only M. m. castaneus was recorded from remaining three types of habitat.
This data also reveals that M. m. castaneus didn’t exhibit any habitat preference as it was recorded from all the habitats studied. Similarly, no habitat
92
Fallow land, 16 % Cropland, 45%
Human settlments, 31 % Non crop area, 8%
Fig 4.10. The proportion of mice specimens taken from different habitat types in study area.
M. cookii M. terricolor M. musculus
Fig 4.11: The proportion of different Mus species collected from the study area.
segregation was observed among the sub-lineages of M. m. castaneus as samples
collected from all the habitats represented all the four sub-lineages. But important
observation about CAS1 was that despite its low overall abundance, this sublineage
was fairly widely distributed as these mice were recovered from all the habitats
sampled in this study.
93
4.4.3 Geographical Segregation
Data about the geographical distribution of all the Mus taxa recovered from Pothwar region is presented in Fig 4.17, 4.18 and 4.19. Figure 4.17 shows that district
Rawalpindi was the most diverse in terms of no. of species reported as besides M. musculs and M. terricolor the only specimen of M. cookii was also recovered from
Rawalpindi. District Jehlum also showed species diversity but second to Rawalpindi as two species i.e. M. musculus and M. terricolor were captured from this area. While only M. musculus was obtained from all the remaining districts in Pothwar. As far as the subspecies of M. muscculus are concerned, areas of twin cities of Rawalpindi-
Islamabad can be regarded as the richest area of the Pothwar as despite low count of
M. m. domesticus and M. m. musculus this was the only area which contained both sub-species along with widely distributed M. m. castaneus.
District Attock was the second rich area of the Pothwar as two (i.e. M. m. domesticus and M. m. castaneus) out of the three captured sub-spp. were recovered from this district. While single sub-species (M. m. castaneus) was recovered from
M. m. domesticus M. m. musculus M. m. castaneus
94
Fig 4.12: The proportion of different sub-spp. of M. musculus collected from the study area.
CAS4 CAS1 25 % 7 %
CAS2 CAS3 43 % 25 %
Fig 4.13: The proportion of different lineages of M. m. castaneus collected from the study area.
120 %
100 %
80 %
60 % M. cookii 40 % M. tericolor 20 % M. musculus
0 % Cropland Non crop area Human Fallow land settlments
Habitat
Fig 4.14: The proportion of occurrence of three Mus spp. in each habitat type.
95
120% 100% 80% 60 % 40% 20% M. m. domesticus M. m. musculus 0 % M. m. castaneus
Habitat
Fig 4.15: The proportion of occurrence of three sub-species of M. musculus in each habitat type.
60 %
50 %
40 %
30% CAS1 CAS2 20 % CAS3 10% CAS4
0 % Cropland Non crop Human Fallow area settlments land Habitat
96
Fig 4.16: The proportion of occurrence of different lineages of M. m. castaneus in each habitat type.
Chakwal and Jehlum.
At the sub-species level M. m. castaneus didn’t show any visible sign of geographical segregation as it was distributed throughout the Pothwar. Geographical segregation was not much obvious among the four sub-lineages of M. m. castaneus as all of them were reported from all the districts included in the study area except the fact that trapping success was highest in Chakwal and CAS1 was more abundant in Chakwal and RWP (Fig 4.19).
97
120 %
100 %
80 %
60 %
40 % M. musculus
20 % M. terricolor M. cookkii 0 %
Districts
Fig 4.17: The proportion of occurrence of three Mus species in different districts of
Pothwar.
60.00% 50.00% 40.00% 30.00%
20.00% M. m. castaneus 10.00% M. m. domesticus 0.00 % M. m. musculus
Districts
Fig 4.18: The proportion of occurrence of three sub-spp. of M. musculus in different districts of Pothwar.
98
60 % 50% 40% 30% CAS1 20% CAS2 10% CAS3 CAS4 0%
Districts
Fig 4.19: The proportion of occurrence of different CAS lineages in each district in study area.
CONCLUSIONS AND RECOMMENDATIONS
Main findings of the present study are: 99
1. On the basis of molecular analysis M. terricolor, M. cookii, M. m.
musculus, M. m. domesticus, and M. m. castaneus are distributed in
the Pothwar region.
