De Novo Truncating Variants in PHF21A Cause Intellectual Disability and Craniofacial Anomalies
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Mapk8ip1 (NM 011162) Mouse Tagged ORF Clone Product Data
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MG226852 Mapk8ip1 (NM_011162) Mouse Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Mapk8ip1 (NM_011162) Mouse Tagged ORF Clone Tag: TurboGFP Symbol: Mapk8ip1 Synonyms: IB1; JIP-1; Jip1; mjip-2a; Prkm8ip; Skip Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 5 Mapk8ip1 (NM_011162) Mouse Tagged ORF Clone – MG226852 ORF Nucleotide >MG226852 representing NM_011162 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCGGAGCGAGAGAGCGGCCTGGGCGGGGGCGCCGCGTCCCCACCGGCCGCTTCCCCATTCCTGGGAC TGCACATCGCGTCGCCTCCCAATTTCAGGCTCACCCATGACATCAGCCTGGAGGAGTTTGAGGATGAAGA CCTTTCGGAGATCACTGACGAGTGTGGCATCAGCCTGCAGTGCAAAGACACCCTGTCTCTCCGGCCCCCG CGCGCCGGGCTGCTGTCTGCGGGTAGCAGCGGCAGCGCGGGGAGCCGGCTGCAGGCGGAGATGCTGCAGA TGGACCTGATCGACGCGGCAGGTGACACTCCGGGCGCCGAGGACGACGAGGAGGAGGAGGACGACGAGCT CGCTGCCCAACGACCAGGAGTGGGGCCTCCCAAAGCGGAGTCCAACCAGGATCCGGCGCCTCGCAGCCAG GGCCAGGGCCCGGGCACAGGCAGCGGAGACACCTACCGACCCAAGAGGCCTACCACGCTCAACCTTTTCC CGCAGGTGCCGCGGTCTCAGGACACGCTGAATAATAACTCTTTAGGCAAAAAGCACAGTTGGCAGGACCG TGTGTCTCGATCATCCTCCCCTCTGAAGACAGGAGAACAGACGCCTCCACATGAACACATCTGCCTGAGT -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
4-6 Weeks Old Female C57BL/6 Mice Obtained from Jackson Labs Were Used for Cell Isolation
Methods Mice: 4-6 weeks old female C57BL/6 mice obtained from Jackson labs were used for cell isolation. Female Foxp3-IRES-GFP reporter mice (1), backcrossed to B6/C57 background for 10 generations, were used for the isolation of naïve CD4 and naïve CD8 cells for the RNAseq experiments. The mice were housed in pathogen-free animal facility in the La Jolla Institute for Allergy and Immunology and were used according to protocols approved by the Institutional Animal Care and use Committee. Preparation of cells: Subsets of thymocytes were isolated by cell sorting as previously described (2), after cell surface staining using CD4 (GK1.5), CD8 (53-6.7), CD3ε (145- 2C11), CD24 (M1/69) (all from Biolegend). DP cells: CD4+CD8 int/hi; CD4 SP cells: CD4CD3 hi, CD24 int/lo; CD8 SP cells: CD8 int/hi CD4 CD3 hi, CD24 int/lo (Fig S2). Peripheral subsets were isolated after pooling spleen and lymph nodes. T cells were enriched by negative isolation using Dynabeads (Dynabeads untouched mouse T cells, 11413D, Invitrogen). After surface staining for CD4 (GK1.5), CD8 (53-6.7), CD62L (MEL-14), CD25 (PC61) and CD44 (IM7), naïve CD4+CD62L hiCD25-CD44lo and naïve CD8+CD62L hiCD25-CD44lo were obtained by sorting (BD FACS Aria). Additionally, for the RNAseq experiments, CD4 and CD8 naïve cells were isolated by sorting T cells from the Foxp3- IRES-GFP mice: CD4+CD62LhiCD25–CD44lo GFP(FOXP3)– and CD8+CD62LhiCD25– CD44lo GFP(FOXP3)– (antibodies were from Biolegend). In some cases, naïve CD4 cells were cultured in vitro under Th1 or Th2 polarizing conditions (3, 4). -
1 a Gene Implicated in Activation of Retinoic Acid Receptor Targets Is A
Genetics: Early Online, published on July 24, 2017 as 10.1534/genetics.117.1125 A gene implicated in activation of retinoic acid receptor targets is a novel renal agenesis gene in humans. Patrick D. Brophy, *1 Maria Rasmussen,†1 Mrutyunjaya Parida, ‡1 Greg Bonde, § Benjamin W. Darbro, * Xiaojing Hong, ‡ Jason C. Clarke, * Kevin A. Peterson, ** James Denegre, ** Michael Schneider, †† Caroline R. Sussman, ‡‡ Lone Sunde, † Dorte L. Lildballe, † Jens Michael Hertz, §§ Robert A. Cornell, §, Stephen A. Murray, ** J. Robert Manak*‡ 1Co-first authors *Department of Pediatrics, University of Iowa, Iowa City, IA, 52242. †Department of Clinical Genetics, Aarhus University Hospital, Skejby, Denmark ‡Department of Biology, University of Iowa, Iowa City, IA, 52242. §Department of Anatomy and Cell Biology, University of Iowa, IA, 52242. **The Jackson Laboratory, Bar Harbor, ME, 04609. ††Medical Genetics, Carle Foundation Hospital and Physician Group, Urbana, IL, 61801. ‡‡Department of Nephrology and Hypertension, Mayo Clinic, Rochester, MN, 55905. §§Department of Clinical Genetics, Odense University Hospital, Denmark IRB # 200711705 Whole