An Excess of Chromosome 1 Breakpoints in Male Infertility
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Biobin User Guide Current Version: Biobin 2.0
___________________________________ BioBin User Guide Current version: BioBin 2.0 October 2012 Last modified: October 2012 Ritchie Lab, Center for Systems Genomics Pennsylvania State University, University Park, PA 16802 URL: https://ritchielab.psu.edu/ritchielab/software/ Email: [email protected] Table of Contents Overview ............................................................................................................................................................................... 3 BioBin ................................................................................................................................................................................................................ 3 Library of Knowledge Integration (LOKI) Database .................................................................................................................... 3 Quick Reference ............................................................................................................................................................................................ 5 Installation ............................................................................................................................................................................ 6 Prerequisites .................................................................................................................................................................................................. 6 Unpacking ...................................................................................................................................................................................................... -
Seq2pathway Vignette
seq2pathway Vignette Bin Wang, Xinan Holly Yang, Arjun Kinstlick May 19, 2021 Contents 1 Abstract 1 2 Package Installation 2 3 runseq2pathway 2 4 Two main functions 3 4.1 seq2gene . .3 4.1.1 seq2gene flowchart . .3 4.1.2 runseq2gene inputs/parameters . .5 4.1.3 runseq2gene outputs . .8 4.2 gene2pathway . 10 4.2.1 gene2pathway flowchart . 11 4.2.2 gene2pathway test inputs/parameters . 11 4.2.3 gene2pathway test outputs . 12 5 Examples 13 5.1 ChIP-seq data analysis . 13 5.1.1 Map ChIP-seq enriched peaks to genes using runseq2gene .................... 13 5.1.2 Discover enriched GO terms using gene2pathway_test with gene scores . 15 5.1.3 Discover enriched GO terms using Fisher's Exact test without gene scores . 17 5.1.4 Add description for genes . 20 5.2 RNA-seq data analysis . 20 6 R environment session 23 1 Abstract Seq2pathway is a novel computational tool to analyze functional gene-sets (including signaling pathways) using variable next-generation sequencing data[1]. Integral to this tool are the \seq2gene" and \gene2pathway" components in series that infer a quantitative pathway-level profile for each sample. The seq2gene function assigns phenotype-associated significance of genomic regions to gene-level scores, where the significance could be p-values of SNPs or point mutations, protein-binding affinity, or transcriptional expression level. The seq2gene function has the feasibility to assign non-exon regions to a range of neighboring genes besides the nearest one, thus facilitating the study of functional non-coding elements[2]. Then the gene2pathway summarizes gene-level measurements to pathway-level scores, comparing the quantity of significance for gene members within a pathway with those outside a pathway. -
Epigenetic Control of Mammalian Centromere Protein Binding: Does DNA Methylation Have a Role?
