Ann Microbiol (2015) 65:1985–1991 DOI 10.1007/s13213-015-1036-y

ORIGINAL ARTICLE

Detection of erm(X)-mediated antibiotic resistance in Bifidobacterium longum subsp.longum

Cheng Luo & Xiaomin Hang & Xianglong Liu & Min Zhang & Xu Yang & Hong Yang

Received: 2 October 2014 /Accepted: 7 January 2015 /Published online: 18 January 2015 # Springer-Verlag Berlin Heidelberg and the University of Milan 2015

Abstract Forty-six strains from a collection of human Introduction bifidobacteria stored in our lab, each belonging to Bifidobacterium longum subsp. longum species and Bifidobacteria are Gram-positive, bifid-shaped anaerobes that displaying unique Multilocus sequencing typing (MLST) pro- constitute a major group of human and animal gastrointestinal files, were chosen to assess an antibiotic resistance pattern. microbiota and are usually used as probiotics for their health- Three B. longum strains were found to be macrolide- promoting effects. Given their long and safe history of appli- lincosamide-streptogramin B (MLS)-resistant; erm(X) deter- cation, bifidobacteria have acquired the status of “generally minants were detected in genomic DNA, and two acquired regarded as safe” (GRAS). However, they might play a role in erm(X) determinants by Tn5432 transposition. A complete the transfer of antibiotic-resistant determinants to pathogenic sequence of Tn5432 in the bifidobacteria genome was obtain- and opportunistic bacteria, as the resistance gene reservoir ed for the first time. The transposon Tn5432 in the hypothesis suggests (Salyers et al. 2004). Horizontal gene Bifidobacterium longum subsp. longum SQS4-63 genome transfer events naturally occur between viable microorgan- was located between the NTP pyrophosphatase and pyruvate isms in an open environment such as the gastrointestinal tract, kinase genes, and the insertion created an 8 bp duplication of and acquired resistance mediated by added genes is consid- the target sequence (GATAACGA). ered to have a high potential for lateral spread (van Reenen and Dicks 2011). The European Food Safety Authority (EFSA) requires, as part of its Qualified Presumption of Keywords erm(X) . Tn5432 . Human bifidobacteria . Safety (QPS) approach, that bifidobacteria used as probiotics Horizontal gene transfer should not contain any acquired antibiotic resistant determi- nants (EFSA 2012). China has become the world’s top antibiotics consuming country, with an annual per-capita consumption of antibiotics at 138 g (Xiao 2008). Excess amounts of antibiotics are applied in medical treatments or used as animal growth pro- moters, which can lead to antimicrobial selection pressure and increased rates of resistant microbes in human- or animal- Electronic supplementary material The online version of this article associated microbiota, such as the gastrointestinal microbiota. (doi:10.1007/s13213-015-1036-y) contains supplementary material, which is available to authorized users. Bifidobacterial isolates from human sources face great risk for safety use as feed additives and their antibiotic resistance : : : : * C. Luo X. Liu M. Zhang X. Yang H. Yang ( ) pattern must be assessed. State Key Laboratory of Microbial metabolism, and School of Life Science & Biotechnology, Shanghai Jiao Tong University, 800 Antibiotic-resistant determinants detected in bifidobacteria Dongchuan Rd., Shanghai 200240, People’s Republic of China are relatively scarce and limited to tetracycline and macrolide e-mail: [email protected] antibiotics, as Gueimonde et al. (2013) reviewed. The erm(X) gene encodes an Erm(X) protein of 284 amino acids which X. Hang : M. Zhang Institute of Bio-medicine, Shanghai Jiao Da Onlly Company specifically methylate nucleotide A2058 in the 23S rRNA of Limited, Shanghai 200233, People’s Republic of China the 50S ribosomal subunit, thus protecting bacteria from MLS 1986 Ann Microbiol (2015) 65:1985–1991 antibiotics (Roberts 2008). The erm(X) gene was detected in where growth was inhibited along the inhibition ellipse (for Bifidobacterium thermophilum and Bifidobacterium animalis tetracycline, erythromycin, and clindamycin, the MIC was subsp. lactis isolates from animal sources and the antibiotic read at the point where growth was inhibited by 80 %). determinant was borne by transposon Tn5432 (van Hoek et al. Three independent replicates were conducted for each 2008). However, no genes coding for MLS resistance have experiment. been detected in human bifidobacteria. A complete sequence of Tn5432 in the bifidobacteria genome has not been obtain- DNA isolation and