exome sequencing data available in the Sequence Read Archive (SRA) database (accession number SRP112780) 1 Copyright 2017. Running Title: GREB1L, a novel renal agenesis gene Key Words: GREB1L, retinoic acid, renal agenesis, CAKUT, whole exome sequencing Corresponding author: J. Robert Manak, PhD 459 Biology Building, Dept. of Biology University of Iowa 129 E. Jefferson St. Iowa City, IA 52242 Ph. 319-335-0180 [email protected] 2 ABSTRACT Renal agenesis (RA) is one of the more extreme examples of congenital anomalies of the kidney and urinary tract (CAKUT). Bilateral renal agenesis is almost invariably fatal at birth, and unilateral renal agenesis can lead to future health issues including end stage renal disease. -
Supplemental Material For
Supplemental material for Epithelial to mesenchymal transition rewires the molecular path to PI3-Kinase-dependent proliferation Megan B. Salt1,2, Sourav Bandyopadhyay1,3 and Frank McCormick1 Authors Affiliations: 1-Helen Diller Family Comprehensive Cancer Center; 2-Biomedical Sciences Graduate Program, University of California San Francisco, San Francisco, California; 3-California Institute for Quantitative Biosciences, San Francisco, California. Supplemental Figure Legends Table S1. EMT associated changes in gene expression. Significantly (A) up- and (B) down- regulated genes in comparing H358-TwistER cells to control H358-GFP expressing cells treated with 100nM 4OHT for 12 days. The four columns on the right are associated with significantly upregulated genes, while the four columns furthest left described significantly downregulated genes. The first column for the up- and downregulated genes shows the Probe ID associated with each gene from the Affymetric Human Gene 1.0 ST microarrays. The gene name are shown in the next column, followed by the log2(fold change) in expression for each gene after 4OHT treatment in the H358-TwistER cells. The final column shows the p-value for each gene adjusted for the false discovery rate. Figure S1. Akt inhibition reduces serum-independent proliferation. (A) Proliferation of H358- TwistER cells with increasing concentrations (uM) of GSK-690693 (top) or MK-2206 (bottom). (B) Lysates from H358-TwistER cells treated for 48hrs in serum free media with indicated concentrations of GSK-690693 (top), or MK-2206 (bottom). Figure S2. The effects of TGFβ1 are specific to epithelial cells and lead to reduced serum- independent proliferation. (A) Proliferation of untreated (top) or TGFβ1 pre-treated (bottom) H358 and H441 cells in the presence (10%) or absence (SS) of serum. -
Common Variants in SOX-2 and Congenital Cataract Genes Contribute to Age-Related Nuclear Cataract
ARTICLE https://doi.org/10.1038/s42003-020-01421-2 OPEN Common variants in SOX-2 and congenital cataract genes contribute to age-related nuclear cataract Ekaterina Yonova-Doing et al.# 1234567890():,; Nuclear cataract is the most common type of age-related cataract and a leading cause of blindness worldwide. Age-related nuclear cataract is heritable (h2 = 0.48), but little is known about specific genetic factors underlying this condition. Here we report findings from the largest to date multi-ethnic meta-analysis of genome-wide association studies (discovery cohort N = 14,151 and replication N = 5299) of the International Cataract Genetics Consortium. We confirmed the known genetic association of CRYAA (rs7278468, P = 2.8 × 10−16) with nuclear cataract and identified five new loci associated with this dis- ease: SOX2-OT (rs9842371, P = 1.7 × 10−19), TMPRSS5 (rs4936279, P = 2.5 × 10−10), LINC01412 (rs16823886, P = 1.3 × 10−9), GLTSCR1 (rs1005911, P = 9.8 × 10−9), and COMMD1 (rs62149908, P = 1.2 × 10−8). The results suggest a strong link of age-related nuclear cat- aract with congenital cataract and eye development genes, and the importance of common genetic variants in maintaining crystalline lens integrity in the aging eye. #A list of authors and their affiliations appears at the end of the paper. COMMUNICATIONS BIOLOGY | (2020) 3:755 | https://doi.org/10.1038/s42003-020-01421-2 | www.nature.com/commsbio 1 ARTICLE COMMUNICATIONS BIOLOGY | https://doi.org/10.1038/s42003-020-01421-2 ge-related cataract is the leading cause of blindness, structure (meta-analysis genomic inflation factor λ = 1.009, accounting for more than one-third of blindness Supplementary Table 4 and Supplementary Fig. -