Journal of Cell Science 109, 2199-2206 (1996) 2199 Printed in Great Britain © The Company of Biologists Limited 1996 JCS3386 Epigenetic control of mammalian centromere protein binding: does DNA methylation have a role? Arthur R. Mitchell*, Peter Jeppesen, Linda Nicol†, Harris Morrison and David Kipling MRC Human Genetics Unit, Western General Hospital, Crewe Road, Edinburgh EH4 2XU, UK *Author for correspondence (internet [email protected]) †Present address: MRC Reproductive Biology Unit, Edinburgh, UK SUMMARY Chromosome 1 of the inbred mouse strain DBA/2 has a block of minor satellite DNA sequences on chromosome 1. polymorphism associated with the minor satellite DNA at The binding of the CENP-E protein does not appear to be its centromere. The more terminal block of satellite DNA affected by demethylation of the minor satellite sequences. sequences on this chromosome acts as the centromere as We present a model to explain these observations. This shown by the binding of CREST ACA serum, anti-CENP- model may also indicate the mechanism by which the B and anti-CENP-E polyclonal sera. Demethylation of the CENP-B protein recognises specific sites within the arrays minor satellite DNA sequences accomplished by growing of minor satellite DNA on mouse chromosomes. cells in the presence of the drug 5-aza-2′-deoxycytidine results in a redistribution of the CENP-B protein. This protein now binds to an enlarged area on the more terminal Key words: Centromere satellite DNA, Demethylation, Centromere block and in addition it now binds to the more internal antibody INTRODUCTION A common feature of many mammalian pericentromeric domains is that they contain families of repetitive DNA The centromere of mammalian chromosomes is recognised at sequences (Singer, 1982). -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
Single-Cell Profiling Identifies Impaired Adaptive NK Cells Expanded After HCMV Reactivation in Haploidentical HSCT
Single-cell profiling identifies impaired adaptive NK cells expanded after HCMV reactivation in haploidentical HSCT Elisa Zaghi, … , Enrico Lugli, Domenico Mavilio JCI Insight. 2021;6(12):e146973. https://doi.org/10.1172/jci.insight.146973. Research Article Hematology Immunology Graphical abstract Find the latest version: https://jci.me/146973/pdf RESEARCH ARTICLE Single-cell profiling identifies impaired adaptive NK cells expanded after HCMV reactivation in haploidentical HSCT Elisa Zaghi,1 Michela Calvi,1,2 Simone Puccio,3 Gianmarco Spata,1 Sara Terzoli,1 Clelia Peano,4 Alessandra Roberto,3 Federica De Paoli,3 Jasper J.P. van Beek,3 Jacopo Mariotti,5 Chiara De Philippis,5 Barbara Sarina,5 Rossana Mineri,6 Stefania Bramanti,5 Armando Santoro,5 Vu Thuy Khanh Le-Trilling,7 Mirko Trilling,7 Emanuela Marcenaro,8 Luca Castagna,5 Clara Di Vito,1,2 Enrico Lugli,3,9 and Domenico Mavilio1,2 1Unit of Clinical and Experimental Immunology, IRCCS Humanitas Research Hospital, Rozzano, Milan, Italy. 2BIOMETRA, Università degli Studi di Milano, Milan, Italy. 3Laboratory of Translational Immunology, 4Institute of Genetic and Biomedical Research, UoS Milan, National Research Council, and Genomic Unit, 5Bone Marrow Transplant Unit, and 6Molecular Biology Section, Clinical Investigation Laboratory, IRCCS Humanitas Research Hospital, Milan, Italy. 7Institute for Virology, University Hospital Essen, University Duisburg-Essen, Essen, Germany. 8Department of Experimental Medicine, University of Genoa, Genoa, Italy. 9Flow Cytometry Core, IRCCS Humanitas Research Hospital, Milan, Italy. Haploidentical hematopoietic stem cell transplantation (h-HSCT) represents an efficient curative approach for patients affected by hematologic malignancies in which the reduced intensity conditioning induces a state of immunologic tolerance between donor and recipient. -
Supplementary Table 1: Adhesion Genes Data Set
