DOCSLIB.ORG

Mediated Antibiotic Resistance in Bifidobacterium Longum Subsp. Longum

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mediated Antibiotic Resistance in Bifidobacterium Longum Subsp. Longum Ann Microbiol (2015) 65:1985–1991 DOI 10.1007/s13213-015-1036-y ORIGINAL ARTICLE Detection of erm(X)-mediated antibiotic resistance in Bifidobacterium longum subsp.longum Cheng Luo & Xiaomin Hang & Xianglong Liu & Min Zhang & Xu Yang & Hong Yang Received: 2 October 2014 /Accepted: 7 January 2015 /Published online: 18 January 2015 # Springer-Verlag Berlin Heidelberg and the University of Milan 2015 Abstract Forty-six strains from a collection of human Introduction bifidobacteria stored in our lab, each belonging to Bifidobacterium longum subsp. longum species and Bifidobacteria are Gram-positive, bifid-shaped anaerobes that displaying unique Multilocus sequencing typing (MLST) pro- constitute a major group of human and animal gastrointestinal files, were chosen to assess an antibiotic resistance pattern. microbiota and are usually used as probiotics for their health- Three B. longum strains were found to be macrolide- promoting effects. Given their long and safe history of appli- lincosamide-streptogramin B (MLS)-resistant; erm(X) deter- cation, bifidobacteria have acquired the status of “generally minants were detected in genomic DNA, and two acquired regarded as safe” (GRAS). However, they might play a role in erm(X) determinants by Tn5432 transposition. A complete the transfer of antibiotic-resistant determinants to pathogenic sequence of Tn5432 in the bifidobacteria genome was obtain- and opportunistic bacteria, as the resistance gene reservoir ed for the first time. The transposon Tn5432 in the hypothesis suggests (Salyers et al. 2004). Horizontal gene Bifidobacterium longum subsp. longum SQS4-63 genome transfer events naturally occur between viable microorgan- was located between the NTP pyrophosphatase and pyruvate isms in an open environment such as the gastrointestinal tract, kinase genes, and the insertion created an 8 bp duplication of and acquired resistance mediated by added genes is consid- the target sequence (GATAACGA). ered to have a high potential for lateral spread (van Reenen and Dicks 2011). The European Food Safety Authority (EFSA) requires, as part of its Qualified Presumption of Keywords erm(X) . Tn5432 . Human bifidobacteria . Safety (QPS) approach, that bifidobacteria used as probiotics Horizontal gene transfer should not contain any acquired antibiotic resistant determi- nants (EFSA 2012). China has become the world’s top antibiotics consuming country, with an annual per-capita consumption of antibiotics at 138 g (Xiao 2008). Excess amounts of antibiotics are applied in medical treatments or used as animal growth pro- moters, which can lead to antimicrobial selection pressure and increased rates of resistant microbes in human- or animal- Electronic supplementary material The online version of this article associated microbiota, such as the gastrointestinal microbiota. (doi:10.1007/s13213-015-1036-y) contains supplementary material, which is available to authorized users. Bifidobacterial isolates from human sources face great risk for safety use as feed additives and their antibiotic resistance : : : : * C. Luo X. Liu M. Zhang X. Yang H. Yang ( ) pattern must be assessed. State Key Laboratory of Microbial metabolism, and School of Life Science & Biotechnology, Shanghai Jiao Tong University, 800 Antibiotic-resistant determinants detected in bifidobacteria Dongchuan Rd., Shanghai 200240, People’s Republic of China are relatively scarce and limited to tetracycline and macrolide e-mail: [email protected] antibiotics, as Gueimonde et al. (2013) reviewed. The erm(X) gene encodes an Erm(X) protein of 284 amino acids which X. Hang : M. Zhang Institute of Bio-medicine, Shanghai Jiao Da Onlly Company specifically methylate nucleotide A2058 