KNIME Bioinformatics Extensions

Total Page:16

File Type:pdf, Size:1020Kb

Load more

KNIME Bioinformatics Extensions Karol Kozak ETH Zurich January 2011, Zurich, KNIME SIG your name Start HCS your name HCS Experiments and Informatics your name HCS & Open Source HCDB – OpenBIS & Library Database Bioinformatics KNIME KNIME Matlab Off-Target LIMS WEKA Nodes KNIME, Java Cell Classifiers Spotfire KNIME KNIME Matlab your name Research interest Role Software Classification Database engineering + RNA technology Pattern understanding modeling recognition Annotation database Role of Bioinformatics in RNAi technology to detect functionality of Off-target genes in mammalian cells prediction -New prediction algorithms including Kernel methods -Post analysis of existing hits 2D/3D Structure relationships -Traditional bioinformatics: homology, blast, alignment score -Database development Gene functionality your name RNAi Libraries - Genome wide - Functional groups (Kinases..) - n - Ologinucleotides - Pooled your name RNAi Libraries - Qiagen - Thermo Fisher Scientific (Dharmacon) - Applied Biosystems (Ambion) - Sigma-Aldrich (esiRNA) your name RNAi Library evlolution V1 Purchase Sigma esiRNA AppBiosyst Qiagen TFisher annot annot annot Annot database database database database V2 Dharmacon annot TIME database V3 Less genes Dharmacon More known oligo Today annot New design database Transcripts analysis Off-target information your name Annotation of human genome & Meier Roger Reliability of siRNA libraries Qiagen genome wide siRNA library (HsDgV3 (Human Druggable Genome siRNA Set V3); HsNmV1 (Human Refseq Xm siRNA Set V1); HsXmV1 (Human Predicted genome Set V1)) 2006: 22’832 genes / 90’728 siRNAs 2010: 16’199 genes 0.07 % 0.11 % 0.01 % 0.23 % 0.01 % % of genes target by: 12.512.5% % 10.310.3% % 1 siRNA 2 siRNA 30.630.6% % 41 % 3939% % 3 siRNA 16.516.5% % 41% 25.625.6% % 4 siRNA 71 % 5 siRNA 71% 6 siRNA 3333% % 7 siRNA 2020% % 8 siRNA 9 siRNA target genes with off target(s) siRNAs with off target(s) wrong predicted genes siRNAs against wrong predicted genes target genes siRNAs w/o off target(s) your name Based on GENEID your name Annotated off-target by companies How did companies select these off targets siRNA ? - There are eliminated a lot of Ribosomal siRNA - There are eliminated a lot of siRNA against "membrane" proteins (2061 in old list, 945 in clean list) - did not eliminate many siRNA against "kinase" proteins (2624 in old list, 1605 in list) - besides the 2800 proteins that there are discarded slightly enriched in virus related pathways your name Library reduction • siRNA without geneID? • The web site shows the gene that the siRNA matched at the time it was selected. The database table from which we get current annotation shows what the siRNA matches in the current Refseq. your name Library handling From pooled 2 Oligo based Library analysis your name Bioinformatics - RNAi -Off-target effect UUGCCGUACAGGAUGGACGtg UUAACUGAUGUUCCAAUCCtg your name Sandra Kaestner Bioinformatics your name Bioinformatics your name Workflow your name Project Ribosome biogenesis translation of ribosomal proteins maturation and export of 80S ribosome ribosomal mRNAs ribosomal proteins 80S ribosome Pol II mRNA mature 40S subunit transcription of ribosomal mRNAs maturation and export of pre-40S particle mature 60S subunit pre-40S particle final maturation 90S particle pre-60S particle large ribosomal proteins Pol I Pol III maturation and 35S rRNA 5S rRNA export of pre-60Sparticle small ribosomal rDNA proteins transcription of ribosomal RNAs trans-acting nucleolus nucleoplasm cytoplasm factors 18S rRNA maturation 18S 5.8S 25S 18S 18S 18S 35S rRNA 23S rRNA 20S rRNA 20S