Supplementary Table 1: Adhesion genes data set PROBE Entrez Gene ID Celera Gene ID Gene_Symbol Gene_Name 160832 1 hCG201364.3 A1BG alpha-1-B glycoprotein 223658 1 hCG201364.3 A1BG alpha-1-B glycoprotein 212988 102 hCG40040.3 ADAM10 ADAM metallopeptidase domain 10 133411 4185 hCG28232.2 ADAM11 ADAM metallopeptidase domain 11 110695 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 195222 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 165344 8751 hCG20021.3 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 189065 6868 null ADAM17 ADAM metallopeptidase domain 17 (tumor necrosis factor, alpha, converting enzyme) 108119 8728 hCG15398.4 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 117763 8748 hCG20675.3 ADAM20 ADAM metallopeptidase domain 20 126448 8747 hCG1785634.2 ADAM21 ADAM metallopeptidase domain 21 208981 8747 hCG1785634.2|hCG2042897 ADAM21 ADAM metallopeptidase domain 21 180903 53616 hCG17212.4 ADAM22 ADAM metallopeptidase domain 22 177272 8745 hCG1811623.1 ADAM23 ADAM metallopeptidase domain 23 102384 10863 hCG1818505.1 ADAM28 ADAM metallopeptidase domain 28 119968 11086 hCG1786734.2 ADAM29 ADAM metallopeptidase domain 29 205542 11085 hCG1997196.1 ADAM30 ADAM metallopeptidase domain 30 148417 80332 hCG39255.4 ADAM33 ADAM metallopeptidase domain 33 140492 8756 hCG1789002.2 ADAM7 ADAM metallopeptidase domain 7 122603 101 hCG1816947.1 ADAM8 ADAM metallopeptidase domain 8 183965 8754 hCG1996391 ADAM9 ADAM metallopeptidase domain 9 (meltrin gamma) 129974 27299 hCG15447.3 ADAMDEC1 ADAM-like, -
Noelia Díaz Blanco
Effects of environmental factors on the gonadal transcriptome of European sea bass (Dicentrarchus labrax), juvenile growth and sex ratios Noelia Díaz Blanco Ph.D. thesis 2014 Submitted in partial fulfillment of the requirements for the Ph.D. degree from the Universitat Pompeu Fabra (UPF). This work has been carried out at the Group of Biology of Reproduction (GBR), at the Department of Renewable Marine Resources of the Institute of Marine Sciences (ICM-CSIC). Thesis supervisor: Dr. Francesc Piferrer Professor d’Investigació Institut de Ciències del Mar (ICM-CSIC) i ii A mis padres A Xavi iii iv Acknowledgements This thesis has been made possible by the support of many people who in one way or another, many times unknowingly, gave me the strength to overcome this "long and winding road". First of all, I would like to thank my supervisor, Dr. Francesc Piferrer, for his patience, guidance and wise advice throughout all this Ph.D. experience. But above all, for the trust he placed on me almost seven years ago when he offered me the opportunity to be part of his team. Thanks also for teaching me how to question always everything, for sharing with me your enthusiasm for science and for giving me the opportunity of learning from you by participating in many projects, collaborations and scientific meetings. I am also thankful to my colleagues (former and present Group of Biology of Reproduction members) for your support and encouragement throughout this journey. To the “exGBRs”, thanks for helping me with my first steps into this world. Working as an undergrad with you Dr. -
Role of RUNX1 in Aberrant Retinal Angiogenesis Jonathan D
Page 1 of 25 Diabetes Identification of RUNX1 as a mediator of aberrant retinal angiogenesis Short Title: Role of RUNX1 in aberrant retinal angiogenesis Jonathan D. Lam,†1 Daniel J. Oh,†1 Lindsay L. Wong,1 Dhanesh Amarnani,1 Cindy Park- Windhol,1 Angie V. Sanchez,1 Jonathan Cardona-Velez,1,2 Declan McGuone,3 Anat O. Stemmer- Rachamimov,3 Dean Eliott,4 Diane R. Bielenberg,5 Tave van Zyl,4 Lishuang Shen,1 Xiaowu Gai,6 Patricia A. D’Amore*,1,7 Leo A. Kim*,1,4 Joseph F. Arboleda-Velasquez*1 Author affiliations: 1Schepens Eye Research Institute/Massachusetts Eye and Ear, Department of Ophthalmology, Harvard Medical School, 20 Staniford St., Boston, MA 02114 2Universidad Pontificia Bolivariana, Medellin, Colombia, #68- a, Cq. 1 #68305, Medellín, Antioquia, Colombia 3C.S. Kubik Laboratory for Neuropathology, Massachusetts General Hospital, 55 Fruit St., Boston, MA 02114 4Retina Service, Massachusetts Eye and Ear Infirmary, Department of Ophthalmology, Harvard Medical School, 243 Charles St., Boston, MA 02114 5Vascular Biology Program, Boston Children’s Hospital, Department of Surgery, Harvard Medical School, 300 Longwood Ave., Boston, MA 02115 6Center for Personalized Medicine, Children’s Hospital Los Angeles, Los Angeles, 4650 Sunset Blvd, Los Angeles, CA 90027, USA 7Department of Pathology, Harvard Medical School, 25 Shattuck St., Boston, MA 02115 Corresponding authors: Joseph F. Arboleda-Velasquez: [email protected] Ph: (617) 912-2517 Leo Kim: [email protected] Ph: (617) 912-2562 Patricia D’Amore: [email protected] Ph: (617) 912-2559 Fax: (617) 912-0128 20 Staniford St. Boston MA, 02114 † These authors contributed equally to this manuscript Word Count: 1905 Tables and Figures: 4 Diabetes Publish Ahead of Print, published online April 11, 2017 Diabetes Page 2 of 25 Abstract Proliferative diabetic retinopathy (PDR) is a common cause of blindness in the developed world’s working adult population, and affects those with type 1 and type 2 diabetes mellitus. -