PCR detection of erm determinants ed, and the transposon target sites remain to be determined. Genomic DNA isolation was achieved using the MiniBEST Bacteria Genomic DNA Extraction Kit (TaKaRa, Dalian, Materials and methods China) according to the manufacturer’s instructions with mod- ifications in cell lysis. Cell lysis was achieved by mechanical Bifidobacterial strains and MLST lysis with the Mini-Beadbeater™ (Biospec, Bartlesville, OK, USA) and glass beads (Sigma, St. Louis, MO, USA) for 3 min A total of 48 B. longum strains were investigated in this study, at maximum speed at 4 °C. Detection of MLS-resistant erm including one type strain, one commercial strain, and 46 determinants was performed by PCR assays. Four primer pairs strains. Each was defined an individual strain by MLST were employed, and the primer pairs for erm(B) and erm(X) analyses from a collection of ∼300 bifidobacteria strains iso- were obtained from Jensen et al. (1999) and van Hoek et al. lated from human feces as candidates for probiotics. Among (2008), respectively, while the other two primer pairs for these 46 strains, 32 of them were isolated from fecal samples erm(A) and erm(E) were designed in this work, respectively, of healthy children aged 4 to 5 years in 2010 and 14 were based on the sequences of Staphylococcus aureus subsp. isolates from the feces of healthy adults aged 18 to 22 years in aureus MRSA252 (GenBank: BX571856.1) and 2012 (Table 2). All strains were identified to species level by Saccharopolyspora erythraea NRRL 2338 (GenBank: partial 16S rDNA sequencing and to strain level by MLST M11200.1) using Primer3web (Ver. 4.0.0 http://primer3.ut. analyses. Bifidobacterial strains were routinely grown anaer- ee/cgi-bin/primer3/primer3web_results.cgi). obically at 37 °C in MRS+cys broth (MRS broth supplement- ed with 0.5 g/L l-cysteine-HCl) pH 6.0. Self-formed adaptor PCR (SEFA PCR) Seven housekeeping genes, clpC, dnaG, dnaJ, fusA, gyrB, purF,andrpoB, were chosen for MLST analyses according to An attempt was made to obtain flanking regions of erm the method described by Ventura et al. (2006) and Makino determinants by SEFA PCR (Wang et al. 2007). PCR ampli- et al. (2011). Sequences of the clpC, dnaG, dnaJ, fusA, gyrB, fication of the downstream region of erm(X) was performed purF, and rpoB genes were converted into allelic profiles using three gene-specific primers, ermXF_SP1, ermXF_SP2, assigning a unique ID number to each allele, and the allelic and ermXF_SP3 (Table 1), and PCR amplification of the profiles at the seven loci were then used to classify bacterial upstream region of erm(X) was performed using three gene- isolates into sequence types (STs). specific primers, ermXR_SP1, ermXR_SP2, and ermXR_SP3 (Table 1). The primers for SEFA PCR were designed based on Antibiotic susceptibility testing the sequence of erm(X) amplified in this work. SEFA PCR was conducted in accordance with the manufacturer’sinstruc- Susceptibility of the 48 bifidobacterial strains to tetracycline, tions (Wang et al. 2007), and the amplified PCR products were erythromycin, clindamycin, chloramphenicol, ampicillin, and subsequently gel-purified and cloned using the MiniBEST vancomycin was evaluated using the Etest method as Huys Agarose Gel DNA Extraction Kit (TaKaRa, Dalian, China), et al. (2010) described. For inoculum preparation, colonies pMD®18-T Vector (TaKaRa, Dalian, China), and Trans 5α from cultures grown on MRS+cys agar for 2 days were Chemically Competent Cell (TransGen, Beijing, China), re- suspended in MRS+cys broth to cell density corresponding spectively, according to the kit protocols. All sequencing was to McFarland 1 standard or a spectrophotometric equivalent performed by BGI (Shenzhen, China). (3×108 CFU/mL). The standardized inoculum was spread evenly on MRS+cys agar using a sterile cotton swab. Etest Sequence analysis strips (bioMérieux, Marcy-l’Étoile, France), with preformed antimicrobial gradients in the test range from 0.016 to 256 mg/ Nucleotide sequences were assembled using the Vector NTI L, were placed on the air-dried agar surface. Inoculated plates Advance® software package (Ver. 11.5.1, Invitrogen BV, were incubated under anaerobic conditions at 37 °C for 48 h. Breda, the Netherlands). The alignments of DNA sequences The minimal inhibitory concentration (MIC) was defined as were performed at NCBI using blastn program (http://blast. the value corresponding to the first point on the Etest strip ncbi.nlm.nih.gov/Blast.cgi). The conserved domains were Ann Microbiol (2015) 65:1985–1991 1987