in the 23S rRNA of Limited, Shanghai 200233, People’s Republic of China the 50S ribosomal subunit, thus protecting bacteria from MLS 1986 Ann Microbiol (2015) 65:1985–1991 antibiotics (Roberts 2008). The erm(X) gene was detected in where growth was inhibited along the inhibition ellipse (for Bifidobacterium thermophilum and Bifidobacterium animalis tetracycline, erythromycin, and clindamycin, the MIC was subsp. lactis isolates from animal sources and the antibiotic read at the point where growth was inhibited by 80 %). determinant was borne by transposon Tn5432 (van Hoek et al. Three independent replicates were conducted for each 2008). However, no genes coding for MLS resistance have experiment. been detected in human bifidobacteria. A complete sequence of Tn5432 in the bifidobacteria genome has not been obtain- DNA isolation and PCR detection of erm determinants ed, and the transposon target sites remain to be determined. Genomic DNA isolation was achieved using the MiniBEST Bacteria Genomic DNA Extraction Kit (TaKaRa, Dalian, Materials and methods China) according to the manufacturer’s instructions with mod- ifications in cell lysis. Cell lysis was achieved by mechanical Bifidobacterial strains and MLST lysis with the Mini-Beadbeater™ (Biospec, Bartlesville, OK, USA) and glass beads (Sigma, St. Louis, MO, USA) for 3 min A total of 48 B. longum strains were investigated in this study, at maximum speed at 4 °C. Detection of MLS-resistant erm including one type strain, one commercial strain, and 46 determinants was performed by PCR assays. Four primer pairs strains. Each was defined an individual strain by MLST were employed, and the primer pairs for erm(B) and erm(X) analyses from a collection of ∼300 bifidobacteria strains iso- were obtained from Jensen et al. (1999) and van Hoek et al. lated from human feces as candidates for probiotics. Among (2008), respectively, while the other two primer pairs for these 46 strains, 32 of them were isolated from fecal samples erm(A) and erm(E) were designed in this work, respectively, of healthy children aged 4 to 5 years in 2010 and 14 were based on the sequences of Staphylococcus aureus subsp. isolates from the feces of healthy adults aged 18 to 22 years in aureus MRSA252 (GenBank: BX571856.1) and 2012 (Table 2). All strains were identified to species level by Saccharopolyspora erythraea NRRL 2338 (GenBank: partial 16S rDNA sequencing and to strain level by MLST M11200.1) using Primer3web (Ver. 4.0.0 http://primer3.ut. analyses. Bifidobacterial strains were routinely grown anaer- ee/cgi-bin/primer3/primer3web_results.cgi). obically at 37 °C in MRS+cys broth (MRS broth supplement- ed with 0.5 g/L l-cysteine-HCl) pH 6.0. Self-formed adaptor PCR (SEFA PCR) Seven housekeeping genes, clpC, dnaG, dnaJ, fusA, gyrB, purF,andrpoB, were chosen for MLST analyses according to An attempt was made to obtain flanking regions of erm the method described by Ventura et al. (2006) and Makino determinants by SEFA PCR (Wang et al. 2007). PCR ampli- et al. (2011). Sequences of the clpC, dnaG, dnaJ, fusA, gyrB, fication of the downstream region of erm(X) was performed purF, and rpoB genes were converted into allelic profiles using three gene-specific primers, ermXF_SP1, ermXF_SP2, assigning a unique ID number to each allele, and the allelic and ermXF_SP3 (Table 1), and PCR amplification of the profiles at the seven loci were then used to classify bacterial upstream region of erm(X) was performed using three gene- isolates into sequence types (STs). specific primers, ermXR_SP1, ermXR_SP2, and ermXR_SP3 (Table 1). The primers for SEFA PCR were designed based on Antibiotic susceptibility testing the sequence of erm(X) amplified in this work. SEFA PCR was conducted in accordance with the manufacturer’sinstruc- Susceptibility of the 48 bifidobacterial strains to tetracycline, tions (Wang et al. 2007), and the amplified PCR products were