rRNA 18S rRNAyour name Thomas Wild The Rps2-YFP read out 80S ribosome ribosomal proteins 80S ribosome mature 40S subunit mature 60S subunit Nucleolus Nucleoplasm Cytoplasm your name The Rps2-YFP read out 80S ribosome ribosomal proteins 80S ribosome mature 40S subunit mature 60S subunit Nucleolus Nucleoplasm Cytoplasm your name The Rps2-YFP read out 80S ribosome ribosomal proteins 80S ribosome mature 40S subunit mature 60S subunit Nucleolus Nucleoplasm Cytoplasm your name The Rps2-YFP read out 80S ribosome ribosomal proteins 80S ribosome mature 40S subunit mature 60S subunit Nucleolus Nucleoplasm Cytoplasm your name Biogenesis siRNA 84062- DTNBP1 AACCTTCAAAGCTGAACTAGA DTNBP1 HCDC RPS3 Transcript NM_001005 your name Results Biogenesis Results RNAi RNAi Library Hit Library + Results = Wonder Eg. 4 oligo Hit LIST Off-target Real in HIT LIST Off-target in Potential Off-targets Hit LIST Results HIT LIST your name Analysis Off targets Known Off-targets Build model your name AllStars MVP_si03 MVP_si06 Uncoating Acidification AllStars si03 si06 MVP Tubulin your name Virus screen 1 out of 3 siRNA TGGGCCTGAGATGCAGGTAAA MVP NM_003010 HCDC Qiagen off-target SM MAP2K4 MAP2K4 6416|NM_003010|2890|AS your name mRNA 2D variants mRNA siRNA - 2D structure relation to Off-target effects - We can model 2D structures quite robust (Metaserver, Python) - We can predict potential-target effects - We must find relation? your name mRNA We want to identify structural motifs in a set of mRNA sequences your name mRNA 3D Structure Nature Movie Nature Movie - Dicer, tRNA, - Off-target relations RNA-RNA i RNP-RNA - Model how RISC is related to microRNA/siRNA and how it finds own target and bind to him your name RNA 3D your name your name Workflow ModeRNA Python BioPython for parsing structural data from the PDB format your name DatabaseHCS and architecture databases (LIMS) Library and annotation But need maintenance Screening experiment Sample, Results, Management, View Done Public database Phenotypic data your name OpenBis - Open Source database your name Screen DB Open Source database HCDB - OpenBIS your name Open Source database OpenBIS (ETH) -web client -Command line client -Java technology, GWT Google your name Screen DB Open Source database HCDB - OpenBIS your name Screen DB Open Source database HCDB - OpenBIS Adam Srebniak your name Screen DB Open Source database HCDB - OpenBIS your name Image Processing and KNIME your name Adam Srebniak Open Source KNIME WEB DESKTOP your name Dharmaco Qiagen Ambion nannot annot Annot database database database Library Oligo dharmacon Oligo qiagen Oligo ambion files With target gene With target gene With target gene www External databases Gene Cross reference database for gene/oligo annotation + Workflow off-target prediction OpenBis your name Image Processing One of the first Open Source: CellProfiler your name High Content Image Processing (HCIP) your name High Content Image Processing (HCIP) your name Teaching module Slawek Mazur your name HCDC-HITS Bio-Formats developed by OME software (Jason Swedlow), UW-Madisonyour name LOCI and Glencoe Software. Gabor Bakos HCDC-HITS your name Gabor Bakos HCDC-HITS your name HCDC-HITS your name HCDC-HITS your name Visualization Improvement your name Lukasz Zwolinski, ETH – PWR Student Acknowledgement Bioquant Heidelberg and ETH Holger Erfle, Karol Kozak, Berend Rind Juergen Reymann, Gabor Csucs, Adam Srebniak Slawek Mazur, Sandra Kaestner Welcome to join TU Konstanz Trinity College IR MPI-IB, Berlin DE TU Breslau: Dorit Merhof Anthony Davies Peter Braun Karol Kozak Andre Maeurer Lukasz Miroslaw your name .
Recommended publications
  • Text Mining Course for KNIME Analytics Platform