Table 1 PCR primers used in the study

Primer name Gene(s) targeted/SEFA PCR primer Sequence (5′–3′) Reference ermX_F erm(X) ATGTTGATTTCAGGTACCGC (van Hoek et al. 2008) ermX_R AGTCACCTGGAAGAGATCG ermA_F erm(A) AAGAAGCGGTAAACCCCTCT This work ermA_R CGCAAATCCCTTCTCAACGA ermB_F erm(B) CATTTAACGACGAAACTGGC (Jensen et al. 1999) ermB_R GGAACATCTGTGGTATGGCG ermE_F erm(E) GAACGCTACGAGTCGATG This work ermE_R CTCGGTTCGTTCTTCTGATC P3_F Tn5432 GAAACAACGTACGGAGC (Ross et al. 2002) P3_R GGTTGAGGTAGACAAAC P4_F Tn5432 GGGAAATTCTCCGAAGG (Ross et al. 2002) P4_R GGTGATGTCGTTTCGAC NTP_F NTP pyrophosphatase TCAGGAGAACAATGGCGA This work Pyr_R pyruvate kinase AAGTACCCGGATGTGACC Crc_F crcB4 GACATCGTCGAAAGCCCAC This work 1273_R BBMN68_1273 TCGGATCATGGAAGCGTGTA ermXF_SP1b SEFA PCR primer ACAAACCTCCGGCCCCATCATTGA This work ermXF_SP2b ACGGCAGTTGAAGTGGACGCAAAA ermXF_SP3b CGGAGTAGGCGCAANNNNNNNNNTGACGa ermXR_SP1c SEFA PCR primer TGAAAACAACCCTGCCTTCG This work ermXR_SP2c CGAAGAATGGCAGTGGTGAG ermXR_SP3c CAGCTAGNNNNNNNNCCACTa a N=A, C, G and T b SEFA PCR primer for chromosome walking towards erm(X) downstream region c SEFA PCR primer for chromosome walking towards erm(X) upstream region identified with NCBI CDD website (http://www.ncbi.nlm.nih. in Supplementary Fig. 1. Each of the 48 strains was given an gov/Structure/cdd/cdd.shtml) (Marchler-Bauer et al. 2013). individual strain by MLST analyses. For MLST analyses, neighbor-joining phylogenetic trees gen- erated from allelic profiles were calculated using START2 (Sequence Type Analysis and Recombinational Tests Ver. 2, Antimicrobial susceptibility testing http://pubmlst.org/software/analysis/start2/) (Jolley et al. 2001). For Bifidobacterium genus, microbiological cut-off values for tetracycline, erythromycin, clindamycin, chloramphenicol, ampicillin, and vancomycin were, re- Nucleotide sequence accession number spectively, set at 8 mg/L, 1 mg/L, 1 mg/L, 4 mg/L, 2mg/L,and2mg/LbyEFSA(2012). All 48 strains The erm(X) DNA sequences and flanking regions of the three tested were susceptible to tetracycline, chloramphenicol, B. longum strains have been submitted to GenBank under ampicillin, and vancomycin and displayed low MIC – accession numbers KJ752721 KJ752723. values (Table 2). For erythromycin and clindamycin, the results indicated that three strains were resistant and 45 strains were susceptible (Table 2 ). Bifidobacterium longum subsp. longum SQS7-31 and Results Bifidobacterium longum subsp. longum J3 showed strong resistance to these two antimicrobials with high MLST analyses MIC values of >256 mg/L, while B. longum SQS4-63 displayed MIC values of 4 mg/L to erythromycin, con- The phylogenetic tree resulting from the allelic profiles of sidered to be moderately resistant, and of >256 mg/L to clpC, dnaG, dnaJ, fusA, gyrB, purF,andrpoB is presented clindamycin, suggesting strong resistance. 1988 Ann Microbiol (2015) 65:1985–1991