2. Results of molecular and morphological analysis are well
concordant.
3. According to the study of ecological and geographical distribution, cropland proved to be the most preferred habitat while district of
Rawalpindi was the most diverse region within the study area.
This study tried to provide validated information about the Mus fauna of
Pothwar by removing few ambiguities about the occurrence of many previously reported species and led to the conclusion that several Mus taxa and groups are intermingled in the Pothwar region especially co-existence of different CAS lineages within same geographical area was evident by the present study which were previously known to have a non-overlapping geographical distribution. In this way this study explores the diversity and “polytypic character” of M. m. castaneus i.e. it is represented by more than one genetic entity and morphological forms. This view has been strengthened by the tremendous coat colour variation found in this sub- species. This study supports the view held by some other authors that long debated
M. m. bactrianus seems to be the part of high mtDNA diversity present among M. m. castaneus populations of Pakistan and northwest India. Moreover,
84 capture of M. cookii specimen during this study also provides clue about the range expansion of this species which is very interesting as this species was previously never reported from Pakistan or from western parts of Asia and thus provides insight 100 for future endeavours focusing on this subject. Overall, this study led to the following recommendations:
1. Taxonomy of Mus of Pakistan is complicated due to plethora of
historic names and there is strong need to sequence available type
specimens to match name with the genotype.
2. More extensive sampling throughout Pakistan is recommended
involving robust specimen identification.
3. More genetic markers (Maternal, paternal, biparental) should be used
for genetic characterization.
4. It is recommended that researchers studying Mus in agricultural and
ecological context collect tissue samples for genetic identification.
Moreover, as members of the genus Mus are major agricultural pests, this study provided basic information about the distribution and species richness of Mus in Pakistan for developing effective and environment friendly programs for inhibiting different Mus populations.
SUMMARY
101
Present study was undertaken to investigate the taxonomic status and diversity of Mus fauna of the Pothwar region. 180 adult mice specimens were collected from different regions of Pothwar during the period extending from
December 2010 through March, 2013. Specimens were subjected to morphological analysis as well as genetic characterization. Total 16 morphometric measurements were recorded from each specimen including five external body measurements and
11 cranial variables. After recording external body measurements, necropsy was done to remove the skull and tail tissue was preserved from each specimen for DNA extraction. Genetic variations among different groups of specimens of subgenus Mus sorted out on the basis of morphological affinities were studied by analysis of cytochrome b gene and mitochondrial CR.
On the basis of phylogeny constructed according to Cytochrome b analysis three Mus species, M. musculus, M. terricolor and M. cookii, three sub-species of M. musculus and four sub lineages of M. m. castaneus (CAS1, CAS2, CAS3 and CAS4) were identified which were also evident by the mtDNA CR analysis from a subset of the data. Three Mus species characterized genetically were also distinguishable on the basis of morphological characters while morphological segregation was not complete at sub species level. Variations revealed at genetic and morphological level were also visible in terms of coat colour. Results of DFA applied to morphological, cranial and coat colour variables exhibited more or less 50-70% isolation between different sub-lineages of M. m. castaneus thus these sub-
86 lineages are not completely distinct morphologically. DFA proved HFL, BW, HBL,
GSL, IFL and ventral coat color as the most distinguishing characters between the sub-lineages. Habitat study showed that cropland was the most diverse and rich 102 habitat harboring all the three collected species of sub-genus Mus. Data about the geographical distribution showed that district Rawalpindi was the most diverse area in terms of no of Mus taxa recovered.
Before this study Pakistan has never been the point of emphasis for any of the phylogenetic studies and small sample size from this important part of its range could not expose the true diversity. So, present study provided clear picture about the
Mus fauna harbored by this important region of range of many Mus species.
LITERATURE CITED
Allchin, B. and R. Allchin. 1997. Origin of a civilization. Viking Penguin India,
New Delhi. 103
Aplin, K. P., H. Suzuki, A. A. Chinen, R. T. Chesser, J. T. Have, S. C. Donnellan,
J. Austin, A. Frost, J. P. Gonzalez, V. Herbreteau, F. Catzeflis and J. Soubrier.
2011. Multiple Geographic Origins of Commensalism and
Complex Dispersal History of Black Rats. PLoS One, 11: 1-20.