    Text Mining Course for KNIME Analytics Platform

    Text Mining Course for KNIME Analytics Platform KNIME AG Copyright © 2018 KNIME AG Table of Contents 1. The Open Analytics Platform 2. The Text Processing Extension 3. Importing Text 4. Enrichment 5. Preprocessing 6. Transformation 7. Classification 8. Visualization 9. Clustering 10. Supplementary Workflows Licensed under a Creative Commons Attribution- ® Copyright © 2018 KNIME AG 2 Noncommercial-Share Alike license 1 https://creativecommons.org/licenses/by-nc-sa/4.0/ Overview KNIME Analytics Platform Licensed under a Creative Commons Attribution- ® Copyright © 2018 KNIME AG 3 Noncommercial-Share Alike license 1 https://creativecommons.org/licenses/by-nc-sa/4.0/ What is KNIME Analytics Platform? • A tool for data analysis, manipulation, visualization, and reporting • Based on the graphical programming paradigm • Provides a diverse array of extensions: • Text Mining • Network Mining • Cheminformatics • Many integrations, such as Java, R, Python, Weka, H2O, etc. Licensed under a Creative Commons Attribution- ® Copyright © 2018 KNIME AG 4 Noncommercial-Share Alike license 2 https://creativecommons.org/licenses/by-nc-sa/4.0/ Visual KNIME Workflows NODES perform tasks on data Not Configured Configured Outputs Inputs Executed Status Error Nodes are combined to create WORKFLOWS Licensed under a Creative Commons Attribution- ® Copyright © 2018 KNIME AG 5 Noncommercial-Share Alike license 3 https://creativecommons.org/licenses/by-nc-sa/4.0/ Data Access • Databases • MySQL, MS SQL Server, PostgreSQL • any JDBC (Oracle, DB2, …) • Files • CSV, txt
  • Imagej2-Allow the Users to Use Directly Use/Update Imagej2 Plugins Inside KNIME As Well As Recording and Running KNIME Workflows in Imagej2

    Imagej2-Allow the Users to Use Directly Use/Update Imagej2 Plugins Inside KNIME As Well As Recording and Running KNIME Workflows in Imagej2

    The KNIME Image Processing Extension for Biomedical Image Analysis Andries Zijlstra (Vanderbilt University Medical Center The need for image processing in medicine Kevin Eliceiri (University of Wisconsin-Madison) KNIME Image Processing and ImageJ Ecosystem [email protected] [email protected] The need for precision oncology 36% of newly diagnosed cancers, and 10% of all cancer deaths in men Out of every 100 men... 16 will be diagnosed with prostate cancer in their lifetime In reality, up to 80 will have prostate cancer by age 70 And 3 will die from it. But which 3 ? In the meantime, we The goal: Diagnose patients that have over-treat many aggressive disease through Precision Medicine patients Objectives of Approach to Modern Medicine Precision Medicine • Measure many things (data density) • Improved outcome through • Make very accurate measurements (fidelity) personalized/precision medicine • Consider multiple perspectives (differential) • Reduced expense/resource allocation through • Achieve confidence in the diagnosis improved diagnosis, prognosis, treatment • Match patients with a treatment they are most • Maximize quality of life by “targeted” therapy likely to respond to. Objectives of Approach to Modern Medicine Precision Medicine • Measure many things (data density) • Improved outcome through • Make very accurate measurements (fidelity) personalized/precision medicine • Consider multiple perspectives (differential) • Reduced expense/resource allocation through • Achieve confidence in the diagnosis improved diagnosis,
  • KNIME Workbench Guide

    KNIME Workbench Guide

    KNIME Workbench Guide KNIME AG, Zurich, Switzerland Version 4.4 (last updated on 2021-06-08) Table of Contents Workspaces . 1 KNIME Workbench . 2 Welcome page . 4 Workflow editor & nodes . 5 KNIME Explorer . 13 Workflow Coach . 35 Node repository . 37 KNIME Hub view . 38 Description. 40 Node Monitor. 40 Outline. 41 Console. 41 Customizing the KNIME Workbench . 42 Reset and logging . 42 Show heap status . 42 Configuring KNIME Analytics Platform . 43 Preferences . 43 Setting up knime.ini. 47 KNIME runtime options . 49 KNIME tables . 55 Data table . 55 Column types. 56 Sorting . 59 Column rendering . 59 Table storage. 61 KNIME Workbench Guide This guide describes the first steps to take after starting KNIME Analytics Platform and points you to the resources available in the KNIME Workbench for building workflows. It also explains how to customize the workbench and configure KNIME Analytics Platform to best suit specific needs. In the last part of this guide we introduce data tables. Workspaces When you start KNIME Analytics Platform, the KNIME Analytics Platform launcher window appears and you are asked to define the KNIME workspace, as shown in Figure 1. The KNIME workspace is a folder on the local computer to store KNIME workflows, node settings, and data produced by the workflow. Figure 1. KNIME Analytics Platform launcher The workflows and data stored in the workspace are available through the KNIME Explorer in the upper left corner of the KNIME Workbench. © 2021 KNIME AG. All rights reserved. 1 KNIME Workbench Guide KNIME Workbench After selecting a workspace for the current project, click Launch. The KNIME Analytics Platform user interface - the KNIME Workbench - opens.
  • Data Analytics with Knime