Table 2 Susceptibility of B. longum strains to antimicrobial agents in the study

Strain # Origin MIC (mg/L)

TET ERY CLI CHL AMP VAN

BL88-Onllya Human 0.25 0.125 <0.016 0.25 <0.016 0.25 ATCC 15707b Human 1.0 0.25 <0.016 0.125 <0.016 0.25 SQS1-12 Child feces 1.0 0.25 <0.016 0.094 <0.016 0.50 SQS1-15 Child feces 1.0 0.50 0.023 0.064 <0.016 0.25 SQS1-17 Child feces 0.25 0.25 <0.016 0.094 0.023 1.0 SQS2-08 Child feces 2 0.25 0.023 0.064 <0.016 0.25 SQS2-15 Child feces 0.50 0.125 0.064 0.064 <0.016 0.50 SQS2-21 Child feces 0.50 0.125 <0.016 <0.016 <0.016 0.25 SQS3-06 Child feces 1.0 0.50 0.064 0.064 <0.016 0.25 SQS3-12 Child feces 1.0 0.25 <0.016 0.064 <0.016 1.0 SQS3-23 Child feces 2 0.25 0.023 0.064 <0.016 0.25 SQS3-54 Child feces 1.0 0.25 <0.016 0.125 <0.016 0.25 SQS4-14 Child feces 1.0 1.0 0.125 0.125 <0.016 0.25 SQS4-18 Child feces 2 1.0 0.125 0.125 <0.016 1.0 SQS4-63 Child feces 0.25 4 >256 0.50 <0.016 0.25 SQS6-21 Child feces 1.0 0.25 <0.016 0.125 <0.016 0.38 SQS6-25 Child feces 2 0.25 0.023 0.25 <0.016 1.0 SQS6-36 Child feces 0.25 0.25 0.064 0.125 <0.016 0.38 SQS7-03 Child feces 1.0 0.125 <0.016 0.125 <0.016 0.25 SQS7-13 Child feces 0.25 0.125 0.023 <0.016 <0.016 0.38 SQS7-31 Child feces 1.0 >256 >256 0.25 <0.016 0.50 SQS7-48 Child feces 1.0 0.125 <0.016 0.125 <0.016 0.38 C1 Child feces 0.50 0.50 0.094 0.064 <0.016 0.25 C13 Child feces 2 1.0 0.094 0.25 <0.016 0.25 C22 Child feces 0.50 0.125 <0.016 <0.016 <0.016 0.25 D1 Child feces 0.50 0.125 0.023 0.023 <0.016 0.25 D21 Child feces 1.0 0.125 <0.016 <0.016 <0.016 0.38 D33 Child feces 1.0 0.25 0.023 0.064 <0.016 0.25 D35 Child feces 1.0 0.50 0.125 0.064 0.023 0.25 X3 Child feces 0.50 0.125 <0.016 0.023 <0.016 0.25 X4 Child feces 1.0 0.25 <0.016 0.125 <0.016 0.50 X21 Child feces 1.0 0.50 0.023 0.023 <0.016 0.25 X33 Child feces 1.0 0.50 0.023 0.064 <0.016 0.50 X34 Child feces 1.0 0.25 <0.016 0.064 <0.016 0.25 L1 Adult feces 2 0.125 <0.016 0.023 <0.016 0.25 L2 Adult feces 0.50 0.25 <0.016 <0.016 <0.016 0.50 L6 Adult feces 0.50 1.0 0.032 0.023 <0.016 0.25 L13 Adult feces 1.0 0.125 <0.016 0.023 <0.016 0.25 L21 Adult feces 2 1.0 0.125 0.25 <0.016 0.25 L33 Adult feces 1.0 0.125 <0.016 <0.016 0.023 0.50 J1 Adult feces 0.50 1.0 0.094 0.023 0.023 0.50 J3 Adult feces 0.50 >256 >256 0.25 <0.016 0.25 J4 Adult feces 1.0 0.25 <0.016 <0.016 <0.016 0.25 J22 Adult feces 1.0 0.50 0.023 0.023 0.023 0.25 J23 Adult feces 0.50 1.0 0.094 0.023 0.023 0.50 J26 Adult feces 0.50 0.25 <0.016 <0.016 0.023 0.50 J32 Adult feces 0.50 0.50 0.032 0.023 <0.016 0.25 Ann Microbiol (2015) 65:1985–1991 1989