Atchley, W., A. Plummer and B. Riska. 1985. Genetics of mandible form in the
mouse. Genetics, 111: 555-577.
Auffray, J. C., E. Tchernov and E. Nevo. 1988. Origine du commensalisme de la
souris domestique (M. m. domesticus) vis- ` a-vis de l’homme. C. R. Acad.
Sci. Paris, 307: 517-522.
Auffray, J. C., E. Tchernov and E. Nevo. 1990. Presence and ecological distribution
of Mus “spretoides” and M. m. domesticus in Israel. Circum-
Mediterranean vicariance in the genus Mus. Z. Saug., 55: 1-10.
Awasthi, M., K. V. Bhat and R. K. Anand. 1998. Genetic Heterogeneity in the
Indian Mus musculus. Biochem. Genet., 36: 7-8.
Awasthi, M., K. V. Bhat and R. K. Anand. 1999. Allozymic variation in four
88 Indian species of genus Mus: a comparative analysis. J. Genet., 78: 6-10
Bennett, D. C. and M. L. Lamoreux. 2003. The color loci of mice a genetic century.
Pigment Cell Res., 16: 333-334.
104
Boissinot, S. and P. Boursot. 1997. Discordant phylogeographic patterns between the
Y chromosome and mitochondrial DNA in the house mouse: selection on the
Y chromosome? Genetics, 146: 1019-1034.
Bonhomme, F., J. B. Davidian, L. Thaler and C. S. Triantaphyllidi. 1978. Sur
l’existence en Europe de quatre groupes de Souris (genre Mus L.) du rang
esp` ece et semi-esp` ece, d´ emontr´ ee par la g´ en´ etique biochimique. C.
R. Acad. Sci. Paris, 287: 631-633.
Bonhomme, F., J. Catalan, J. B. Davidian, V. M. Chapman, K. Moriwaki, E. Nevo
and L. Thaler. 1984. Biochemical diversity and evolution in the genus Mus.
Biochem. Genet., 22: 275-303.
Bonhomme, F. 1986. Evolutionary relationships in the genus Mus. Curr. Top.
Microbiol. Immunol., 127: 19-34.
Bonhomme, F. 1992. Genetic diversity and evolution in the genus Mus. In: D.
Goldwitz, D. Wahlsten, & R. E. Wimer, (eds.), Techniques for genetic
analysis of brain and behavior. Elsevier Science Publishers, Amsterdam,
The Netherlands: p. 41-45.
Bonhomme, F., R. Anand, D. Darviche, W. Din and P. Boursot. 1994. The House
Mouse as a Ring Species? In: K. Moriwaki, (ed.), Genetics in Wild Mice:
Its Application to Biomedical Research. Japan Scientific Societies Press,
Tokyo. p. 13-23.
105
Boursot, P., J. C. Auffray, J. B. Davidian and F. Bonhomme. 1993. The Evolution of
House Mice. Ann. Rev. Ecol. Syst., 24: 119-152.
Boursot, P., W. Din, R. Anand, D. Darviche, B. Dod, F. V. Deimling, G. Talwar and
F. Bonhomme. 1996. Origin and radiation of the house mouse:
mitochondrial DNA phylogeny. J. Evol. Biol., 9: 391-415.
Bresin, A., S. Kiliardis and K. G. Strid. 1999. Effect of masticatory function on the
internal bone structure in the mandible of the growing rat. Eur. J. Oral. Sci.,
107: 35-44.
Brooks, J. E., E. Ahmad and I. Hussain. 1988. Damages by vertebrate pests to
groundnut in Pakistan. In: A. C. Crab & R. E. Marsh, (eds.), Proceedings of
the 13th Vertebrates Pest Conference. University of California: Davis, CA. p.
129-133.
Burtt, E. and H. Jr. 1981. The adaptiveness of animal colors. Bioscience, 31: 723-
729. Campbell, N. J., F. C. Harriss, M. S. Elephinstone and P. R. Baverstock. 1995.
Outgroup heteroduple analysis using temperature gradient
gel
electrophoresis: high resolution, large scale, screening of DNA variation in
the mitochondrial control region. Mol. Ecol., 4: 407-418.