Anti-FCER1G (Aa 22-86) Polyclonal Antibody (DPABH-03673) This Product Is for Research Use Only and Is Not Intended for Diagnostic Use
Anti-FCER1G (aa 22-86) polyclonal antibody (DPABH-03673) This product is for research use only and is not intended for diagnostic use. PRODUCT INFORMATION Antigen Description Associates with a variety of FcR alpha chains to form a functional signaling complex. Regulates several aspects of the immune response. The gamma subunit has a critical role in allowing the IgE Fc receptor to reach the cell surface. Immunogen Synthetic peptide corresponding to a region within amino acids 22-86 of Human FCER1G. Isotype IgG Source/Host Rabbit Species Reactivity Human Purification Immunogen affinity purified Conjugate Unconjugated Applications WB, IHC-P Format Liquid Size 100 μl Buffer pH: 7.00; Constituents: 0.75% Glycine, 1.21% Tris, 10% Glycerol Preservative None Storage Store at -20°C or lower. Aliquot to avoid repeated freezing and thawing. GENE INFORMATION Gene Name FCER1G Fc fragment of IgE, high affinity I, receptor for; gamma polypeptide [ Homo sapiens ] Official Symbol FCER1G Synonyms FCER1G; Fc fragment of IgE, high affinity I, receptor for; gamma polypeptide; high affinity immunoglobulin epsilon receptor subunit gamma; fcRgamma; fceRI gamma; fc-epsilon RI- gamma; Fc receptor gamma-chain; immunoglobulin E receptor, high affinity, gamma chain; FCRG; 45-1 Ramsey Road, Shirley, NY 11967, USA Email: [email protected] Tel: 1-631-624-4882 Fax: 1-631-938-8221 1 © Creative Diagnostics All Rights Reserved Entrez Gene ID 2207 Protein Refseq NP_004097 UniProt ID P30273 Chromosome Location 1q23 Pathway Asthma; Cell surface interactions at the vascular wall; Fc epsilon RI signaling pathway; Fc- epsilon receptor I signaling in mast cells; GPVI-mediated activation cascade; Function IgE binding; IgG binding; receptor activity; transmembrane signaling receptor activity; 45-1 Ramsey Road, Shirley, NY 11967, USA Email: [email protected] Tel: 1-631-624-4882 Fax: 1-631-938-8221 2 © Creative Diagnostics All Rights Reserved. -
Supplementary Table 2 Gene Sets Used in GSEA
Supplementary Table 2 Gene sets used in GSEA Up in RNAi and Sign Confirmed in Inducible Gene Probe Set ID Accession Symbol Gene Title 200660_at NM_005620 S100A11 S100 calcium binding protein A11 (calgizzarin) 200785_s_at NM_002332 LRP1 low density lipoprotein-related protein 1 (alpha-2-macroglobulin receptor) 201325_s_at NM_001423 EMP1 epithelial membrane protein 1 201373_at NM_000445 PLEC1 plectin 1, intermediate filament binding protein 500kDa 201466_s_at NM_002228 JUN v-jun sarcoma virus 17 oncogene homolog (avian) 201952_at AA156721 ALCAM activated leukocyte cell adhesion molecule 202042_at NM_002109 HARS histidyl-tRNA synthetase 202074_s_at NM_021980 OPTN optineurin 202087_s_at NM_001912 CTSL cathepsin L 202588_at NM_000476 AK1 adenylate kinase 1 202609_at NM_004447 EPS8 epidermal growth factor receptor pathway substrate 8 202733_at NM_004199 P4HA2 procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide II 202756_s_at NM_002081 GPC1 glypican 1 202786_at NM_013233 STK39 serine threonine kinase 39 (STE20/SPS1 homolog, yeast) 202859_x_at NM_000584 IL8 interleukin 8 203083_at NM_003247 THBS2 thrombospondin 2 203186_s_at NM_002961 S100A4 S100 calcium binding protein A4 (calcium protein, calvasculin, metastasin, murine placental homolog) 203232_s_at NM_000332 ATXN1 ataxin 1 203233_at NM_000418 IL4R interleukin 4 receptor 203771_s_at AA740186 BLVRA biliverdin reductase A 203821_at NM_001945 HBEGF heparin-binding EGF-like growth factor 203939_at NM_002526 NT5E 5'-nucleotidase, ecto (CD73) 203955_at NM_014811 -