erythromycin, clindamycin, chloramphenicol, ampicillin, and subsequently gel-purified and cloned using the MiniBEST vancomycin was evaluated using the Etest method as Huys Agarose Gel DNA Extraction Kit (TaKaRa, Dalian, China), et al. (2010) described. For inoculum preparation, colonies pMD®18-T Vector (TaKaRa, Dalian, China), and Trans 5α from cultures grown on MRS+cys agar for 2 days were Chemically Competent Cell (TransGen, Beijing, China), re- suspended in MRS+cys broth to cell density corresponding spectively, according to the kit protocols. All sequencing was to McFarland 1 standard or a spectrophotometric equivalent performed by BGI (Shenzhen, China). (3×108 CFU/mL). The standardized inoculum was spread evenly on MRS+cys agar using a sterile cotton swab. Etest Sequence analysis strips (bioMérieux, Marcy-l’Étoile, France), with preformed antimicrobial gradients in the test range from 0.016 to 256 mg/ Nucleotide sequences were assembled using the Vector NTI L, were placed on the air-dried agar surface. Inoculated plates Advance® software package (Ver. 11.5.1, Invitrogen BV, were incubated under anaerobic conditions at 37 °C for 48 h. Breda, the Netherlands). The alignments of DNA sequences The minimal inhibitory concentration (MIC) was defined as were performed at NCBI using blastn program (http://blast. the value corresponding to the first point on the Etest strip ncbi.nlm.nih.gov/Blast.cgi). The conserved domains were Ann Microbiol (2015) 65:1985–1991 1987 Table 1 PCR primers used in the study Primer name Gene(s) targeted/SEFA PCR primer Sequence (5′–3′) Reference ermX_F erm(X) ATGTTGATTTCAGGTACCGC (van Hoek et al. 2008) ermX_R AGTCACCTGGAAGAGATCG ermA_F erm(A) AAGAAGCGGTAAACCCCTCT This work ermA_R CGCAAATCCCTTCTCAACGA ermB_F erm(B) CATTTAACGACGAAACTGGC (Jensen et al. 1999) ermB_R GGAACATCTGTGGTATGGCG ermE_F erm(E) GAACGCTACGAGTCGATG This work ermE_R CTCGGTTCGTTCTTCTGATC P3_F Tn5432 GAAACAACGTACGGAGC (Ross et al.
Load more

Recommended publications
  • Bifidobacterium Response to Lactulose Ingestion in the Gut Relies on A
    ARTICLE https://doi.org/10.1038/s42003-021-02072-7 OPEN Bifidobacterium response to lactulose ingestion in the gut relies on a solute-binding protein- dependent ABC transporter ✉ Keisuke Yoshida 1 , Rika Hirano2,3, Yohei Sakai4, Moonhak Choi5, Mikiyasu Sakanaka 5,6, Shin Kurihara3,6, Hisakazu Iino7, Jin-zhong Xiao 1, Takane Katayama5,6 & Toshitaka Odamaki1 This study aims to understand the mechanistic basis underlying the response of Bifido- bacterium to lactulose ingestion in guts of healthy Japanese subjects, with specific focus on a lactulose transporter. An in vitro assay using mutant strains of Bifidobacterium longum subsp. 1234567890():,; longum 105-A shows that a solute-binding protein with locus tag number BL105A_0502 (termed LT-SBP) is primarily involved in lactulose uptake. By quantifying faecal abundance of LT-SBP orthologues, which is defined by phylogenetic analysis, we find that subjects with 107 to 109 copies of the genes per gram of faeces before lactulose ingestion show a marked increase in Bifidobacterium after ingestion, suggesting the presence of thresholds between responders and non-responders to lactulose. These results help predict the prebiotics- responder and non-responder status and provide an insight into clinical interventions that test the efficacy of prebiotics. 1 Next Generation Science Institute, RD Division, Morinaga Milk Industry Co., Ltd., Zama, Japan. 2 Research Institute for Bioresources and Biotechnology, Ishikawa Prefectural University, Nonoichi, Japan. 3 Biology-Oriented Science and Technology, Kindai University, Kinokawa, Japan. 4 Food Ingredients and Technology Institute, RD Division, Morinaga Milk Industry Co., Ltd, Zama, Japan. 5 Graduate School of Biostudies, Kyoto University, Kyoto, Japan. 6 Faculty of Bioresources and Environmental Sciences, Ishikawa Prefectural University, Nonoichi, Japan.