Cardini, A. 2003. The geometry of the marmot (Rodentia, Sciuridae) mandible:
phylogeny and patterns of morphological evolution. Syst. Biol., 52: 186-
205. 106
Catzeflis, F. M. and C. Denys. 1992. The African Nannomys (Muridae): An early
offshoot from the Mus. Evidence from scnDNA hybridization experiments
and compared morphology. Isr. J. Zool., 38: 219-231.
Chakravarthy, A. K., Y. G. Shadakshri and E. Gangappa. 1992. Rodent damage to
rice germplasm in Mudigere, Karnataka. Rodent Newl., 16: 6-6.
Chandrahas, R. K. 1974. Ecology of the brown spiny mouse Mus platythrix
(Bennett) and the Indian field mouse Mus booduga (Gray). Indian J. Med.
Res., 62: 264-280.
Chevret, P., P. Jenkins and F. Catzeflis. 2003. Evolutionnary systematics of the
Indian mouse Mus famulus: molecular (DNA/DNA hybrization and 12S
rRNA sequences) and morphological evidence. Zool. J. Linn. Soc., 137:
385-401. Chevret, P., F. Veyrunes and J. B. Davidian. 2005. Molecular phylogeny of the genus
Mus (Rodentia: Murinae) based on mitochondrial and nuclear data.
Biol. J. Linn. Soc., 84: 417-427.
Chou, C. W., P. F. Lee, K. H. Lu and H. T. Yu. 1998. A population study of house
mice (M. m. castaneus) inhabiting rice graineries in Taiwan. Zool. Stud.,
37: 201-212.
Cloudsley-Thompson, J. L. 1999. Multiple factors in the evolution of animal
coloration. Naturwissenschaften, 86: 123-132.
107
Corti, M. and C. Fadda. 1996. Systematics of Arvicanthis (Rodentia, Muridae) from
the Horn of Africa. A geometric morphometrics evaluation. Int. J.
Zool., 63: 185-192.
Corti, M., C. Fadda, S. Simson, and E. Nevo. 1996. Size and shape variation in the
mandible of the fossorial rodent Spalax ehrenbergi. A procrustes analysis in
three dimensions. In: L. F. Marcus, M. Corti, A. Loy, G. J. P. Naylor & D. E.
Slice, (eds.), Advances in Morphometrics. Plenum Press, New York. p.
303-320.
Corti, M., M. Aguilera and E. Capanna. 1998. Phylogeny, size and shape changes in
the skull of the South American rodent Proechimys. Acta. Zool. Acad.
Sci. Hungary, 44: 139-150.
Cucchi, T., A. Orth, J. C. Auffray, S. Renaud, L. Fabre, J. Catalan, E. Hadjisterkotis,
F. Bonhomme and J. D. Vigne. 2006. A new endemic species of the genus
Mus (Rodentia, Mammalia) on the island of Cyprus.
Zootaxa, 1241: 1-36.
Darviche, J. and P. Orsini. 1982. Criteres de diff´ erenciation morphologique et biom´
etrique de deux esp` eces de souris sympatriques: Mus spretus et M.
m. domesticus. Mammalia, 46: 205-217.
Darvish, J. 1988. Discrimination of different subspecies of house mouse Mus
musculus from Eurasia and North Africa on the basis of their morphometric
characteristics. IJBIO., 7: 49-71.
108
Darvish, J. 1997. Morphological studies of denttary and skull of house mouse (M.
musculus L.) from Eurasia and North Africa. Iranian Journal of Biology, 4(1):
84-110.
Darvish, J. 2004. Analysis of morphological variations of molars teeth of house
mouse Mus musculus 1766 of Eastern Iranian and their relative oldness in
comparison with Mediterranean basin house mouse. IJBIO., 16: 13-19.
Darvish, J., A. Orth and F. Bonhomme. 2006. Genetic transition in the house mouse,
Mus musculus of Eastern Iranian Plateau. Folia Zool., 55(4): 349-
357.
Darvish, J. 2008. Biosystematic approach to geographic variations of house mouse
group, Mus musculus (L.1766). IJAB., 4: 31-54.