    Data Analytics with Knime

    DATA ANALYTICS WITH KNIME v.3.4.0 QUALIFICATIONS & EXPERIENCE ▶ 38 years of providing professional services to state and local taxing officials ▶ TMA works exclusively with government partners WHO ▶ TMA is composed of 150+ WE ARE employees in five main offices across the United States Tax Management Associates is a professional services firm that has ▶ Our main focus is on revenue served the interests of state and local enhancement services for state government since 1979. and local jurisdictions and property tax compliance efforts KNIME POWERED CUSTOM ANALYTICS ▶ TMA is a proud KNIME Trusted Consulting Partner. Visit: www.knime.org/knime-trusted-partners ▶ Successful analytics solutions: ○ Fraud Detection (Michigan Department of Treasury) ○ Entity Discovery (multiple counties) ○ Data Aggregation (Louisiana State Tax Commission) KNIME POWERED CUSTOM ANALYTICS ▶ KNIME is an open source data toolkit ▶ Active development community and core team ▶ GUI based with scripting integration ○ Easy adoption, integration, and training ▶ Data ingestion, transformation, analytics, and reporting FEATURES & TERMINOLOGY KNIME WORKBENCH TAX MANAGEMENT ASSOCIATES, INC. KNIME WORKFLOW TAX MANAGEMENT ASSOCIATES, INC. KNIME NODES TAX MANAGEMENT ASSOCIATES, INC. DATA TYPES & SOURCES DATA AGNOSTIC ▶ Flat Files ▶ Shapefiles ▶ Xls/x Reader ▶ HTTP Requests ▶ Fixed Width ▶ RSS Feeds ▶ Text Files ▶ Custom API’s/Curl ▶ Image Files ▶ Standard API’s ▶ XML ▶ JSON TAX MANAGEMENT ASSOCIATES, INC. KNIME DATA NODES TAX MANAGEMENT ASSOCIATES, INC. DATABASE AGNOSTIC ▶ Microsoft SQL ▶ Oracle ▶ MySQL ▶ IBM DB2 ▶ Postgres ▶ Hadoop ▶ SQLite ▶ Any JDBC driver TAX MANAGEMENT ASSOCIATES, INC. KNIME DATABASE NODES TAX MANAGEMENT ASSOCIATES, INC. CORE DATA ANALYTICS FEATURES KNIME DATA ANALYTICS LIFECYCLE Read Data Extract, Data Analytics Reporting or Predictive Read Transform, and/or Load (ETL) Analysis Injection Data Read Data TAX MANAGEMENT ASSOCIATES, INC.
  • Sheffield HPC Documentation

    Sheffield HPC Documentation

    Sheffield HPC Documentation Release November 14, 2016 Contents 1 Research Computing Team 3 2 Research Software Engineering Team5 i ii Sheffield HPC Documentation, Release The current High Performance Computing (HPC) system at Sheffield, is the Iceberg cluster. A new system, ShARC (Sheffield Advanced Research Computer), is currently under development. It is not yet ready for use. Contents 1 Sheffield HPC Documentation, Release 2 Contents CHAPTER 1 Research Computing Team The research computing team are the team responsible for the iceberg service, as well as all other aspects of research computing. If you require support with iceberg, training or software for your workstations, the research computing team would be happy to help. Take a look at the Research Computing website or email research-it@sheffield.ac.uk. 3 Sheffield HPC Documentation, Release 4 Chapter 1. Research Computing Team CHAPTER 2 Research Software Engineering Team The Sheffield Research Software Engineering Team is an academically led group that collaborates closely with CiCS. They can assist with code optimisation, training and all aspects of High Performance Computing including GPU computing along with local, national, regional and cloud computing services. Take a look at the Research Software Engineering website or email rse@sheffield.ac.uk 2.1 Using the HPC Systems 2.1.1 Getting Started If you have not used a High Performance Computing (HPC) cluster, Linux or even a command line before this is the place to start. This guide will get you set up using iceberg in the easiest way that fits your requirements. Getting an Account Before you can start using iceberg you need to register for an account.
  • Mathematica Document