    [Show full text]
  • Bifidobacterium Longum Subsp. Infantis CECT7210
    nutrients Article Bifidobacterium longum subsp. infantis CECT7210 (B. infantis IM-1®) Displays In Vitro Activity against Some Intestinal Pathogens 1,2, 1,2, 1,2 3 Lorena Ruiz y, Ana Belén Flórez y , Borja Sánchez , José Antonio Moreno-Muñoz , Maria Rodriguez-Palmero 3, Jesús Jiménez 3 , Clara G. de los Reyes Gavilán 1,2 , Miguel Gueimonde 1,2 , Patricia Ruas-Madiedo 1,2 and Abelardo Margolles 1,2,* 1 Instituto de Productos Lácteos de Asturias (CSIC), P. Río Linares s/n, 33300 Villaviciosa, Spain; [email protected] (L.R.); abfl[email protected] (A.B.F.); [email protected] (B.S.); [email protected] (C.G.d.l.R.G.); [email protected] (M.G.); [email protected] (P.R.-M.) 2 Instituto de Investigación Sanitaria del Principado de Asturias (ISPA), 33011 Oviedo, Spain 3 Laboratorios Ordesa S.L., Parc Científic de Barcelona, C/Baldiri Reixac 15-21, 08028 Barcelona, Spain; [email protected] (J.A.M.-M.); [email protected] (M.R.-P.); [email protected] (J.J.) * Correspondence: [email protected]; Tel.: +34-985-89-21-31 These authors contributed equally to this work. y Received: 31 July 2020; Accepted: 21 October 2020; Published: 24 October 2020 Abstract: Certain non-digestible oligosaccharides (NDO) are specifically fermented by bifidobacteria along the human gastrointestinal tract, selectively favoring their growth and the production of health-promoting metabolites. In the present study, the ability of the probiotic strain Bifidobacterium longum subsp. infantis CECT7210 (herein referred to as B. infantis IM-1®) to utilize a large range of oligosaccharides, or a mixture of oligosaccharides, was investigated.
    [Show full text]
  • Bifidobacterium Bifidum: a Key Member of the Early Human Gut
    microorganisms Review Bifidobacterium bifidum: A Key Member of the Early Human Gut Microbiota Francesca Turroni 1,2,*, Sabrina Duranti 1, Christian Milani 1, Gabriele Andrea Lugli 1, Douwe van Sinderen 3,4 and Marco Ventura 1,2 1 Laboratory of Probiogenomics, Department of Chemistry, Life Sciences and Environmental Sustainability, University of Parma, 43124 Parma, Italy; [email protected] (S.D.); [email protected] (C.M.); [email protected] (G.A.L.); [email protected] (M.V.) 2 Microbiome Research Hub, University of Parma, 43124 Parma, Italy 3 School of Microbiology, University College Cork, T12 YT20 Cork, Ireland; [email protected] 4 APC Microbiome Institute, University College Cork, T12 YT20 Cork, Ireland * Correspondence: [email protected] Received: 2 October 2019; Accepted: 7 November 2019; Published: 9 November 2019 Abstract: Bifidobacteria typically represent the most abundant bacteria of the human gut microbiota in healthy breast-fed infants. Members of the Bifidobacterium bifidum species constitute one of the dominant taxa amongst these bifidobacterial communities and have been shown to display notable physiological and genetic features encompassing adhesion to epithelia as well as metabolism of host-derived glycans. In the current review, we discuss current knowledge concerning particular biological characteristics of the B. bifidum species that support its specific adaptation to the human gut and their implications in terms of supporting host health. Keywords: Bifidobacterium bifidum; bifidobacteria; probiotics; genomics; microbiota 1. General Features of the Genus Bifidobacterium The genus Bifidobacterium belongs to the Actinobacteria phylum and this genus together with nine other genera constitute the Bifidobacteriaceae family [1].