Table 2 (continued)

Strain # Origin MIC (mg/L)

TET ERY CLI CHL AMP VAN

J33 Adult feces 0.50 0.25 0.023 0.023 <0.016 0.50

TET tetracycline, ERY erythromycin, CLI clindamycin, CHL chloramphenicol, AMP ampicillin, VAN vancomycin a Commercial strain provided by Shanghai Jiao Da Onlly Co. (Shanghai, PR China) b Type strain

Detection of erm determinants control. It was shown that B. longum SQS7-31 was positive in screening for a Tn5432 reaction while B. longum J3 was Total genomic DNA was extracted from the three negative. This result was confirmed by analysis of the down- erythromycin- and clindamycin-resistant strains, along with stream sequence of the erm(X) determinant of B. longum J3 the type strain (Bifidobacterium longum subsp. longum ATCC (see below). 15707) and commercial strain (Bifidobacterium longum For B. longum J3, a 2065 bp sequence, including the subsp. longum BL88-Onlly). B. longum SQS4-63, erm(X) gene, was obtained. The downstream sequence of B. longum SQS7-31, and B. longum J3 were detected the erm(X) gene encoded a truncated protein, which might erm(X) determinants in genomic DNA by PCR assays with be C-terminus helices of a type II restriction-modification (R- the primers ermX_F and ermX_R, while no PCR product was M) enzyme GcrY (Jost et al. 2003), and a putative transposase amplified from either of the two susceptible strains. No (Fig. 1b). erm(A), erm(B), or erm(E) was detected for all five strains (data not shown).

Analysis of the erm(X) determinants and their flanking Discussion regions This is the first time erm(X) has been reported in The obtained erm(X) determinants showed >97 % DNA human bifidobacteria. The erm(X) determinant amplified identity with the erm(X) genes reported in B. thermophilum from B. longum SQS4-63 showed 100 % DNA identity (GenBank: AM748797.1–AM748802.1), B. lactis (GenBank: with that from B. longum SQS7-31. Considering that AM748803.1) (van Hoek et al. 2008), and Corynebacterium erm(X) determinants were both carried by transposon diphtheriae (GenBank: AF492560.1) (Tauch et al. 1995). Tn5432 for B. longum SQS4-63 and B. longum SQS7- For B. longum SQS4-63, flanking regions of erm(X) deter- 31, and these two strains were isolated from children's minant were retrieved by SEFA PCR. A complete sequence of feces, it can be assumed that erm(X) determinants were the4521bptransposonTn5432 carrying erm(X) gene was horizontally transferred among B. longum species obtained, which showed >99 % DNA identity with the in vivo. Tn5432 reported in Corynebacterium diphtheriae A complete sequence of Tn5432 was obtained and the (GenBank: AF492560.1) (Tauch et al. 1995)and transposon location in the genome was identified for Propionibacterium acnes (GenBank: AF411029.1) (Ross bifidobacteria for the first time. The 8 bp duplication created et al. 2002). The open reading frames of Tn5432 are shown by insertion of Tn5432 in B. longum SQS4-63 genome was in Fig. 1a. Analysis of 474 bp upstream and 501 bp down- not consistent with the investigation on corynebacteria that all stream sequences flanking Tn5432 revealed that the transpo- 8 bp target site sequences contained a triple–A/T sequence son was located between the NTP pyrophosphatase and py- (Tauch et al. 1995). PCR assays using primers NTP_F and ruvate kinase genes in the B. longum SQS4-63 genome Pyr_R (Table 1) were employed to amplify sequences be- (Fig. 1a). An 8 bp duplication of the target sequence (GATA tween the NTP pyrophosphatase and pyruvate kinase ACGA) was created by insertion of Tn5432. genes for the five strains. The results confirmed the The SEFA PCR assays failed for B. longum SQS7-31. To existence of Tn5432 for B. longum SQS4-63, while no determine whether the erm(X) determinant was located within insertion was found in the same location for either Tn5432, PCR assays were performed for B. longum SQS7-31 B. longum BL88-Onlly, B. longum ATCC 15707, and B. longum J3 using two screening primer pairs (amplify- B. longum SQS7-31, or B. longum J3. ing P3 and P4 regions, respectively; Fig. 1a) suggested by For B. longum J3, a total length of 2065 bp, including Ross et al. (2002). B. longum SQS4-63 was used as a positive the erm(X) gene and downstream sequence, was aligned 1990 Ann Microbiol (2015) 65:1985–1991