David, B. and B. Laurin. 1996. Morphometrics and cladistics: measuring phylogeny in
the sea urchin Echinocardium. Evolution, 50: 348-359.
Davidian, J. B., J. Catalan, M. G. Ramalhinho, G. Ganem, J. C. Auffray, R. Capela,
M. Biscoito, J. Searle and M. L. Mathias. 2000. Rapid chromosomal
evolution in island mice. Nature, 403: 158-158.
Davis, A. K. 2010. A technique for rapidly quantifying mammal hair morphology for
zoological research. Folia Zool., 59(2): 87-92.
Ehrich, T. H., T. T. Vaughn, S. F. Koreishi, R. B. Linsey, L. S. Pletscher and J. M. 109
Cheverud. 2003. Pleiotropic effects on mandibular morphology I.
Developmental morphological integration and differential dominance. J.
Exp. Zool., 296: 58-79.
Frisman, L. V., K. V. Korobitsina, L. V. Yakimenko, F. M. Bokshtein and A. I.
Muntyanu. 1990. Genetic differentiation of U.S.S.R. house mice:
Electrophoretic study of proteins. Biol. J. Linn. Soc., 41: 65-72.
Gerasimov, S., H. Nikolov, V. Mikailova, J. C. Auffray and F. Bonhomme. 1990.
Morphometric stepwise discriminant analysis of the five genetically
determined European taxa of the genus Mus. Biol. J. Linn. Soc., 41: 47-64.
Hansen, T. F. 1997. Stabilizing selection and the comparative analysis of adaptation.
Evolution, 51: 1341-1351.
Harpending, H. C. 1994. Signature of ancient population growth in a lowresolution
mitochondrial DNA mismatch distribution. Human Biol., 66:
591-600.
Hillis, D. M. 1987. Molecular versus morphological approaches to systematics.
Annu. Rev. Ecol. Syst., 18: 23-42.
Hoekstra, H. E., K. E. Drumm and M. W. Nachman. 2004. Ecological genetics of
adaptive color polymorphism in pocket mice: geographic variation in selected
and neutral genes. Evolution, 58: 1329-1341.
Hunt, W. G. and R. K. Selander. 1973. Biochemical genetics of hybridization in
European house mice. Heredity, 31: 11-33. 110
Jouvin-Marche, E., A. Cuddihy, S. Butler, J. N. Hansen, W. M. Fitch and S. Rudikoff.
1988. Modern evolution of a single-copy gene: The
immunoglobulin Ck locus in wild mice. Mol. Biol. Evol., 5: 500-511.
Kijas, J. M., H. R. Wales, A. To¨rnsten, P. Chardon, M. Moller and L. Andersson.
1998. Melanocortin receptor 1 (MC1R) mutations and coat color in pigs.
Genetics, 150: 1177-1185.
Klingenberg, C. P., L. J. Leamy, E. J. Routman and J. M. Cheverud. 2001. Genetic
architecture of mandible shape in mice: effects of quantitative trait loci
analyzed by geometric morphometrics. Genetics, 157: 785-802.
Klingenberg, C. P. 2010. Evolution and development of shape: integrating
quantitative approaches. Nat. Rev. Genetics, 11: 623-635.
Lai, Y. C., T. Shiroshi, K. Moriwaki, M. Motokawa and H. T. Yu. 2008. Variation
of coat color in house mice throughout Asia. J. of Zoology, 274: 270-276.
Long, A. D. and R. S. Singh. 1995. Molecules versus morphology: the detection of
selection acting on morphological characters along a cline in Drosophila
melanogaster. Heredity, 74: 569-581.
Louis, B. and T. Diethard. 2011. Micro-evolutionary divergence patterns of mandible
shapes in wild house mouse (Mus musculus) populations. Evol.
Biol., 11: 306-321.
111
Lundrigan, B. L., S. A. Jansa and P. K. Tucker. 2002. Phylogenetic relationships in
the genus Mus, based on paternally, maternally, and biparentally inherited
characters. Syst. Biol., 51: 410-431.
Macholán, M. 2008. The mouse skull as a source of morphometric data for phylogeny inference. Zool. Anz., 247: 315-327.