HCC and Cancer Mutated Genes Summarized in the Literature Gene Symbol Gene Name References*
HCC and cancer mutated genes summarized in the literature Gene symbol Gene name References* A2M Alpha-2-macroglobulin (4) ABL1 c-abl oncogene 1, receptor tyrosine kinase (4,5,22) ACBD7 Acyl-Coenzyme A binding domain containing 7 (23) ACTL6A Actin-like 6A (4,5) ACTL6B Actin-like 6B (4) ACVR1B Activin A receptor, type IB (21,22) ACVR2A Activin A receptor, type IIA (4,21) ADAM10 ADAM metallopeptidase domain 10 (5) ADAMTS9 ADAM metallopeptidase with thrombospondin type 1 motif, 9 (4) ADCY2 Adenylate cyclase 2 (brain) (26) AJUBA Ajuba LIM protein (21) AKAP9 A kinase (PRKA) anchor protein (yotiao) 9 (4) Akt AKT serine/threonine kinase (28) AKT1 v-akt murine thymoma viral oncogene homolog 1 (5,21,22) AKT2 v-akt murine thymoma viral oncogene homolog 2 (4) ALB Albumin (4) ALK Anaplastic lymphoma receptor tyrosine kinase (22) AMPH Amphiphysin (24) ANK3 Ankyrin 3, node of Ranvier (ankyrin G) (4) ANKRD12 Ankyrin repeat domain 12 (4) ANO1 Anoctamin 1, calcium activated chloride channel (4) APC Adenomatous polyposis coli (4,5,21,22,25,28) APOB Apolipoprotein B [including Ag(x) antigen] (4) AR Androgen receptor (5,21-23) ARAP1 ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1 (4) ARHGAP35 Rho GTPase activating protein 35 (21) ARID1A AT rich interactive domain 1A (SWI-like) (4,5,21,22,24,25,27,28) ARID1B AT rich interactive domain 1B (SWI1-like) (4,5,22) ARID2 AT rich interactive domain 2 (ARID, RFX-like) (4,5,22,24,25,27,28) ARID4A AT rich interactive domain 4A (RBP1-like) (28) ARID5B AT rich interactive domain 5B (MRF1-like) (21) ASPM Asp (abnormal -
Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase -
Aneuploidy: Using Genetic Instability to Preserve a Haploid Genome?
Health Science Campus FINAL APPROVAL OF DISSERTATION Doctor of Philosophy in Biomedical Science (Cancer Biology) Aneuploidy: Using genetic instability to preserve a haploid genome? Submitted by: Ramona Ramdath In partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biomedical Science Examination Committee Signature/Date Major Advisor: David Allison, M.D., Ph.D. Academic James Trempe, Ph.D. Advisory Committee: David Giovanucci, Ph.D. Randall Ruch, Ph.D. Ronald Mellgren, Ph.D. Senior Associate Dean College of Graduate Studies Michael S. Bisesi, Ph.D. Date of Defense: April 10, 2009 Aneuploidy: Using genetic instability to preserve a haploid genome? Ramona Ramdath University of Toledo, Health Science Campus 2009 Dedication I dedicate this dissertation to my grandfather who died of lung cancer two years ago, but who always instilled in us the value and importance of education. And to my mom and sister, both of whom have been pillars of support and stimulating conversations. To my sister, Rehanna, especially- I hope this inspires you to achieve all that you want to in life, academically and otherwise. ii Acknowledgements As we go through these academic journeys, there are so many along the way that make an impact not only on our work, but on our lives as well, and I would like to say a heartfelt thank you to all of those people: My Committee members- Dr. James Trempe, Dr. David Giovanucchi, Dr. Ronald Mellgren and Dr. Randall Ruch for their guidance, suggestions, support and confidence in me. My major advisor- Dr. David Allison, for his constructive criticism and positive reinforcement. -
Supplementary Material
BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) J Neurol Neurosurg Psychiatry Page 1 / 45 SUPPLEMENTARY MATERIAL Appendix A1: Neuropsychological protocol. Appendix A2: Description of the four cases at the transitional stage. Table A1: Clinical status and center proportion in each batch. Table A2: Complete output from EdgeR. Table A3: List of the putative target genes. Table A4: Complete output from DIANA-miRPath v.3. Table A5: Comparison of studies investigating miRNAs from brain samples. Figure A1: Stratified nested cross-validation. Figure A2: Expression heatmap of miRNA signature. Figure A3: Bootstrapped ROC AUC scores. Figure A4: ROC AUC scores