    [Show full text]
  • The Genome Sequence of Bifidobacterium Longum Reflects Its Adaptation to the Human Gastrointestinal Tract
    The genome sequence of Bifidobacterium longum reflects its adaptation to the human gastrointestinal tract Mark A. Schell*†, Maria Karmirantzou*‡, Berend Snel§¶, David Vilanova*, Bernard Berger*, Gabriella Pessi*ʈ, Marie-Camille Zwahlen*, Frank Desiere*, Peer Bork§, Michele Delley*, R. David Pridmore*, and Fabrizio Arigoni*,** *Nestle´Research Center, Vers-Chez-les-Blanc, Lausanne 1000, Switzerland; †Department of Microbiology, University of Georgia, Athens, GA 30602; and §European Molecular Biology Laboratory, Meyerhoffstrasse 1, 69117 Heidelberg, Germany Communicated by Dieter So¨ll, Yale University, New Haven, CT, August 30, 2002 (received for review July 3, 2002) Bifidobacteria are Gram-positive prokaryotes that naturally colo- colonizers of the sterile GITs of newborns and predominate in nize the human gastrointestinal tract (GIT) and vagina. Although breast-fed infants until weaning, when they are surpassed by not numerically dominant in the complex intestinal microflora, Bacteroides and other groups (6, 7). This progressive coloniza- they are considered as key commensals that promote a healthy GIT. tion is thought to be important for development of immune We determined the 2.26-Mb genome sequence of an infant-derived system tolerance, not only to GIT commensals, but also to strain of Bifidobacterium longum, and identified 1,730 possible dietary antigens (8); lack of such tolerance possibly leads to food coding sequences organized in a 60%–GC circular chromosome. allergies and chronic inflammation. Bioinformatic analysis revealed several physiological traits that Although bifidobacteria represent only 3–6% of the adult could partially explain the successful adaptation of this bacteria fecal flora, their presence has been associated with beneficial to the colon. An unexpectedly large number of the predicted health effects, such as prevention of diarrhea, amelioration of proteins appeared to be specialized for catabolism of a variety lactose intolerance, or immunomodulation (5).
    [Show full text]
  • The Bifidogenic Effect Revisited—Ecology and Health Perspectives
    microorganisms Review The Bifidogenic Effect Revisited—Ecology and Health Perspectives of Bifidobacterial Colonization in Early Life Himanshu Kumar 1, Maria Carmen Collado 2,3 , Harm Wopereis 1 , Seppo Salminen 3 , Jan Knol 1,4 and Guus Roeselers 1,* 1 Danone Nutricia Research, 3584 CT Utrecht, The Netherlands; [email protected] (H.K.); [email protected] (H.W.); [email protected] (J.K.) 2 Department of Biotechnology, Institute of Agrochemistry and Food Technology-Spanish National Research Council (IATA-CSIC), Paterna, 46980 Valencia, Spain; [email protected] 3 Functional Foods Forum, Faculty of Medicine, University of Turku, 20500 Turku, Finland; seppo.salminen@utu.fi 4 Laboratory for Microbiology, Wageningen University, 6708 PB Wageningen, The Netherlands * Correspondence: [email protected] Received: 22 October 2020; Accepted: 23 November 2020; Published: 25 November 2020 Abstract: Extensive microbial colonization of the infant gastrointestinal tract starts after parturition. There are several parallel mechanisms by which early life microbiome acquisition may proceed, including early exposure to maternal vaginal and fecal microbiota, transmission of skin associated microbes, and ingestion of microorganisms present in breast milk. The crucial role of vertical transmission from the maternal microbial reservoir during vaginal delivery is supported by the shared microbial strains observed among mothers and their babies and the distinctly different gut microbiome composition of caesarean-section born infants. The healthy infant colon is often dominated by members of the keystone genus Bifidobacterium that have evolved complex genetic pathways to metabolize different glycans present in human milk. In exchange for these host-derived nutrients, bifidobacteria’s saccharolytic activity results in an anaerobic and acidic gut environment that is protective against enteropathogenic infection.