Macholán, M., O. Mikula and V. Vohralík. 2008. Geographic phenetic variation of two eastern-Mediterranean non-commensal mouse species, Mus macedonicus and
Mus cypriacus (Rodentia: Muridae) based on traditional and geometric approaches to morphometrics. Zool. Anz., 247: 76-80.
Marshall, J. T. 1977. A synopsis of Asian species of Mus (Rodentia, Muridae).
Bull. Am. Mus. Nat. Hist., 158: 174-220.
Marshall, J. T. 1998. Identification and scientific names of Eurasian house mice and
their European allies, subgenus Mus (Rodentia: Muridae). Privately
published. Available from author at National Museum of Natural History.
Washington, DC.
Matthey. R. and F. Petter. 1968. Existence de deux
especes I'une chromosomiquement polmorphe, chez des Mus Indiens
du groupe booduga.
Etude cytogenetique et taxonomique. Rev Suisse de Zool., 75: 461-498.
Mauk, C. L., M. A. Houck and R. D. Bradley. 1999. Morphometric analysis of seven
species of pocket gophers (Geomys). J. Mammal., 80: 499-511.
112
Michaux, J. and P.Chevret. 2007. Morphological diversity of Old World rats and
mice (Rodentia, Muridae) mandible in relation with phylogeny and
adaptation. J. Zool. Syst. Evol. Res., 45(3): 263-279.
Mitteroecker, P. and P. Gunz. 2009. Advances in geometric morphometrics. Evol. Biol., 36: 235-247.
Moro, D., N. J. Campbell, M. S. Elphinstone and P. R. Baverstock. 1998. The
Thevenard Island Mouse: Historic and conservation Implications from
Mitochondrial DNA sequence-variation. Pac. Conserv. Biol., 4: 282-288.
Muntyanu, A. I. 1990. Ecological features of an overwintering population of the
hillock mouse (M. h. nordm.) in the southwest of the U.S.S.R. Biol. J. Linn.
Soc., 41: 73-82.
Musser, G. G. and M. D. Carleton. 1993. Family Muridae. In: D. E. Wilson & D.
M. Reeder, (eds.), Mammal species of the world. (Smithsonian Institution
Press, Washington, D.C. 501-755.
Nason, E. S. 1948. Morphology of hair of eastern North American bats. Am.
Midland Nat., 39-64.
Nunome, M., C. Ishimori, K. P. Aplin, K. Tsuchiya, H. Yonekawa, K. Moriwaki and
H. Suzuki. 2010. Detection of recombinant haplotypes in wild mice
(Mus musculus) provides new insights into the origin of Japanese mice.
Molecular Ecology, 19: 2474-2489.
113
Orsini, P., F. Bonhomme, J. B. Davidian, H. Croset, S. Gerasimov and L. Thaler.
1983. Le complexe d’esp` eces du genreMus en Europe Centrale et Orientale.
Z. Saug., 48: 86-95.
Parshad, V. R., N. Ahmad and G. Chopra. 1987a. Deterioration of poultry farm
environment by commensal rodents and their control. Int. Biodet., 23: 29-
46.
Parshad, V. R., C. S. Malhi, N. Ahmad and B. Gupta. 1987b. Rodent damage and
control in peanut in India. Peanut Sci., 14: 4-6.
Parshad, V. R. 1987c. Rodent damage and control in sugarcane. Indian Sugar, 37:
341-345.
Parshad, V. R., M. S. Saini, N. Ahmad and C. S. Malhi. 1994. Food contamination by
commensal rodents in Ludhiana: a preliminary report. Pestology, 18: 30-
32.
Pialek, J., H. C. Hauffe, J. B. Searle. 2005. Chromosomal variation in the house
mouse. Biol. J. Linn. Soc., 84: 535-563.
Pocock, M. J. O. and N. Jennings. 2006. Use of hair tubes to survey for shrews:
new methods for identification and quantification of abundance. Mammal
Rev., 36: 299-308.
114
Polly, P. D. 2003. Paleophylogeography of Sorex araneus: molar shape as a morphological marker for fossil shrews. Mammalia, 68: 233-243.