A NTP pyrophosphatase tnp1249a erm(X) tnpCX tnp1249b pyruvate kinase

GATAACGA GATAACGA

0.5 1 kbp 0

B erm(X) truncated protein transposase

00.51 kbp Fig. 1 Schematic representation of erm(X) determinants and flanking an 8 bp duplication of the target sequence (GATAACGA). The dotted genes detected in Bifidobacterium longum subsp. longum. a lines represent regions for screening Tn5432 on erm(X)-positive strains. Bifidobacterium longum subsp. longum SQS4-63. Open reading frames b Bifidobacterium longum subsp. longum J3. The downstream sequence inside and outside Tn5432 were shown. Tn5432 transposition resulted in of erm(X) gene encoded a truncated protein and a putative transposase with the nucleotide collection (nr/nt) database on NCBI’s Acknowledgments This work was supported by the National Basic website. The top two significant alignments were partial Research Program of China (973 Program) (No. 2012CB720802) and the National High Technology Research and Development Program of China sequences of plasmids pLEW279a (GenBank: (863 Program) (No. 2011AA100901). DQ390458.1) and pAP2 (GenBank: AY255627.1), both with 93 % DNA identity and 67 % query coverage, suggesting that the erm(X) determinant might originate from plasmids. However, no plasmid was detected in References either B. longum J3 or the other two erm(X)-positive strains. The putative transposase flanking the erm(X) Averina OV, Nezametdinova VZ, Alekseeva MG, Danilenko VN (2012) gene showed >99 % DNA identity with a hypothetical Genetic instability of probiotic characteristics in the Bifidobacterium gene at locus BBMN68_1273 in Bifidobacterium longum subsp. longum B379M strain during cultivation and main- longum subsp. longum BBMN68 genome (GenBank: tenance. Russ J Genet 48:1103–1111. doi:10.1134/ CP002286.1). PCR assay employing primers 1273_R s1022795412110026 EFSA (2012) Guidance on the assessment of bacterial susceptibility to and Crc_F (designed according to BBMN68_1273 and antimicrobials of human and veterinary importance. EFSA J 10: crcB4 gene of B. longum BBMN68) revealed another 2740 copy of the putative transposase gene in B. longum J3 Gueimonde M, Sánchez B, de los Reyes-Gavilán CG, Margolles A genome (Supplementary Fig. 2). The putative (2013) Antibiotic resistance in probiotic bacteria. Front Microbiol transposase consists of conserved multi-domains called 4. doi:10.3389/fmicb.2013.00202 Huys G et al (2010) Intra- and interlaboratory performances of PHA02517, including an HTH-like domain (pfam13276) two commercial antimicrobial susceptibility testing methods and integrase core domains Rev (pfam00665) and for bifidobacteria and nonenterococcal lactic acid bacteria. Rev_3 (pfam13683). PHA02517 was typically found in Antimicrob Agents Chemother 54:2567–2574. doi:10.1128/ phage-encoded transposase by searching CDD, suggest- aac.00407-10 Jensen LB, Frimodt-Moller N, Aarestrup FM (1999) Presence of erm ing that the putative transposase might originate from gene classes in Gram-positive bacteria of animal and human origin phages. in Denmark. FEMS Microbiol Lett 170:151–158 Loss of resistance genes in B. longum species has Jolley KA, Feil EJ, Chan MS, Maiden MCJ (2001) Sequence type been reported (Averina et al. 2012), and the stability of analysis and recombinational tests (START). Bioinformatics 17: – antibiotic susceptibility for B. longum SQS4-63, 1230 1231. doi:10.1093/bioinformatics/17.12.1230 Jost BH, Field AC, Trinh HT, Songer JG, Billington SJ (2003) Tylosin B. longum SQS7-31, and B. longum J3 during cultiva- resistance in Arcanobacterium pyogenes is encoded by an Erm X tion and maintenance under laboratory conditions were determinant. Antimicrob Agents Chemother 47:3519–3524. doi:10. tested. After ∼1,000 generations of growth in MRS+cys 1128/aac.47.11.3519-3524.2003 broth, the MICs for these three strains to erythromycin Makino H et al (2011) Transmission of intestinal Bifidobacterium longum and clindamycin showed little or no change and erm(X) subsp. longum strains from mother to infant, determined by multilocus sequencing typing and amplified fragment length poly- genes were not lost, suggesting that the resistance genes morphism. Appl Environ Microbiol 77:6788–6793. doi:10.1128/ were relatively stable in laboratory conditions. aem.05346-11 Ann Microbiol (2015) 65:1985–1991 1991