Microcephaly Genes and Risk of Late-Onset Alzheimer Disease
ORIGINAL ARTICLE Microcephaly Genes and Risk of Late-onset Alzheimer Disease Deniz Erten-Lyons, MD,*w Beth Wilmot, PhD,zy Pavana Anur, BS,z Shannon McWeeney, PhD,zyJ Shawn K. Westaway, PhD,w Lisa Silbert, MD,w Patricia Kramer, PhD,w and Jeffrey Kaye, MD*w Alzheimer’s Disease Neuroimaging Initiative ratio=3.41; confidence interval, 1.77-6.57). However, this associa- Abstract: Brain development in the early stages of life has been tion was not replicated using another case-control sample research suggested to be one of the factors that may influence an individual’s participants from the Alzheimer Disease Neuroimaging Initiative. risk of Alzheimer disease (AD) later in life. Four microcephaly We conclude that the common variations we measured in the 4 genes, which regulate brain development in utero and have been microcephaly genes do not affect the risk of AD or that their effect suggested to play a role in the evolution of the human brain, were size is small. selected as candidate genes that may modulate the risk of AD. We examined the association between single nucleotide polymorphisms Key Words: Alzheimer disease, microcephaly genes, cognitive tagging common sequence variations in these genes and risk of AD reserve in two case-control samples. We found that the G allele of (Alzheimer Dis Assoc Disord 2011;25:276–282) rs2442607 in microcephalin 1 was associated with an increased risk of AD (under an additive genetic model, P=0.01; odds Received for publication June 2, 2010; accepted December 2, 2010. enetics has been suggested to play a role in variations From the *Portland Veterans Affairs Medical Center; wDepartment of Gin cognitive function in late life.1 One way in which Neurology; zOregon Clinical and Translational Research Center; genes may play a role in cognitive function in late life is yDivision of Bioinformatics and Computational Biology, Depart- through providing an “initial endowment” that is more ment of Medical Informatics and Clinical Epidemiology; and JDivision of Biostatistics, Department of Public Health and resistant to age-related changes. -
Download Validation Data
PrimePCR™Assay Validation Report Gene Information Gene Name UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 4 Gene Symbol B4GALT4 Organism Human Gene Summary This gene is one of seven beta-14-galactosyltransferase (beta4GalT) genes. They encode type II membrane-bound glycoproteins that appear to have exclusive specificity for the donor substrate UDP-galactose; all transfer galactose in a beta14 linkage to similar acceptor sugars: GlcNAc Glc and Xyl. Each beta4GalT has a distinct function in the biosynthesis of different glycoconjugates and saccharide structures. As type II membrane proteins they have an N-terminal hydrophobic signal sequence that directs the protein to the Golgi apparatus and which then remains uncleaved to function as a transmembrane anchor. By sequence similarity the beta4GalTs form four groups: beta4GalT1 and beta4GalT2 beta4GalT3 and beta4GalT4 beta4GalT5 and beta4GalT6 and beta4GalT7. The enzyme encoded by this gene appears to mainly play a role in glycolipid biosynthesis. Two alternatively spliced transcript variants have been found for this gene. Gene Aliases B4Gal-T4, beta4Gal-T4 RefSeq Accession No. NC_000003.11, NT_005612.16 UniGene ID Hs.13225 Ensembl Gene ID ENSG00000121578 Entrez Gene ID 8702 Assay Information Unique Assay ID qHsaCED0001445 Assay Type SYBR® Green Detected Coding Transcript(s) ENST00000483209, ENST00000467604, ENST00000471675, ENST00000359213, ENST00000393765, ENST00000475803, ENST00000479150 Amplicon Context Sequence TGAGGTAAGGAGACACAGAAGGGCAGTTGTCAAGTTCTACCTTCTTCGTGGATG CTTCATTAGTCAGAGTTTTTCCCTTCCCCAAAATGAGGGT Amplicon Length (bp) 64 Chromosome Location 3:118948694-118948787 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 103 Page 1/5 PrimePCR™Assay Validation Report R2 0.9998 cDNA Cq 21.23 cDNA Tm (Celsius) 78 gDNA Cq 23.9 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report.