Possehl, G. L. 1996. Mehrgarh. In: B. M. Fagan, (ed.), The Oxford Companion to
Archaeology. Oxford Univ. Press, Oxford, 437-438.
Prager, E. M., H. Tichy and R. D. Sage. 1996. Mitochondrial DNA sequence
variation in the eastern house mouse, Mus musculus: comparison with other
house mice and report of a 75-bp tandem repeat. Genetics, 143: 427-446.
Prager, E. M., C. Orrego and D. R. Sage. 1998. Genetic Variation and
phylogeography of Central Asian and Other House Mice, Including a Major
New Mitochondrial Lineage in Yemen. Genetics, 150: 835-861.
Rajabi-Maham, H., A. Orth, R. Siahsarvie, P. Boursot, J. Darvish, and F.
Bonhomme. 2012. The south-eastern house mouse Mus musculus castaneus
(Rodentia: Muridae) is a polytypic subspecies. Biol. J. Linn. Soc., 107: 295-
306.
Rana, S. A. 1991. Biology and taxonomic status of little Indian field mouse in Punjab.
(Unpublished) Ph. D. thesis, Univ. of Agriculture Faisalabad: 176 pp.
Rangareddy, A. 1994. Rodent management in cereal crops with reference to rice.
Paper presented to the Apex Level Rodent Control Training, ICAR, NEH
Complex, Barapani, Shillong. 86-92. Rao, A. M. K. and M. Balasubramanyam. 1992. The Mice, Mus spp. In: I. Prakash
& P. K. Ghosh, (eds.), Rodents in Indian Agriculture. Jodhpur Scientific
Publishers: p. 147-164. 115
Renaud, S., J. R. Michaux, P. Mein, J. P. Aguilar and J. C. Auffray. 1999. Patterns
of size and shape differentiation during the evolutionary radiation of the
European Miocene murine rodents. Lethaia., 32: 61-71.
Renaud, S. and J. R. Michaux. 2003. Adaptive latitudinal trends in the mandible
shape of Apodemus wood mice. J. Biogeogr., 30: 1617-1628.
Renaud, S., J. Michaux, D. N. Schmidt, J. P. Aguilar, P. Mein and J. C. Auffray.
2005. Morphological evolution, ecological diversification and climate change
in rodents. Proc. R. Soc. Lond. Biol. Sci., 272: 609-617.
Renaud, S. and J. C. Auffray. 2009. Adaptation and plasticity in insular evolution of
the house mouse mandible. J. Zool. Evol. Res., 48: 138-150.
Renaud, S. and J. C. Auffray. 2010. Epigenetic effects on the mouse mandible:
common features and discrepancies in remodeling due to muscular dystrophy
and response to food consistency. Evol. Biol., 10: 28-41.
Roberts, T. J. 1977. The mammals of Pakistan, 2nd Ed. Oxford University Press,
Karachi. 262-266.
Sahajpal, V., S. P. Goyal, R. Jayapal, K. Yoganand and M. K. Thakar. 2008. Hair charecteristics of four Indian bear species. Sci. Justice, 48: 8-15.
Satoh, K. 1997. Comparative functional morphology of mandibular forward
movement during mastication of two murid rodents, Apodemus speciosus
(Murinae) and Clethrionomys rufocanus (Arvicolinae). J. Morphol., 231: 116
131-142.
Schneider, S., D. Roessli and L. Excoffier. 2000. Arlequin Ver 2001: software for
population genetics data analysis, University of Geneva, Switzerland.
Selander, R. K., W. G. Hunt and S. Y. Yang. 1969. Protein polymorphismand genetic
heterozygosity in two European subspecies of the house mouse.
Evolution, 23: 379-390.
She, J. X., F. Bonhomme, P. Boursot, L. Thaler and F. Catzeflis. 1990. Molecular
phylogeniesi in the genus Mus: comparative analysiso fprotein
electrophoresiss, cn DNA hybridization, and mt DNA RFCP data. Biol. J.
Linn. Soc., 41: 83-103.
Shimada, T., K. P. Aplin, P. Jenkins and H. Suzuki 2007. Rediscovery of Mus
nitidulus Blyth (Rodentia: Muridae), an endemic murine rodent of the central
basin of Myanmar. Zootaxa, 1498: 45-68.