    Mathematica Document

    Mathematica Project: Exploratory Data Analysis on ‘Data Scientists’ A big picture view of the state of data scientists and machine learning engineers. ����� ���� ��������� ��� ������ ���� ������ ������ ���� ������/ ������ � ���������� ���� ��� ������ ��� ���������������� �������� ������/ ����� ��������� ��� ���� ���������������� ����� ��������������� ��������� � ������(�������� ���������� ���������) ������ ��������� ����� ������� �������� ����� ������� ��� ������ ����������(���� �������) ��������� ����� ���� ������ ����� (���������� �������) ����������(���������� ������� ���������� ��� ���� ���� �����/ ��� �������������� � ����� ���� �� �������� � ��� ����/���������� ��������������� ������� ������������� ��� ���������� ����� �����(���� �������) ����������� ����� / ����� ��� ������ ��������������� ���������� ����������/�++ ������/������������/����/������ ���� ������� ����� ������� ������� ����������������� ������� ������� ����/����/�������/��/��� ����������(�����/����-�������� ��������) ������������ In this Mathematica project, we will explore the capabilities of Mathematica to better understand the state of data science enthusiasts. The dataset consisting of more than 10,000 rows is obtained from Kaggle, which is a result of ‘Kaggle Survey 2017’. We will explore various capabilities of Mathematica in Data Analysis and Data Visualizations. Further, we will utilize Machine Learning techniques to train models and Classify features with several algorithms, such as Nearest Neighbors, Random Forest. Dataset : https : // www.kaggle.com/kaggle/kaggle
  • Direct Submission Or Co-Submission Direct Submission

    Direct Submission Or Co-Submission Direct Submission

    Z-Matrix template-based substitution approach Title for enumeration of 3D molecular structures Authors Wanutcha Lorpaiboon and Taweetham Limpanuparb* Science Division, Mahidol University International College, Affiliations Mahidol University, Salaya, Nakhon Pathom 73170, Thailand Corresponding Author’s email address [email protected] • Chemical structures • Education Keywords • Molecular generator • Structure generator • Z-matrix Direct Submission or Co-Submission Direct Submission ABSTRACT The exhaustive enumeration of 3D chemical structures based on Z-matrix templates has recently been used in the quantum chemical investigation of constitutional isomers, diastereomers and 5 rotamers. This simple yet powerful initial structure generation approach can apply beyond the investigation of compounds of identical formula by quantum chemical methods. This paper aims to provide a short description of the overall concept followed by a practical tutorial to the approach. • The four steps required for Z-matrix template-based substitution are template construction, generation of tuples for substitution sites, removal of duplicate tuples and 10 substitution on the template. • The generated tuples can be used to create chemical identifiers to query compound properties from chemical databases. • All of these steps are demonstrated in this paper by common model compounds and are very straightforward for an undergraduate audience to reproduce. A comparison of the 15 approach in this tutorial and other options is also discussed. SPECIFICATIONS TABLE Subject Area Chemistry More specific subject area Cheminformatics Method name Z-matrix template-based substitution Name and reference of original method N/A Source codes are available as supplementary information in this Resource availability paper. 2 of 10 Method details 20 1. Introduction Initial structures (Z-matrix or Cartesian coordinate) are important starting points for the in silico investigation of chemical species.
  • Role of Materials Data Science and Informatics in Accelerated Materials Innovation Surya R

    Role of Materials Data Science and Informatics in Accelerated Materials Innovation Surya R