Marchler-Bauer A et al (2013) CDD: conserved domains and protein van Hoek A, Mayrhofer S, Domig KJ, Aarts HJM (2008) Resistance three-dimensional structure. Nucleic Acids Res 41:D348–D352. determinant erm(X) is borne by transposon Tn5432 in doi:10.1093/nar/gks1243 Bifidobacterium thermophilum and Bifidobacterium animalis subsp Roberts MC (2008) Update on macrolide-lincosamide-streptogramin, lactis. Int J Antimicrob Agents 31:544–548. doi:10.1016/j. ketolide, and oxazolidinone resistance genes. FEMS Microbiol ijantimicag.2008.01.025 Lett 282:147–159. doi:10.1111/j.1574-6968.2008.01145.x van Reenen CA, Dicks LM (2011) Horizontal gene transfer amongst Ross JI, Eady EA, Carnegie E, Cove JH (2002) Detection of transposon probiotic lactic acid bacteria and other intestinal microbiota: what Tn5432-mediated macrolide-lincosamide-streptogramin B (MLSB) are the possibilities? A review. Arch Microbiol 193:157–168 resistance in cutaneous propionibacteria from six European cities. J Ventura M, Canchaya C, Del Casale A, Dellaglio F, Neviani E, Fitzgerald Antimicrob Chemother 49:165–168. doi:10.1093/jac/49.1.165 GF, van Sinderen D (2006) Analysis of bifidobacterial evolution Salyers AA, Gupta A, Wang YP (2004) Human intestinal bacteria as using a multilocus approach. Int J Syst Evol Microbiol 56:2783– reservoirs for antibiotic resistance genes. Trends Microbiol 12:412– 2792. doi:10.1099/ijs.0.64233-0 416. doi:10.1016/j.tim.2004.07.004 Wang SM, He J, Cui ZL, Li SP (2007) Self-formed adaptor PCR: a simple Tauch A, Kassing F, Kalinowski J, Pühler A (1995) The and efficient method for chromosome walking. Appl Environ Corynebacterium xerosis composite transposon Tn5432 consists Microbiol 73:5048–5051. doi:10.1128/aem.02973-06 of two identical insertion sequences, designated IS1249, flanking Xiao YH (2008) Antibiotics overuse and its medical and social conse- the erythromycin resistance gene ermCX. Plasmid 34:119–131 quences. Antibiot Saf Qual Symp 60–64