Siddiqi, M. S. 1969. Fauna of Pakistan. Agricultural Research Council, Govt. of Pakistan, Islamabad, Pakistan.
Simmons, N. B. and T. M. Conway. 2001. Phylogenetic relationships of mormoopid
bats (Chiroptera: Mormoopidae) based on morphological data.
Bull. Am. Mus. Nat. Hist., 258: 1-97.
117
Singh, S., N. Cheong, G. Narayan and T. Sharma. 2009. Burrow characteristics of
the co-existing sibling species Mus booduga and Mus terricolor and the
genetic basis of adaptation to hypoxic/hypercapnic stress. BMC Ecology, 9:
6-9.
Slabova, M. and D. Frynta. 2007. Morphometric variation in nearly unstudied
populations of the most studied mammal: the non-commensal house mouse
(Mus musculus domesticus) in the Near East and Northern Africa. Zool.
Anz., 247: 91-101.
Sourrouille, P., C. Hanni, M. Ruedi and F. M. Catzeflis. 1995. Molecular systematics
of Mus crociduroides, an endemicmouse of Sumatra (Muridae:
Rodentia). Mammalia, 59: 91-102.
Steppan, S. J. 1998. Phylogenetic relationships and species limits within Phyllotis
(Rodentia: Sigmodontinae. Concordance between mtDNA sequence and
morphology. J. Mammal., 79: 573-593.
Suzuki, H., T. Shimada, M. Terashima, K. Tsuchiya and K. Aplin. 2004. Temporal, spatial, and ecological modes of evolution of Eurasian Mus based on mitochondrial and nuclear gene sequences. Mol. Phylogenet. Evol., 33:
626-646.
Suzuki, H., M. Nunome, G. Kinoshita1, K. Aplin, P. Vogel, A. Kryukov, M. L. Jin,
S. H. Han, I. Maryanto, K. Tsuchiya, H. Ikeda, T. Shiroishi, H. Yonekawa
and K. Moriwaki. 2013. Evolutionary and dispersal history of Eurasian house 118
mice Mus musculus clarified by more extensive geographic sampling of
mitochondrial DNA. Heredity, 1-16.
Taber, R. D., A. N. Sheri and M. S. Ahmad.1967. Mammals of the Lyallpur
Region, West Pakistan. J. Mammal., 48(3): 392-407.
Thaler, L., F. Bonhomme, J. B. Davidian, and M. Hamar. 1981. The house mouse
complex of species: Sympatric occurrence of biochemical groups Mus 2 and
Mus 4 in Rumania. Z. Saug., 46:169-173.
Thaler, L. 1986. Origin and evolution of mice: An appraisal of fossil evidence and
morphological traits. Curr. Top. Microbiol. Immunol., 127: 3-11.
Torrance, A. W. 1997. Evolution, phylogeny, biogeography, and diversification of
the Australasian Hydromyinae. (Unpublished) Ph. D. thesis, Harvard
University Cambridge: 106 pp.
Tumilson, R. 1983. An annotated key to the dorsal guard hairs of Arkansas game mammals and furbearers. Southwest. Nat., 28: 315-323.
Velzen, V. J., N. Bouton and R. Zandee. 1998. A procedure to extract phylogenetic
information from morphometric data. Neth. J. Zool., 48: 305-322.
Veyrunes, F., J. Catalan, B. Sicard, T. J. Robinson, J. M. Duplantier, L. Granjon, G.
Dobigny, J. B. Davidian. 2004 Autosome and sex chromosome diversity
among the African pygmy mice, subgenus Nannomys (Muridae; Mus).
Chromosome Res., 12: 369-382. 119
Veyrunes, F., J. B. Davidian, T. J. Robinson, E. Calvet, C. Denys, P. Chevret.
2005. Molecular phylogeny of the African pygmy mice, subgenus Nannomys
(Rodentia, Murinae, Mus): implications for chromosomal evolution. Mol.
Phylogenet. Evol., 36: 358-369.
Willmore, K. E., L. Leamy and B. Hallgrimsson. 2006. Effects of developmental and
functional interactions on mouse cranial variability through late ontogeny.
Evolution and development, 8(6): 550-567.