    Role of materials data science and informatics in accelerated materials innovation Surya R. Kalidindi , David B. Brough , Shengyen Li , Ahmet Cecen , Aleksandr L. Blekh , Faical Yannick P. Congo , and Carelyn Campbell The goal of the Materials Genome Initiative is to substantially reduce the time and cost of materials design and deployment. Achieving this goal requires taking advantage of the recent advances in data and information sciences. This critical need has impelled the emergence of a new discipline, called materials data science and informatics. This emerging new discipline not only has to address the core scientifi c/technological challenges related to datafi cation of materials science and engineering, but also, a number of equally important challenges around data-driven transformation of the current culture, practices, and workfl ows employed for materials innovation. A comprehensive effort that addresses both of these aspects in a synergistic manner is likely to succeed in realizing the vision of scaled-up materials innovation. Key toolsets needed for the successful adoption of materials data science and informatics in materials innovation are identifi ed and discussed in this article. Prototypical examples of emerging novel toolsets and their functionality are described along with select case studies. Introduction goal of reducing the time and cost of materials development Materials innovation initiatives and deployment by 50%. 1 Essential to achieving this goal is A number of US-based, 1 – 3 as well as international, 4 , 5 efforts are the development and deployment of a supporting infrastruc- now focused on accelerated deployment of advanced materials ture that integrates a wide range of data, experimental, and in commercial products.
  • Titel Untertitel

    Titel Untertitel

    KNIME Image Processing Nycomed Chair for Bioinformatics and Information Mining Department of Computer and Information Science Konstanz University, Germany Why Image Processing with KNIME? KNIME UGM 2013 2 The “Zoo” of Image Processing Tools Development Processing UI Handling ImgLib2 ImageJ OMERO OpenCV ImageJ2 BioFormats MatLab Fiji … NumPy CellProfiler VTK Ilastik VIGRA CellCognition … Icy Photoshop … = Single, individual, case specific, incompatible solutions KNIME UGM 2013 3 The “Zoo” of Image Processing Tools Development Processing UI Handling ImgLib2 ImageJ OMERO OpenCV ImageJ2 BioFormats MatLab Fiji … NumPy CellProfiler VTK Ilastik VIGRA CellCognition … Icy Photoshop … → Integration! KNIME UGM 2013 4 KNIME as integration platform KNIME UGM 2013 5 Integration: What and How? KNIME UGM 2013 6 Integration ImgLib2 • Developed at MPI-CBG Dresden • Generic framework for data (image) processing algoritms and data-structures • Generic design of algorithms for n-dimensional images and labelings • http://fiji.sc/wiki/index.php/ImgLib2 → KNIME: used as image representation (within the data cells); basis for algorithms KNIME UGM 2013 7 Integration ImageJ/Fiji • Popular, highly interactive image processing tool • Huge base of available plugins • Fiji: Extension of ImageJ1 with plugin-update mechanism and plugins • http://rsb.info.nih.gov/ij/ & http://fiji.sc/ → KNIME: ImageJ Macro Node KNIME UGM 2013 8 Integration ImageJ2 • Next-generation version of ImageJ • Complete re-design of ImageJ while maintaining backwards compatibility • Based on ImgLib2
  • Leveraging SAS with KNIME

    Leveraging SAS with KNIME

    Leveraging SAS with KNIME Thomas Gabriel and Phil Winters Copyright © 2013 by KNIME.com AG. All rights reserved. SAS and all other SAS Institute Inc. product or service names are registered trademarks or trademarks of SAS Institute Inc. in the USA and other countries. ® indicates USA registration. Copyright © 2013 by KNIME.com AG. All rights reserved. 2 A bit of History: The Original SAS Concept Access Manage Present Analyse Copyright © 2013 by KNIME.com AG. All rights reserved. 4 More Products to meet new requirements EG DI RTD DB2 Macro Oracle PC FILIE Connect Access Manage MM SCL Present Analyse EM ® AF DVD QC JMP OR IML IDP ETS STAT Graph Copyright © 2013 by KNIME.com AG. All rights reserved. 5 Even More Products…. Teradata Hadoop EG DI RTD DB2 Macro Oracle PC FILIE Connect Access Manage MM SCL Present Analyse EM PMML …Model Manager …Model PMML High Performance Analytics Performance High ® AF DVD QC JMP OR IML IDP ETS STAT Graph Text Mining Social Media Analytics R…. in IML in R…. Copyright © 2013 by KNIME.com AG. All rights reserved. 6 Our new reality: You must have Choice and Control New Infrastructures New Data New Other Science Applications New New Users Methods New Business Copyright © 2013 by KNIME.com AG. All rights reserved. Challenges 7 The KNIME Platform Open, Open Source, Free on the Desktop Copyright © 2013 by KNIME.com AG. All rights reserved. 8 The question is not “which is better”…. Copyright © 2013 by KNIME.com AG. All rights reserved. 9 The question is: What’s the Big Difference? SAS KNIME A script-oriented 4GL programming language A Script-free environment in four major parts: comprised of • The DATA step • Nodes and Connectors • Procedure steps • A macro language, • Metanodes and Flow variables for packaging a metaprogramming language • ODS statements • GUIs: are most often front-ends • GUI is the interface to facilitate SAS Program script generation • Through Proprietary Technology “Provide it all” • Through Open Source “Provide it all” Copyright © 2013 by KNIME.com AG.
  • Introduction to Label-Free Quantification