    [Show full text]
  • GRAS Notice 877, Bifidobacterium Longum BB536
    GRAS Notice (GRN) No. 877 https://www.fda.gov/food/generally-recognized-safe-gras/gras-notice-inventory G-r<. N f77 July 24, 2019 Rachel Morissette, Ph.D. Regulatory Review Scientist Center for Food Safety and Applied Nutrition Office of Food Additive Safety U.S. Food and Drug Administration JUL 2 5 2019 CPK-2 Building, Room 2092 OFFICE OF 5001 Campus Drive, HFS-225 FOOD ADDITIVE SAFETY College Park, MD 20740 Dear Dr. Morissette: It is our opinion that the GRAS determination titled "Generally Recognized As Safe (GRAS) Notification for the Use of Bifidobacterium longum BB536 in Infant Formula" constitutes a new notification. Bifidobacterium longum BB536 produced by Morinaga Milk Industry Co., Ltd., subject of GRN 268, has been previously determined safe for use in conventional foods and beverages. This notification expands the intended use of B. longum BB536 to include non­ exempt infant formula. The safety narrative was updated to include new published information since the filing of Morinaga' s original B. longum BB536 GRN 268. We thank you for taking the time to review this GRAS determination. Should you have additional questions, please let us know. Sincerely, Claire L, Kruger, Ph.D., D.A.B.T. President 11821 Parklawn Drive, Suite 310 Rockville, MD 20852 T (301) 230-2180; F: (301) 230-2188 https://chromadex.com/consulting-overview/ Form Approved: 0MB No. 0910-0342; Expiration Date: 09/30/2019 (See last page for 0MB StatemenQ FDA USE ONLY GRN NUMBER DATE OF RECEIPT DEPARTMENT OF HEALTH AND HUMAN SERVICES ESTIMATED DAILY INTAKE INTENDED USE FOR INTERNET Food and Drug Administration GENERALLY RECOGNIZED AS SAFE NAME FOR INTERNET (GRAS) NOTICE (Subpart E of Part 170) KEYWORDS Transmit completed form and attachments electronically via the Electronic Submission Gateway (see Instructions); OR Transmit completed form and attachments in paper format or on physical media to: Office of Food Additive Safety (HFS-200), Center for Food Safety and Applied Nutrition, Food and Drug Administration,5001 Campus Drive, College Park, MD 20740-3835.
    [Show full text]
  • Probiotics and Antimicrobial Effect of Lactiplantibacillus Plantarum, Saccharomyces Cerevisiae, and Bifidobacterium Longum Again
    agriculture Article Probiotics and Antimicrobial Effect of Lactiplantibacillus plantarum, Saccharomyces cerevisiae, and Bifidobacterium longum against Common Foodborne Pathogens in Poultry Joy Igbafe 1, Agnes Kilonzo-Nthenge 2,*, Samuel N. Nahashon 1, Abdullah Ibn Mafiz 1 and Maureen Nzomo 1 1 Department of Agriculture and Environmental Sciences, Tennessee State University, 3500 John A. Merritt Boulevard, Nashville, TN 37209, USA; [email protected] (J.I.); [email protected] (S.N.N.); amafi[email protected] (A.I.M.); [email protected] (M.N.) 2 Department of Human Sciences, Tennessee State University, 3500 John A. Merritt Boulevard, Nashville, TN 37209, USA * Correspondence: [email protected]; Tel.: +1-615-963-5437; Fax: +1-615-963-5557 Received: 30 July 2020; Accepted: 17 August 2020; Published: 20 August 2020 Abstract: The probiotic potential and antimicrobial activity of Lactiplantibacillus plantarum, Saccharomyces cerevisiae, and Bifidobacterium longum were investigated against Escherichia coli O157:H7, Salmonella typhimurium and Listeria monocytogenes. Selected strains were subjected to different acid levels (pH 2.5–6.0) and bile concentrations (1.0–3.0%). Strains were also evaluated for their antimicrobial activity by agar spot test. The potential probiotic strains tolerated pH 3.5 and above without statistically significant growth reduction. However, at pH 2.5, a significant (p < 0.05) growth reduction occurred after 1 h for L. plantarum (4.32 log CFU/mL) and B. longum (5.71 log CFU/mL). S. cerevisiae maintained steady cell counts for the entire treatment period without a statistically significant (p > 0.05) reduction (0.39 log CFU/mL). The results indicate at 3% bile concertation, 1.86 log CFU/mL reduction was observed for L.