with 100 different fold splits. Figure A5: Presymptomatic subjects probability scores. Figure A6: Heatmap of the level of enrichment in KEGG pathways. Kmetzsch V, et al. J Neurol Neurosurg Psychiatry 2021; 92:485–493. doi: 10.1136/jnnp-2020-324647 BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) J Neurol Neurosurg Psychiatry Appendix A1. Neuropsychological protocol The PREV-DEMALS cognitive evaluation included standardized neuropsychological tests to investigate all cognitive domains, and in particular frontal lobe functions. The scores were provided previously (Bertrand et al., 2018). Briefly, global cognitive efficiency was evaluated by means of Mini-Mental State Examination (MMSE) and Mattis Dementia Rating Scale (MDRS). Frontal executive functions were assessed with Frontal Assessment Battery (FAB), forward and backward digit spans, Trail Making Test part A and B (TMT-A and TMT-B), Wisconsin Card Sorting Test (WCST), and Symbol-Digit Modalities test. -
Areca Catechu-(Betel-Nut)-Induced Whole Transcriptome Changes Associated With
bioRxiv preprint doi: https://doi.org/10.1101/2020.08.03.233932; this version posted August 3, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 1 Areca catechu-(Betel-nut)-induced whole transcriptome changes associated with 2 diabetes, obesity and metabolic syndrome in a human monocyte cell line 3 4 Short title: Betel-nut induced whole transcriptome changes 5 6 7 Shirleny Cardoso1¶ , B. William Ogunkolade1¶, Rob Lowe2, Emanuel Savage3, Charles A 8 Mein3, Barbara J Boucher1, Graham A Hitman1* 9 10 11 1Centre for Genomics and Child Health, Blizard Institute, Barts and the London School of 12 Medicine and Dentistry, Queen Mary University of London, United Kingdom 13 14 2Omnigen Biodata Ltd, Cambridge, United Kingdom 15 16 3Barts and The London Genome Centre, Blizard Institute, Queen Mary University of London, 17 United Kingdom 18 19 * Corresponding author 20 Email: [email protected] 21 22 ¶These authors contributed equally to the work 23 24 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.08.03.233932; this version posted August 3, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 25 Abstract 26 Betel-nut consumption is the fourth most common addictive habit globally and there is good 27 evidence to link it with obesity, type 2 diabetes and the metabolic syndrome. -
Limited Survival and Impaired Hepatic Fasting Metabolism in Mice with Constitutive Rag Gtpase Signaling
ARTICLE https://doi.org/10.1038/s41467-021-23857-8 OPEN Limited survival and impaired hepatic fasting metabolism in mice with constitutive Rag GTPase signaling Celia de la Calle Arregui 1, Ana Belén Plata-Gómez 1, Nerea Deleyto-Seldas1, Fernando García 2, Ana Ortega-Molina 1, Julio Abril-Garrido 1, Elena Rodriguez3, Ivan Nemazanyy4, Laura Tribouillard5,6, Alba de Martino7, Eduardo Caleiras7, Ramón Campos-Olivas8, Francisca Mulero 9, Mathieu Laplante 5,6, Javier Muñoz 2, Mario Pende 10, Guadalupe Sabio 3, David M. Sabatini 11,12,13,14,15 & ✉ Alejo Efeyan 1,11,12 1234567890():,; The mechanistic target of rapamycin complex 1 (mTORC1) integrates cellular nutrient sig- naling and hormonal cues to control metabolism. We have previously shown that constitutive nutrient signaling to mTORC1 by means of genetic activation of RagA (expression of GTP- locked RagA, or RagAGTP) in mice resulted in a fatal energetic crisis at birth. Herein, we rescue neonatal lethality in RagAGTP mice and find morphometric and metabolic alterations that span glucose, lipid, ketone, bile acid and amino acid homeostasis in adults, and a median lifespan of nine months. Proteomic and metabolomic analyses of livers from RagAGTP mice reveal a failed metabolic adaptation to fasting due to a global impairment in PPARα tran- scriptional program. These metabolic defects are partially recapitulated by restricting acti- vation of RagA to hepatocytes, and revert by pharmacological inhibition of mTORC1. Constitutive hepatic nutrient signaling does not cause hepatocellular damage and carcino- mas, unlike genetic activation of growth factor signaling upstream of mTORC1. In summary, RagA signaling dictates dynamic responses to feeding-fasting cycles to tune metabolism so as to match the nutritional state.