    Introduction to Label-Free Quantification

    SeqAn and OpenMS Integration Workshop Temesgen Dadi, Julianus Pfeuffer, Alexander Fillbrunn The Center for Integrative Bioinformatics (CIBI) Mass-spectrometry data analysis in KNIME Julianus Pfeuffer, Alexander Fillbrunn OpenMS • OpenMS – an open-source C++ framework for computational mass spectrometry • Jointly developed at ETH Zürich, FU Berlin, University of Tübingen • Open source: BSD 3-clause license • Portable: available on Windows, OSX, Linux • Vendor-independent: supports all standard formats and vendor-formats through proteowizard • OpenMS TOPP tools – The OpenMS Proteomics Pipeline tools – Building blocks: One application for each analysis step – All applications share identical user interfaces – Uses PSI standard formats • Can be integrated in various workflow systems – Galaxy – WS-PGRADE/gUSE – KNIME Kohlbacher et al., Bioinformatics (2007), 23:e191 OpenMS Tools in KNIME • Wrapping of OpenMS tools in KNIME via GenericKNIMENodes (GKN) • Every tool writes its CommonToolDescription (CTD) via its command line parser • GKN generates Java source code for nodes to show up in KNIME • Wraps C++ executables and provides file handling nodes Installation of the OpenMS plugin • Community-contributions update site (stable & trunk) – Bioinformatics & NGS • provides > 180 OpenMS TOPP tools as Community nodes – SILAC, iTRAQ, TMT, label-free, SWATH, SIP, … – Search engines: OMSSA, MASCOT, X!TANDEM, MSGFplus, … – Protein inference: FIDO Data Flow in Shotgun Proteomics Sample HPLC/MS Raw Data 100 GB Sig. Proc. Peak 50 MB Maps Data Reduction 1
  • Bringing Open Source to Drug Discovery

    Bringing Open Source to Drug Discovery

    Bringing Open Source to Drug Discovery Chris Swain Cambridge MedChem Consulting Standing on the shoulders of giants • There are a huge number of people involved in writing open source software • It is impossible to acknowledge them all individually • The slide deck will be available for download and includes 25 slides of details and download links – Copy on my website www.cambridgemedchemconsulting.com Why us Open Source software? • Allows access to source code – You can customise the code to suit your needs – If developer ceases trading the code can continue to be developed – Outside scrutiny improves stability and security What Resources are available • Toolkits • Databases • Web Services • Workflows • Applications • Scripts Toolkits • OpenBabel (htttp://openbabel.org) is a chemical toolbox – Ready-to-use programs, and complete programmer's toolkit – Read, write and convert over 110 chemical file formats – Filter and search molecular files using SMARTS and other methods, KNIME add-on – Supports molecular modeling, cheminformatics, bioinformatics – Organic chemistry, inorganic chemistry, solid-state materials, nuclear chemistry – Written in C++ but accessible from Python, Ruby, Perl, Shell scripts… Toolkits • OpenBabel • R • CDK • OpenCL • RDkit • SciPy • Indigo • NumPy • ChemmineR • Pandas • Helium • Flot • FROWNS • GNU Octave • Perlmol • OpenMPI Toolkits • RDKit (http://www.rdkit.org) – A collection of cheminformatics and machine-learning software written in C++ and Python. – Knime nodes – The core algorithms and data structures are written in C ++. Wrappers are provided to use the toolkit from either Python or Java. – Additionally, the RDKit distribution includes a PostgreSQL-based cartridge that allows molecules to be stored in relational database and retrieved via substructure and similarity searches.