    [Show full text]
  • Strain-Specific Effects of Bifidobacterium Longum On
    International Journal of Molecular Sciences Article Strain-Specific Effects of Bifidobacterium longum on Hypercholesterolemic Rats and Potential Mechanisms Jinchi Jiang 1, Caie Wu 2, Chengcheng Zhang 1,3, Qingsong Zhang 1,3, Leilei Yu 1,3, Jianxin Zhao 1,3, Hao Zhang 1,3,4,5,6,7, Arjan Narbad 4,8, Wei Chen 1,3,5,9 and Qixiao Zhai 1,3,4,* 1 State Key Laboratory of Food Science and Technology, Jiangnan University, Wuxi 214122, China; [email protected] (J.J.); [email protected] (C.Z.); [email protected] (Q.Z.); [email protected] (L.Y.); [email protected] (J.Z.); [email protected] (H.Z.); [email protected] (W.C.) 2 College of Light Industry and Food Engineering, Nanjing Forestry University, Nanjing 210037, China; [email protected] 3 School of Food Science and Technology, Jiangnan University, Wuxi 214122, China 4 International Joint Research Laboratory for Pharmabiotics & Antibiotic Resistance, Jiangnan University, Wuxi 214122, China; [email protected] 5 National Engineering Research Center for Functional Food, Jiangnan University, Wuxi 214122, China 6 Wuxi Translational Medicine Research Center and Jiangsu Translational Medicine Research Institute Wuxi Branch, Wuxi 214122, China 7 (Yangzhou) Institute of Food Biotechnology, Jiangnan University, Yangzhou 225004, China 8 Gut Health and Food Safety Programme, Quadram Institute Bioscience, Norwich Research Park Colney, Norwich, Norfolk NR4 7UA, UK 9 Beijing Innovation Center of Food Nutrition and Human Health, Beijing Technology and Business University (BTBU), Beijing 100048, China * Correspondence: [email protected]; Tel.: +86-510-8591-2155 Citation: Jiang, J.; Wu, C.; Zhang, C.; Abstract: Hypercholesterolemia is an independent risk factor of cardiovascular disease, which is Zhang, Q.; Yu, L.; Zhao, J.; Zhang, H.; among the major causes of death worldwide.
    [Show full text]
  • Comparative Genomic and Phylogenomic Analyses of The
    Lugli et al. BMC Genomics (2017) 18:568 DOI 10.1186/s12864-017-3955-4 RESEARCHARTICLE Open Access Comparative genomic and phylogenomic analyses of the Bifidobacteriaceae family Gabriele Andrea Lugli1, Christian Milani1, Francesca Turroni1, Sabrina Duranti1, Leonardo Mancabelli1, Marta Mangifesta2, Chiara Ferrario1, Monica Modesto3, Paola Mattarelli3, Killer Jiří4,5, Douwe van Sinderen6 and Marco Ventura1* Abstract Background: Members of the Bifidobacteriaceae family represent both dominant microbial groups that colonize the gut of various animals, especially during the suckling stage of their life, while they also occur as pathogenic bacteria of the urogenital tract. The pan-genome of the genus Bifidobacterium has been explored in detail in recent years, though genomics of the Bifidobacteriaceae family has not yet received much attention. Here, a comparative genomic analyses of 67 Bifidobacteriaceae (sub) species including all currently recognized genera of this family, i.e., Aeriscardovia, Alloscardovia, Bifidobacterium, Bombiscardovia, Gardnerella, Neoscardovia, Parascardovia, Pseudoscardovia and Scardovia, was performed. Furthermore, in order to include a representative of each of the 67 (currently recognized) (sub) species belonging to the Bifidobacteriaceae family, we sequenced the genomes of an additional 11 species from this family, accomplishing the most extensive comparative genomic analysis performed within this family so far. Results: Phylogenomics-based analyses revealed the deduced evolutionary pathway followed by each member
    [Show full text]
  • Milk and Two Oligosaccharides Alan Walker
    NEWS & ANALYSIS GENOME WATCH Milk and two oligosaccharides Alan Walker This month’s Genome Watch reviews the genes involved in HMO catabolism in the three recent papers that describe B. longum subsp. infantis genome were not bifidobacterial genomes. present in B. animalis subsp. lactis, indicat- ing that there are niche-specific adaptations Bifidobacteria comprise a phylogenetically between these two groups. Genome analysis distinct group of approximately 30 species did, however, indicate the presence of a range of Gram-positive, anaerobic rods belonging of other factors that are important for coloni- to the Actinobacteria phylum and are com- zation and persistence in the gastro intestinal mon inhabitants of the gastrointestinal tract tract, such as the ability to degrade a range of of humans and other mammals. Infants milk galactosides and plant-derived oligosac- are born sterile but bacterial colonization charides, and a bile salt hydrolase that medi- of the gut occurs rapidly after birth. In ates tolerance to bile. Insight into the probiotic breast-fed infants, bifidobacteria frequently function of B. animalis subsp. lactis was pro- predominate in the gastrointestinal tract vided by the identification of the fos gene and consequently might have a role in the cluster. This cluster is involved in processing development and maturation of the healthy fructo oligosaccharides, which are common gut. After weaning, however, the popula- prebiotics and known bifidogenic factors. tion of bifidobacteria declines, and these There are now several complete and species are less abundant members of the ongoing bifidobacterial genome sequencing gut microbiota in adults. Bifidobacterium Nature Reviews | Microbiology projects. The results promise to increase our species have therefore gained attention as mechanism for HMO utilization in this sub- understanding of the co-evolution between potential probiotics, with several postulated species.
    [Show full text]
  • Bifidobacterium Longum 105-A Via Expression of a Catalase Doi:10.1021/Bm061081f
    Tahoun et al. Gut Pathog (2017) 9:27 DOI 10.1186/s13099-017-0177-x Gut Pathogens RESEARCH Open Access Capsular polysaccharide inhibits adhesion of Bifdobacterium longum 105‑A to enterocyte‑like Caco‑2 cells and phagocytosis by macrophages Amin Tahoun1,2†, Hisayoshi Masutani1†, Hanem El‑Sharkawy2,3, Trudi Gillespie4, Ryo P. Honda5, Kazuo Kuwata6,7,8, Mizuho Inagaki1,9, Tomio Yabe1,8,9, Izumi Nomura1 and Tohru Suzuki1,9* Abstract Background: Bifdobacterium longum 105-A produces markedly high amounts of capsular polysaccharides (CPS) and exopolysaccharides (EPS) that should play distinct roles in bacterial–host interactions. To identify the biological func‑ tion of B. longum 105-A CPS/EPS, we carried out an informatics survey of the genome and identifed the EPS-encoding genetic locus of B. longum 105-A that is responsible for the production of CPS/EPS. The role of CPS/EPS in the adapta‑ tion to gut tract environment and bacteria-gut cell interactions was investigated using the ΔcpsD mutant. Results: A putative B. longum 105-A CPS/EPS gene cluster was shown to consist of 24 putative genes encoding a priming glycosyltransferase (cpsD), 7 glycosyltransferases, 4 CPS/EPS synthesis machinery proteins, and 3 dTDP-L- rhamnose synthesis enzymes. These enzymes should form a complex system that is involved in the biogenesis of CPS and/or EPS. To confrm this, we constructed a knockout mutant (ΔcpsD) by a double cross-over homologous recombination. Compared to wild-type, the ∆cpsD mutant showed a similar growth rate. However, it showed quicker sedimentation and formation of cell clusters in liquid culture.
    [Show full text]
  • Application of Molecular Biological Methods for Studying Probiotics and the Gut Flora
    Downloaded from British Journal of Nutrition (2002), 88, Suppl. 1, S29–S37 DOI: 10.1079/BJN2002627 q The Author 2002 https://www.cambridge.org/core Application of molecular biological methods for studying probiotics and the gut flora A. L. McCartney* . IP address: Food Microbial Sciences Unit, School of Food Biosciences, University of Reading, Whiteknights, Reading RG6 6AP, UK 170.106.40.40 Increasingly, the microbiological scientific community is relying on molecular biology to define the complexity of the gut flora and to distinguish one organism from the next. This is particu- larly pertinent in the field of probiotics, and probiotic therapy, where identifying probiotics , on from the commensal flora is often warranted. Current techniques, including genetic fingerprint- 29 Sep 2021 at 19:04:11 ing, gene sequencing, oligonucleotide probes and specific primer selection, discriminate closely related bacteria with varying degrees of success. Additional molecular methods being employed to determine the constituents of complex microbiota in this area of research are community analysis, denaturing gradient gel electrophoresis (DGGE)/temperature gradient gel electrophor- esis (TGGE), fluorescent in situ hybridisation (FISH) and probe grids. Certain approaches enable specific aetiological agents to be monitored, whereas others allow the effects of dietary , subject to the Cambridge Core terms of use, available at intervention on bacterial populations to be studied. Other approaches demonstrate diversity, but may not always enable quantification of the population. At the heart of current molecular methods is sequence information gathered from culturable organisms. However, the diversity and novelty identified when applying these methods to the gut microflora demonstrates how little is known about this ecosystem.
    [Show full text]